Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CLCNKB	1188	broad.mit.edu	37	1	16378751	16378751	+	Silent	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16378751C>T	uc001axw.3	+	15	1547	c.1467C>T	c.(1465-1467)TTC>TTT	p.F489F	FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Silent_p.F489F|CLCNKB_uc001axy.3_Silent_p.F320F	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1	489	Helical; (Potential).				excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TGCTGGCCTTCGAGGTGACCG	0.657																0.231579	52.704414	58.972428	22	73	KEEP	---	---	---	---	13	13	43	47	-1	capture	Silent	SNP	16378751	16378751	CLCNKB	1	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	3435	27
KLF17	128209	broad.mit.edu	37	1	44595217	44595217	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44595217C>T	uc001clp.2	+	2	332	c.274C>T	c.(274-276)CCA>TCA	p.P92S	KLF17_uc009vxf.1_Missense_Mutation_p.P55S	NM_173484	NP_775755	Q5JT82	KLF17_HUMAN	zinc finger protein 393	92					regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					GTTCAGTATGCCACTGCCTGA	0.567																0.02649	-31.097509	6.30437	4	147	KEEP	---	---	---	---	1	3	77	77	-1	capture	Missense_Mutation	SNP	44595217	44595217	KLF17	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8266	27
TESK2	10420	broad.mit.edu	37	1	45923297	45923297	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:45923297G>A	uc001cns.1	-	2	564	c.161C>T	c.(160-162)ACG>ATG	p.T54M	TESK2_uc009vxr.1_Missense_Mutation_p.T54M|TESK2_uc010olo.1_Intron|TESK2_uc009vxs.1_Translation_Start_Site|TESK2_uc010olp.1_Missense_Mutation_p.T54M	NM_007170	NP_009101	Q96S53	TESK2_HUMAN	testis-specific protein kinase 2	54					actin cytoskeleton organization|focal adhesion assembly|spermatogenesis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(2)|pancreas(1)	5	Acute lymphoblastic leukemia(166;0.155)					ATCCAAACGCGTCAGTCTGGA	0.453					192											0.049451	-22.270723	16.949725	9	173	KEEP	---	---	---	---	7	3	79	109	-1	capture	Missense_Mutation	SNP	45923297	45923297	TESK2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15653	27
AP4B1	10717	broad.mit.edu	37	1	114438528	114438528	+	Missense_Mutation	SNP	G	A	A	rs149723440		TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114438528G>A	uc001eeb.2	-	9	1786	c.1643C>T	c.(1642-1644)CCG>CTG	p.P548L	uc001edv.1_Intron|AP4B1_uc001eec.2_Missense_Mutation_p.P380L|AP4B1_uc001eed.2_Missense_Mutation_p.P548L|AP4B1_uc010owp.1_Missense_Mutation_p.P449L|AP4B1_uc001eea.1_3'UTR|AP4B1_uc001eee.1_Missense_Mutation_p.P75L	NM_006594	NP_006585	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1	548					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|soluble fraction|trans-Golgi network	protein binding|protein transporter activity			ovary(3)|central_nervous_system(1)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTTTCTGCCGGATCCTCCAA	0.498																0.383929	131.835579	133.144739	43	69	KEEP	---	---	---	---	21	24	38	36	-1	capture	Missense_Mutation	SNP	114438528	114438528	AP4B1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	744	27
SPTA1	6708	broad.mit.edu	37	1	158653172	158653172	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158653172C>G	uc001fst.1	-	3	578	c.379G>C	c.(379-381)GAA>CAA	p.E127Q		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	127	Spectrin 2.			Missing (in Ref. 3; AAA60575).	actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TTCGTTTCTTCGTGGGCAGAA	0.388																0.021429	-58.203881	13.476679	6	274	KEEP	---	---	---	---	2	5	157	161	-1	capture	Missense_Mutation	SNP	158653172	158653172	SPTA1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	403	31	4	4	15008	27
ANGPTL1	9068	broad.mit.edu	37	1	178834371	178834371	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:178834371A>G	uc001gma.2	-	3	1017	c.541T>C	c.(541-543)TCC>CCC	p.S181P	RALGPS2_uc001gly.1_Intron|RALGPS2_uc001glz.2_Intron|RALGPS2_uc010pnb.1_Intron|ANGPTL1_uc001gmb.2_Missense_Mutation_p.S181P|ANGPTL1_uc010pnc.1_Missense_Mutation_p.S103P	NM_004673	NP_004664	O95841	ANGL1_HUMAN	angiopoietin-like 1 precursor	181						extracellular space	receptor binding				0						TCAGTCAAGGAAGCGTATTTC	0.423																0.338346	150.141605	153.211357	45	88	KEEP	---	---	---	---	16	31	42	51	-1	capture	Missense_Mutation	SNP	178834371	178834371	ANGPTL1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	610	27
OBSCN	84033	broad.mit.edu	37	1	228431145	228431145	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228431145G>T	uc009xez.1	+	10	3235	c.3191G>T	c.(3190-3192)CGC>CTC	p.R1064L	OBSCN_uc001hsn.2_Missense_Mutation_p.R1064L	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1064	Ig-like 10.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GTCTCCTTCCGCCTGCACATC	0.552					4006											0.387755	58.630833	59.165666	19	30	KEEP	---	---	---	---	8	13	19	18	0.380952380952	capture	Missense_Mutation	SNP	228431145	228431145	OBSCN	1	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	10717	27
OBSCN	84033	broad.mit.edu	37	1	228557713	228557713	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228557713G>A	uc009xez.1	+	91	20082	c.20038G>A	c.(20038-20040)GTG>ATG	p.V6680M	OBSCN_uc001hsr.1_Missense_Mutation_p.V1309M	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	6680	Protein kinase 1.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GGAGGGGCGCGTGTCATGGAG	0.642					4006											0.034783	-20.196308	6.879221	4	111	KEEP	---	---	---	---	1	4	53	78	-1	capture	Missense_Mutation	SNP	228557713	228557713	OBSCN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10717	27
LYST	1130	broad.mit.edu	37	1	235938388	235938388	+	Splice_Site	SNP	T	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235938388T>A	uc001hxj.2	-	18	5636	c.5461_splice	c.e18-1	p.V1821_splice	LYST_uc009xgb.1_Splice_Site|LYST_uc010pxs.1_Splice_Site	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTCAACAACCTAAAAAAAAAA	0.313												Chediak-Higashi_syndrome				0.041237	-14.114363	7.778953	4	93	KEEP	---	---	---	---	3	1	40	62	-1	capture	Splice_Site	SNP	235938388	235938388	LYST	1	T	A	A	A	1	0	0	0	0	0	0	1	0	689	53	5	4	9043	27
CHRM3	1131	broad.mit.edu	37	1	240072235	240072235	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:240072235C>T	uc001hyp.2	+	5	2263	c.1484C>T	c.(1483-1485)GCG>GTG	p.A495V		NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	495	Helical; Name=6; (By similarity).				cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	ACCCTCAGTGCGATCTTGCTT	0.493																0.399015	233.430058	235.241655	81	122	KEEP	---	---	---	---	49	40	77	61	-1	capture	Missense_Mutation	SNP	240072235	240072235	CHRM3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3343	27
PRKCQ	5588	broad.mit.edu	37	10	6553040	6553040	+	Missense_Mutation	SNP	C	T	T	rs148376969		TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:6553040C>T	uc001ijj.1	-	3	310	c.235G>A	c.(235-237)GTG>ATG	p.V79M	PRKCQ_uc009xim.1_Missense_Mutation_p.V79M|PRKCQ_uc001iji.1_Missense_Mutation_p.V112M|PRKCQ_uc009xin.1_Missense_Mutation_p.V43M|PRKCQ_uc010qax.1_Translation_Start_Site	NM_006257	NP_006248	Q04759	KPCT_HUMAN	protein kinase C, theta	79	C2.				axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6						ATGAGGTCCACGTTTTTGCCT	0.478	Ovarian(50;572 1126 10530 25349 30594)				435											0.583333	287.247005	288.192893	91	65	KEEP	---	---	---	---	44	58	26	42	-1	capture	Missense_Mutation	SNP	6553040	6553040	PRKCQ	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12411	27
USP6NL	9712	broad.mit.edu	37	10	11505268	11505268	+	Silent	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:11505268G>A	uc001ikt.3	-	15	1980	c.1659C>T	c.(1657-1659)AAC>AAT	p.N553N	USP6NL_uc001iks.1_Silent_p.N570N	NM_014688	NP_055503	Q92738	US6NL_HUMAN	USP6 N-terminal like isoform 1	553						intracellular	Rab GTPase activator activity				0						GGCCTGGCACGTTGTCGTACT	0.662																0.75	194.711683	199.250737	60	20	KEEP	---	---	---	---	35	34	6	16	-1	capture	Silent	SNP	11505268	11505268	USP6NL	10	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16969	27
PPP3CB	5532	broad.mit.edu	37	10	75204531	75204531	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:75204531T>A	uc001jue.2	-	12	1453	c.1318A>T	c.(1318-1320)ATG>TTG	p.M440L	PPP3CB_uc001juf.2_Missense_Mutation_p.M441L|PPP3CB_uc001jug.2_Missense_Mutation_p.M441L|PPP3CB_uc001jui.2_Missense_Mutation_p.M458L|PPP3CB_uc001juh.2_Missense_Mutation_p.M355L|PPP3CB_uc010qkj.1_Missense_Mutation_p.M68L	NM_021132	NP_066955	P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta	440										skin(1)	1	Prostate(51;0.0119)					CTAGGCAACATCCCTGTGGGA	0.483					146											0.339286	54.907706	56.186544	19	37	KEEP	---	---	---	---	7	16	19	22	-1	capture	Missense_Mutation	SNP	75204531	75204531	PPP3CB	10	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	12299	27
PTEN	5728	broad.mit.edu	37	10	89692922	89692922	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692922T>C	uc001kfb.2	+	6	1437	c.406T>C	c.(406-408)TGT>CGT	p.C136R		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	136	Phosphatase tensin-type.		C -> Y (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P3).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.C136Y(7)|p.R55fs*1(4)|p.C136F(3)|p.I135fs*44(3)|p.C136fs*1(2)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.C136R(2)|p.I135_A137>T(1)|p.A121_F145del(1)|p.I135fs*6(1)|p.C136_A137insGM(1)|p.C136W(1)|p.T131fs*42(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGTAATGATATGTGCATATTT	0.388			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.662338	337.791084	341.380058	102	52	KEEP	---	---	---	---	57	56	30	27	-1	capture	Missense_Mutation	SNP	89692922	89692922	PTEN	10	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	12633	27
MMP21	118856	broad.mit.edu	37	10	127456157	127456157	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:127456157C>G	uc001liu.2	-	6	1354	c.1354G>C	c.(1354-1356)GAC>CAC	p.D452H		NM_147191	NP_671724	Q8N119	MMP21_HUMAN	matrix metalloproteinase 21 preproprotein	452	Hemopexin-like 3.				proteolysis	extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				AACGCCGTGTCTAGGGGACTT	0.443																0.597015	300.829294	301.932223	80	54	KEEP	---	---	---	---	40	44	26	30	-1	capture	Missense_Mutation	SNP	127456157	127456157	MMP21	10	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	9572	27
OR52E6	390078	broad.mit.edu	37	11	5862602	5862602	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5862602T>G	uc010qzq.1	-	1	526	c.526A>C	c.(526-528)ATC>CTC	p.I176L	TRIM5_uc001mbq.1_Intron	NM_001005167	NP_001005167	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E,	176	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTATGAGGGATGATACGATGT	0.483																0.420354	332.814207	334.058309	95	131	KEEP	---	---	---	---	45	55	71	74	-1	capture	Missense_Mutation	SNP	5862602	5862602	OR52E6	11	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	11021	27
CD44	960	broad.mit.edu	37	11	35232846	35232846	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:35232846A>G	uc001mvu.2	+	14	2094	c.1660A>G	c.(1660-1662)ACT>GCT	p.T554A	CD44_uc001mvv.2_Missense_Mutation_p.T511A|CD44_uc001mvw.2_Missense_Mutation_p.T305A|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Missense_Mutation_p.T241A|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron|CD44_uc010res.1_Missense_Mutation_p.T118A|CD44_uc010ret.1_RNA|CD44_uc010reu.1_Missense_Mutation_p.T82A	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor	554	Extracellular (Potential).|Stem.				cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)	TGAAGGCTCAACTACTTTACT	0.463					401											0.375451	363.340625	367.109867	104	173	KEEP	---	---	---	---	54	63	96	94	-1	capture	Missense_Mutation	SNP	35232846	35232846	CD44	11	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	2988	27
SLC22A9	114571	broad.mit.edu	37	11	63149746	63149746	+	Missense_Mutation	SNP	C	T	T	rs141060614		TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63149746C>T	uc001nww.2	+	6	1338	c.1070C>T	c.(1069-1071)ACG>ATG	p.T357M	SLC22A9_uc001nwx.2_RNA	NM_080866	NP_543142	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion/cation	357	Helical; (Potential).				transmembrane transport	integral to membrane				breast(2)|large_intestine(1)	3						CTGTCCTTTACGAGGTAAGCT	0.403																0.382812	290.395589	293.476058	98	158	KEEP	---	---	---	---	56	55	90	93	-1	capture	Missense_Mutation	SNP	63149746	63149746	SLC22A9	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14353	27
HTR3A	3359	broad.mit.edu	37	11	113853886	113853886	+	Missense_Mutation	SNP	G	A	A	rs149715642		TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113853886G>A	uc010rxb.1	+	5	670	c.437G>A	c.(436-438)CGG>CAG	p.R146Q	HTR3A_uc010rxa.1_Missense_Mutation_p.R146Q|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Missense_Mutation_p.R125Q	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	140	Extracellular (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	GTGTATATTCGGCATCAAGGC	0.542																0.396226	319.23145	321.724579	105	160	KEEP	---	---	---	---	51	58	74	89	-1	capture	Missense_Mutation	SNP	113853886	113853886	HTR3A	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7369	27
CACNA1C	775	broad.mit.edu	37	12	2566754	2566754	+	Silent	SNP	A	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:2566754A>G	uc009zdu.1	+	5	952	c.639A>G	c.(637-639)GAA>GAG	p.E213E	CACNA1C_uc009zdv.1_Silent_p.E213E|CACNA1C_uc001qkb.2_Silent_p.E213E|CACNA1C_uc001qkc.2_Silent_p.E213E|CACNA1C_uc001qke.2_Silent_p.E213E|CACNA1C_uc001qkf.2_Silent_p.E213E|CACNA1C_uc001qjz.2_Silent_p.E213E|CACNA1C_uc001qkd.2_Silent_p.E213E|CACNA1C_uc001qkg.2_Silent_p.E213E|CACNA1C_uc009zdw.1_Silent_p.E213E|CACNA1C_uc001qkh.2_Silent_p.E213E|CACNA1C_uc001qkl.2_Silent_p.E213E|CACNA1C_uc001qkn.2_Silent_p.E213E|CACNA1C_uc001qko.2_Silent_p.E213E|CACNA1C_uc001qkp.2_Silent_p.E213E|CACNA1C_uc001qkr.2_Silent_p.E213E|CACNA1C_uc001qku.2_Silent_p.E213E|CACNA1C_uc001qkq.2_Silent_p.E213E|CACNA1C_uc001qks.2_Silent_p.E213E|CACNA1C_uc001qkt.2_Silent_p.E213E|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_5'UTR|CACNA1C_uc001qkj.1_5'UTR|CACNA1C_uc001qkk.1_5'UTR|CACNA1C_uc001qkm.1_5'UTR	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	213	Extracellular (Potential).|I.				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CAATTTTAGAACAAGCAACCA	0.557																0.333333	258.437122	264.039509	76	152	KEEP	---	---	---	---	36	48	76	86	-1	capture	Silent	SNP	2566754	2566754	CACNA1C	12	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	2516	27
PPFIBP1	8496	broad.mit.edu	37	12	27809558	27809558	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:27809558G>A	uc001ric.1	+	10	1176	c.799G>A	c.(799-801)GCA>ACA	p.A267T	PPFIBP1_uc010sjr.1_Missense_Mutation_p.A95T|PPFIBP1_uc001rib.1_Missense_Mutation_p.A236T|PPFIBP1_uc001ria.2_Missense_Mutation_p.A236T|PPFIBP1_uc001rid.1_Missense_Mutation_p.A114T|PPFIBP1_uc001rie.1_5'Flank	NM_003622	NP_003613	Q86W92	LIPB1_HUMAN	PTPRF interacting protein binding protein 1	267	Potential.				cell adhesion	plasma membrane	protein binding		PPFIBP1/ALK(3)	soft_tissue(3)|kidney(1)|skin(1)	5	Lung SC(9;0.0873)					GGATGAACTGGCATCTTTAAA	0.323																0.210526	46.143769	53.510809	20	75	KEEP	---	---	---	---	12	18	43	35	-1	capture	Missense_Mutation	SNP	27809558	27809558	PPFIBP1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12214	27
MDM2	4193	broad.mit.edu	37	12	69210697	69210697	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:69210697G>A	uc001sui.2	+	4	567	c.280G>A	c.(280-282)GTG>ATG	p.V94M	MDM2_uc009zri.2_Intron|MDM2_uc009zqx.2_Missense_Mutation_p.V94M|MDM2_uc009zqw.2_Missense_Mutation_p.V94M|MDM2_uc001suk.2_Intron|MDM2_uc009zqy.1_Missense_Mutation_p.V83M|MDM2_uc001sun.3_Intron|MDM2_uc009zqz.2_Missense_Mutation_p.V88M|MDM2_uc009zra.2_Intron|MDM2_uc009zrb.1_RNA|MDM2_uc001sum.1_Intron|MDM2_uc009zrd.2_Intron|MDM2_uc009zrc.2_Intron|MDM2_uc009zre.2_Intron|MDM2_uc009zrf.2_Intron|MDM2_uc001suo.2_Intron|MDM2_uc009zrg.2_Intron|MDM2_uc009zrh.2_Intron	NM_002392	NP_002383	Q00987	MDM2_HUMAN	mouse double minute 2 homolog isoform MDM2	88	Necessary for interaction with USP2.|SWIB.				cellular response to hypoxia|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|establishment of protein localization|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein complex assembly|protein destabilization|protein localization to nucleus|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to antibiotic|synaptic transmission	cytosol|endocytic vesicle membrane|insoluble fraction|nucleolus|nucleoplasm|plasma membrane|protein complex	enzyme binding|identical protein binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|central_nervous_system(1)	3	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TTTGTTTGGCGTGCCAAGCTT	0.363					221	A		sarcoma|glioma|colorectal|other								0.024691	-33.818799	6.776691	4	158	KEEP	---	---	---	---	4	0	82	90	-1	capture	Missense_Mutation	SNP	69210697	69210697	MDM2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9326	27
TPH2	121278	broad.mit.edu	37	12	72366329	72366329	+	Silent	SNP	T	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:72366329T>A	uc009zrw.1	+	6	780	c.639T>A	c.(637-639)ACT>ACA	p.T213T	TPH2_uc001swy.2_Silent_p.T123T	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	213					aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)	TGGAGTATACTGAAGAAGAAA	0.428																0.374558	642.26124	650.080381	212	354	KEEP	---	---	---	---	106	129	183	206	-1	capture	Silent	SNP	72366329	72366329	TPH2	12	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	16285	27
MYF5	4617	broad.mit.edu	37	12	81111228	81111228	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:81111228G>A	uc001szg.2	+	1	521	c.386G>A	c.(385-387)CGC>CAC	p.R129H		NM_005593	NP_005584	P13349	MYF5_HUMAN	myogenic factor 5	129	Helix-loop-helix motif.				muscle cell fate commitment|positive regulation of muscle cell differentiation|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(1)	1						AATGCCATCCGCTACATCGAG	0.587																0.362694	191.080176	194.287938	70	123	KEEP	---	---	---	---	31	46	67	74	-1	capture	Missense_Mutation	SNP	81111228	81111228	MYF5	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9937	27
STAB2	55576	broad.mit.edu	37	12	104089589	104089589	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104089589G>T	uc001tjw.2	+	33	3735	c.3549G>T	c.(3547-3549)GAG>GAT	p.E1183D		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1183	Extracellular (Potential).|FAS1 4.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						ATGCCATCGAGAATTACATCA	0.403																0.373913	118.389192	119.997168	43	72	KEEP	---	---	---	---	20	27	33	51	0.425531914894	capture	Missense_Mutation	SNP	104089589	104089589	STAB2	12	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	15128	27
LHX5	64211	broad.mit.edu	37	12	113905175	113905175	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113905175C>T	uc001tvj.1	-	4	1301	c.727G>A	c.(727-729)GCC>ACC	p.A243T		NM_022363	NP_071758	Q9H2C1	LHX5_HUMAN	LIM homeobox protein 5	243						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GCGCCTAGGGCGCTCAGCTGT	0.652																0.157895	5.116537	7.23423	3	16	KEEP	---	---	---	---	3	0	10	8	-1	capture	Missense_Mutation	SNP	113905175	113905175	LHX5	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8694	27
RIMBP2	23504	broad.mit.edu	37	12	130927111	130927111	+	Silent	SNP	G	A	A	rs142303116	byFrequency	TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130927111G>A	uc001uil.2	-	8	899	c.735C>T	c.(733-735)AAC>AAT	p.N245N	RIMBP2_uc001uim.2_Silent_p.N153N|RIMBP2_uc001uin.1_Translation_Start_Site	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	245						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GATCCTGCTCGTTCCCCAGCG	0.602																0.338983	159.894691	163.929166	60	117	KEEP	---	---	---	---	31	30	56	71	-1	capture	Silent	SNP	130927111	130927111	RIMBP2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13255	27
COG6	57511	broad.mit.edu	37	13	40293942	40293942	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:40293942G>A	uc001uxh.2	+	15	1662	c.1562G>A	c.(1561-1563)CGT>CAT	p.R521H	COG6_uc001uxi.2_Missense_Mutation_p.R469H|COG6_uc010acb.2_Missense_Mutation_p.R521H	NM_020751	NP_065802	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6 isoform	521					protein transport	Golgi membrane|Golgi transport complex				kidney(1)|skin(1)	2		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		ACTGACAGACGTCTGGAAATG	0.343																0.317647	144.774787	149.808884	54	116	KEEP	---	---	---	---	30	27	63	64	-1	capture	Missense_Mutation	SNP	40293942	40293942	COG6	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3627	27
FANCM	57697	broad.mit.edu	37	14	45657010	45657010	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:45657010A>G	uc001wwd.3	+	19	4798	c.4699A>G	c.(4699-4701)AAA>GAA	p.K1567E	FANCM_uc010anf.2_Missense_Mutation_p.K1541E|FANCM_uc001wwe.3_Missense_Mutation_p.K1103E|FANCM_uc010ang.2_Missense_Mutation_p.K781E	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1567					DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						TATTTACATGAAATCTTTGCG	0.254					793						Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				0.197183	36.907828	42.973617	14	57	KEEP	---	---	---	---	10	7	35	28	-1	capture	Missense_Mutation	SNP	45657010	45657010	FANCM	14	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	5617	27
TBPL2	387332	broad.mit.edu	37	14	55907173	55907173	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:55907173G>A	uc001xby.2	-	1	91	c.91C>T	c.(91-93)CGG>TGG	p.R31W		NM_199047	NP_950248	Q6SJ96	TBPL2_HUMAN	TATA box binding protein like 2	31					multicellular organismal development|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding				0						TCCATGGACCGTAATCCCACT	0.657																0.417391	136.384048	137.065848	48	67	KEEP	---	---	---	---	23	31	40	31	-1	capture	Missense_Mutation	SNP	55907173	55907173	TBPL2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	15533	27
EHD4	30844	broad.mit.edu	37	15	42193062	42193062	+	Silent	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42193062G>A	uc001zot.2	-	6	1470	c.1407C>T	c.(1405-1407)AAC>AAT	p.N469N		NM_139265	NP_644670	Q9H223	EHD4_HUMAN	EH-domain containing 4	469	EH.				endocytic recycling|protein homooligomerization	early endosome membrane|endoplasmic reticulum|nucleus|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			ovary(2)	2		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)		CCTTCTTGGCGTTGACACCTG	0.592																0.301075	75.065216	78.351461	28	65	KEEP	---	---	---	---	14	16	32	39	-1	capture	Silent	SNP	42193062	42193062	EHD4	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4935	27
RAB11FIP3	9727	broad.mit.edu	37	16	553082	553082	+	Silent	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:553082G>A	uc002chf.2	+	7	1719	c.1380G>A	c.(1378-1380)GAG>GAA	p.E460E	RAB11FIP3_uc010uuf.1_Silent_p.E164E|RAB11FIP3_uc010uug.1_Silent_p.E195E	NM_014700	NP_055515	O75154	RFIP3_HUMAN	rab11-family interacting protein 3 isoform 1	460					cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)				GCCCAGAGGAGGACATTGCTG	0.622	Melanoma(160;2366 2595 4474 8099)															0.288462	89.608564	93.780147	30	74	KEEP	---	---	---	---	18	16	44	36	-1	capture	Silent	SNP	553082	553082	RAB11FIP3	16	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	12790	27
SCNN1G	6340	broad.mit.edu	37	16	23226531	23226531	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23226531G>A	uc002dlm.1	+	13	1830	c.1691G>A	c.(1690-1692)CGC>CAC	p.R564H		NM_001039	NP_001030	P51170	SCNNG_HUMAN	sodium channel, nonvoltage-gated 1, gamma	564	Cytoplasmic (By similarity).				excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	ATTGCCCGCCGCCAGTGGCAG	0.587																0.385714	154.250728	155.840907	54	86	KEEP	---	---	---	---	34	34	55	64	-1	capture	Missense_Mutation	SNP	23226531	23226531	SCNN1G	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13823	27
CES1	1066	broad.mit.edu	37	16	55853460	55853460	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:55853460G>A	uc002eim.2	-	7	998	c.890C>T	c.(889-891)ACG>ATG	p.T297M	CES1_uc010ccf.2_5'Flank|CES1_uc002eil.2_Missense_Mutation_p.T298M|CES1_uc002ein.2_Missense_Mutation_p.T297M	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor	297					response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	TTTCAATGTCGTCTCCAAGAG	0.507	NSCLC(162;1801 2756 42904 52896)															0.037879	-40.764786	20.210806	10	254	KEEP	---	---	---	---	4	6	142	148	-1	capture	Missense_Mutation	SNP	55853460	55853460	CES1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3237	27
CES8	283848	broad.mit.edu	37	16	67040719	67040719	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67040719G>A	uc002eqv.2	+	11	1349	c.1306G>A	c.(1306-1308)GGA>AGA	p.G436R	CES8_uc010vix.1_Intron|CES8_uc002eqw.2_Intron|CES8_uc002eqy.2_Missense_Mutation_p.G408R|CES8_uc002eqx.2_Missense_Mutation_p.G312R|CES8_uc010viy.1_Intron|CES8_uc010viz.1_Missense_Mutation_p.G408R|CES8_uc002eqz.2_Intron	NM_173815	NP_776176	Q5XG92	EST4A_HUMAN	carboxylesterase 8 (putative)	506						extracellular region	carboxylesterase activity				0						TGCCCGCACAGGGTGAGTCTG	0.567																0.436242	210.352462	210.880741	65	84	KEEP	---	---	---	---	19	47	46	44	-1	capture	Missense_Mutation	SNP	67040719	67040719	CES8	16	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	3241	27
THRA	7067	broad.mit.edu	37	17	38240101	38240101	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38240101G>A	uc002htw.2	+	5	719	c.236G>A	c.(235-237)CGC>CAC	p.R79H	THRA_uc010cwp.1_Missense_Mutation_p.R79H|THRA_uc002htv.2_Missense_Mutation_p.R79H|THRA_uc002htx.2_Missense_Mutation_p.R79H	NM_003250	NP_003241	P10827	THA_HUMAN	thyroid hormone receptor, alpha isoform 2	79	Nuclear receptor.				negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|negative regulation of transcription initiation, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription from RNA polymerase II promoter	cytosol|nucleoplasm	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|TBP-class protein binding|thyroid hormone binding|thyroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding				0	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Levothyroxine(DB00451)|Liothyronine(DB00279)	TTCTTTCGCCGCACAATCCAG	0.547																0.020513	-43.631227	6.55347	4	191	KEEP	---	---	---	---	2	2	102	122	-1	capture	Missense_Mutation	SNP	38240101	38240101	THRA	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15758	27
ASPSCR1	79058	broad.mit.edu	37	17	79953896	79953896	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79953896C>T	uc002kcx.2	+	6	558	c.461C>T	c.(460-462)ACG>ATG	p.T154M	ASPSCR1_uc002kcw.1_Missense_Mutation_p.T154M|ASPSCR1_uc002kcy.2_Missense_Mutation_p.T154M|ASPSCR1_uc002kcz.2_Missense_Mutation_p.T154M|ASPSCR1_uc002kda.2_Missense_Mutation_p.T77M|ASPSCR1_uc002kdb.1_Missense_Mutation_p.T77M	NM_024083	NP_076988	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region,	154							protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CTGCGGGGCACGACGCTGCAG	0.657					254	T	TFE3	alveolar soft part sarcoma								0.4	16.847298	16.978333	6	9	KEEP	---	---	---	---	5	1	4	6	-1	capture	Missense_Mutation	SNP	79953896	79953896	ASPSCR1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1050	27
MIB1	57534	broad.mit.edu	37	18	19345780	19345780	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19345780A>G	uc002ktq.2	+	2	277	c.277A>G	c.(277-279)ATC>GTC	p.I93V	MIB1_uc002ktp.2_5'UTR	NM_020774	NP_065825	Q86YT6	MIB1_HUMAN	mindbomb homolog 1	93	ZZ-type.				Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)			CCAGCAACCAATCATTGGCAT	0.378																0.410714	243.974147	245.135575	69	99	KEEP	---	---	---	---	46	43	71	61	-1	capture	Missense_Mutation	SNP	19345780	19345780	MIB1	18	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	9478	27
LMAN1	3998	broad.mit.edu	37	18	57022801	57022801	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:57022801C>A	uc002lhz.2	-	2	336	c.304G>T	c.(304-306)GAG>TAG	p.E102*	LMAN1_uc010xek.1_Nonsense_Mutation_p.E102*	NM_005570	NP_005561	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1 precursor	102	Lumenal (Potential).|L-type lectin-like.				blood coagulation|ER to Golgi vesicle-mediated transport|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	mannose binding|metal ion binding|unfolded protein binding			skin(1)	1		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	TCCCAGTTCTCAAAGGCCGCT	0.413																0.372781	178.974828	181.379978	63	106	KEEP	---	---	---	---	31	37	48	65	0.544117647059	capture	Nonsense_Mutation	SNP	57022801	57022801	LMAN1	18	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	8756	27
MUM1	84939	broad.mit.edu	37	19	1357015	1357015	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1357015C>T	uc010xgm.1	+	2	134	c.65C>T	c.(64-66)GCC>GTC	p.A22V	MUM1_uc010dsi.2_5'UTR|MUM1_uc002lrz.2_Missense_Mutation_p.A23V|MUM1_uc002lsb.2_5'UTR|MUM1_uc002lsc.1_5'Flank			Q2TAK8	MUM1_HUMAN	SubName: Full=MUM1 protein;	22					chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGGTTTTGGCCCGAACCGCG	0.353																0.028571	-27.721838	6.535214	4	136	KEEP	---	---	---	---	2	2	66	82	-1	capture	Missense_Mutation	SNP	1357015	1357015	MUM1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9895	27
TUBB4	10382	broad.mit.edu	37	19	6502176	6502176	+	Silent	SNP	G	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6502176G>T	uc002mfg.1	-	1	155	c.48C>A	c.(46-48)ATC>ATA	p.I16I	TUBB4_uc002mff.1_5'UTR	NM_006087	NP_006078	P04350	TBB4_HUMAN	tubulin, beta 4	16					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(2)	2		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)		CCTTGGCCCCGATCTGGTTGC	0.547																0.333333	8.622437	8.843624	3	6	KEEP	---	---	---	---	2	2	2	5	0.5	capture	Silent	SNP	6502176	6502176	TUBB4	19	G	T	T	T	1	0	0	0	0	0	0	0	1	473	37	4	4	16640	27
CD209	30835	broad.mit.edu	37	19	7807928	7807928	+	Silent	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7807928C>T	uc002mht.2	-	7	1279	c.1212G>A	c.(1210-1212)GCG>GCA	p.A404A	CD209_uc010xju.1_Silent_p.A243A|CD209_uc010dvp.2_3'UTR|CD209_uc002mhr.2_Silent_p.A380A|CD209_uc002mhs.2_Silent_p.A334A|CD209_uc002mhu.2_Silent_p.A312A|CD209_uc010dvq.2_Silent_p.A398A|CD209_uc002mhq.2_Silent_p.A404A|CD209_uc002mhv.2_Silent_p.A380A|CD209_uc002mhx.2_Silent_p.A360A|CD209_uc002mhw.2_Silent_p.A268A|CD209_uc010dvr.2_Silent_p.A168A	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	404	Extracellular (Probable).				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						AGTTCTGCTACGCAGGAGGGG	0.502																0.264085	189.504406	203.790331	75	209	KEEP	---	---	---	---	49	42	142	107	-1	capture	Silent	SNP	7807928	7807928	CD209	19	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	2955	27
CARM1	10498	broad.mit.edu	37	19	11022906	11022906	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11022906C>T	uc002mpz.2	+	5	731	c.605C>T	c.(604-606)GCC>GTC	p.A202V	CARM1_uc010dxn.2_RNA|CARM1_uc002mqa.2_5'UTR	NM_199141	NP_954592	Q86X55	CARM1_HUMAN	coactivator-associated arginine	202					cellular lipid metabolic process|histone H3-R2 methylation|interspecies interaction between organisms|pathogenesis|positive regulation of fat cell differentiation|regulation of estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleoplasm	beta-catenin binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-R17 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein-arginine omega-N asymmetric methyltransferase activity|transcription regulatory region DNA binding				0						TCGTTTTTTGCCGCCCAAGCT	0.622																0.010386	-177.237649	8.636515	7	667	KEEP	---	---	---	---	3	5	350	396	-1	capture	Missense_Mutation	SNP	11022906	11022906	CARM1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2631	27
AKAP8	10270	broad.mit.edu	37	19	15484143	15484143	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15484143C>T	uc002nav.2	-	5	441	c.380G>A	c.(379-381)CGC>CAC	p.R127H	AKAP8_uc010dzy.2_5'UTR|AKAP8_uc010dzz.1_RNA|AKAP8_uc010xog.1_5'UTR	NM_005858	NP_005849	O43823	AKAP8_HUMAN	A-kinase anchor protein 8	127					signal transduction	nuclear matrix				ovary(1)|breast(1)	2						CGGCTGGAAGCGGAAGGAGCT	0.607	GBM(190;1671 2163 3274 27186 30476)															0.236842	22.158324	24.561718	9	29	KEEP	---	---	---	---	4	5	14	19	-1	capture	Missense_Mutation	SNP	15484143	15484143	AKAP8	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	457	27
OR10H4	126541	broad.mit.edu	37	19	16060302	16060302	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16060302C>T	uc010xov.1	+	1	485	c.485C>T	c.(484-486)ACG>ATG	p.T162M		NM_001004465	NP_001004465	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H,	162	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.T162T(1)		ovary(1)|breast(1)	2						ATGGTGACAACGATAGTTTTC	0.502																0.263889	280.484736	302.244275	114	318	KEEP	---	---	---	---	61	57	151	181	-1	capture	Missense_Mutation	SNP	16060302	16060302	OR10H4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10812	27
RCN3	57333	broad.mit.edu	37	19	50042431	50042431	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50042431A>G	uc002poj.2	+	5	1121	c.674A>G	c.(673-675)TAC>TGC	p.Y225C		NM_020650	NP_065701	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain	225	EF-hand 4.					endoplasmic reticulum lumen	calcium ion binding|protein binding			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		GTGGAGGAGTACATCGGTGAG	0.587																0.068376	-0.36941	22.147663	8	109	KEEP	---	---	---	---	3	5	56	64	-1	capture	Missense_Mutation	SNP	50042431	50042431	RCN3	19	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	13076	27
SIGLEC11	114132	broad.mit.edu	37	19	50453362	50453362	+	Silent	SNP	G	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50453362G>T	uc010ybh.1	-	11	2053	c.1962C>A	c.(1960-1962)CTC>CTA	p.L654L	SIGLEC11_uc010ybi.1_Silent_p.L558L	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1	654	Cytoplasmic (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		CAGGCTCCCAGAGCCTCAGGC	0.662																0.274725	59.227973	63.392973	25	66	KEEP	---	---	---	---	17	20	36	48	0.459459459459	capture	Silent	SNP	50453362	50453362	SIGLEC11	19	G	T	T	T	1	0	0	0	0	0	0	0	1	418	33	4	4	14200	27
CAPN13	92291	broad.mit.edu	37	2	30966369	30966369	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:30966369C>T	uc002rnn.2	-	12	1501	c.1325G>A	c.(1324-1326)CGC>CAC	p.R442H	CAPN13_uc002rnm.2_RNA|CAPN13_uc002rno.2_5'UTR	NM_144575	NP_653176	Q6MZZ7	CAN13_HUMAN	calpain 13	442					proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			large_intestine(1)|ovary(1)	2	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					GAAGTTGCGGCGGAATTTATT	0.463																0.401929	373.180894	375.742874	125	186	KEEP	---	---	---	---	60	68	94	103	-1	capture	Missense_Mutation	SNP	30966369	30966369	CAPN13	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2602	27
LHCGR	3973	broad.mit.edu	37	2	48915170	48915170	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:48915170G>A	uc002rwu.3	-	11	1836	c.1766C>T	c.(1765-1767)GCC>GTC	p.A589V	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	589	Helical; Name=6; (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	AGCTGAGATGGCAAAAAAAGA	0.383												Familial_Male-Limited_Precocious_Puberty				0.022989	-37.253588	6.849316	4	170	KEEP	---	---	---	---	0	4	72	111	-1	capture	Missense_Mutation	SNP	48915170	48915170	LHCGR	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	8682	27
DYSF	8291	broad.mit.edu	37	2	71871111	71871111	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71871111A>C	uc002sie.2	+	41	4803	c.4427A>C	c.(4426-4428)GAT>GCT	p.D1476A	DYSF_uc010feg.2_Missense_Mutation_p.D1507A|DYSF_uc010feh.2_Missense_Mutation_p.D1483A|DYSF_uc002sig.3_Missense_Mutation_p.D1462A|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.D1497A|DYSF_uc010fef.2_Missense_Mutation_p.D1514A|DYSF_uc010fei.2_Missense_Mutation_p.D1493A|DYSF_uc010fek.2_Missense_Mutation_p.D1494A|DYSF_uc010fej.2_Missense_Mutation_p.D1484A|DYSF_uc010fel.2_Missense_Mutation_p.D1463A|DYSF_uc010feo.2_Missense_Mutation_p.D1508A|DYSF_uc010fem.2_Missense_Mutation_p.D1498A|DYSF_uc010fen.2_Missense_Mutation_p.D1515A|DYSF_uc002sif.2_Missense_Mutation_p.D1477A|DYSF_uc010yqy.1_Missense_Mutation_p.D357A|DYSF_uc010yqz.1_Missense_Mutation_p.D237A	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1476	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						GAGTTCATCGATTGGTGGAGC	0.502																0.352941	39.792721	40.439863	12	22	KEEP	---	---	---	---	12	1	14	10	-1	capture	Missense_Mutation	SNP	71871111	71871111	DYSF	2	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	4814	27
SCN9A	6335	broad.mit.edu	37	2	167085353	167085353	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167085353T>A	uc010fpl.2	-	22	4362	c.4021A>T	c.(4021-4023)AAC>TAC	p.N1341Y	uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1352	III.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	TCTGTGGTGTTAATACACTCA	0.403																0.356989	474.023102	482.398607	166	299	KEEP	---	---	---	---	73	119	168	168	-1	capture	Missense_Mutation	SNP	167085353	167085353	SCN9A	2	T	A	A	A	1	0	0	0	0	1	0	0	0	793	61	4	4	13818	27
TTN	7273	broad.mit.edu	37	2	179437058	179437058	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179437058T>C	uc010zfg.1	-	275	66321	c.66097A>G	c.(66097-66099)ATT>GTT	p.I22033V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.I15728V|TTN_uc010zfi.1_Missense_Mutation_p.I15661V|TTN_uc010zfj.1_Missense_Mutation_p.I15536V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22960							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCAGCCCAATGCCATATTCA	0.448					8722											0.395833	115.531598	116.442525	38	58	KEEP	---	---	---	---	20	21	38	26	-1	capture	Missense_Mutation	SNP	179437058	179437058	TTN	2	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	16617	27
RBL1	5933	broad.mit.edu	37	20	35663716	35663716	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35663716T>A	uc002xgi.2	-	15	2178	c.2099A>T	c.(2098-2100)CAA>CTA	p.Q700L	RBL1_uc010zvt.1_RNA|RBL1_uc002xgj.1_Missense_Mutation_p.Q700L	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a	700	Pocket; binds T and E1A.|Spacer.				cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				TAGAAGAGTTTGACCAGGTAA	0.363					419											0.339367	215.546875	220.593356	75	146	KEEP	---	---	---	---	41	38	83	74	-1	capture	Missense_Mutation	SNP	35663716	35663716	RBL1	20	T	A	A	A	1	0	0	0	0	1	0	0	0	819	63	4	4	13004	27
DSCAM	1826	broad.mit.edu	37	21	41514514	41514514	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:41514514A>T	uc002yyq.1	-	18	3829	c.3377T>A	c.(3376-3378)GTC>GAC	p.V1126D	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1126	Extracellular (Potential).|Fibronectin type-III 3.				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCAGTAAATGACTCTGAACCC	0.468	Melanoma(134;970 1778 1785 21664 32388)															0.28125	136.038416	144.319855	54	138	KEEP	---	---	---	---	21	37	66	82	-1	capture	Missense_Mutation	SNP	41514514	41514514	DSCAM	21	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	4723	27
PRDM15	63977	broad.mit.edu	37	21	43230603	43230603	+	Silent	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43230603G>A	uc002yzq.1	-	28	3768	c.3657C>T	c.(3655-3657)CAC>CAT	p.H1219H	PRDM15_uc002yzo.2_Silent_p.H890H|PRDM15_uc002yzp.2_Silent_p.H910H|PRDM15_uc002yzr.1_Silent_p.H910H	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	1219	C2H2-type 15.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCACCTTGTCGTGTGTGAGCT	0.612																0.25	19.692558	21.505404	8	24	KEEP	---	---	---	---	5	5	9	15	-1	capture	Silent	SNP	43230603	43230603	PRDM15	21	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12352	27
IL2RB	3560	broad.mit.edu	37	22	37524874	37524874	+	Silent	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37524874C>T	uc003aqv.1	-	10	1049	c.918G>A	c.(916-918)TCG>TCA	p.S306S		NM_000878	NP_000869	P14784	IL2RB_HUMAN	interleukin 2 receptor beta precursor	306	Cytoplasmic (Potential).				interspecies interaction between organisms|positive regulation of survival gene product expression|protein complex assembly	external side of plasma membrane|integral to plasma membrane	interleukin-2 receptor activity				0					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	AGGGGAAGGGCGAAGAGAGCC	0.607																0.461538	90.045017	90.128429	30	35	KEEP	---	---	---	---	15	18	26	18	-1	capture	Silent	SNP	37524874	37524874	IL2RB	22	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7610	27
STAB1	23166	broad.mit.edu	37	3	52554842	52554842	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52554842G>A	uc003dej.2	+	55	5803	c.5729G>A	c.(5728-5730)CGC>CAC	p.R1910H	STAB1_uc003dek.1_5'UTR|STAB1_uc003del.2_5'Flank	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	1910	Extracellular (Potential).				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GCCTGCTGGCGCTTCTACCCG	0.662																0.05985	-34.075599	47.13752	24	377	KEEP	---	---	---	---	9	22	222	241	-1	capture	Missense_Mutation	SNP	52554842	52554842	STAB1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15127	27
PROS1	5627	broad.mit.edu	37	3	93603713	93603713	+	Nonsense_Mutation	SNP	G	A	A	rs5017717		TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:93603713G>A	uc003drb.3	-	12	1692	c.1351C>T	c.(1351-1353)CGA>TGA	p.R451*	PROS1_uc010hoo.2_Nonsense_Mutation_p.R320*|PROS1_uc003dqz.3_Nonsense_Mutation_p.R320*	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein	451	Laminin G-like 1.				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)	TTCCAGCTTCGTATACATCCA	0.358																0.054348	-8.904975	10.355978	5	87	KEEP	---	---	---	---	2	4	47	46	-1	capture	Nonsense_Mutation	SNP	93603713	93603713	PROS1	3	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	12454	27
ZIC1	7545	broad.mit.edu	37	3	147130368	147130368	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:147130368G>A	uc003ewe.2	+	2	1765	c.1046G>A	c.(1045-1047)CGC>CAC	p.R349H		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	349	C2H2-type 4.				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						AGCAGCGACCGCAAGAAGCAC	0.542																0.245283	62.433314	68.673723	26	80	KEEP	---	---	---	---	18	12	51	40	-1	capture	Missense_Mutation	SNP	147130368	147130368	ZIC1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17558	27
SULT1B1	27284	broad.mit.edu	37	4	70596339	70596339	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70596339T>G	uc003hen.2	-	7	956	c.658A>C	c.(658-660)ATC>CTC	p.I220L		NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member	220	PAPS (By similarity).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						CTATCCAAGATCTCATCATTC	0.363																0.354167	114.326542	116.124355	34	62	KEEP	---	---	---	---	24	12	39	29	-1	capture	Missense_Mutation	SNP	70596339	70596339	SULT1B1	4	T	G	G	G	1	0	0	0	0	1	0	0	0	650	50	4	4	15264	27
BMP3	651	broad.mit.edu	37	4	81967402	81967402	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:81967402A>G	uc003hmg.3	+	2	1147	c.827A>G	c.(826-828)CAC>CGC	p.H276R		NM_001201	NP_001192	P12645	BMP3_HUMAN	bone morphogenetic protein 3 preproprotein	276					cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(4)|central_nervous_system(1)	5						TGGGATAGCCACATCAGAGCT	0.517																0.294118	114.24997	119.406939	40	96	KEEP	---	---	---	---	23	22	49	56	-1	capture	Missense_Mutation	SNP	81967402	81967402	BMP3	4	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	1449	27
QRFPR	84109	broad.mit.edu	37	4	122254151	122254151	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:122254151G>A	uc010inj.1	-	4	1001	c.622C>T	c.(622-624)CCT>TCT	p.P208S	QRFPR_uc010ink.1_RNA|QRFPR_uc003ids.2_Missense_Mutation_p.P208S	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103	208	Extracellular (Potential).					plasma membrane	neuropeptide Y receptor activity				0						TGGTGCACAGGGCTGGTCCAC	0.388																0.381818	197.392469	199.411255	63	102	KEEP	---	---	---	---	34	35	63	54	-1	capture	Missense_Mutation	SNP	122254151	122254151	QRFPR	4	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	12773	27
CARD6	84674	broad.mit.edu	37	5	40853779	40853779	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:40853779G>A	uc003jmg.2	+	3	2420	c.2345G>A	c.(2344-2346)AGT>AAT	p.S782N		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	782					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						CGAGGTAAAAGTTTTGGTATT	0.488																0.370044	485.502649	492.268987	168	286	KEEP	---	---	---	---	92	83	156	138	-1	capture	Missense_Mutation	SNP	40853779	40853779	CARD6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	2626	27
ADAMTS6	11174	broad.mit.edu	37	5	64766854	64766854	+	Silent	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:64766854C>T	uc003jtp.2	-	3	1027	c.213G>A	c.(211-213)CGG>CGA	p.R71R	ADAMTS6_uc003jto.2_RNA|ADAMTS6_uc003jtq.2_RNA|ADAMTS6_uc003jtr.1_5'UTR	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1	71					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		GGTCCATACTCCGTCTTCTCC	0.383																0.323232	182.482164	187.948524	64	134	KEEP	---	---	---	---	37	38	59	86	-1	capture	Silent	SNP	64766854	64766854	ADAMTS6	5	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	270	27
MAP1B	4131	broad.mit.edu	37	5	71494069	71494069	+	Silent	SNP	A	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:71494069A>G	uc003kbw.3	+	5	5128	c.4887A>G	c.(4885-4887)GCA>GCG	p.A1629A	MAP1B_uc010iyw.1_Silent_p.A1646A|MAP1B_uc010iyx.1_Silent_p.A1503A|MAP1B_uc010iyy.1_Silent_p.A1503A	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1629						microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CTAAAACTGCAAAGTCCAGGA	0.438	Melanoma(17;367 822 11631 31730 47712)															0.259259	155.907121	167.240759	56	160	KEEP	---	---	---	---	29	31	83	88	-1	capture	Silent	SNP	71494069	71494069	MAP1B	5	A	G	G	G	1	0	0	0	0	0	0	0	1	54	5	3	3	9142	27
SGCD	6444	broad.mit.edu	37	5	155935645	155935645	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:155935645G>T	uc003lwd.3	+	3	700	c.224G>T	c.(223-225)GGT>GTT	p.G75V	SGCD_uc003lwa.1_Missense_Mutation_p.G76V|SGCD_uc003lwb.2_Missense_Mutation_p.G76V|SGCD_uc003lwc.3_Missense_Mutation_p.G76V	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3	75	Extracellular (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACAGAAAAAGGTCTAAAGCTA	0.418																0.396552	67.910897	68.454637	23	35	KEEP	---	---	---	---	13	11	18	20	0.541666666667	capture	Missense_Mutation	SNP	155935645	155935645	SGCD	5	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	14094	27
FLT4	2324	broad.mit.edu	37	5	180048669	180048669	+	Silent	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180048669C>T	uc003mma.3	-	13	1972	c.1893G>A	c.(1891-1893)GCG>GCA	p.A631A	FLT4_uc003mlz.3_Silent_p.A631A|FLT4_uc003mmb.1_Silent_p.A164A|FLT4_uc011dgy.1_Silent_p.A631A	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	631	Ig-like C2-type 6.|Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	TGGCGTGGCGCGCCCCAGGTG	0.672	Colon(97;1075 1466 27033 27547 35871)				2638							Congenital_Hereditary_Lymphedema				0.378378	37.908371	38.363088	14	23	KEEP	---	---	---	---	12	7	15	16	-1	capture	Silent	SNP	180048669	180048669	FLT4	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	5888	27
ITPR3	3710	broad.mit.edu	37	6	33653882	33653882	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33653882C>T	uc011drk.1	+	42	5939	c.5720C>T	c.(5719-5721)ACG>ATG	p.T1907M	ITPR3_uc003oey.2_Translation_Start_Site	NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	1907	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						GTATGCGAGACGCTGCAGTTC	0.592																0.328947	65.736617	67.714545	25	51	KEEP	---	---	---	---	13	12	29	26	-1	capture	Missense_Mutation	SNP	33653882	33653882	ITPR3	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7845	27
GLP1R	2740	broad.mit.edu	37	6	39024212	39024212	+	Nonsense_Mutation	SNP	C	T	T	rs141990898		TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:39024212C>T	uc003ooj.3	+	2	178	c.118C>T	c.(118-120)CGA>TGA	p.R40*	GLP1R_uc003ooh.2_RNA|GLP1R_uc003ooi.2_RNA	NM_002062	NP_002053	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor precursor	40	Extracellular (Potential).				activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled			lung(3)|breast(1)|pancreas(1)	5					Exenatide(DB01276)|Glucagon recombinant(DB00040)	GCAGAAATGGCGAGAATACCG	0.632																0.306452	50.600745	52.672487	19	43	KEEP	---	---	---	---	16	8	15	32	-1	capture	Nonsense_Mutation	SNP	39024212	39024212	GLP1R	6	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	6388	27
DST	667	broad.mit.edu	37	6	56505355	56505355	+	Silent	SNP	A	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56505355A>G	uc003pdf.2	-	17	2005	c.1977T>C	c.(1975-1977)TCT>TCC	p.S659S	DST_uc003pcz.3_Silent_p.S481S|DST_uc011dxj.1_Silent_p.S510S|DST_uc011dxk.1_Silent_p.S521S|DST_uc011dxl.1_Silent_p.S510S|DST_uc003pcy.3_Silent_p.S155S|DST_uc003pdb.2_Silent_p.S155S|DST_uc003pdc.3_Silent_p.S155S|DST_uc003pdd.3_Silent_p.S155S|DST_uc003pde.2_Silent_p.S597S	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	481					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGTACACAGAAGAACATTCGT	0.388					2498											0.333333	225.135096	230.152074	68	136	KEEP	---	---	---	---	32	43	71	79	-1	capture	Silent	SNP	56505355	56505355	DST	6	A	G	G	G	1	0	0	0	0	0	0	0	1	28	3	3	3	4738	27
HSF2	3298	broad.mit.edu	37	6	122744040	122744040	+	Silent	SNP	C	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:122744040C>A	uc003pyu.2	+	9	1195	c.1008C>A	c.(1006-1008)ACC>ACA	p.T336T	HSF2_uc003pyv.2_Silent_p.T336T	NM_004506	NP_004497	Q03933	HSF2_HUMAN	heat shock transcription factor 2 isoform a	336					response to stress|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		CCAGTCTGACCTCAGAAGATC	0.433																0.381579	165.807265	167.67905	58	94	KEEP	---	---	---	---	28	32	40	58	0.533333333333	capture	Silent	SNP	122744040	122744040	HSF2	6	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	7321	27
QKI	9444	broad.mit.edu	37	6	163899861	163899861	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:163899861A>C	uc003qui.2	+	3	886	c.335A>C	c.(334-336)CAA>CCA	p.Q112P	QKI_uc003que.2_Missense_Mutation_p.Q112P|QKI_uc003quf.2_Missense_Mutation_p.Q112P|QKI_uc003qug.2_Missense_Mutation_p.Q112P|QKI_uc003quh.2_Missense_Mutation_p.Q112P|QKI_uc003quj.2_Missense_Mutation_p.Q112P	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform	112	KH.				mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		ACAGCCAAACAACTTGAAGCA	0.368																0.412214	194.135258	195.014797	54	77	KEEP	---	---	---	---	29	31	36	49	-1	capture	Missense_Mutation	SNP	163899861	163899861	QKI	6	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	12768	27
EGFR	1956	broad.mit.edu	37	7	55223543	55223543	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55223543C>T	uc003tqk.2	+	8	1156	c.910C>T	c.(910-912)CAC>TAC	p.H304Y	EGFR_uc003tqh.2_Missense_Mutation_p.H304Y|EGFR_uc003tqi.2_Missense_Mutation_p.H304Y|EGFR_uc003tqj.2_Missense_Mutation_p.H304Y|EGFR_uc010kzg.1_Missense_Mutation_p.H259Y|EGFR_uc011kco.1_Missense_Mutation_p.H251Y|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	304	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GGTGACAGATCACGGCTCGTG	0.592			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.23219	187.432163	212.320632	88	291	KEEP	---	---	---	---	66	53	174	208	-1	capture	Missense_Mutation	SNP	55223543	55223543	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	4922	27
TPST1	8460	broad.mit.edu	37	7	65751542	65751542	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:65751542G>A	uc003tuw.2	+	3	1242	c.890G>A	c.(889-891)GGA>GAA	p.G297E	TPST1_uc010kzy.2_RNA|TPST1_uc010kzz.2_Missense_Mutation_p.G297E|TPST1_uc010laa.2_Missense_Mutation_p.G297E	NM_003596	NP_003587	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	297	Lumenal (Potential).				inflammatory response|peptidyl-tyrosine sulfation	Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity				0						GTCAATGTAGGAGCTCTATCA	0.368																0.25974	105.126435	113.178207	40	114	KEEP	---	---	---	---	22	26	65	70	-1	capture	Missense_Mutation	SNP	65751542	65751542	TPST1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	16310	27
SRPK2	6733	broad.mit.edu	37	7	104782641	104782641	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:104782641G>A	uc003vct.2	-	10	1511	c.1324C>T	c.(1324-1326)CGA>TGA	p.R442*	SRPK2_uc003vcu.2_Nonsense_Mutation_p.R442*|SRPK2_uc003vcv.2_Nonsense_Mutation_p.R453*|SRPK2_uc003vcw.1_Nonsense_Mutation_p.R442*	NM_182691	NP_872633	P78362	SRPK2_HUMAN	serine/arginine-rich protein-specific kinase 2	442	Protein kinase.				angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6						ATTTTATGTCGTCCATTTGGC	0.448					326											0.29	307.015835	322.77892	116	284	KEEP	---	---	---	---	56	66	149	159	-1	capture	Nonsense_Mutation	SNP	104782641	104782641	SRPK2	7	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	15052	27
GPR37	2861	broad.mit.edu	37	7	124404927	124404927	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:124404927C>G	uc003vli.2	-	1	755	c.104G>C	c.(103-105)AGA>ACA	p.R35T		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	35	Extracellular (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						AGTTTCGTTTCTGGACGCAGG	0.647																0.270833	37.753174	40.027046	13	35	KEEP	---	---	---	---	5	8	17	21	-1	capture	Missense_Mutation	SNP	124404927	124404927	GPR37	7	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	6625	27
FGL1	2267	broad.mit.edu	37	8	17726189	17726189	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:17726189G>A	uc003wxx.2	-	8	971	c.647C>T	c.(646-648)GCG>GTG	p.A216V	FGL1_uc003wxy.2_Missense_Mutation_p.A216V|FGL1_uc003wxz.2_Missense_Mutation_p.A215V|FGL1_uc003wya.2_Missense_Mutation_p.A216V|FGL1_uc003wyb.2_Missense_Mutation_p.A216V|FGL1_uc003wyc.2_Missense_Mutation_p.A216V|FGL1_uc003wyd.2_RNA|FGL1_uc003wye.2_Missense_Mutation_p.A266V|FGL1_uc003wyf.2_Missense_Mutation_p.A186V	NM_201553	NP_963847	Q08830	FGL1_HUMAN	fibrinogen-like 1 precursor	216	Fibrinogen C-terminal.				signal transduction	fibrinogen complex	receptor binding				0				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		AAAATTCCCCGCAAGGGAATC	0.453																0.066351	-11.703366	29.42859	14	197	KEEP	---	---	---	---	6	9	96	120	-1	capture	Missense_Mutation	SNP	17726189	17726189	FGL1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5818	27
DOCK5	80005	broad.mit.edu	37	8	25222153	25222153	+	Missense_Mutation	SNP	G	A	A	rs148483229	byFrequency;by1000genomes	TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25222153G>A	uc003xeg.2	+	30	3193	c.3056G>A	c.(3055-3057)CGT>CAT	p.R1019H	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.R733H|DOCK5_uc003xei.2_Missense_Mutation_p.R589H|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1019						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GTTTTTCTCCGTGCTATAAAT	0.413	Pancreas(145;34 1887 3271 10937 30165)															0.357143	28.438416	28.943244	10	18	KEEP	---	---	---	---	7	6	11	9	-1	capture	Missense_Mutation	SNP	25222153	25222153	DOCK5	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4646	27
PCMTD1	115294	broad.mit.edu	37	8	52733157	52733157	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:52733157C>A	uc003xqx.3	-	6	1169	c.828G>T	c.(826-828)AGG>AGT	p.R276S	PCMTD1_uc011ldm.1_Missense_Mutation_p.R146S|PCMTD1_uc003xqw.3_Missense_Mutation_p.R276S|PCMTD1_uc011ldn.1_Missense_Mutation_p.R88S|PCMTD1_uc010lya.2_Missense_Mutation_p.R200S	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	276						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TCTTTCTTTTCCTTTTGGGTG	0.368																0.044248	-49.362353	26.019151	15	324	KEEP	---	---	---	---	9	12	225	291	0.571428571429	capture	Missense_Mutation	SNP	52733157	52733157	PCMTD1	8	C	A	A	A	1	0	0	0	0	1	0	0	0	389	30	4	4	11489	27
STK3	6788	broad.mit.edu	37	8	99718703	99718703	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:99718703G>C	uc003yip.2	-	6	817	c.676C>G	c.(676-678)CCA>GCA	p.P226A	STK3_uc003yio.2_Missense_Mutation_p.P254A|STK3_uc010mbm.1_Intron	NM_006281	NP_006272	Q13188	STK3_HUMAN	serine/threonine kinase 3	226	Protein kinase.				apoptosis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of apoptosis	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein dimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		ACCCTCATTGGATGTATATCA	0.348					180											0.396396	151.879611	152.921556	44	67	KEEP	---	---	---	---	27	21	38	30	-1	capture	Missense_Mutation	SNP	99718703	99718703	STK3	8	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	15185	27
ATAD2	29028	broad.mit.edu	37	8	124358469	124358469	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124358469T>C	uc003yqh.3	-	18	2497	c.2389A>G	c.(2389-2391)ATA>GTA	p.I797V	ATAD2_uc011lii.1_Missense_Mutation_p.I588V|ATAD2_uc003yqi.3_RNA|ATAD2_uc003yqj.2_Missense_Mutation_p.I797V	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	797					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TCTCCTACTATCAATATTCTT	0.353																0.392857	225.718795	227.405742	66	102	KEEP	---	---	---	---	31	46	50	64	-1	capture	Missense_Mutation	SNP	124358469	124358469	ATAD2	8	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	1062	27
SPATC1	375686	broad.mit.edu	37	8	145095497	145095497	+	Silent	SNP	G	A	A			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145095497G>A	uc011lkw.1	+	3	897	c.795G>A	c.(793-795)TCG>TCA	p.S265S	SPATC1_uc011lkx.1_Silent_p.S265S	NM_198572	NP_940974	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	265										ovary(1)|central_nervous_system(1)	2	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCCCCAGTCGACCCAGGACC	0.617																0.385965	193.313776	195.261393	66	105	KEEP	---	---	---	---	30	49	53	77	-1	capture	Silent	SNP	145095497	145095497	SPATC1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	14909	27
KDM6A	7403	broad.mit.edu	37	X	44922695	44922695	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:44922695G>C	uc004dge.3	+	16	1931	c.1556G>C	c.(1555-1557)CGA>CCA	p.R519P	KDM6A_uc010nhk.2_Missense_Mutation_p.R485P|KDM6A_uc011mkz.1_Missense_Mutation_p.R571P|KDM6A_uc011mla.1_Missense_Mutation_p.R474P|KDM6A_uc011mlb.1_Missense_Mutation_p.R526P|KDM6A_uc011mlc.1_Missense_Mutation_p.R223P|KDM6A_uc011mld.1_Missense_Mutation_p.R158P	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	519					histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						GCACAGGTACGATCTACTGGA	0.463	Colon(129;1273 1667 15230 27352 52914)				372	D|N|F|S		renal|oesophageal SCC|MM								0.045455	-9.668964	9.744411	4	84	KEEP	---	---	---	---	0	5	34	57	-1	capture	Missense_Mutation	SNP	44922695	44922695	KDM6A	23	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	8059	27
DCAF12L2	340578	broad.mit.edu	37	X	125299171	125299171	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125299171C>T	uc004euk.1	-	1	764	c.737G>A	c.(736-738)CGT>CAT	p.R246H		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	246										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						ATCCCTCGGACGGATGTGGGC	0.647																0.666667	81.456124	82.415076	26	13	KEEP	---	---	---	---	12	17	9	5	-1	capture	Missense_Mutation	SNP	125299171	125299171	DCAF12L2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4224	27
SLITRK4	139065	broad.mit.edu	37	X	142718314	142718314	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142718314C>T	uc004fbx.2	-	2	987	c.611G>A	c.(610-612)CGT>CAT	p.R204H	SLITRK4_uc004fby.2_Missense_Mutation_p.R204H	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	204	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TTCAACGACACGGCCAATGTG	0.428																0.584906	292.68264	293.680912	93	66	KEEP	---	---	---	---	46	54	40	36	-1	capture	Missense_Mutation	SNP	142718314	142718314	SLITRK4	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14637	27
SPANXN2	494119	broad.mit.edu	37	X	142795437	142795437	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142795437C>T	uc004fbz.2	-	2	995	c.241G>A	c.(241-243)GTC>ATC	p.V81I		NM_001009615	NP_001009615	Q5MJ10	SPXN2_HUMAN	SPANX-N2 protein	81										ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTCTTGGACGGGATTGATG	0.453																0.792244	957.211267	985.7668	286	75	KEEP	---	---	---	---	166	159	33	51	-1	capture	Missense_Mutation	SNP	142795437	142795437	SPANXN2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14883	27
HNRNPU	3192	broad.mit.edu	37	1	245022048	245022050	+	In_Frame_Del	DEL	CAT	-	-			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:245022048_245022050delCAT	uc001iaz.1	-	6	1429_1431	c.1211_1213delATG	c.(1210-1215)GATGTG>GTG	p.D404del	HNRNPU_uc001iaw.1_5'Flank|HNRNPU_uc001iax.1_RNA|HNRNPU_uc001iay.1_In_Frame_Del_p.D128del|HNRNPU_uc001iba.1_In_Frame_Del_p.D385del|HNRNPU_uc001ibb.1_In_Frame_Del_p.D92del	NM_031844	NP_114032	Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U	404	B30.2/SPRY.				CRD-mediated mRNA stabilization	catalytic step 2 spliceosome|cell surface|CRD-mediated mRNA stability complex|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	ATP binding|DNA binding|protein binding|RNA binding				0	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			CATGTAATCACATCATTTTCATC	0.310	NSCLC(33;911 1010 3329 23631 49995)															0.26			29	82		---	---	---	---						capture_indel	In_Frame_Del	DEL	245022048	245022050	HNRNPU	1	CAT	-	-	-	1	0	1	0	1	0	0	0	0	221	17	5	5	7198	27
PCDHGC3	5098	broad.mit.edu	37	5	140857767	140857770	+	Frame_Shift_Del	DEL	TTCT	-	-			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140857767_140857770delTTCT	uc003lkv.1	+	1	2199_2202	c.2084_2087delTTCT	c.(2083-2088)CTTCTTfs	p.L695fs	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lku.1_Frame_Shift_Del_p.L695fs|PCDHGC3_uc003lkw.1_Intron	NM_002588	NP_002579	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3 isoform 1	695_696	Helical; (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTTATCTACTTCTTTCTCTAATC	0.490														OREG0016865	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.34			268	511		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	140857767	140857770	PCDHGC3	5	TTCT	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	11472	27
HNRNPA2B1	3181	broad.mit.edu	37	7	26236176	26236178	+	Splice_Site	DEL	CCT	-	-			TCGA-06-0155-01	TCGA-06-0155-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:26236176_26236178delCCT	uc003sxr.3	-	6	829	c.613_splice	c.e6+1	p.G205_splice	HNRNPA2B1_uc003sxs.3_Splice_Site_p.G193_splice	NM_031243	NP_112533	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1						RNA transport	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|protein binding|RNA binding|single-stranded telomeric DNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3						ATTAAAATTACCTCCTCTTCCAC	0.379					717	T	ETV1	prostate								0.23			138	466		---	---	---	---						capture_indel	Splice_Site	DEL	26236176	26236178	HNRNPA2B1	7	CCT	-	-	-	1	0	1	0	1	0	0	1	0	234	18	5	5	7184	27
