Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TNFRSF25	8718	broad.mit.edu	37	1	6522120	6522120	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6522120C>A	uc001ane.2	-	9	947	c.859G>T	c.(859-861)GAG>TAG	p.E287*	TNFRSF25_uc001ana.2_Nonsense_Mutation_p.E104*|TNFRSF25_uc001anb.2_RNA|TNFRSF25_uc001anc.2_RNA|TNFRSF25_uc001and.2_Nonsense_Mutation_p.E60*|TNFRSF25_uc009vlz.2_RNA|TNFRSF25_uc001anf.2_Nonsense_Mutation_p.E250*|TNFRSF25_uc001ang.2_Nonsense_Mutation_p.E242*|TNFRSF25_uc001anh.2_Nonsense_Mutation_p.E296*	NM_003790	NP_003781	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily,	287	Cytoplasmic (Potential).				apoptosis|induction of apoptosis by extracellular signals	cytosol|extracellular region|integral to plasma membrane	tumor necrosis factor receptor activity			central_nervous_system(2)|breast(1)	3	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		TCCTGGGTCTCGGGGTAGCCA	0.627																0.032258	-23.313801	6.370327	4	120	KEEP	---	---	---	---	3	2	74	63	0.4	capture	Nonsense_Mutation	SNP	6522120	6522120	TNFRSF25	1	C	A	A	A	1	0	0	0	0	0	1	0	0	403	31	5	4	16179	31
LPHN2	23266	broad.mit.edu	37	1	82456163	82456163	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:82456163G>C	uc001dit.3	+	21	3727	c.3546G>C	c.(3544-3546)AAG>AAC	p.K1182N	LPHN2_uc001dis.2_Missense_Mutation_p.K162N|LPHN2_uc001diu.2_Missense_Mutation_p.K1182N|LPHN2_uc001div.2_3'UTR|LPHN2_uc009wcd.2_3'UTR|LPHN2_uc001diw.2_Missense_Mutation_p.K809N	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	1238	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		CGCTGCACAAGGGTGACTATA	0.413																0.170213	66.288191	85.626806	32	156	KEEP	---	---	---	---	11	26	78	87	-1	capture	Missense_Mutation	SNP	82456163	82456163	LPHN2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	8832	31
PEX19	5824	broad.mit.edu	37	1	160254853	160254853	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160254853A>G	uc001fvs.2	-	1	89	c.62T>C	c.(61-63)CTT>CCT	p.L21P	DCAF8_uc010pjc.1_5'UTR|PEX19_uc010pje.1_RNA|PEX19_uc001fvt.2_5'UTR	NM_002857	NP_002848	P40855	PEX19_HUMAN	peroxisomal biogenesis factor 19 isoform a	21	Necessary for PEX19 function on peroxisome biogenesis.|Docking to the peroxisome membrane and binding to PEX3.				peroxisome membrane biogenesis|peroxisome organization|protein targeting to peroxisome|transmembrane transport	brush border membrane|cytosol|integral to membrane|nucleus|peroxisomal membrane	protein binding|protein N-terminus binding				0	all_cancers(52;1.27e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACTTTCCAGAAGCTCCTCCAA	0.597																0.141667	36.108053	50.955201	17	103	KEEP	---	---	---	---	13	12	64	48	-1	capture	Missense_Mutation	SNP	160254853	160254853	PEX19	1	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	11647	31
ARID4B	51742	broad.mit.edu	37	1	235345301	235345301	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235345301C>T	uc001hwq.2	-	20	3431	c.2933G>A	c.(2932-2934)TGT>TAT	p.C978Y	ARID4B_uc001hwr.2_Missense_Mutation_p.C892Y|ARID4B_uc001hws.3_Missense_Mutation_p.C892Y|ARID4B_uc001hwp.2_RNA|ARID4B_uc001hwt.3_Missense_Mutation_p.C659Y	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	978					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			ACTGGGTGAACAACTCTCCTC	0.493																0.019802	-70.396271	8.014432	6	297	KEEP	---	---	---	---	3	3	165	164	-1	capture	Missense_Mutation	SNP	235345301	235345301	ARID4B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	913	31
OR6F1	343169	broad.mit.edu	37	1	247875180	247875180	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247875180C>T	uc001idj.1	-	1	878	c.878G>A	c.(877-879)CGT>CAT	p.R293H		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	293	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TTCCTTATTACGAAGCGTATA	0.438																0.020661	-53.748508	8.527865	5	237	KEEP	---	---	---	---	2	5	143	140	-1	capture	Missense_Mutation	SNP	247875180	247875180	OR6F1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11105	31
BMI1	648	broad.mit.edu	37	10	22615862	22615862	+	Nonsense_Mutation	SNP	T	G	G			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:22615862T>G	uc001irh.2	+	3	795	c.156T>G	c.(154-156)TAT>TAG	p.Y52*	BMI1_uc009xkg.2_Nonsense_Mutation_p.Y195*	NM_005180	NP_005171	P35226	BMI1_HUMAN	BMI1 polycomb ring finger oncogene	52	RING-type.				hemopoiesis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fibroblast proliferation|positive regulation of ubiquitin-protein ligase activity|segment specification|transcription, DNA-dependent	cytoplasm|nucleolus|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding			ovary(1)|skin(1)	2						CCAGCAAGTATTGTCCTATTT	0.343					116											0.025974	-44.254163	13.188919	6	225	KEEP	---	---	---	---	2	5	129	149	-1	capture	Nonsense_Mutation	SNP	22615862	22615862	BMI1	10	T	G	G	G	1	0	0	0	0	0	1	0	0	673	52	5	4	1443	31
C10orf71	118461	broad.mit.edu	37	10	50531485	50531485	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50531485G>A	uc010qgp.1	+	3	1234	c.895G>A	c.(895-897)GAA>AAA	p.E299K		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	299											0						AACCGTCCCAGAAAGCAAAGC	0.542																0.320755	50.455089	51.968373	17	36	KEEP	---	---	---	---	8	13	21	19	-1	capture	Missense_Mutation	SNP	50531485	50531485	C10orf71	10	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	1602	31
PTEN	5728	broad.mit.edu	37	10	89711882	89711882	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89711882C>G	uc001kfb.2	+	7	1531	c.500C>G	c.(499-501)ACT>AGT	p.T167S		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	167	Phosphatase tensin-type.		T -> P (in breast cancer; severely reduced protein phosphatase activity).	T->A,D: 60% reduction in phosphatase activity towards PtdIns(3,4,5)P3.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.T167A(4)|p.R55fs*1(4)|p.V166fs*17(3)|p.?(3)|p.G165fs*9(3)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.V166fs*10(1)|p.T167I(1)|p.G165_K342del(1)|p.G165_*404del(1)|p.T167S(1)|p.T167P(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAGGGAGTAACTATTCCCAGT	0.368			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.327381	180.770873	185.208681	55	113	KEEP	---	---	---	---	37	27	80	56	-1	capture	Missense_Mutation	SNP	89711882	89711882	PTEN	10	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	12633	31
KNDC1	85442	broad.mit.edu	37	10	135012314	135012314	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135012314A>C	uc001llz.1	+	14	2303	c.2302A>C	c.(2302-2304)AAC>CAC	p.N768H	KNDC1_uc001lma.1_Missense_Mutation_p.N703H|KNDC1_uc001lmb.1_Missense_Mutation_p.N180H	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)	768	Pro-rich.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		GGCCCCAGCAAACCAGCCAGA	0.731																0.375	10.924455	11.033651	3	5	KEEP	---	---	---	---	3	1	6	6	-1	capture	Missense_Mutation	SNP	135012314	135012314	KNDC1	10	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	8346	31
MYOD1	4654	broad.mit.edu	37	11	17741852	17741852	+	Missense_Mutation	SNP	G	T	T	rs143600911		TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:17741852G>T	uc001mni.2	+	1	743	c.523G>T	c.(523-525)GCA>TCA	p.A175S		NM_002478	NP_002469	P15172	MYOD1_HUMAN	myogenic differentiation 1	175					muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|skeletal muscle tissue development	nuclear chromatin|transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity			breast(2)|ovary(1)	3						CCCTGGCGCCGCAGCCGCCTT	0.577																0.576923	47.023669	47.15714	15	11	KEEP	---	---	---	---	4	12	7	8	0.25	capture	Missense_Mutation	SNP	17741852	17741852	MYOD1	11	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	9998	31
TMEM132D	121256	broad.mit.edu	37	12	129558863	129558863	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:129558863C>A	uc009zyl.1	-	9	3185	c.2857G>T	c.(2857-2859)GAG>TAG	p.E953*	TMEM132D_uc001uia.2_Nonsense_Mutation_p.E491*	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	953	Cytoplasmic (Potential).					integral to membrane		p.E953*(1)		ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TCCTGCTCCTCGAAGGGAACC	0.458																0.129213	39.000912	62.826108	23	155	KEEP	---	---	---	---	14	10	90	91	0.416666666667	capture	Nonsense_Mutation	SNP	129558863	129558863	TMEM132D	12	C	A	A	A	1	0	0	0	0	0	1	0	0	403	31	5	4	15931	31
NALCN	259232	broad.mit.edu	37	13	101795440	101795440	+	Silent	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:101795440G>A	uc001vox.1	-	17	2298	c.2109C>T	c.(2107-2109)ATC>ATT	p.I703I	NALCN_uc001voy.2_Silent_p.I418I	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	703	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTTTTTGGTCGATGTATTTGT	0.468																0.031447	-28.968434	9.247445	5	154	KEEP	---	---	---	---	3	3	102	81	-1	capture	Silent	SNP	101795440	101795440	NALCN	13	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	10057	31
CDKL1	8814	broad.mit.edu	37	14	50862534	50862534	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:50862534A>G	uc010anu.1	-	5	623	c.623T>C	c.(622-624)GTT>GCT	p.V208A	CDKL1_uc001wxz.2_Missense_Mutation_p.V19A	NM_004196	NP_004187	Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1	18	ATP (By similarity).|Protein kinase.					cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(1)|stomach(1)	2	all_epithelial(31;0.000746)|Breast(41;0.0102)					ACATTTGAAAACAACTCCATA	0.358					153											0.27451	88.861069	93.528634	28	74	KEEP	---	---	---	---	24	8	34	47	-1	capture	Missense_Mutation	SNP	50862534	50862534	CDKL1	14	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	3123	31
KCNH5	27133	broad.mit.edu	37	14	63447847	63447847	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:63447847C>T	uc001xfx.2	-	6	736	c.685G>A	c.(685-687)GCC>ACC	p.A229T	KCNH5_uc001xfy.2_Missense_Mutation_p.A229T|KCNH5_uc001xfz.1_Missense_Mutation_p.A171T|KCNH5_uc001xga.2_Missense_Mutation_p.A171T	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	229	Helical; Name=Segment S1; (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		ACCATAATGGCGGTGTAGAAG	0.383																0.26087	45.716676	49.289474	18	51	KEEP	---	---	---	---	9	12	23	36	-1	capture	Missense_Mutation	SNP	63447847	63447847	KCNH5	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7957	31
HERC2	8924	broad.mit.edu	37	15	28460793	28460793	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:28460793A>G	uc001zbj.2	-	39	6290	c.6184T>C	c.(6184-6186)TTC>CTC	p.F2062L		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	2062					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GTGGCAGTGAAGGGTGCGTGC	0.607					1580											0.386364	59.165967	59.663651	17	27	KEEP	---	---	---	---	11	9	27	19	-1	capture	Missense_Mutation	SNP	28460793	28460793	HERC2	15	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	6984	31
FRMD5	84978	broad.mit.edu	37	15	44181021	44181021	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:44181021C>T	uc001ztl.2	-	9	955	c.778G>A	c.(778-780)GTA>ATA	p.V260I	FRMD5_uc001ztj.1_5'UTR|FRMD5_uc001ztk.1_Splice_Site_p.Y170_splice|FRMD5_uc001ztm.2_5'UTR|FRMD5_uc001ztn.2_Missense_Mutation_p.V26I	NM_032892	NP_116281	Q7Z6J6	FRMD5_HUMAN	FERM domain containing 5 isoform 2	260	FERM.					cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)		TTCTGACTTACGTATAAATAG	0.498																0.067485	-7.512597	24.066895	11	152	KEEP	---	---	---	---	9	4	73	106	-1	capture	Missense_Mutation	SNP	44181021	44181021	FRMD5	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5996	31
SLTM	79811	broad.mit.edu	37	15	59186379	59186379	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:59186379G>A	uc002afp.2	-	11	1479	c.1391C>T	c.(1390-1392)CCC>CTC	p.P464L	SLTM_uc002afn.2_Missense_Mutation_p.P33L|SLTM_uc002afo.2_Missense_Mutation_p.P446L|SLTM_uc002afq.2_Missense_Mutation_p.P33L|SLTM_uc010bgd.2_Missense_Mutation_p.P33L	NM_024755	NP_079031	Q9NWH9	SLTM_HUMAN	modulator of estrogen induced transcription	464					apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)	1						TTTCTTAGAGGGATCACCTTT	0.318																0.244444	30.402938	33.080068	11	34	KEEP	---	---	---	---	2	9	24	14	-1	capture	Missense_Mutation	SNP	59186379	59186379	SLTM	15	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	14646	31
GCNT3	9245	broad.mit.edu	37	15	59911701	59911701	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:59911701C>T	uc002age.2	+	3	1713	c.1264C>T	c.(1264-1266)CAG>TAG	p.Q422*	GCNT3_uc002agd.2_Nonsense_Mutation_p.Q422*	NM_004751	NP_004742	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin	422	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane|membrane fraction	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)	2						TAATGCTCTTCAGTGCTTAGA	0.458																0.340782	339.116417	347.149116	122	236	KEEP	---	---	---	---	63	69	111	149	-1	capture	Nonsense_Mutation	SNP	59911701	59911701	GCNT3	15	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	6242	31
RASGRF1	5923	broad.mit.edu	37	15	79320175	79320175	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:79320175G>A	uc002beq.2	-	9	1664	c.1289C>T	c.(1288-1290)ACG>ATG	p.T430M	RASGRF1_uc002bep.2_Missense_Mutation_p.T430M|RASGRF1_uc010blm.1_Missense_Mutation_p.T352M|RASGRF1_uc002ber.3_Missense_Mutation_p.T430M	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	430					activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						GATGTTCTCCGTCTCACTTAC	0.547					694											0.165323	77.315526	103.68215	41	207	KEEP	---	---	---	---	23	24	116	122	-1	capture	Missense_Mutation	SNP	79320175	79320175	RASGRF1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12967	31
RPL3L	6123	broad.mit.edu	37	16	2002950	2002950	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2002950C>T	uc002cnh.2	-	3	337	c.290G>A	c.(289-291)CGA>CAA	p.R97Q		NM_005061	NP_005052	Q92901	RL3L_HUMAN	ribosomal protein L3-like	97					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	RNA binding|structural constituent of ribosome				0						CCGGAGACCTCGAGGGGTGGC	0.607																0.029412	-26.435875	6.492018	4	132	KEEP	---	---	---	---	3	1	62	78	-1	capture	Missense_Mutation	SNP	2002950	2002950	RPL3L	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13486	31
ATF7IP2	80063	broad.mit.edu	37	16	10524503	10524503	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10524503G>A	uc002czu.2	+	3	253	c.26G>A	c.(25-27)CGG>CAG	p.R9Q	ATF7IP2_uc002czv.2_Missense_Mutation_p.R9Q|ATF7IP2_uc010uyo.1_RNA|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Missense_Mutation_p.R9Q|ATF7IP2_uc010uyq.1_RNA	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting	9					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						AGAAGTAAACGGAAGATATTA	0.348																0.290323	48.525012	50.967487	18	44	KEEP	---	---	---	---	9	11	29	17	-1	capture	Missense_Mutation	SNP	10524503	10524503	ATF7IP2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1079	31
ABCC1	4363	broad.mit.edu	37	16	16218658	16218658	+	Silent	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:16218658G>A	uc010bvi.2	+	25	3778	c.3603G>A	c.(3601-3603)GTG>GTA	p.V1201V	ABCC1_uc010bvj.2_Silent_p.V1142V|ABCC1_uc010bvk.2_Silent_p.V1145V|ABCC1_uc010bvl.2_Silent_p.V1201V|ABCC1_uc010bvm.2_Silent_p.V1086V|ABCC1_uc002del.3_Silent_p.V1095V	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	1201	Cytoplasmic.|ABC transmembrane type-1 2.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	GGCTGGCCGTGCGGCTGGAGT	0.592																0.294118	76.403337	80.276722	30	72	KEEP	---	---	---	---	17	19	47	52	-1	capture	Silent	SNP	16218658	16218658	ABCC1	16	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	49	31
CLEC3A	10143	broad.mit.edu	37	16	78064579	78064579	+	Silent	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:78064579C>T	uc002ffh.3	+	3	516	c.435C>T	c.(433-435)AAC>AAT	p.N145N		NM_005752	NP_005743	O75596	CLC3A_HUMAN	C-type lectin domain family 3 member A	145	C-type lectin.				skeletal system development	extracellular region	sugar binding				0						TTGACGTCAACGGAATCGCTA	0.527																0.312169	159.70518	165.616182	59	130	KEEP	---	---	---	---	25	42	89	64	-1	capture	Silent	SNP	78064579	78064579	CLEC3A	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3475	31
MYH1	4619	broad.mit.edu	37	17	10415407	10415407	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10415407C>A	uc002gmo.2	-	13	1344	c.1250G>T	c.(1249-1251)GGT>GTT	p.G417V	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	417	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						CACAGTTTGACCTTTGGTGAC	0.463					585											0.080235	0.690126	92.507714	41	470	KEEP	---	---	---	---	25	20	263	284	0.444444444444	capture	Missense_Mutation	SNP	10415407	10415407	MYH1	17	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	9939	31
MYO19	80179	broad.mit.edu	37	17	34864958	34864958	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34864958C>T	uc010wcy.1	-	15	2166	c.1174G>A	c.(1174-1176)GTA>ATA	p.V392I	MYO19_uc002hmw.2_Missense_Mutation_p.V392I|MYO19_uc010cuu.2_RNA|MYO19_uc010wcz.1_RNA	NM_001163735	NP_001157207	Q96H55	MYO19_HUMAN	myosin XIX isoform 2	392	Myosin head-like.					mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)	1		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		ATCACTGATACCAGCCAGTCA	0.537																0.416667	28.237891	28.385032	10	14	KEEP	---	---	---	---	5	7	9	12	-1	capture	Missense_Mutation	SNP	34864958	34864958	MYO19	17	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	9977	31
MPP3	4356	broad.mit.edu	37	17	41898381	41898381	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41898381C>T	uc002iei.3	-	11	896	c.730G>A	c.(730-732)GCC>ACC	p.A244T	MPP3_uc002ieh.2_Missense_Mutation_p.A269T|MPP3_uc002iej.2_RNA|MPP3_uc010czi.1_Missense_Mutation_p.A244T|MPP3_uc010wik.1_Missense_Mutation_p.A269T	NM_001932	NP_001923	Q13368	MPP3_HUMAN	palmitoylated membrane protein 3	244	SH3.				signal transduction	cell surface|integral to plasma membrane	guanylate kinase activity			large_intestine(1)|skin(1)	2		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		CAAGGGATGGCCCGGTCCTCC	0.677																0.3	39.604398	41.392086	15	35	KEEP	---	---	---	---	7	15	23	27	-1	capture	Missense_Mutation	SNP	41898381	41898381	MPP3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9647	31
SPIRE1	56907	broad.mit.edu	37	18	12496095	12496095	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:12496095C>A	uc002kre.2	-	7	1026	c.979G>T	c.(979-981)GGT>TGT	p.G327C	SPIRE1_uc002krc.2_RNA|SPIRE1_uc010wzw.1_Missense_Mutation_p.G207C|SPIRE1_uc010wzx.1_Missense_Mutation_p.G130C|SPIRE1_uc010wzy.1_Missense_Mutation_p.G327C	NM_001128626	NP_001122098	Q08AE8	SPIR1_HUMAN	spire homolog 1 isoform a	327						cytoskeleton|perinuclear region of cytoplasm	actin binding				0						GGAATATCACCATTCACCTAA	0.358																0.244186	54.228904	59.359165	21	65	KEEP	---	---	---	---	10	13	34	41	0.565217391304	capture	Missense_Mutation	SNP	12496095	12496095	SPIRE1	18	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	14963	31
ILF3	3609	broad.mit.edu	37	19	10798360	10798360	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10798360G>A	uc002mpn.2	+	18	2715	c.2398G>A	c.(2398-2400)GAC>AAC	p.D800N	ILF3_uc002mpo.2_Missense_Mutation_p.D804N|ILF3_uc002mpq.2_Silent_p.P102P	NM_012218	NP_036350	Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3 isoform a	800	Interaction with PRMT1.				M phase|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleolus|ribonucleoprotein complex	DNA binding|double-stranded RNA binding|protein binding|protein binding			ovary(3)	3			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			GGGCGGATCCGACTACAACTA	0.617																0.221239	57.832357	65.90215	25	88	KEEP	---	---	---	---	10	18	59	48	-1	capture	Missense_Mutation	SNP	10798360	10798360	ILF3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7635	31
LDLR	3949	broad.mit.edu	37	19	11233883	11233883	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11233883C>A	uc002mqk.3	+	15	2342	c.2174C>A	c.(2173-2175)TCC>TAC	p.S725Y	LDLR_uc010xlk.1_Missense_Mutation_p.S725Y|LDLR_uc010xll.1_Missense_Mutation_p.S684Y|LDLR_uc010xlm.1_Missense_Mutation_p.S578Y|LDLR_uc010xln.1_Missense_Mutation_p.S547Y|LDLR_uc010xlo.1_Missense_Mutation_p.S557Y	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	725	Clustered O-linked oligosaccharides.|Extracellular (Potential).				cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	CAGGAGACATCCACCGTCAGG	0.607	GBM(18;201 575 7820 21545)				1109											0.411765	131.746348	132.556	49	70	KEEP	---	---	---	---	29	33	35	47	0.532258064516	capture	Missense_Mutation	SNP	11233883	11233883	LDLR	19	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	8624	31
FBL	2091	broad.mit.edu	37	19	40328442	40328442	+	Silent	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40328442G>A	uc002omn.2	-	6	705	c.591C>T	c.(589-591)GGC>GGT	p.G197G	FBL_uc002omm.1_Silent_p.G111G|FBL_uc002omo.2_Silent_p.G196G	NM_001436	NP_001427	P22087	FBRL_HUMAN	fibrillarin	197					rRNA processing|tRNA processing	box C/D snoRNP complex|Cajal body	methyltransferase activity|protein binding|RNA binding			ovary(1)	1	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		TGAGGTCACGGCCAGAGCGGT	0.413																0.031746	-23.317686	6.917281	4	122	KEEP	---	---	---	---	3	2	58	70	-1	capture	Silent	SNP	40328442	40328442	FBL	19	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	5642	31
ZNF180	7733	broad.mit.edu	37	19	44981674	44981674	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44981674G>A	uc002ozf.3	-	5	1306	c.1024C>T	c.(1024-1026)CAA>TAA	p.Q342*	ZNF180_uc002ozh.3_5'UTR|ZNF180_uc002ozi.3_Nonsense_Mutation_p.Q315*|ZNF180_uc002ozg.3_Nonsense_Mutation_p.Q341*|ZNF180_uc010ejm.2_Nonsense_Mutation_p.Q317*	NM_013256	NP_037388	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	342					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)				CTCATGTTTTGAGTAAGGGAG	0.378	Esophageal Squamous(180;1353 2003 32862 46574 49854)															0.33	183.67484	188.80153	66	134	KEEP	---	---	---	---	32	42	67	78	-1	capture	Nonsense_Mutation	SNP	44981674	44981674	ZNF180	19	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	17628	31
FPR3	2359	broad.mit.edu	37	19	52327921	52327921	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52327921G>A	uc002pxt.1	+	2	1104	c.920G>A	c.(919-921)CGT>CAT	p.R307H		NM_002030	NP_002021	P25089	FPR3_HUMAN	formyl peptide receptor-like 2	307	Cytoplasmic (Potential).				cellular component movement|chemotaxis	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(4)|breast(1)|skin(1)	6						TTTATGGGTCGTAACTTCCAA	0.473																0.259398	175.84426	189.796457	69	197	KEEP	---	---	---	---	42	37	132	104	-1	capture	Missense_Mutation	SNP	52327921	52327921	FPR3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5984	31
DYNC2LI1	51626	broad.mit.edu	37	2	44023908	44023908	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:44023908G>A	uc002rtk.2	+	8	724	c.628G>A	c.(628-630)GCA>ACA	p.A210T	DYNC2LI1_uc002rtj.2_Missense_Mutation_p.A210T|DYNC2LI1_uc002rtl.2_Missense_Mutation_p.A211T|DYNC2LI1_uc010ynz.1_Missense_Mutation_p.A84T	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1	210						apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TCGATTTGTTGCACATTATTA	0.343																0.189189	41.210445	51.245825	21	90	KEEP	---	---	---	---	17	9	52	62	-1	capture	Missense_Mutation	SNP	44023908	44023908	DYNC2LI1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4802	31
ZRANB3	84083	broad.mit.edu	37	2	135960424	135960424	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135960424A>G	uc002tum.2	-	20	3236	c.3119T>C	c.(3118-3120)CTC>CCC	p.L1040P	ZRANB3_uc002tuk.2_Missense_Mutation_p.L583P|ZRANB3_uc002tul.2_Missense_Mutation_p.L1038P	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	1040						intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)		GACTGTGCAGAGAGTCTGCAG	0.478																0.238095	13.161885	14.480407	5	16	KEEP	---	---	---	---	5	1	6	13	-1	capture	Missense_Mutation	SNP	135960424	135960424	ZRANB3	2	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	18100	31
MMP24	10893	broad.mit.edu	37	20	33851598	33851598	+	Silent	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:33851598C>T	uc002xbu.2	+	5	825	c.822C>T	c.(820-822)AAC>AAT	p.N274N	EDEM2_uc010zuv.1_Intron	NM_006690	NP_006681	Q9Y5R2	MMP24_HUMAN	matrix metalloproteinase 24 preproprotein	274	Extracellular (Potential).				proteolysis	integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00252)			CCACAGGGAACGACCTCTTCC	0.522																0.388889	17.51141	17.708867	7	11	KEEP	---	---	---	---	5	3	6	7	-1	capture	Silent	SNP	33851598	33851598	MMP24	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9573	31
NUP210	23225	broad.mit.edu	37	3	13379344	13379344	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13379344C>T	uc003bxv.1	-	26	3628	c.3545G>A	c.(3544-3546)GGC>GAC	p.G1182D		NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210 precursor	1182	Lumenal (Probable).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11	all_neural(104;0.187)					CACCTGGGTGCCCGTCCTCAT	0.627					587											0.111111	3.009063	7.04311	3	24	KEEP	---	---	---	---	2	1	13	18	-1	capture	Missense_Mutation	SNP	13379344	13379344	NUP210	3	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10667	31
XCR1	2829	broad.mit.edu	37	3	46063343	46063343	+	Missense_Mutation	SNP	C	T	T	rs140218706		TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:46063343C>T	uc003cpe.2	-	3	321	c.97G>A	c.(97-99)GCC>ACC	p.A33T	uc003cpd.1_5'Flank|XCR1_uc003cpf.2_Missense_Mutation_p.A33T	NM_005283	NP_005274	P46094	XCR1_HUMAN	XC chemokine receptor 1	33	Helical; Name=1; (Potential).				chemotaxis|G-protein signaling, coupled to cyclic nucleotide second messenger|inflammatory response	integral to plasma membrane	chemokine receptor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		ACAGTGGTGGCGAGGGTAGCA	0.567																0.224638	66.980187	76.581235	31	107	KEEP	---	---	---	---	15	22	72	64	-1	capture	Missense_Mutation	SNP	46063343	46063343	XCR1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17306	31
CP	1356	broad.mit.edu	37	3	148895735	148895735	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148895735T>G	uc003ewy.3	-	17	3163	c.2910A>C	c.(2908-2910)CAA>CAC	p.Q970H	CP_uc011bnr.1_RNA|CP_uc003eww.3_Missense_Mutation_p.Q122H|CP_uc003ewx.3_Missense_Mutation_p.Q751H|CP_uc003ewz.2_Missense_Mutation_p.Q970H	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	970	F5/8 type A 3.|Plastocyanin-like 6.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	TTGTGAGGCCTTGTAGGTTTC	0.378																0.023392	-35.560815	7.692311	4	167	KEEP	---	---	---	---	2	4	100	95	-1	capture	Missense_Mutation	SNP	148895735	148895735	CP	3	T	G	G	G	1	0	0	0	0	1	0	0	0	725	56	4	4	3752	31
MECOM	2122	broad.mit.edu	37	3	169099085	169099085	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:169099085C>A	uc011bpj.1	-	2	668	c.265G>T	c.(265-267)GGG>TGG	p.G89W	MECOM_uc003ffl.2_Missense_Mutation_p.G61W|MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Missense_Mutation_p.G89W|MECOM_uc011bpl.1_Missense_Mutation_p.G89W	NM_004991	NP_004982	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform c	Error:Variant_position_missing_in_Q03112_after_alignment					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						AGTCCTGCCCCAGGCATATTT	0.473					646											0.079208	0.33235	36.858887	16	186	KEEP	---	---	---	---	12	6	106	105	0.333333333333	capture	Missense_Mutation	SNP	169099085	169099085	MECOM	3	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	9335	31
LIMCH1	22998	broad.mit.edu	37	4	41652554	41652554	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:41652554G>A	uc003gvu.3	+	13	1864	c.1810G>A	c.(1810-1812)GAG>AAG	p.E604K	LIMCH1_uc003gvv.3_Missense_Mutation_p.E604K|LIMCH1_uc003gvw.3_Missense_Mutation_p.E604K|LIMCH1_uc003gvx.3_Missense_Mutation_p.E592K|LIMCH1_uc003gwe.3_Missense_Mutation_p.E604K|LIMCH1_uc003gvy.3_Missense_Mutation_p.E433K|LIMCH1_uc003gwa.3_Missense_Mutation_p.E445K|LIMCH1_uc003gvz.3_Missense_Mutation_p.E989K|LIMCH1_uc011byu.1_Missense_Mutation_p.E438K|LIMCH1_uc003gwc.3_Missense_Mutation_p.E450K|LIMCH1_uc003gwd.3_Missense_Mutation_p.E438K|LIMCH1_uc011byv.1_Missense_Mutation_p.E355K	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a	604					actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						GTCTCCACTGGAGCTGAAACA	0.527																0.126761	12.623185	22.27457	9	62	KEEP	---	---	---	---	4	6	41	36	-1	capture	Missense_Mutation	SNP	41652554	41652554	LIMCH1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	8717	31
NPY2R	4887	broad.mit.edu	37	4	156135822	156135822	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:156135822G>C	uc003ioq.2	+	2	1226	c.731G>C	c.(730-732)AGT>ACT	p.S244T	NPY2R_uc003ior.2_Missense_Mutation_p.S244T	NM_000910	NP_000901	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	244	Cytoplasmic (Potential).				cardiac left ventricle morphogenesis|inhibition of adenylate cyclase activity by G-protein signaling pathway|locomotory behavior|outflow tract morphogenesis	integral to plasma membrane	calcium channel regulator activity			lung(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0854)				CGCATTTGGAGTAAATTGAAG	0.433																0.028037	-19.074473	7.192021	3	104	KEEP	---	---	---	---	1	2	69	50	-1	capture	Missense_Mutation	SNP	156135822	156135822	NPY2R	4	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	10516	31
FTMT	94033	broad.mit.edu	37	5	121187974	121187974	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:121187974G>A	uc003kss.2	+	1	325	c.316G>A	c.(316-318)GTG>ATG	p.V106M		NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial precursor	106	Ferritin-like diiron.				cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity			ovary(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		CCGGGATGACGTGGCCTTGAA	0.592																0.346154	98.765579	100.939976	36	68	KEEP	---	---	---	---	17	25	40	34	-1	capture	Missense_Mutation	SNP	121187974	121187974	FTMT	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6027	31
FCHSD1	89848	broad.mit.edu	37	5	141029038	141029038	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:141029038C>T	uc003llk.2	-	5	350	c.299G>A	c.(298-300)CGA>CAA	p.R100Q	FCHSD1_uc010jgg.2_5'Flank|FCHSD1_uc003llj.2_RNA	NM_033449	NP_258260	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	100									FCHSD1/BRAF(2)	skin(2)|ovary(1)|central_nervous_system(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCTGGAGTCGGGTTTGGCC	0.637																0.253086	96.330466	105.282267	41	121	KEEP	---	---	---	---	26	20	81	70	-1	capture	Missense_Mutation	SNP	141029038	141029038	FCHSD1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5735	31
WBSCR17	64409	broad.mit.edu	37	7	71175882	71175882	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71175882G>C	uc003tvy.2	+	10	1637	c.1637G>C	c.(1636-1638)AGC>ACC	p.S546T	WBSCR17_uc003tvz.2_Missense_Mutation_p.S245T	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	546	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				AAGGTCAAGAGCAGCCTGTAC	0.612																0.140625	-1.919996	6.508034	9	55	KEEP	---	---	---	---	20	7	41	51	-1	capture	Missense_Mutation	SNP	71175882	71175882	WBSCR17	7	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	17145	31
PCLO	27445	broad.mit.edu	37	7	82595090	82595090	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82595090T>A	uc003uhx.2	-	4	4303	c.4014A>T	c.(4012-4014)AAA>AAT	p.K1338N	PCLO_uc003uhv.2_Missense_Mutation_p.K1338N	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						AACTTACTGTTTTTTCTTTCC	0.338																0.288591	106.763259	112.735113	43	106	KEEP	---	---	---	---	25	22	76	44	-1	capture	Missense_Mutation	SNP	82595090	82595090	PCLO	7	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	11486	31
DYNC1I1	1780	broad.mit.edu	37	7	95457400	95457400	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:95457400C>T	uc003uoc.3	+	5	674	c.397C>T	c.(397-399)CTC>TTC	p.L133F	DYNC1I1_uc003uod.3_Missense_Mutation_p.L116F|DYNC1I1_uc003uob.2_Intron|DYNC1I1_uc003uoe.3_Intron|DYNC1I1_uc010lfl.2_Missense_Mutation_p.L122F	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	133					vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CCCCTCAGTGCTCCAGCTGCA	0.443																0.241641	437.201019	477.256876	159	499	KEEP	---	---	---	---	96	89	274	298	-1	capture	Missense_Mutation	SNP	95457400	95457400	DYNC1I1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	4797	31
ST18	9705	broad.mit.edu	37	8	53073986	53073986	+	Missense_Mutation	SNP	G	A	A	rs2303460	byFrequency;by1000genomes	TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:53073986G>A	uc003xqz.2	-	9	1699	c.1543C>T	c.(1543-1545)CGC>TGC	p.R515C	ST18_uc011ldq.1_Missense_Mutation_p.R162C|ST18_uc011ldr.1_Missense_Mutation_p.R480C|ST18_uc011lds.1_Missense_Mutation_p.R420C|ST18_uc003xra.2_Missense_Mutation_p.R515C|ST18_uc003xrb.2_Missense_Mutation_p.R515C	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	515						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				ATGAGAGGGCGTTTACCGAAA	0.433																0.034188	-39.808182	15.488212	8	226	KEEP	---	---	---	---	6	4	134	135	-1	capture	Missense_Mutation	SNP	53073986	53073986	ST18	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15102	31
ASAP1	50807	broad.mit.edu	37	8	131124496	131124496	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:131124496C>G	uc003yta.1	-	23	2273	c.2245G>C	c.(2245-2247)GAC>CAC	p.D749H	ASAP1_uc003ysz.1_Missense_Mutation_p.D560H|ASAP1_uc011liw.1_Missense_Mutation_p.D742H	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	749					cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						GCCAGCTTGTCCTGGGGGGAG	0.542																0.05036	-13.691213	16.178303	7	132	KEEP	---	---	---	---	5	6	92	76	-1	capture	Missense_Mutation	SNP	131124496	131124496	ASAP1	8	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	1001	31
FAM75C1	441452	broad.mit.edu	37	9	90537612	90537612	+	Silent	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90537612C>T	uc010mqi.2	+	4	2819	c.2790C>T	c.(2788-2790)GCC>GCT	p.A930A	FAM75C1_uc004apq.3_Silent_p.A913A	NM_001145124	NP_001138596			family with sequence similarity 75, member C1												0						TCATGTCAGCCAGAAGGAGTA	0.547																0.033613	-20.692539	7.516039	4	115	KEEP	---	---	---	---	0	6	116	105	-1	capture	Silent	SNP	90537612	90537612	FAM75C1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	5569	31
ZNF618	114991	broad.mit.edu	37	9	116750662	116750662	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116750662G>A	uc004bid.2	+	3	238	c.139G>A	c.(139-141)GAG>AAG	p.E47K	ZNF618_uc004bib.1_Missense_Mutation_p.E47K|ZNF618_uc004bic.2_Missense_Mutation_p.E47K|ZNF618_uc011lxi.1_Missense_Mutation_p.E47K|ZNF618_uc011lxj.1_Missense_Mutation_p.E47K	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	47					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AGTGCCAGCCGAGGCCTCGCT	0.602																0.22	27.298443	30.907904	11	39	KEEP	---	---	---	---	1	11	22	27	-1	capture	Missense_Mutation	SNP	116750662	116750662	ZNF618	9	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17920	31
OR5C1	392391	broad.mit.edu	37	9	125551633	125551633	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125551633C>T	uc011lzd.1	+	1	422	c.422C>T	c.(421-423)TCG>TTG	p.S141L		NM_001001923	NP_001001923	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C,	141	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1						ACAGCTATGTCGCAGCGTCTA	0.572																0.021164	-41.252233	7.202395	4	185	KEEP	---	---	---	---	5	0	99	102	-1	capture	Missense_Mutation	SNP	125551633	125551633	OR5C1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11057	31
BCOR	54880	broad.mit.edu	37	X	39932171	39932171	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:39932171G>A	uc004den.3	-	4	2720	c.2428C>T	c.(2428-2430)CGA>TGA	p.R810*	BCOR_uc004dep.3_Nonsense_Mutation_p.R810*|BCOR_uc004deo.3_Nonsense_Mutation_p.R810*|BCOR_uc004dem.3_Nonsense_Mutation_p.R810*|BCOR_uc004deq.3_Nonsense_Mutation_p.R810*	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	810					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						GGTTCTTCTCGGAGAAGGTCT	0.522																0.538462	219.656776	219.825276	70	60	KEEP	---	---	---	---	41	33	41	25	-1	capture	Nonsense_Mutation	SNP	39932171	39932171	BCOR	23	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	1375	31
OTUD5	55593	broad.mit.edu	37	X	48814319	48814319	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48814319C>T	uc004dlu.2	-	1	575	c.514G>A	c.(514-516)GGC>AGC	p.G172S	OTUD5_uc004dlt.3_Missense_Mutation_p.G172S|OTUD5_uc004dlv.2_Missense_Mutation_p.G172S|OTUD5_uc011mmp.1_Intron	NM_017602	NP_060072	Q96G74	OTUD5_HUMAN	OTU domain containing 5 isoform a	172	Gly-rich.				negative regulation of type I interferon production		cysteine-type peptidase activity			pancreas(1)	1						TAGCCTGCGCCGACCTCCTCA	0.687																0.333333	6.248393	6.3958	2	4	KEEP	---	---	---	---	0	3	6	1	-1	capture	Missense_Mutation	SNP	48814319	48814319	OTUD5	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11219	31
MED12	9968	broad.mit.edu	37	X	70349202	70349202	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70349202G>A	uc004dyy.2	+	26	3813	c.3614G>A	c.(3613-3615)CGC>CAC	p.R1205H	MED12_uc011mpq.1_Missense_Mutation_p.R1205H|MED12_uc004dyz.2_Missense_Mutation_p.R1205H|MED12_uc004dza.2_Missense_Mutation_p.R1052H|MED12_uc010nla.2_5'Flank	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	1205					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					TCCTGCGACCGCCACCTGCTG	0.582														OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.050847	-6.02108	6.583973	3	56	KEEP	---	---	---	---	1	2	31	40	-1	capture	Missense_Mutation	SNP	70349202	70349202	MED12	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9341	31
SLC5A11	115584	broad.mit.edu	37	16	24921737	24921739	+	In_Frame_Del	DEL	CAG	-	-			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24921737_24921739delCAG	uc002dmu.2	+	15	1993_1995	c.1761_1763delCAG	c.(1759-1764)GCCAGC>GCC	p.S592del	SLC5A11_uc002dms.2_In_Frame_Del_p.S528del|SLC5A11_uc010vcd.1_In_Frame_Del_p.S557del|SLC5A11_uc002dmt.2_In_Frame_Del_p.S436del|SLC5A11_uc010vce.1_In_Frame_Del_p.S522del|SLC5A11_uc010bxt.2_In_Frame_Del_p.S528del|SLC5A11_uc002dmv.2_In_Frame_Del_p.S215del	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	592	Cytoplasmic (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)		TGCCAGAGGCCAGCAGCAGCAGC	0.542																0.04			8	174		---	---	---	---						capture_indel	In_Frame_Del	DEL	24921737	24921739	SLC5A11	16	CAG	-	-	-	1	0	1	0	1	0	0	0	0	262	21	5	5	14555	31
PIK3CA	5290	broad.mit.edu	37	3	178916641	178916661	+	In_Frame_Del	DEL	CTGTGGGGCATCCACTTGATG	-	-			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916641_178916661delCTGTGGGGCATCCACTTGATG	uc003fjk.2	+	2	185_205	c.28_48delCTGTGGGGCATCCACTTGATG	c.(28-48)CTGTGGGGCATCCACTTGATGdel	p.LWGIHLM10del		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	10_16					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.G12D(2)|p.L10_M16del(1)|p.L15_V22>PM(1)|p.E9_R19del(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			ATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAA	0.394	Colon(199;1504 1750 3362 26421 31210 32040)		57	p.M16I(DMS153-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.08			9	98		---	---	---	---						capture_indel	In_Frame_Del	DEL	178916641	178916661	PIK3CA	3	CTGTGGGGCATCCACTTGATG	-	-	-	1	0	1	0	1	0	0	0	0	259	20	5	5	11816	31
AP3M2	10947	broad.mit.edu	37	8	42024775	42024776	+	Frame_Shift_Ins	INS	-	GT	GT			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:42024775_42024776insGT	uc003xop.2	+	8	1188_1189	c.897_898insGT	c.(895-900)CAGACGfs	p.Q299fs	AP3M2_uc003xoo.2_Frame_Shift_Ins_p.Q299fs|AP3M2_uc010lxe.2_Intron	NM_001134296	NP_001127768	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	299_300	MHD.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|Golgi apparatus					0	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			GACCCAAGCAGACGATGGGGAA	0.515																0.08			13	147		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	42024775	42024776	AP3M2	8	-	GT	GT	GT	1	0	1	1	0	0	0	0	0	425	33	5	5	741	31
DCAF13	25879	broad.mit.edu	37	8	104427337	104427338	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0166-01	TCGA-06-0166-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104427337_104427338insG	uc003yln.2	+	1	396_397	c.119_120insG	c.(118-120)GAGfs	p.E40fs	SLC25A32_uc003yll.2_5'UTR|SLC25A32_uc011lhr.1_5'UTR|DCAF13_uc003ylm.1_5'UTR|DCAF13_uc003ylo.2_5'UTR	NM_015420	NP_056235	Q9NV06	DCA13_HUMAN	WD repeats and SOF1 domain containing	Error:Variant_position_missing_in_Q9NV06_after_alignment					rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex				breast(1)	1						TCTAGTACTGAGGGGGCAAGAA	0.663																0.23			28	94		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	104427337	104427338	DCAF13	8	-	G	G	G	1	0	1	1	0	0	0	0	0	143	11	5	5	4225	31
