Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
RPS6KA1	6195	broad.mit.edu	37	1	26885365	26885365	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26885365C>T	uc001bmr.1	+	14	1315	c.1152C>T	c.(1150-1152)ACC>ACT	p.T384T	RPS6KA1_uc010ofe.1_Silent_p.T292T|RPS6KA1_uc010off.1_Silent_p.T368T|RPS6KA1_uc001bms.1_Silent_p.T393T|RPS6KA1_uc009vsl.1_Silent_p.T227T	NM_002953	NP_002944	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	384	AGC-kinase C-terminal.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		TCGTGGCCACCGGCCTGATGG	0.647					655											0.44	97.44399	97.681877	33	42	KEEP	---	---	---	---	23	16	16	31	-1	capture	Silent	SNP	26885365	26885365	RPS6KA1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13542	18
MACF1	23499	broad.mit.edu	37	1	39549978	39549978	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39549978C>T	uc010ois.1	+	3	293	c.88C>T	c.(88-90)CGG>TGG	p.R30W	MACF1_uc010oir.1_Silent_p.S25S	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	30	Actin-binding.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAGGAGCGAGCGGTCGGGGAG	0.612																0.368421	55.86223	56.728481	21	36	KEEP	---	---	---	---	11	11	24	17	-1	capture	Missense_Mutation	SNP	39549978	39549978	MACF1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	9059	18
C1orf161	126868	broad.mit.edu	37	1	116666899	116666899	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:116666899C>T	uc001egc.1	+	4	667	c.402C>T	c.(400-402)GAC>GAT	p.D134D		NM_152367	NP_689580	Q8N8X9	MB213_HUMAN	hypothetical protein LOC126868	134											0	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TGAACATCGACGGAGACATTG	0.552																0.354167	95.824554	97.623098	34	62	KEEP	---	---	---	---	21	20	31	35	-1	capture	Silent	SNP	116666899	116666899	C1orf161	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1991	18
PDE4DIP	9659	broad.mit.edu	37	1	144873981	144873981	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144873981G>T	uc001elw.3	-	31	5267	c.4976C>A	c.(4975-4977)TCA>TAA	p.S1659*	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Nonsense_Mutation_p.S1615*|PDE4DIP_uc001elv.3_Nonsense_Mutation_p.S666*	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1659					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ACTGGTTGATGATGGTTTAGA	0.473					595	T	PDGFRB	MPD								0.01682	-155.306134	17.342633	11	643	KEEP	---	---	---	---	7	5	366	339	0.583333333333	capture	Nonsense_Mutation	SNP	144873981	144873981	PDE4DIP	1	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	11546	18
MTMR11	10903	broad.mit.edu	37	1	149901596	149901596	+	Silent	SNP	T	C	C			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:149901596T>C	uc001etl.3	-	16	2111	c.1860A>G	c.(1858-1860)CCA>CCG	p.P620P	SF3B4_uc001etj.1_5'Flank|SF3B4_uc001etk.1_5'Flank|SF3B4_uc009wll.1_5'Flank|MTMR11_uc001etm.1_Silent_p.P548P	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	620	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GCAGCAGCCCTGGAGGTAAAG	0.587					238											0.465812	324.222613	324.462622	109	125	KEEP	---	---	---	---	49	63	62	63	-1	capture	Silent	SNP	149901596	149901596	MTMR11	1	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	9850	18
NTRK1	4914	broad.mit.edu	37	1	156836717	156836717	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156836717C>T	uc001fqh.1	+	4	431	c.375C>T	c.(373-375)AAC>AAT	p.N125N	NTRK1_uc001fqf.1_Silent_p.N95N|NTRK1_uc009wsi.1_Translation_Start_Site|NTRK1_uc001fqi.1_Silent_p.N125N|NTRK1_uc009wsk.1_Silent_p.N125N	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	125	LRR 2.|Extracellular (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	TCTCCTTCAACGCTCTGGAGT	0.587					290	T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			0.341085	126.164778	129.041905	44	85	KEEP	---	---	---	---	31	19	50	41	-1	capture	Silent	SNP	156836717	156836717	NTRK1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10613	18
FCRL2	79368	broad.mit.edu	37	1	157739709	157739709	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157739709G>A	uc001fre.2	-	4	601	c.542C>T	c.(541-543)ACG>ATG	p.T181M	FCRL2_uc001frd.2_5'Flank|FCRL2_uc010phz.1_Missense_Mutation_p.T181M|FCRL2_uc009wsp.2_Intron|FCRL2_uc010pia.1_Missense_Mutation_p.T181M	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor	181	Extracellular (Potential).|Ig-like C2-type 2.				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GTGAGTCACCGTTTCTGCCTT	0.527																0.41791	167.963494	168.753947	56	78	KEEP	---	---	---	---	30	31	40	43	-1	capture	Missense_Mutation	SNP	157739709	157739709	FCRL2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5741	18
FCAMR	83953	broad.mit.edu	37	1	207135779	207135779	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207135779C>T	uc001hfa.3	-	5	931	c.431G>A	c.(430-432)CGT>CAT	p.R144H	FCAMR_uc001hfb.2_Missense_Mutation_p.R144H|FCAMR_uc009xca.1_Missense_Mutation_p.R144H|FCAMR_uc001hfc.2_Missense_Mutation_p.R119H	NM_001122980	NP_001116452	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity isoform 2	99	Extracellular (Potential).|Ig-like V-type.					integral to membrane|plasma membrane	receptor activity			ovary(1)	1						GGGCCCCAGACGGCACCAGTA	0.582	Ovarian(199;1883 2142 16966 44409 45154)															0.45283	74.495682	74.598093	24	29	KEEP	---	---	---	---	14	12	15	17	-1	capture	Missense_Mutation	SNP	207135779	207135779	FCAMR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5718	18
PCNXL2	80003	broad.mit.edu	37	1	233231513	233231513	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:233231513A>G	uc001hvl.2	-	22	4169	c.3934T>C	c.(3934-3936)TTT>CTT	p.F1312L	PCNXL2_uc001hvm.1_RNA|PCNXL2_uc009xfu.2_Intron|PCNXL2_uc001hvp.1_RNA|PCNXL2_uc009xfv.1_RNA	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	1312	Helical; (Potential).					integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				GGAATGGCAAAGAGCTGAGCA	0.473																0.473684	34.575174	34.586531	9	10	KEEP	---	---	---	---	5	6	4	7	-1	capture	Missense_Mutation	SNP	233231513	233231513	PCNXL2	1	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	11495	18
C1orf100	200159	broad.mit.edu	37	1	244528021	244528021	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:244528021C>T	uc001iah.2	+	2	132	c.19C>T	c.(19-21)CGA>TGA	p.R7*	C1orf100_uc001iai.2_Nonsense_Mutation_p.R7*	NM_001012970	NP_001012988	Q5SVJ3	CA100_HUMAN	hypothetical protein LOC200159	7											0	all_cancers(71;3.94e-05)|all_epithelial(71;0.000138)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|all_lung(81;0.0736)|Ovarian(71;0.0761)|Lung NSC(105;0.103)		all cancers(7;8.19e-08)|GBM - Glioblastoma multiforme(7;2.05e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.000984)			CATCCGACTACGAGAATTTAT	0.468																0.340426	90.261381	92.381761	32	62	KEEP	---	---	---	---	18	19	34	35	-1	capture	Nonsense_Mutation	SNP	244528021	244528021	C1orf100	1	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	1957	18
OR2T10	127069	broad.mit.edu	37	1	248756435	248756435	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248756435G>A	uc010pzn.1	-	1	635	c.635C>T	c.(634-636)ACG>ATG	p.T212M		NM_001004693	NP_001004693	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T,	212	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGAAATGACCGTCACAGGTAT	0.458																0.82	138.303972	143.119432	41	9	KEEP	---	---	---	---	27	22	5	4	-1	capture	Missense_Mutation	SNP	248756435	248756435	OR2T10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10921	18
OR52K1	390036	broad.mit.edu	37	11	4511035	4511035	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4511035G>A	uc001lza.1	+	1	905	c.905G>A	c.(904-906)CGT>CAT	p.R302H		NM_001005171	NP_001005171	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K,	302	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		AAGCAGATTCGTGAGTATGTG	0.433																0.050459	-24.067341	22.640063	11	207	KEEP	---	---	---	---	6	6	122	100	-1	capture	Missense_Mutation	SNP	4511035	4511035	OR52K1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11027	18
OR51F1	256892	broad.mit.edu	37	11	4790947	4790947	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4790947C>A	uc010qyl.1	-	1	201	c.201G>T	c.(199-201)AGG>AGT	p.R67S		NM_001004752	NP_001004752	A6NLW9	A6NLW9_HUMAN	olfactory receptor, family 51, subfamily F,	67						integral to membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		TGGCTGATAGCCTGAAGAGGA	0.443																0.148148	6.380469	9.590886	4	23	KEEP	---	---	---	---	12	10	10	15	0.454545454545	capture	Missense_Mutation	SNP	4790947	4790947	OR51F1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	337	26	4	4	11000	18
RBMXL2	27288	broad.mit.edu	37	11	7111041	7111041	+	Silent	SNP	T	G	G			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7111041T>G	uc001mfc.2	+	1	877	c.690T>G	c.(688-690)GGT>GGG	p.G230G		NM_014469	NP_055284	O75526	HNRGT_HUMAN	testes-specific heterogenous nuclear	230	Arg/Gly/Pro-rich.					nucleus|ribonucleoprotein complex	nucleotide binding|RNA binding				0				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AACCCCGGGGTTTTGCCCCCT	0.692																0.2	3.840768	6.492306	6	24	KEEP	---	---	---	---	3	7	16	11	-1	capture	Silent	SNP	7111041	7111041	RBMXL2	11	T	G	G	G	1	0	0	0	0	0	0	0	1	769	60	4	4	13049	18
PLEKHA7	144100	broad.mit.edu	37	11	16838834	16838834	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:16838834G>A	uc001mmo.2	-	11	1394	c.1379C>T	c.(1378-1380)CCT>CTT	p.P460L	PLEKHA7_uc010rcu.1_Missense_Mutation_p.P460L|PLEKHA7_uc010rcv.1_Missense_Mutation_p.P34L|PLEKHA7_uc001mmn.2_Missense_Mutation_p.P168L	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A	460					epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3						GGATTGGCCAGGACCCTGGCG	0.602																0.031008	-25.147857	6.307349	4	125	KEEP	---	---	---	---	0	4	76	60	-1	capture	Missense_Mutation	SNP	16838834	16838834	PLEKHA7	11	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	11964	18
CD44	960	broad.mit.edu	37	11	35227763	35227763	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:35227763C>T	uc001mvu.2	+	11	1821	c.1387C>T	c.(1387-1389)CGA>TGA	p.R463*	CD44_uc001mvv.2_Nonsense_Mutation_p.R420*|CD44_uc001mvw.2_Intron|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Intron|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron|CD44_uc010res.1_Nonsense_Mutation_p.R27*|CD44_uc010ret.1_Intron|CD44_uc010reu.1_Intron	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor	463	Extracellular (Potential).|Stem.				cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)	CCCCATGGGACGAGGTCATCA	0.443					401											0.443709	203.50683	203.923178	67	84	KEEP	---	---	---	---	41	30	51	43	-1	capture	Nonsense_Mutation	SNP	35227763	35227763	CD44	11	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	2988	18
OR4C16	219428	broad.mit.edu	37	11	55339695	55339695	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55339695G>A	uc010rih.1	+	1	92	c.92G>A	c.(91-93)CGT>CAT	p.R31H		NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C,	31	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		all_epithelial(135;0.0748)				ATTTTTTTGCGTCTCTACTTG	0.368																0.308901	165.359442	171.572159	59	132	KEEP	---	---	---	---	58	31	76	59	-1	capture	Missense_Mutation	SNP	55339695	55339695	OR4C16	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10953	18
FOLR1	2348	broad.mit.edu	37	11	71906672	71906672	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71906672G>A	uc001orz.1	+	5	512	c.374G>A	c.(373-375)CGC>CAC	p.R125H	FOLR1_uc001osa.1_Missense_Mutation_p.R125H|FOLR1_uc001osb.1_Missense_Mutation_p.R125H|FOLR1_uc001osc.1_Missense_Mutation_p.R125H|FOLR1_uc001osd.1_Missense_Mutation_p.R125H	NM_016724	NP_057936	P15328	FOLR1_HUMAN	folate receptor 1 precursor	125					cell death|folic acid transport|receptor-mediated endocytosis	anchored to membrane|extracellular region|integral to plasma membrane|membrane fraction	folic acid binding|receptor activity			ovary(1)	1						CAGAGCTGGCGCAAAGAGCGG	0.537																0.454545	136.265535	136.443344	45	54	KEEP	---	---	---	---	24	23	29	32	-1	capture	Missense_Mutation	SNP	71906672	71906672	FOLR1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5925	18
TAS2R46	259292	broad.mit.edu	37	12	11214816	11214816	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11214816G>A	uc001qzp.1	-	1	78	c.78C>T	c.(76-78)TTC>TTT	p.F26F	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176887	NP_795368	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	26	Cytoplasmic (Potential).				sensory perception of taste	cilium membrane|integral to membrane	G-protein coupled receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		CCAATGCTATGAAGCCATTAG	0.363																0.085106	-1.744845	6.594965	4	43	KEEP	---	---	---	---	5	8	26	34	-1	capture	Silent	SNP	11214816	11214816	TAS2R46	12	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	15470	18
PIK3C2G	5288	broad.mit.edu	37	12	18576934	18576934	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18576934G>A	uc001rdt.2	+	17	2458	c.2342G>A	c.(2341-2343)CGC>CAC	p.R781H	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.R822H|PIK3C2G_uc010sic.1_Missense_Mutation_p.R600H	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	781					cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity	p.R781H(1)		lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				CTACTCCACCGCTCCTTGCAG	0.428					655											0.294118	24.229524	25.524239	10	24	KEEP	---	---	---	---	4	7	12	17	-1	capture	Missense_Mutation	SNP	18576934	18576934	PIK3C2G	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11814	18
AMDHD1	144193	broad.mit.edu	37	12	96354263	96354263	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:96354263C>T	uc001tel.1	+	5	781	c.675C>T	c.(673-675)CAC>CAT	p.H225H	AMDHD1_uc009zth.1_Silent_p.H116H	NM_152435	NP_689648	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	225					histidine catabolic process to glutamate and formamide	cytosol	imidazolonepropionase activity|metal ion binding			central_nervous_system(1)	1						GGGAAATACACGTGGACAATA	0.413																0.463636	157.415001	157.541615	51	59	KEEP	---	---	---	---	21	35	37	28	-1	capture	Silent	SNP	96354263	96354263	AMDHD1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	567	18
DAO	1610	broad.mit.edu	37	12	109293195	109293195	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109293195C>T	uc001tnr.3	+	10	1009	c.856C>T	c.(856-858)CGC>TGC	p.R286C	DAO_uc001tnq.3_Missense_Mutation_p.R220C|DAO_uc009zvb.2_RNA|DAO_uc001tns.3_RNA	NM_001917	NP_001908	P14920	OXDA_HUMAN	D-amino-acid oxidase	286					glyoxylate metabolic process	peroxisomal matrix	binding|D-amino-acid oxidase activity			ovary(1)|skin(1)	2						CCGGCCAGTACGCCCCCAGAT	0.468																0.459459	50.079636	50.130779	17	20	KEEP	---	---	---	---	16	8	8	14	-1	capture	Missense_Mutation	SNP	109293195	109293195	DAO	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4190	18
NOS1	4842	broad.mit.edu	37	12	117768667	117768667	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117768667G>A	uc001twm.1	-	2	894	c.208C>T	c.(208-210)CGG>TGG	p.R70W		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	70	Interaction with NOSIP (By similarity).|PDZ.				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	ACCAAGGGCCGGCCGTTGACC	0.612	Esophageal Squamous(162;1748 2599 51982 52956)															0.547826	208.274187	208.511032	63	52	KEEP	---	---	---	---	26	46	26	27	-1	capture	Missense_Mutation	SNP	117768667	117768667	NOS1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	10448	18
OR4N5	390437	broad.mit.edu	37	14	20612259	20612259	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20612259G>A	uc010tla.1	+	1	365	c.365G>A	c.(364-366)CGC>CAC	p.R122H		NM_001004724	NP_001004724	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		GCCTTTGACCGCTACATCGCC	0.478																0.021807	-70.045958	11.926212	7	314	KEEP	---	---	---	---	5	3	189	145	-1	capture	Missense_Mutation	SNP	20612259	20612259	OR4N5	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10983	18
MYH6	4624	broad.mit.edu	37	14	23855760	23855760	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23855760C>T	uc001wjv.2	-	33	4790	c.4723G>A	c.(4723-4725)GAG>AAG	p.E1575K		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1575	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		AGCTTCCGCTCGATCTCTGCC	0.647																0.466667	478.123813	478.442561	154	176	KEEP	---	---	---	---	100	67	115	80	-1	capture	Missense_Mutation	SNP	23855760	23855760	MYH6	14	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9948	18
ATL1	51062	broad.mit.edu	37	14	51080061	51080061	+	Missense_Mutation	SNP	C	T	T	rs119476046		TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:51080061C>T	uc001wyf.3	+	7	956	c.715C>T	c.(715-717)CGC>TGC	p.R239C	ATL1_uc001wyd.3_Missense_Mutation_p.R239C|ATL1_uc001wye.3_Missense_Mutation_p.R239C	NM_015915	NP_056999	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1 isoform a	239	Cytoplasmic.		R -> C (in SPG3; affects endoplasmic reticulum and Golgi morphology).		axonogenesis|cell death|endoplasmic reticulum organization|protein homooligomerization	axon|endoplasmic reticulum membrane|Golgi cis cisterna|Golgi membrane|integral to membrane|microsome	GTP binding|GTPase activity|identical protein binding			skin(3)|central_nervous_system(1)	4						CTTGGAAAAACGCCTCAAGGT	0.353																0.364706	94.827615	96.185507	31	54	KEEP	---	---	---	---	17	15	32	25	-1	capture	Missense_Mutation	SNP	51080061	51080061	ATL1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1097	18
CLMN	79789	broad.mit.edu	37	14	95677055	95677055	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95677055G>A	uc001yef.2	-	7	886	c.770C>T	c.(769-771)GCC>GTC	p.A257V		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	257	Actin-binding.|CH 2.					integral to membrane	actin binding				0				Epithelial(152;0.193)		GATGTGCAGGGCATCCTGTGC	0.418																0.02139	-41.120202	6.725139	4	183	KEEP	---	---	---	---	3	1	105	99	-1	capture	Missense_Mutation	SNP	95677055	95677055	CLMN	14	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3507	18
RYR3	6263	broad.mit.edu	37	15	33895522	33895522	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33895522C>T	uc001zhi.2	+	18	2191	c.2121C>T	c.(2119-2121)GAC>GAT	p.D707D	RYR3_uc010bar.2_Silent_p.D707D	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	707	Cytoplasmic (By similarity).|B30.2/SPRY 1.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity	p.D707D(1)		ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTGTTGGTGACGACCTGTACT	0.537																0.403561	409.531332	412.271505	136	201	KEEP	---	---	---	---	76	73	108	109	-1	capture	Silent	SNP	33895522	33895522	RYR3	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13662	18
PLCB2	5330	broad.mit.edu	37	15	40583828	40583828	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40583828C>T	uc001zld.2	-	25	2927	c.2626G>A	c.(2626-2628)GAG>AAG	p.E876K	PLCB2_uc001zlc.2_5'Flank|PLCB2_uc010bbo.2_Missense_Mutation_p.E872K|PLCB2_uc010ucm.1_Intron	NM_004573	NP_004564	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	876					activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)|breast(3)|kidney(1)|pancreas(1)	8		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TTCATAGCCTCTTCCCTGGCC	0.706					1073											0.36	26.867656	27.299247	9	16	KEEP	---	---	---	---	6	4	9	10	-1	capture	Missense_Mutation	SNP	40583828	40583828	PLCB2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	11931	18
A2BP1	54715	broad.mit.edu	37	16	7726795	7726795	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:7726795G>A	uc002cys.2	+	14	1938	c.950G>A	c.(949-951)CGC>CAC	p.R317H	A2BP1_uc002cyt.2_Missense_Mutation_p.R290H|A2BP1_uc010uxz.1_Missense_Mutation_p.R360H|A2BP1_uc010uya.1_Missense_Mutation_p.R274H|A2BP1_uc010uyb.1_Missense_Mutation_p.R317H|A2BP1_uc002cyw.2_Missense_Mutation_p.R338H|A2BP1_uc002cyy.2_Missense_Mutation_p.R338H|A2BP1_uc002cyx.2_Missense_Mutation_p.R338H|A2BP1_uc010uyc.1_Missense_Mutation_p.R311H	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4	317					mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		GCTGCATACCGCTACGCCCAG	0.517																0.43299	129.891982	130.25834	42	55	KEEP	---	---	---	---	23	21	35	23	-1	capture	Missense_Mutation	SNP	7726795	7726795	A2BP1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3	18
ACSM3	6296	broad.mit.edu	37	16	20787173	20787173	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20787173C>A	uc002dhr.2	+	3	419	c.232C>A	c.(232-234)CCT>ACT	p.P78T	ACSM3_uc002dhq.2_Missense_Mutation_p.P78T|ACSM3_uc010vba.1_Missense_Mutation_p.P70T	NM_005622	NP_005613	Q53FZ2	ACSM3_HUMAN	SA hypertension-associated homolog isoform 1	78					regulation of blood pressure	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			ovary(1)	1						TGGAAAGAAACCTTCAAATCC	0.403																0.386905	204.338108	206.220826	65	103	KEEP	---	---	---	---	32	44	54	62	0.578947368421	capture	Missense_Mutation	SNP	20787173	20787173	ACSM3	16	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	185	18
ITGAM	3684	broad.mit.edu	37	16	31338227	31338227	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31338227C>A	uc002ebq.2	+	22	2777	c.2679C>A	c.(2677-2679)AAC>AAA	p.N893K	ITGAM_uc002ebr.2_Missense_Mutation_p.N894K|ITGAM_uc010can.2_Missense_Mutation_p.N299K|ITGAM_uc002ebs.1_Missense_Mutation_p.N299K	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	893	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						CCCTTGGAAACAAACTGCTCC	0.478																0.365672	299.074809	303.329461	98	170	KEEP	---	---	---	---	62	50	103	83	0.446428571429	capture	Missense_Mutation	SNP	31338227	31338227	ITGAM	16	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	7810	18
RRAD	6236	broad.mit.edu	37	16	66957764	66957764	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:66957764G>A	uc002eqn.2	-	3	581	c.429C>T	c.(427-429)TAC>TAT	p.Y143Y	RRAD_uc002eqo.2_Silent_p.Y143Y	NM_001128850	NP_001122322	P55042	RAD_HUMAN	Ras-related associated with diabetes	143					small GTPase mediated signal transduction	plasma membrane	calmodulin binding|GTP binding|GTPase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		CCCAAATGTCGTAGACCATGA	0.582																0.400922	257.176128	259.040381	87	130	KEEP	---	---	---	---	47	57	80	78	-1	capture	Silent	SNP	66957764	66957764	RRAD	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13563	18
CHST5	23563	broad.mit.edu	37	16	75564091	75564091	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75564091G>A	uc002fei.2	-	3	1587	c.192C>T	c.(190-192)CAC>CAT	p.H64H	CHST5_uc002fej.1_Silent_p.H70H	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	64	Lumenal (Potential).				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						GCACCAGCACGTGCACACGAT	0.657																0.5	45.950225	45.950225	15	15	KEEP	---	---	---	---	10	5	10	7	-1	capture	Silent	SNP	75564091	75564091	CHST5	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3372	18
KIF2B	84643	broad.mit.edu	37	17	51900728	51900728	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:51900728G>A	uc002iua.2	+	1	490	c.334G>A	c.(334-336)GCC>ACC	p.A112T	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	112					blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						CCAGCGTACCGCCACGAAATG	0.602																0.410112	206.630846	207.889597	73	105	KEEP	---	---	---	---	33	43	55	52	-1	capture	Missense_Mutation	SNP	51900728	51900728	KIF2B	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8220	18
UTS2R	2837	broad.mit.edu	37	17	80332605	80332605	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80332605C>T	uc010wvl.1	+	1	405	c.405C>T	c.(403-405)CAC>CAT	p.H135H		NM_018949	NP_061822	Q9UKP6	UR2R_HUMAN	urotensin 2 receptor	135	Helical; Name=3; (Potential).					integral to membrane|plasma membrane				breast(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			TGACCATGCACGCCAGCATCT	0.662																0.521739	75.906535	75.92593	24	22	KEEP	---	---	---	---	11	17	12	12	-1	capture	Silent	SNP	80332605	80332605	UTS2R	17	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16988	18
POTEC	388468	broad.mit.edu	37	18	14537857	14537857	+	Silent	SNP	A	G	G			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14537857A>G	uc010dln.2	-	3	1207	c.753T>C	c.(751-753)GAT>GAC	p.D251D	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	251	ANK 4.									skin(3)	3						CCATTAATTTATCTTCATTGT	0.343																0.414013	240.56142	241.571525	65	92	KEEP	---	---	---	---	42	27	42	58	-1	capture	Silent	SNP	14537857	14537857	POTEC	18	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	12164	18
CDH20	28316	broad.mit.edu	37	18	59158011	59158011	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:59158011C>T	uc010dps.1	+	1	237	c.225C>T	c.(223-225)ACC>ACT	p.T75T	CDH20_uc002lif.2_Silent_p.T69T	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	75	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				ACACTGGGACCGACCCTTTGT	0.448																0.064039	-10.080659	30.035597	13	190	KEEP	---	---	---	---	7	7	104	106	-1	capture	Silent	SNP	59158011	59158011	CDH20	18	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3077	18
FBXO15	201456	broad.mit.edu	37	18	71790685	71790685	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:71790685G>A	uc002lle.2	-	8	1164	c.828C>T	c.(826-828)CAC>CAT	p.H276H	FBXO15_uc002llf.2_Silent_p.H352H	NM_152676	NP_689889	Q8NCQ5	FBX15_HUMAN	F-box protein 15 isoform 1	276										ovary(2)|pancreas(1)	3		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		GTTGGTAGCCGTGCAGTCCAT	0.443																0.05	-9.270453	7.917332	4	76	KEEP	---	---	---	---	2	2	41	41	-1	capture	Silent	SNP	71790685	71790685	FBXO15	18	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5674	18
RFX2	5990	broad.mit.edu	37	19	5997146	5997146	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5997146G>A	uc002meb.2	-	16	2207	c.1938C>T	c.(1936-1938)GAC>GAT	p.D646D	RFX2_uc002mec.2_Silent_p.D621D	NM_000635	NP_000626	P48378	RFX2_HUMAN	regulatory factor X2 isoform a	646					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			breast(4)|ovary(1)|skin(1)	6						ACATGTACTCGTCGTAGAGCA	0.662	Colon(38;171 817 19800 47433 48051)															0.268293	54.84575	58.800095	22	60	KEEP	---	---	---	---	9	14	36	33	-1	capture	Silent	SNP	5997146	5997146	RFX2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13158	18
PRKCSH	5589	broad.mit.edu	37	19	11559740	11559740	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11559740G>A	uc002mrt.2	+	15	1613	c.1277G>A	c.(1276-1278)CGC>CAC	p.R426H	PRKCSH_uc002mru.2_Missense_Mutation_p.R423H|PRKCSH_uc010xlz.1_Missense_Mutation_p.R433H|PRKCSH_uc010dya.2_Missense_Mutation_p.R208H|PRKCSH_uc010dyb.2_Missense_Mutation_p.R423H	NM_002743	NP_002734	P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H isoform 1	426	PRKCSH.				innate immune response|intracellular protein kinase cascade|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen	calcium ion binding|protein kinase C binding				0						TACGTCTACCGCCTCTGCCCC	0.647																0.341564	228.177775	233.555	83	160	KEEP	---	---	---	---	37	53	84	109	-1	capture	Missense_Mutation	SNP	11559740	11559740	PRKCSH	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12412	18
ZNF491	126069	broad.mit.edu	37	19	11917007	11917007	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11917007G>A	uc002mso.1	+	3	524	c.239G>A	c.(238-240)CGT>CAT	p.R80H		NM_152356	NP_689569	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	80					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CATAAACAACGTAGGAAAGCC	0.378																0.333333	127.581699	131.048566	47	94	KEEP	---	---	---	---	28	23	49	54	-1	capture	Missense_Mutation	SNP	11917007	11917007	ZNF491	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17821	18
HSH2D	84941	broad.mit.edu	37	19	16259656	16259656	+	Silent	SNP	C	T	T	rs77723805		TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16259656C>T	uc002ndp.3	+	4	627	c.96C>T	c.(94-96)CCC>CCT	p.P32P	HSH2D_uc002ndr.2_5'UTR|HSH2D_uc010ead.2_RNA	NM_032855	NP_116244	Q96JZ2	HSH2D_HUMAN	hematopoietic SH2 domain containing	32						cytoplasm|nucleus					0						ACGGGGTCCCCGAGTGGTTCC	0.637																0.355769	111.852833	113.755847	37	67	KEEP	---	---	---	---	13	24	35	39	-1	capture	Silent	SNP	16259656	16259656	HSH2D	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7325	18
LYPD4	147719	broad.mit.edu	37	19	42341249	42341249	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42341249C>T	uc002orp.1	-	5	1693	c.709G>A	c.(709-711)GTC>ATC	p.V237I	LYPD4_uc002orq.1_Missense_Mutation_p.V202I	NM_173506	NP_775777	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4 precursor	237						anchored to membrane|plasma membrane				ovary(1)	1						AGGCCTAAGACGACACCCCAA	0.483																0.246305	124.367766	136.250963	50	153	KEEP	---	---	---	---	24	29	84	77	-1	capture	Missense_Mutation	SNP	42341249	42341249	LYPD4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9027	18
PSG7	5676	broad.mit.edu	37	19	43430081	43430081	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43430081G>C	uc002ovl.3	-	6	1189	c.1087C>G	c.(1087-1089)CAG>GAG	p.Q363E	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Missense_Mutation_p.Q276E|PSG7_uc002ous.1_RNA|PSG7_uc002out.1_Missense_Mutation_p.Q89E|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Missense_Mutation_p.Q276E|PSG7_uc010xwl.1_Missense_Mutation_p.Q241E	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7	363	Ig-like C2-type 3.				female pregnancy	extracellular region					0		Prostate(69;0.00682)				CAAGAATACTGTGCCGGTGGG	0.458																0.041257	-61.15571	54.028697	21	488	KEEP	---	---	---	---	7	14	264	262	-1	capture	Missense_Mutation	SNP	43430081	43430081	PSG7	19	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	12555	18
LILRB1	10859	broad.mit.edu	37	19	55143564	55143564	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55143564C>T	uc002qgj.2	+	6	877	c.537C>T	c.(535-537)CGC>CGT	p.R179R	LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Silent_p.R179R|LILRB1_uc002qgk.2_Silent_p.R179R|LILRB1_uc002qgm.2_Silent_p.R179R|LILRB1_uc010erq.2_Silent_p.R179R|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	179	Ig-like C2-type 2.|Extracellular (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		GGTCGTCCCGCGCCATCTTCT	0.577													HNSCC(37;0.09)			0.310811	183.207737	190.277411	69	153	KEEP	---	---	---	---	40	34	81	88	-1	capture	Silent	SNP	55143564	55143564	LILRB1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8710	18
ABCG8	64241	broad.mit.edu	37	2	44078770	44078770	+	Missense_Mutation	SNP	G	A	A	rs143276716		TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:44078770G>A	uc002rtq.2	+	4	460	c.370G>A	c.(370-372)GGC>AGC	p.G124S	ABCG8_uc010yoa.1_Missense_Mutation_p.G124S	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8	124	ABC transporter.|Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CCGAGGTCACGGCGGCAAGAT	0.617																0.071429	-0.586622	7.341154	3	39	KEEP	---	---	---	---	3	1	19	26	-1	capture	Missense_Mutation	SNP	44078770	44078770	ABCG8	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	72	18
RGPD3	653489	broad.mit.edu	37	2	107049681	107049681	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107049681T>C	uc010ywi.1	-	16	2323	c.2266A>G	c.(2266-2268)AAC>GAC	p.N756D		NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	756					intracellular transport		binding			ovary(1)	1						TCACTATAGTTTTCGAGTTCC	0.373																0.008897	-146.760879	9.978852	5	557	KEEP	---	---	---	---	3	2	363	330	-1	capture	Missense_Mutation	SNP	107049681	107049681	RGPD3	2	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	13180	18
TTN	7273	broad.mit.edu	37	2	179497473	179497473	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179497473G>A	uc010zfg.1	-	184	35780	c.35556C>T	c.(35554-35556)TTC>TTT	p.F11852F	TTN_uc010zfh.1_Silent_p.F5547F|TTN_uc010zfi.1_Silent_p.F5480F|TTN_uc010zfj.1_Silent_p.F5355F	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12779							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATCTTTCTCGAAGACTTTAA	0.428					8722											0.409283	297.531784	299.235547	97	140	KEEP	---	---	---	---	56	44	79	67	-1	capture	Silent	SNP	179497473	179497473	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	16617	18
ITGA4	3676	broad.mit.edu	37	2	182358131	182358131	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:182358131G>A	uc002unu.2	+	11	1996	c.1233G>A	c.(1231-1233)TCG>TCA	p.S411S		NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	411	FG-GAP 6.|Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	ATGGGATCTCGTCAACCTTCT	0.368																0.470588	121.900249	121.96345	40	45	KEEP	---	---	---	---	30	14	27	21	-1	capture	Silent	SNP	182358131	182358131	ITGA4	2	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	7801	18
SERPINE2	5270	broad.mit.edu	37	2	224866465	224866465	+	Silent	SNP	G	A	A	rs3795875		TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:224866465G>A	uc002vnu.2	-	2	396	c.153C>T	c.(151-153)ATC>ATT	p.I51I	SERPINE2_uc002vnt.2_Silent_p.I51I|SERPINE2_uc010zlr.1_Silent_p.I63I|SERPINE2_uc002vnv.2_Silent_p.I51I	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2	51					negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GAGAGATCACGATGTTGTCAT	0.567																0.03125	-23.310823	7.486358	4	124	KEEP	---	---	---	---	0	4	67	65	-1	capture	Silent	SNP	224866465	224866465	SERPINE2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	14005	18
B3GNT7	93010	broad.mit.edu	37	2	232262645	232262645	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:232262645C>T	uc002vrs.2	+	2	395	c.215C>T	c.(214-216)ACG>ATG	p.T72M		NM_145236	NP_660279	Q8NFL0	B3GN7_HUMAN	UDP-GlcNAc:betaGal	72	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity				0		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;3.22e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		GCTGCGCCCACGCCCATGGCC	0.617																0.372093	44.290055	44.907491	16	27	KEEP	---	---	---	---	7	11	18	14	-1	capture	Missense_Mutation	SNP	232262645	232262645	B3GNT7	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1251	18
C20orf54	113278	broad.mit.edu	37	20	744504	744504	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:744504C>T	uc002wed.3	-	3	1050	c.711G>A	c.(709-711)GCG>GCA	p.A237A	C20orf54_uc002wee.2_Silent_p.A237A	NM_033409	NP_212134	Q9NQ40	RFT2_HUMAN	hypothetical protein LOC113278 precursor	237	Helical; (Potential).				sensory perception of sound	integral to plasma membrane	riboflavin transporter activity			ovary(2)	2						GGACAAAGAACGCCACGAGGC	0.617																0.042553	-12.750686	8.331368	4	90	KEEP	---	---	---	---	2	2	47	52	-1	capture	Silent	SNP	744504	744504	C20orf54	20	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	2095	18
C20orf152	140894	broad.mit.edu	37	20	34571988	34571988	+	Silent	SNP	C	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:34571988C>A	uc002xes.1	+	5	648	c.492C>A	c.(490-492)ACC>ACA	p.T164T	C20orf152_uc002xer.1_Silent_p.T164T|C20orf152_uc010gfp.1_Intron			Q96M20	CT152_HUMAN	SubName: Full=C20orf152 protein;	164	cNMP.										0	Breast(12;0.00631)					TTGCAATAACCAAGGACGAGG	0.532																0.033058	-21.314385	7.485451	4	117	KEEP	---	---	---	---	2	2	60	62	0.5	capture	Silent	SNP	34571988	34571988	C20orf152	20	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	2074	18
KCNG1	3755	broad.mit.edu	37	20	49620775	49620775	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49620775C>T	uc002xwa.3	-	3	1638	c.1343G>A	c.(1342-1344)GGC>GAC	p.G448D		NM_002237	NP_002228	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G,	448	Helical; Name=Segment S6; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2						GAGCAGGATGCCGCTCAGGAT	0.622																0.021978	-40.045887	6.378983	4	178	KEEP	---	---	---	---	2	2	96	105	-1	capture	Missense_Mutation	SNP	49620775	49620775	KCNG1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7949	18
LAMA5	3911	broad.mit.edu	37	20	60887326	60887326	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60887326G>A	uc002ycq.2	-	69	9474	c.9407C>T	c.(9406-9408)GCG>GTG	p.A3136V		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	3136	Laminin G-like 3.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GTTCGAGAGCGCCAGGCGAAG	0.682																0.190476	8.0909	9.969703	4	17	KEEP	---	---	---	---	2	2	12	7	-1	capture	Missense_Mutation	SNP	60887326	60887326	LAMA5	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8529	18
LRRC3	81543	broad.mit.edu	37	21	45877207	45877207	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45877207G>A	uc002zfa.2	+	2	973	c.680G>A	c.(679-681)CGC>CAC	p.R227H		NM_030891	NP_112153	Q9BY71	LRRC3_HUMAN	leucine-rich repeat-containing 3 precursor	227						integral to membrane	protein binding				0		Breast(209;0.00908)		COAD - Colon adenocarcinoma(84;0.148)|Lung(125;0.195)		TACTATGTGCGCCACAACCAG	0.662																0.434783	114.985836	115.326558	40	52	KEEP	---	---	---	---	24	20	29	27	-1	capture	Missense_Mutation	SNP	45877207	45877207	LRRC3	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8900	18
KRTAP10-10	353333	broad.mit.edu	37	21	46057875	46057875	+	Missense_Mutation	SNP	G	A	A	rs147625145	byFrequency	TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46057875G>A	uc002zfq.2	+	1	603	c.541G>A	c.(541-543)GCC>ACC	p.A181T	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_181688	NP_859016	P60014	KR10A_HUMAN	keratin associated protein 10-10	181	15 X 5 AA repeats of C-C-X(3).|12.					keratin filament					0						TTGCTGCACCGCCTCCTGCTG	0.642																0.46696	281.41834	281.631596	106	121	KEEP	---	---	---	---	62	78	94	72	-1	capture	Missense_Mutation	SNP	46057875	46057875	KRTAP10-10	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8426	18
SGSM1	129049	broad.mit.edu	37	22	25263061	25263061	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:25263061G>A	uc003abg.2	+	10	1085	c.928G>A	c.(928-930)GTC>ATC	p.V310I	SGSM1_uc003abh.2_Missense_Mutation_p.V310I|SGSM1_uc010guu.1_Missense_Mutation_p.V310I|SGSM1_uc003abj.2_Missense_Mutation_p.V310I|SGSM1_uc003abi.1_Missense_Mutation_p.V285I	NM_001039948	NP_001035037	Q2NKQ1	SGSM1_HUMAN	RUN and TBC1 domain containing 2 isoform 1	310	Required for interaction with RAP family members.					Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5						CGCTTCCAGCGTCTACTGGGA	0.617																0.148148	7.584895	10.791018	4	23	KEEP	---	---	---	---	3	1	15	10	-1	capture	Missense_Mutation	SNP	25263061	25263061	SGSM1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14115	18
SYN3	8224	broad.mit.edu	37	22	32924868	32924868	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32924868C>T	uc003amx.2	-	10	1382	c.1223G>A	c.(1222-1224)AGA>AAA	p.R408K	SYN3_uc003amy.2_Missense_Mutation_p.R408K|SYN3_uc003amz.2_Missense_Mutation_p.R407K|SYN3_uc011amc.1_Missense_Mutation_p.R42K	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa	408	J; Pro-rich linker.				neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						TACCCAAGGTCTGAGGGGGGA	0.572					35									OREG0026488	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.442623	84.116205	84.291358	27	34	KEEP	---	---	---	---	18	12	21	14	-1	capture	Missense_Mutation	SNP	32924868	32924868	SYN3	22	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	15330	18
CELSR1	9620	broad.mit.edu	37	22	46860064	46860064	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46860064G>A	uc003bhw.1	-	2	3723	c.3723C>T	c.(3721-3723)GAC>GAT	p.D1241D		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	1241	Extracellular (Potential).				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		AGACGAAGACGTCGTCCTTGG	0.642																0.416667	87.569287	87.996619	30	42	KEEP	---	---	---	---	17	13	21	26	-1	capture	Silent	SNP	46860064	46860064	CELSR1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3189	18
SCN5A	6331	broad.mit.edu	37	3	38592883	38592883	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38592883G>A	uc003cio.2	-	28	5174	c.4980C>T	c.(4978-4980)ATC>ATT	p.I1660I	SCN5A_uc003cin.2_Silent_p.I1659I|SCN5A_uc003cil.3_Silent_p.I1660I|SCN5A_uc010hhi.2_Silent_p.I1642I|SCN5A_uc010hhk.2_Silent_p.I1627I|SCN5A_uc011ayr.1_Silent_p.I1606I	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1660	Helical; Name=S5 of repeat IV; (Potential).		I -> V (in BRS1; detected in a compound heterozygote also carrying L-336; the presence of both mutations is necessary for the phenotypic expression of the disease; complete loss of sodium currents due to defective channel trafficking to the plasma membrane).		blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GCAGCAGCCCGATGTTGAAGA	0.567																0.272727	119.699246	127.383614	45	120	KEEP	---	---	---	---	21	26	64	66	-1	capture	Silent	SNP	38592883	38592883	SCN5A	3	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	13815	18
SCN10A	6336	broad.mit.edu	37	3	38765036	38765036	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38765036G>A	uc003ciq.2	-	18	3237	c.3237C>T	c.(3235-3237)GAC>GAT	p.D1079D		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	1079					sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	AGCTTGTGTCGTCCACTCCCT	0.512																0.277778	24.132866	25.73369	10	26	KEEP	---	---	---	---	6	4	14	12	-1	capture	Silent	SNP	38765036	38765036	SCN10A	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13805	18
SCN10A	6336	broad.mit.edu	37	3	38770224	38770224	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38770224G>A	uc003ciq.2	-	15	2449	c.2449C>T	c.(2449-2451)CGA>TGA	p.R817*		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	817	II.				sensory perception	voltage-gated sodium channel complex		p.R817*(1)		ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	ATATTTTTTCGGTTGTTACGG	0.532																0.362832	127.248284	129.117465	41	72	KEEP	---	---	---	---	23	21	37	43	-1	capture	Nonsense_Mutation	SNP	38770224	38770224	SCN10A	3	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	13805	18
EPHA6	285220	broad.mit.edu	37	3	96706525	96706525	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:96706525C>T	uc010how.1	+	3	845	c.802C>T	c.(802-804)CGT>TGT	p.R268C	EPHA6_uc003drp.1_Missense_Mutation_p.R268C	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	173	Ephrin-binding.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity	p.R174C(1)		stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						CACTGAAATTCGTGAGGTGGG	0.443				p.R268C(VCAP-Tumor)|p.R268C(RERFLCAD2-Tumor)	480											0.459854	599.843091	600.418743	189	222	KEEP	---	---	---	---	110	93	111	121	-1	capture	Missense_Mutation	SNP	96706525	96706525	EPHA6	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5126	18
TMPRSS7	344805	broad.mit.edu	37	3	111782428	111782428	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111782428C>T	uc010hqb.2	+	10	1296	c.1126C>T	c.(1126-1128)CGT>TGT	p.R376C	TMPRSS7_uc011bhr.1_Missense_Mutation_p.R231C	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	502	LDL-receptor class A 1.|Extracellular (Potential).				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2						TCAGGCCCAGCGTTGTGATGG	0.383																0.058511	-29.46015	47.33127	22	354	KEEP	---	---	---	---	12	17	232	180	-1	capture	Missense_Mutation	SNP	111782428	111782428	TMPRSS7	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16135	18
POLQ	10721	broad.mit.edu	37	3	121212455	121212455	+	Silent	SNP	G	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121212455G>T	uc003eee.3	-	15	2521	c.2392C>A	c.(2392-2394)CGG>AGG	p.R798R	POLQ_uc003eed.2_5'Flank	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	798					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		AAGGATACCCGAACCAGGTCA	0.488	Pancreas(152;907 1925 26081 31236 36904)										DNA_polymerases_(catalytic_subunits)					0.365079	64.70679	65.715802	23	40	KEEP	---	---	---	---	13	10	22	20	0.565217391304	capture	Silent	SNP	121212455	121212455	POLQ	3	G	T	T	T	1	0	0	0	0	0	0	0	1	480	37	4	4	12111	18
AGTR1	185	broad.mit.edu	37	3	148459240	148459240	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148459240C>T	uc003ewg.2	+	4	864	c.418C>T	c.(418-420)CGC>TGC	p.R140C	AGTR1_uc003ewh.2_Missense_Mutation_p.R140C|AGTR1_uc003ewi.2_Missense_Mutation_p.R140C|AGTR1_uc003ewj.2_Missense_Mutation_p.R140C|AGTR1_uc003ewk.2_Missense_Mutation_p.R140C	NM_031850	NP_114038	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	140	Cytoplasmic (Potential).				calcium-mediated signaling|cell chemotaxis|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|kidney development|low-density lipoprotein particle remodeling|positive regulation of cellular protein metabolic process|positive regulation of cholesterol esterification|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of phospholipase A2 activity|positive regulation of reactive oxygen species metabolic process|regulation of cell growth|regulation of cell proliferation|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|Rho protein signal transduction		acetyltransferase activator activity|angiotensin type I receptor activity|angiotensin type II receptor activity|bradykinin receptor binding|protein heterodimerization activity				0			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Spironolactone(DB00421)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	CCGCCTTCGACGCACAATGCT	0.473																0.468468	314.973075	315.165565	104	118	KEEP	---	---	---	---	52	60	72	61	-1	capture	Missense_Mutation	SNP	148459240	148459240	AGTR1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	401	18
RTP2	344892	broad.mit.edu	37	3	187416724	187416724	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:187416724G>A	uc003fro.1	-	2	669	c.240C>T	c.(238-240)CGC>CGT	p.R80R		NM_001004312	NP_001004312	Q5QGT7	RTP2_HUMAN	receptor transporting protein 2	80	Cytoplasmic (Potential).				protein insertion into membrane	cell surface|integral to membrane|plasma membrane	olfactory receptor binding				0	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)		CCCGCTGGGCGCGGTCCAGGA	0.657																0.439024	55.046036	55.178505	18	23	KEEP	---	---	---	---	10	11	14	12	-1	capture	Silent	SNP	187416724	187416724	RTP2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13626	18
TMEM156	80008	broad.mit.edu	37	4	39000377	39000377	+	Missense_Mutation	SNP	G	A	A	rs13118782		TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39000377G>A	uc003gto.2	-	2	349	c.241C>T	c.(241-243)CGT>TGT	p.R81C	TMEM156_uc010ifj.2_Missense_Mutation_p.R81C	NM_024943	NP_079219	Q8N614	TM156_HUMAN	transmembrane protein 156	81	Extracellular (Potential).					integral to membrane				skin(1)	1						GTGAAGTTACGAAAATTGGAG	0.368																0.311475	54.203407	56.133554	19	42	KEEP	---	---	---	---	7	12	19	27	-1	capture	Missense_Mutation	SNP	39000377	39000377	TMEM156	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15957	18
RAI14	26064	broad.mit.edu	37	5	34823835	34823835	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:34823835A>G	uc003jir.2	+	15	2084	c.1888A>G	c.(1888-1890)ATG>GTG	p.M630V	RAI14_uc010iur.2_Missense_Mutation_p.M601V|RAI14_uc011coj.1_Missense_Mutation_p.M630V|RAI14_uc003jis.2_Missense_Mutation_p.M633V|RAI14_uc003jit.2_Missense_Mutation_p.M630V|RAI14_uc011cok.1_Missense_Mutation_p.M622V	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a	630	Potential.					cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					AGCTGAGGACATGAAAGAAGC	0.418																0.426667	97.491807	97.84248	32	43	KEEP	---	---	---	---	16	19	18	29	-1	capture	Missense_Mutation	SNP	34823835	34823835	RAI14	5	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	12903	18
UGT3A2	167127	broad.mit.edu	37	5	36035966	36035966	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:36035966G>A	uc003jjz.1	-	7	1499	c.1406C>T	c.(1405-1407)ACG>ATG	p.T469M	UGT3A2_uc011cos.1_Missense_Mutation_p.T435M|UGT3A2_uc011cot.1_Missense_Mutation_p.T167M	NM_174914	NP_777574	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	469	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTTGAGGTGCGTCGCGCCCCC	0.627																0.4	54.041198	54.434663	18	27	KEEP	---	---	---	---	10	10	10	19	-1	capture	Missense_Mutation	SNP	36035966	36035966	UGT3A2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16846	18
HEATR7B2	133558	broad.mit.edu	37	5	41067251	41067251	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41067251G>A	uc003jmj.3	-	3	650	c.160C>T	c.(160-162)CGA>TGA	p.R54*		NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	54	HEAT 1.						binding			ovary(6)|central_nervous_system(2)	8						TAAATCAATCGTTGGACAATT	0.373																0.25	7.819215	8.500951	3	9	KEEP	---	---	---	---	0	4	6	3	-1	capture	Nonsense_Mutation	SNP	41067251	41067251	HEATR7B2	5	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	6961	18
SLC27A6	28965	broad.mit.edu	37	5	128302221	128302221	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:128302221G>A	uc003kuy.2	+	2	787	c.391G>A	c.(391-393)GTG>ATG	p.V131M	SLC27A6_uc003kuz.2_Missense_Mutation_p.V131M	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid	131	Helical; (Potential).				long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		GCTGGGCTGCGTGGTGGCCTT	0.592																0.409091	51.736059	52.054872	18	26	KEEP	---	---	---	---	7	13	10	17	-1	capture	Missense_Mutation	SNP	128302221	128302221	SLC27A6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14422	18
ABLIM3	22885	broad.mit.edu	37	5	148637854	148637854	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148637854C>T	uc003lpy.2	+	24	2190	c.1939C>T	c.(1939-1941)CGC>TGC	p.R647C	ABLIM3_uc003lpz.1_Missense_Mutation_p.R647C|ABLIM3_uc003lqa.1_Missense_Mutation_p.R544C|ABLIM3_uc003lqb.2_Intron|ABLIM3_uc003lqc.1_Missense_Mutation_p.R614C|ABLIM3_uc003lqd.1_Missense_Mutation_p.R552C|ABLIM3_uc003lqf.2_Intron|ABLIM3_uc003lqe.1_Missense_Mutation_p.R536C	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	647	HP.				axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTCCTTCAGCGCCACCTGTC	0.507																0.389831	65.010091	65.637852	23	36	KEEP	---	---	---	---	9	14	14	24	-1	capture	Missense_Mutation	SNP	148637854	148637854	ABLIM3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	96	18
DOCK2	1794	broad.mit.edu	37	5	169108785	169108785	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169108785G>A	uc003maf.2	+	7	588	c.508G>A	c.(508-510)GGA>AGA	p.G170R	DOCK2_uc011der.1_RNA	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	170					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGATGAAGACGGAAATATCTT	0.413																0.371257	196.321709	198.747811	62	105	KEEP	---	---	---	---	28	39	50	63	-1	capture	Missense_Mutation	SNP	169108785	169108785	DOCK2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4643	18
C6orf153	88745	broad.mit.edu	37	6	42993026	42993026	+	Silent	SNP	C	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:42993026C>A	uc003otp.1	+	3	312	c.304C>A	c.(304-306)CGA>AGA	p.R102R		NM_033112	NP_149103	Q96EU6	RRP36_HUMAN	hypothetical protein LOC88745	102					ribosomal small subunit biogenesis|rRNA processing	nucleolus					0			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			AGCCAAGATCCGAGTACCATT	0.338																0.414414	147.633323	148.342513	46	65	KEEP	---	---	---	---	30	19	39	36	0.387755102041	capture	Silent	SNP	42993026	42993026	C6orf153	6	C	A	A	A	1	0	0	0	0	0	0	0	1	295	23	4	4	2315	18
PKHD1	5314	broad.mit.edu	37	6	51947198	51947198	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51947198G>A	uc003pah.1	-	4	549	c.273C>T	c.(271-273)TGC>TGT	p.C91C	PKHD1_uc003pai.2_Silent_p.C91C	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	91	Extracellular (Potential).|IPT/TIG 1; atypical.				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					ACCTGGTCCGGCATGTCACCA	0.478					1537											0.016461	-57.829429	6.466428	4	239	KEEP	---	---	---	---	1	4	117	146	-1	capture	Silent	SNP	51947198	51947198	PKHD1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	11874	18
HCRTR2	3062	broad.mit.edu	37	6	55120034	55120034	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55120034G>A	uc003pcl.2	+	3	818	c.503G>A	c.(502-504)CGG>CAG	p.R168Q	HCRTR2_uc010jzv.2_RNA|HCRTR2_uc010jzw.1_Missense_Mutation_p.R103Q	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2	168	Cytoplasmic (Potential).				feeding behavior	integral to plasma membrane	neuropeptide receptor activity	p.R168W(1)		ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ACAGCAAAGCGGGCCCGTAAC	0.517																0.383929	136.219079	137.534587	43	69	KEEP	---	---	---	---	22	24	38	36	-1	capture	Missense_Mutation	SNP	55120034	55120034	HCRTR2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6929	18
COL19A1	1310	broad.mit.edu	37	6	70840111	70840111	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:70840111A>G	uc003pfc.1	+	18	1496	c.1379A>G	c.(1378-1380)GAC>GGC	p.D460G	COL19A1_uc010kam.1_Missense_Mutation_p.D356G	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	460	Triple-helical region 3 (COL3).				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						CTGAAAGGAGACAAGGTAATC	0.199																0.58	105.087968	105.369267	29	21	KEEP	---	---	---	---	18	13	9	16	-1	capture	Missense_Mutation	SNP	70840111	70840111	COL19A1	6	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	3641	18
ZNF292	23036	broad.mit.edu	37	6	87967291	87967291	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:87967291G>C	uc003plm.3	+	8	3985	c.3944G>C	c.(3943-3945)GGT>GCT	p.G1315A		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	1315					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GGGGGTAATGGTGAAAATGCA	0.383																0.275862	24.48628	25.798683	8	21	KEEP	---	---	---	---	5	3	10	11	-1	capture	Missense_Mutation	SNP	87967291	87967291	ZNF292	6	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	17706	18
IQCE	23288	broad.mit.edu	37	7	2611946	2611946	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2611946G>A	uc003smo.3	+	5	564	c.380G>A	c.(379-381)CGC>CAC	p.R127H	IQCE_uc010ksm.1_Missense_Mutation_p.R127H|IQCE_uc003sml.1_Missense_Mutation_p.R127H|IQCE_uc011jvy.1_Missense_Mutation_p.R111H|IQCE_uc011jvz.1_Missense_Mutation_p.R62H|IQCE_uc003smk.3_Missense_Mutation_p.R111H|IQCE_uc003smn.3_Missense_Mutation_p.R62H	NM_152558	NP_689771	Q6IPM2	IQCE_HUMAN	IQ motif containing E isoform 1	127											0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		CATCTCAGGCGCTCTGCCAGC	0.617																0.306667	54.382115	56.891205	23	52	KEEP	---	---	---	---	16	12	27	28	-1	capture	Missense_Mutation	SNP	2611946	2611946	IQCE	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7729	18
OGDH	4967	broad.mit.edu	37	7	44736643	44736643	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44736643C>T	uc003tln.2	+	15	2140	c.2031C>T	c.(2029-2031)GAC>GAT	p.D677D	OGDH_uc011kbx.1_Silent_p.D673D|OGDH_uc011kby.1_Silent_p.D527D|OGDH_uc003tlp.2_Silent_p.D688D|OGDH_uc011kbz.1_Silent_p.D472D|OGDH_uc003tlo.1_Silent_p.D510D	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	677					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	GCGGCCAGGACGTGGAGCGGG	0.552																0.417722	96.246751	96.716393	33	46	KEEP	---	---	---	---	22	15	32	21	-1	capture	Silent	SNP	44736643	44736643	OGDH	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10744	18
EGFR	1956	broad.mit.edu	37	7	55233037	55233037	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233037C>T	uc003tqk.2	+	15	2033	c.1787C>T	c.(1786-1788)CCG>CTG	p.P596L	EGFR_uc003tqi.2_Missense_Mutation_p.P596L|EGFR_uc003tqj.2_Missense_Mutation_p.P596L|EGFR_uc010kzg.1_Missense_Mutation_p.P551L|EGFR_uc011kco.1_Missense_Mutation_p.P543L|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	596	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.P596L(2)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AAGACCTGCCCGGCAGGAGTC	0.567			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.059701	-67.416707	122.668747	56	882	KEEP	---	---	---	---	30	35	445	487	-1	capture	Missense_Mutation	SNP	55233037	55233037	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4922	18
ZNF716	441234	broad.mit.edu	37	7	57529294	57529294	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:57529294G>T	uc011kdi.1	+	4	1239	c.1127G>T	c.(1126-1128)GGA>GTA	p.G376V		NM_001159279	NP_001152751			zinc finger protein 716											ovary(2)	2						ATTCATACTGGAGAGAAACCC	0.413																0.285714	40.274474	42.583597	16	40	KEEP	---	---	---	---	4	12	18	25	0.25	capture	Missense_Mutation	SNP	57529294	57529294	ZNF716	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	17995	18
GTF2IRD2	84163	broad.mit.edu	37	7	74234528	74234528	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:74234528C>T	uc003ubd.1	-	7	781	c.597G>A	c.(595-597)GCG>GCA	p.A199A	GTF2IRD2_uc011kfi.1_Silent_p.A199A|uc003ube.1_5'Flank|GTF2IRD2_uc003ubf.1_Silent_p.A199A	NM_173537	NP_775808	Q86UP8	GTD2A_HUMAN	GTF2I repeat domain containing 2	199					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TGGATCTCTCCGCATCTGTTA	0.443	NSCLC(40;560 1096 7501 40315 49546)															0.162162	23.962542	31.985586	12	62	KEEP	---	---	---	---	15	4	67	66	-1	capture	Silent	SNP	74234528	74234528	GTF2IRD2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6798	18
SLC12A9	56996	broad.mit.edu	37	7	100459452	100459452	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100459452G>C	uc003uwp.2	+	12	1772	c.1630G>C	c.(1630-1632)GCC>CCC	p.A544P	SLC12A9_uc003uwq.2_Missense_Mutation_p.A455P|SLC12A9_uc011kki.1_Missense_Mutation_p.A75P|SLC12A9_uc003uwr.2_Missense_Mutation_p.A280P|SLC12A9_uc003uws.2_Missense_Mutation_p.A75P|SLC12A9_uc003uwt.2_Missense_Mutation_p.A280P|SLC12A9_uc003uwv.2_Missense_Mutation_p.A75P	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	544	Extracellular (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCCCCGGGGCGCCCTGCCTCT	0.657																0.092308	-4.576795	6.487196	6	59	KEEP	---	---	---	---	15	7	45	43	-1	capture	Missense_Mutation	SNP	100459452	100459452	SLC12A9	7	G	C	C	C	1	0	0	0	0	1	0	0	0	494	38	4	4	14283	18
PTN	5764	broad.mit.edu	37	7	136938378	136938378	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:136938378T>A	uc003vtq.2	-	3	485	c.122A>T	c.(121-123)AAA>ATA	p.K41I	PTN_uc010lmx.2_Missense_Mutation_p.K41I|PTN_uc003vtr.1_Missense_Mutation_p.K41I	NM_002825	NP_002816	P21246	PTN_HUMAN	pleiotrophin	41					nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2						CTTCTTCACTTTTTTTTCTGA	0.428																0.078125	-1.579126	10.073597	5	59	KEEP	---	---	---	---	2	3	33	30	-1	capture	Missense_Mutation	SNP	136938378	136938378	PTN	7	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	12663	18
ATP6V0A4	50617	broad.mit.edu	37	7	138440463	138440463	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138440463C>T	uc003vuf.2	-	9	1025	c.787G>A	c.(787-789)GTC>ATC	p.V263I	ATP6V0A4_uc003vug.2_Missense_Mutation_p.V263I|ATP6V0A4_uc003vuh.2_Missense_Mutation_p.V263I	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	263	Cytoplasmic (Potential).				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						CTCACATTGACGCTCTCCAAC	0.522																0.308511	78.031248	81.108804	29	65	KEEP	---	---	---	---	15	16	33	39	-1	capture	Missense_Mutation	SNP	138440463	138440463	ATP6V0A4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1161	18
DLGAP2	9228	broad.mit.edu	37	8	1497705	1497705	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:1497705C>T	uc003wpl.2	+	2	943	c.846C>T	c.(844-846)GAC>GAT	p.D282D	DLGAP2_uc003wpm.2_Silent_p.D282D	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	361					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TGACGCCCGACGCCAAGTACC	0.647																0.363636	45.399331	46.114305	16	28	KEEP	---	---	---	---	7	9	12	17	-1	capture	Silent	SNP	1497705	1497705	DLGAP2	8	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4518	18
KCNV1	27012	broad.mit.edu	37	8	110984522	110984522	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110984522G>T	uc003ynr.3	-	2	1298	c.956C>A	c.(955-957)GCT>GAT	p.A319D	KCNV1_uc010mcw.2_Missense_Mutation_p.A319D	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	319	Helical; Voltage-sensor; Name=Segment S4; (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CATGCGCAGAGCCCTGAGCAG	0.502																0.314286	59.060543	61.189649	22	48	KEEP	---	---	---	---	11	12	20	28	0.478260869565	capture	Missense_Mutation	SNP	110984522	110984522	KCNV1	8	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	8016	18
CSMD3	114788	broad.mit.edu	37	8	113988211	113988211	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:113988211C>T	uc003ynu.2	-	7	1356	c.1197G>A	c.(1195-1197)ACG>ACA	p.T399T	CSMD3_uc003ynt.2_Silent_p.T359T|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	399	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTCTGAGACTCGTAACTTGCA	0.502					2888								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			0.434389	299.67272	300.501071	96	125	KEEP	---	---	---	---	54	51	69	65	-1	capture	Silent	SNP	113988211	113988211	CSMD3	8	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	3911	18
GABBR2	9568	broad.mit.edu	37	9	101235479	101235479	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101235479G>A	uc004ays.2	-	6	1104	c.948C>T	c.(946-948)GGC>GGT	p.G316G		NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor	316	Extracellular (Potential).				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	CGAAATCCACGCCAATGTAGC	0.572																0.446154	86.782587	86.943378	29	36	KEEP	---	---	---	---	13	16	21	17	-1	capture	Silent	SNP	101235479	101235479	GABBR2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6098	18
TSC1	7248	broad.mit.edu	37	9	135804224	135804224	+	Silent	SNP	G	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135804224G>T	uc004cca.2	-	3	270	c.36C>A	c.(34-36)GCC>GCA	p.A12A	TSC1_uc004ccb.3_Silent_p.A12A|TSC1_uc011mcq.1_Silent_p.A12A|TSC1_uc011mcr.1_Intron|TSC1_uc011mcs.1_5'UTR|TSC1_uc004ccc.1_Silent_p.A12A|TSC1_uc004ccd.2_Silent_p.A12A|TSC1_uc004cce.1_Silent_p.A12A	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	12					activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.A12A(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		AGTCCAGCATGGCAAGAAGCT	0.502					536	D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				0.267717	91.896305	98.081237	34	93	KEEP	---	---	---	---	21	18	47	65	0.538461538462	capture	Silent	SNP	135804224	135804224	TSC1	9	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	16488	18
LCN1	3933	broad.mit.edu	37	9	138415812	138415812	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138415812C>T	uc004cfz.1	+	4	437	c.379C>T	c.(379-381)CCG>TCG	p.P127S	LCN1_uc004cga.1_Missense_Mutation_p.P127S	NM_002297	NP_002288	P31025	LCN1_HUMAN	lipocalin 1 precursor	127					proteolysis|response to stimulus|sensory perception of taste	extracellular region	cysteine-type endopeptidase inhibitor activity|transporter activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		GCACGGGAAGCCGGTCCGAGG	0.632																0.052632	-5.524801	6.529875	3	54	KEEP	---	---	---	---	1	3	41	35	-1	capture	Missense_Mutation	SNP	138415812	138415812	LCN1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8600	18
CDKL5	6792	broad.mit.edu	37	X	18664128	18664128	+	Silent	SNP	C	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18664128C>T	uc004cym.2	+	19	2968	c.2715C>T	c.(2713-2715)GAC>GAT	p.D905D	CDKL5_uc004cyn.2_Silent_p.D905D|RS1_uc004cyo.2_Intron	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	905					neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding	p.D905D(1)		ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					actaactagacggtggatgtg	0.000					244											0.297619	66.638312	69.716555	25	59	KEEP	---	---	---	---	22	5	22	47	-1	capture	Silent	SNP	18664128	18664128	CDKL5	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3127	18
KIF4A	24137	broad.mit.edu	37	X	69510643	69510643	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69510643G>T	uc004dyg.2	+	3	350	c.223G>T	c.(223-225)GGT>TGT	p.G75C	KIF4A_uc010nkw.2_Missense_Mutation_p.G75C|PDZD11_uc004dyd.1_5'Flank|PDZD11_uc004dye.1_5'Flank|KIF4A_uc004dyf.1_Missense_Mutation_p.G75C	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	75	Kinesin-motor.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4						ACTCATAAAAGGTGTATTTAA	0.289																0.057143	-5.462107	8.952829	4	66	KEEP	---	---	---	---	0	4	30	43	-1	capture	Missense_Mutation	SNP	69510643	69510643	KIF4A	23	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	8225	18
DIAPH2	1730	broad.mit.edu	37	X	96684727	96684727	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:96684727G>A	uc004efu.3	+	26	3620	c.3224G>A	c.(3223-3225)CGG>CAG	p.R1075Q	DIAPH2_uc004eft.3_Missense_Mutation_p.R1075Q	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156	1075	Arg/Lys-rich (basic).|DAD.				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						CGTCGAAAGCGGATTCCAAGG	0.408																0.508197	103.906671	103.909909	31	30	KEEP	---	---	---	---	16	18	17	14	-1	capture	Missense_Mutation	SNP	96684727	96684727	DIAPH2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4477	18
ALG13	79868	broad.mit.edu	37	X	110925413	110925413	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:110925413G>A	uc011msy.1	+	2	169	c.135G>A	c.(133-135)ACG>ACA	p.T45T	ALG13_uc004epi.1_Silent_p.T45T|ALG13_uc011msw.1_5'UTR|ALG13_uc011msx.1_Intron|ALG13_uc011msz.1_5'UTR|ALG13_uc011mta.1_Intron|ALG13_uc011mtb.1_5'UTR			Q9NP73	ALG13_HUMAN	SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);	45					dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity			lung(1)	1						GTAGAGGAACGGTGGTACCTG	0.413																0.040293	-39.816606	22.352375	11	262	KEEP	---	---	---	---	6	5	138	146	-1	capture	Silent	SNP	110925413	110925413	ALG13	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	515	18
ODZ1	10178	broad.mit.edu	37	X	123554390	123554390	+	Missense_Mutation	SNP	C	T	T	rs148440423	byFrequency	TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123554390C>T	uc004euj.2	-	24	4796	c.4732G>A	c.(4732-4734)GCG>ACG	p.A1578T	ODZ1_uc011muj.1_Missense_Mutation_p.A1584T|ODZ1_uc010nqy.2_Missense_Mutation_p.A1585T	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1578	YD 2.|Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						CTGGTAATCGCGCCCAAGTCA	0.498					623											0.469388	139.037734	139.117954	46	52	KEEP	---	---	---	---	21	26	22	33	-1	capture	Missense_Mutation	SNP	123554390	123554390	ODZ1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10739	18
SPANXN2	494119	broad.mit.edu	37	X	142795381	142795381	+	Silent	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142795381G>A	uc004fbz.2	-	2	1051	c.297C>T	c.(295-297)GAC>GAT	p.D99D		NM_001009615	NP_001009615	Q5MJ10	SPXN2_HUMAN	SPANX-N2 protein	99										ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					CCAGGTCTTCGTCCTCCTGTG	0.527																0.038035	-101.212682	44.432783	24	607	KEEP	---	---	---	---	27	21	462	367	-1	capture	Silent	SNP	142795381	142795381	SPANXN2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14883	18
MAGEA1	4100	broad.mit.edu	37	X	152482500	152482500	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152482500G>A	uc004fhf.2	-	3	731	c.511C>T	c.(511-513)CTT>TTT	p.L171F		NM_004988	NP_004979	P43355	MAGA1_HUMAN	melanoma antigen family A, 1	171	MAGE.					cytoplasm|plasma membrane		p.L171F(1)		central_nervous_system(7)|ovary(1)|lung(1)|breast(1)	10	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGGTGACAAGGACATAGGAG	0.517																0.418103	316.228943	317.588609	97	135	KEEP	---	---	---	---	57	53	92	59	-1	capture	Missense_Mutation	SNP	152482500	152482500	MAGEA1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	9077	18
RPL10	6134	broad.mit.edu	37	X	153631649	153631649	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153631649G>A	uc004fkr.1	+	3	348	c.313G>A	c.(313-315)GTA>ATA	p.V105I	RPL10_uc004fkq.1_RNA|DNASE1L1_uc004fks.1_Silent_p.Y162Y|DNASE1L1_uc004fkt.1_Silent_p.Y162Y|DNASE1L1_uc004fku.1_Silent_p.Y162Y|DNASE1L1_uc004fkv.1_Silent_p.Y162Y|DNASE1L1_uc004fkw.1_Silent_p.Y162Y	NM_006013	NP_006004	P27635	RL10_HUMAN	ribosomal protein L10	Error:Variant_position_missing_in_P27635_after_alignment					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|endoplasmic reticulum	structural constituent of ribosome				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GAAACACATCGTAGAGGGCGT	0.622																0.458537	287.534653	287.840551	94	111	KEEP	---	---	---	---	46	55	55	71	-1	capture	Missense_Mutation	SNP	153631649	153631649	RPL10	23	G	A	A	A	1	0	0	0	0	1	0	0	0	516	40	1	1	13446	18
ABCD2	225	broad.mit.edu	37	12	40012537	40012538	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40012537_40012538insA	uc001rmb.2	-	1	1306_1307	c.880_881insT	c.(880-882)TATfs	p.Y294fs		NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D, member 2	294	ABC transmembrane type-1.				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						CGAGTGCACATACCGCAAATAG	0.406																0.38			90	148		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	40012537	40012538	ABCD2	12	-	A	A	A	1	0	1	1	0	0	0	0	0	637	49	5	5	61	18
TLR6	10333	broad.mit.edu	37	4	38830432	38830432	+	Frame_Shift_Del	DEL	C	-	-	rs146892714		TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:38830432delC	uc003gtm.2	-	1	729	c.663delG	c.(661-663)GGGfs	p.G221fs	TLR6_uc010ifg.1_Frame_Shift_Del_p.G221fs	NM_006068	NP_006059	Q9Y2C9	TLR6_HUMAN	toll-like receptor 6 precursor	221	Extracellular (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity			ovary(2)	2						GTTGTAAGCACCCTAAAGTAT	0.323																0.36			38	67		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	38830432	38830432	TLR6	4	C	-	-	-	1	0	1	0	1	0	0	0	0	223	18	5	5	15840	18
PCLO	27445	broad.mit.edu	37	7	82763627	82763627	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0137-01	TCGA-06-0137-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82763627delG	uc003uhx.2	-	3	3528	c.3239delC	c.(3238-3240)ACTfs	p.T1080fs	PCLO_uc003uhv.2_Frame_Shift_Del_p.T1080fs	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1026	C4-type (Potential).				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CTTGCATTCAGTGCAAGTATT	0.348																0.33			9	18		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	82763627	82763627	PCLO	7	G	-	-	-	1	0	1	0	1	0	0	0	0	468	36	5	5	11486	18
