Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TMCO4	255104	broad.mit.edu	37	1	20027271	20027271	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:20027271C>T	uc001bcn.2	-	14	1614	c.1372G>A	c.(1372-1374)GGC>AGC	p.G458S	TMCO4_uc001bcm.2_Missense_Mutation_p.G289S|TMCO4_uc001bco.1_Missense_Mutation_p.G458S|TMCO4_uc001bcp.1_Missense_Mutation_p.G418S	NM_181719	NP_859070	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	458						integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		CTGCAGTAGCCGTTGATGATC	0.433																0.026667	-30.236188	6.911141	4	146	KEEP	---	---	---	---	1	3	103	115	-1	capture	Missense_Mutation	SNP	20027271	20027271	TMCO4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15883	40
HOOK1	51361	broad.mit.edu	37	1	60299185	60299185	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:60299185G>A	uc009wad.2	+	6	484	c.382G>A	c.(382-384)GCG>ACG	p.A128T	HOOK1_uc001czo.2_Missense_Mutation_p.A128T|HOOK1_uc001czp.2_RNA|HOOK1_uc010oor.1_Missense_Mutation_p.A86T	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1	128	Sufficient for interaction with microtubules.				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)					TTTAGGTTGTGCGATCAACTG	0.373																0.423077	152.892841	153.566204	55	75	KEEP	---	---	---	---	29	41	45	42	-1	capture	Missense_Mutation	SNP	60299185	60299185	HOOK1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	7207	40
RBMXL1	494115	broad.mit.edu	37	1	89448530	89448530	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89448530T>A	uc009wcx.2	-	3	1696	c.980A>T	c.(979-981)TAC>TTC	p.Y327F	CCBL2_uc001dmp.2_Intron|CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron|RBMXL1_uc001dms.2_Missense_Mutation_p.Y327F	NM_001162536	NP_001156008	Q96E39	RBMXL_HUMAN	RNA binding motif protein, X-linked-like 1	327	Ser-rich.						nucleotide binding|RNA binding				0						GCTGCTTGAGTAACTGTCTCG	0.517																0.458746	394.097653	394.543677	139	164	KEEP	---	---	---	---	74	84	86	100	-1	capture	Missense_Mutation	SNP	89448530	89448530	RBMXL1	1	T	A	A	A	1	0	0	0	0	1	0	0	0	741	57	4	4	13048	40
DDR2	4921	broad.mit.edu	37	1	162749912	162749912	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:162749912C>T	uc001gcf.2	+	19	2909	c.2444C>T	c.(2443-2445)CCT>CTT	p.P815L	DDR2_uc001gcg.2_Missense_Mutation_p.P815L|uc001gch.1_5'Flank	NM_001014796	NP_001014796	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2	815	Cytoplasmic (Potential).|Protein kinase.				cell adhesion	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	p.P815L(1)		lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)			ACTTACCTCCCTCAACCAGCC	0.438	NSCLC(161;314 2006 8283 19651 23192)			p.P815I(HCC366-Tumor)	497											0.4	353.974249	356.413212	112	168	KEEP	---	---	---	---	71	58	112	76	-1	capture	Missense_Mutation	SNP	162749912	162749912	DDR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	4296	40
SMG7	9887	broad.mit.edu	37	1	183511445	183511445	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183511445C>T	uc001gqg.2	+	14	1772	c.1650C>T	c.(1648-1650)AAC>AAT	p.N550N	SMG7_uc010pob.1_Silent_p.N579N|SMG7_uc001gqf.2_Silent_p.N550N|SMG7_uc001gqh.2_Silent_p.N550N|SMG7_uc001gqi.2_Silent_p.N508N|SMG7_uc010poc.1_Silent_p.N508N	NM_173156	NP_775179	Q92540	SMG7_HUMAN	SMG-7 homolog isoform 1	550					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TCAAAGAAAACATTAAGACAC	0.428																0.051282	-25.730162	15.946786	10	185	KEEP	---	---	---	---	5	7	105	107	-1	capture	Silent	SNP	183511445	183511445	SMG7	1	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	14690	40
HMCN1	83872	broad.mit.edu	37	1	185972975	185972975	+	Nonsense_Mutation	SNP	A	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:185972975A>T	uc001grq.1	+	29	4703	c.4474A>T	c.(4474-4476)AAG>TAG	p.K1492*		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1492	Ig-like C2-type 12.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CAAAGATGGCAAGTGAGTATC	0.388																0.283019	76.418091	80.893391	30	76	KEEP	---	---	---	---	18	16	41	51	-1	capture	Nonsense_Mutation	SNP	185972975	185972975	HMCN1	1	A	T	T	T	1	0	0	0	0	0	1	0	0	65	5	5	4	7145	40
USH2A	7399	broad.mit.edu	37	1	216373084	216373084	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216373084C>T	uc001hku.1	-	17	4083	c.3696G>A	c.(3694-3696)TTG>TTA	p.L1232L	USH2A_uc001hkv.2_Silent_p.L1232L	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1232	Extracellular (Potential).|Fibronectin type-III 2.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGTAATGGGCAAGCTGTGTA	0.483													HNSCC(13;0.011)			0.4	124.216718	125.225237	46	69	KEEP	---	---	---	---	29	26	40	35	-1	capture	Silent	SNP	216373084	216373084	USH2A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	324	25	2	2	16918	40
ZP4	57829	broad.mit.edu	37	1	238053434	238053434	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:238053434C>G	uc001hym.2	-	2	218	c.218G>C	c.(217-219)TGT>TCT	p.C73S	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	73	Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CCAGGTGCCACAGTCGGAGTC	0.562	NSCLC(166;160 2029 11600 18754 19936)															0.055556	-11.265304	22.403287	9	153	KEEP	---	---	---	---	5	6	79	92	-1	capture	Missense_Mutation	SNP	238053434	238053434	ZP4	1	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	18094	40
OR2W5	441932	broad.mit.edu	37	1	247654759	247654759	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247654759C>T	uc001icz.1	+	1	330	c.330C>T	c.(328-330)ACC>ACT	p.T110T		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	110	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.T110T(1)		ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TGGGCTCCACCGAGTGCGTCC	0.607																0.06962	-7.196768	23.024509	11	147	KEEP	---	---	---	---	5	7	88	73	-1	capture	Silent	SNP	247654759	247654759	OR2W5	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10938	40
MUC5B	727897	broad.mit.edu	37	11	1267649	1267649	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1267649C>T	uc009ycr.1	+	49	11414	c.11288C>T	c.(11287-11289)ACG>ATG	p.T3763M	MUC5B_uc001ltb.2_Missense_Mutation_p.T3183M	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3180	7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCGGATCCACGGCCACCGCC	0.687																0.115385	8.531629	19.887414	9	69	KEEP	---	---	---	---	5	7	68	49	-1	capture	Missense_Mutation	SNP	1267649	1267649	MUC5B	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9889	40
LRRC55	219527	broad.mit.edu	37	11	56949722	56949722	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56949722C>T	uc001njl.1	+	1	502	c.355C>T	c.(355-357)CGC>TGC	p.R119C		NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	89	LRR 1.					integral to membrane					0						GGCCCACAACCGCATCACAGC	0.597																0.371429	72.924307	73.943518	26	44	KEEP	---	---	---	---	20	14	28	24	-1	capture	Missense_Mutation	SNP	56949722	56949722	LRRC55	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8926	40
AHNAK	79026	broad.mit.edu	37	11	62301253	62301253	+	Silent	SNP	C	T	T	rs141489091	byFrequency	TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62301253C>T	uc001ntl.2	-	5	936	c.636G>A	c.(634-636)TCG>TCA	p.S212S	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	212					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				AGGCTGCCCCCGAGCCCGAGG	0.562																0.372093	83.561646	84.80285	32	54	KEEP	---	---	---	---	25	20	43	42	-1	capture	Silent	SNP	62301253	62301253	AHNAK	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	414	40
SNX15	29907	broad.mit.edu	37	11	64800008	64800008	+	Missense_Mutation	SNP	C	T	T	rs142024969	byFrequency	TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64800008C>T	uc001oci.3	+	6	894	c.241C>T	c.(241-243)CGG>TGG	p.R81W	SNX15_uc009ypy.2_Missense_Mutation_p.R81W|SNX15_uc001ocj.2_Missense_Mutation_p.R81W|SNX15_uc001ock.2_Missense_Mutation_p.R81W	NM_013306	NP_037438	Q9NRS6	SNX15_HUMAN	sorting nexin 15 isoform A	81	PX.				cell communication|intracellular protein transport	cytoplasmic vesicle membrane|cytosol	phosphatidylinositol binding|protein transporter activity			ovary(1)	1						TGCTTTCCCCCGGGCCCAGGT	0.627	Esophageal Squamous(56;269 1304 3324 8253)															0.2	38.926176	46.04148	17	68	KEEP	---	---	---	---	7	13	43	41	-1	capture	Missense_Mutation	SNP	64800008	64800008	SNX15	11	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	14778	40
HSPB2	3316	broad.mit.edu	37	11	111784541	111784541	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:111784541C>T	uc001pmg.2	+	2	565	c.471C>T	c.(469-471)GTC>GTT	p.V157V	CRYAB_uc001pmf.1_5'Flank|CRYAB_uc010rwp.1_5'Flank|HSPB2_uc009yyj.2_RNA|C11orf52_uc001pmh.2_Intron	NM_001541	NP_001532	Q16082	HSPB2_HUMAN	heat shock 27kDa protein 2	157					response to heat|response to unfolded protein	cytosol|nucleus	enzyme activator activity|protein binding			ovary(2)|skin(1)	3		all_cancers(61;3.75e-11)|all_epithelial(67;2.33e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;3.57e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.57e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.051)		ACACAGAGGTCAATGAGGTCT	0.592																0.151163	19.413439	29.445583	13	73	KEEP	---	---	---	---	9	6	48	31	-1	capture	Silent	SNP	111784541	111784541	HSPB2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	7345	40
PDZD3	79849	broad.mit.edu	37	11	119059718	119059718	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119059718C>T	uc001pwb.2	+	8	2014	c.1490C>T	c.(1489-1491)ACT>ATT	p.T497I	PDZD3_uc001pvy.2_Missense_Mutation_p.T417I|PDZD3_uc001pvz.2_Missense_Mutation_p.T431I|PDZD3_uc010rzd.1_Missense_Mutation_p.T418I|PDZD3_uc001pwa.2_Missense_Mutation_p.T127I			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;	497	PDZ 4.				cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		CACCAGGTGACTCCAGGAGGC	0.602																0.077844	-4.568505	25.888051	13	154	KEEP	---	---	---	---	8	7	95	91	-1	capture	Missense_Mutation	SNP	119059718	119059718	PDZD3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	11605	40
VSIG2	23584	broad.mit.edu	37	11	124620786	124620786	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124620786G>A	uc001qas.2	-	3	327	c.251C>T	c.(250-252)CCA>CTA	p.P84L	VSIG2_uc001qat.2_Missense_Mutation_p.P84L	NM_014312	NP_055127	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	84	Extracellular (Potential).|Ig-like V-type.					integral to plasma membrane|membrane fraction				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		AGAACCAGTTGGATACAGATG	0.537																0.03252	-22.816108	6.566111	4	119	KEEP	---	---	---	---	3	1	68	64	-1	capture	Missense_Mutation	SNP	124620786	124620786	VSIG2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	17106	40
SLC6A13	6540	broad.mit.edu	37	12	333649	333649	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:333649C>T	uc001qic.1	-	10	1144	c.1091G>A	c.(1090-1092)CGG>CAG	p.R364Q	SLC6A13_uc009zdj.1_Missense_Mutation_p.R354Q|SLC6A13_uc010sdl.1_Missense_Mutation_p.R272Q	NM_016615	NP_057699	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter	364					neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			CACCACAGCCCGCGGGTAAGC	0.617																0.440367	136.982507	137.320354	48	61	KEEP	---	---	---	---	21	38	30	43	-1	capture	Missense_Mutation	SNP	333649	333649	SLC6A13	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14568	40
TMTC1	83857	broad.mit.edu	37	12	29786150	29786150	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:29786150C>T	uc001rjb.2	-	6	1208	c.734G>A	c.(733-735)CGG>CAG	p.R245Q	TMTC1_uc001riz.2_Missense_Mutation_p.R2Q|TMTC1_uc001rja.2_Missense_Mutation_p.R89Q|TMTC1_uc001rjc.1_Missense_Mutation_p.R307Q	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	353						integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GGCTAAGTTCCGCATGTCCCA	0.498																0.482759	221.346659	221.383913	70	75	KEEP	---	---	---	---	37	39	38	41	-1	capture	Missense_Mutation	SNP	29786150	29786150	TMTC1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16143	40
ARHGAP9	64333	broad.mit.edu	37	12	57872982	57872982	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57872982G>A	uc001sod.2	-	5	614	c.421C>T	c.(421-423)CCC>TCC	p.P141S	ARHGAP9_uc001snz.2_5'Flank|ARHGAP9_uc001soa.2_5'Flank|ARHGAP9_uc001sob.2_Missense_Mutation_p.P70S|ARHGAP9_uc001soc.2_Missense_Mutation_p.P70S|ARHGAP9_uc001soe.1_Missense_Mutation_p.P149S|ARHGAP9_uc010sro.1_Missense_Mutation_p.P70S	NM_032496	NP_115885	Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9 isoform 1	70	SH3.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			lung(1)	1			GBM - Glioblastoma multiforme(3;3.37e-34)			GAGGTGGAGGGAGCTTCTAGG	0.567																0.378788	207.168563	209.722653	75	123	KEEP	---	---	---	---	45	42	68	71	-1	capture	Missense_Mutation	SNP	57872982	57872982	ARHGAP9	12	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	882	40
NTN4	59277	broad.mit.edu	37	12	96180812	96180812	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:96180812A>G	uc001tei.2	-	2	939	c.490T>C	c.(490-492)TGC>CGC	p.C164R	NTN4_uc009ztf.2_Missense_Mutation_p.C164R|NTN4_uc009ztg.2_Missense_Mutation_p.C127R	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor	164	Laminin N-terminal.				axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						GTAGCGGAGCAGTTAGTCGCA	0.493																0.075188	0.843346	25.463325	10	123	KEEP	---	---	---	---	5	7	72	64	-1	capture	Missense_Mutation	SNP	96180812	96180812	NTN4	12	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	10609	40
UNC119B	84747	broad.mit.edu	37	12	121154526	121154526	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121154526C>T	uc001tyz.2	+	3	901	c.454C>T	c.(454-456)CGG>TGG	p.R152W		NM_001080533	NP_001074002	A6NIH7	U119B_HUMAN	unc-119 homolog B	152										haematopoietic_and_lymphoid_tissue(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TCTCCGCCTCCGGACAGTCGG	0.532																0.467105	423.553301	423.835641	142	162	KEEP	---	---	---	---	84	75	94	77	-1	capture	Missense_Mutation	SNP	121154526	121154526	UNC119B	12	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	16865	40
KBTBD6	89890	broad.mit.edu	37	13	41705381	41705381	+	Silent	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:41705381G>A	uc001uxu.1	-	1	1556	c.1267C>T	c.(1267-1269)CTG>TTG	p.L423L	KBTBD6_uc010ace.1_Intron|KBTBD6_uc010tfe.1_Silent_p.L357L|uc001uxv.1_5'Flank	NM_152903	NP_690867	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain-containing 6	423	Kelch 1.						protein binding			ovary(1)|skin(1)	2		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		TCACGACACAGCAAGCGATCT	0.493																0.020725	-42.785909	6.86826	4	189	KEEP	---	---	---	---	0	4	111	102	-1	capture	Silent	SNP	41705381	41705381	KBTBD6	13	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	7919	40
C15orf52	388115	broad.mit.edu	37	15	40630791	40630791	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40630791C>T	uc001zlh.3	-	5	606	c.590G>A	c.(589-591)CGT>CAT	p.R197H	C15orf52_uc001zli.1_Missense_Mutation_p.R129H|C15orf52_uc010ucn.1_5'Flank	NM_207380	NP_997263	Q6ZUT6	CO052_HUMAN	hypothetical protein LOC388115	197										large_intestine(1)	1		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		TCGGGTCACACGCCCTCCAGG	0.577														OREG0023060	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.021622	-40.78549	6.449177	4	181	KEEP	---	---	---	---	2	2	100	101	-1	capture	Missense_Mutation	SNP	40630791	40630791	C15orf52	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1786	40
TP53BP1	7158	broad.mit.edu	37	15	43773221	43773221	+	Splice_Site	SNP	C	G	G			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43773221C>G	uc001zrs.2	-	5	505	c.357_splice	c.e5-1	p.S119_splice	TP53BP1_uc010udp.1_Splice_Site_p.S119_splice|TP53BP1_uc001zrq.3_Splice_Site_p.S124_splice|TP53BP1_uc001zrr.3_Splice_Site_p.S124_splice|TP53BP1_uc010udq.1_Splice_Site_p.S124_splice	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3						double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TCCCAGAACACTACACAGCAG	0.333					421						Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					0.173611	67.082376	81.563981	25	119	KEEP	---	---	---	---	14	18	75	58	-1	capture	Splice_Site	SNP	43773221	43773221	TP53BP1	15	C	G	G	G	1	0	0	0	0	0	0	1	0	260	20	5	4	16266	40
GCOM1	145781	broad.mit.edu	37	15	58006757	58006757	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:58006757G>A	uc002aeo.2	+	13	1447	c.1328G>A	c.(1327-1329)CGC>CAC	p.R443H	GCOM1_uc002aem.2_Silent_p.A511A|GCOM1_uc002aeq.2_RNA|GCOM1_uc002aen.2_RNA|GCOM1_uc010bfy.2_RNA|GCOM1_uc002aep.2_RNA|GCOM1_uc010bfx.2_RNA|GRINL1A_uc002aes.2_Silent_p.A98A|GRINL1A_uc010ugu.1_RNA|GRINL1A_uc002aet.3_Silent_p.A329A|GRINL1A_uc002aeu.3_Silent_p.A172A	NM_001018091	NP_001018101	P0CAP1	GCOM1_HUMAN	GRINL1A combined protein isoform 2	51					intracellular signal transduction	extrinsic to internal side of plasma membrane|I band				ovary(1)	1						AGCTCGCAGCGCAAAAATTAG	0.398																0.025478	-32.811695	6.334924	4	153	KEEP	---	---	---	---	2	3	86	79	-1	capture	Missense_Mutation	SNP	58006757	58006757	GCOM1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6244	40
ZSCAN10	84891	broad.mit.edu	37	16	3140535	3140535	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3140535C>T	uc002ctv.1	-	5	823	c.735G>A	c.(733-735)CCG>CCA	p.P245P	ZSCAN10_uc002cty.1_5'UTR|ZSCAN10_uc002ctw.1_Silent_p.P163P|ZSCAN10_uc002ctx.1_Silent_p.P173P	NM_032805	NP_116194	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	245					negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						AAGGCTCTCCCGGCACCCCAG	0.602																0.469565	163.631525	163.724845	54	61	KEEP	---	---	---	---	37	39	39	44	-1	capture	Silent	SNP	3140535	3140535	ZSCAN10	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	18103	40
MYH11	4629	broad.mit.edu	37	16	15818586	15818586	+	Missense_Mutation	SNP	C	T	T	rs150883363		TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:15818586C>T	uc002ddy.2	-	30	4141	c.4034G>A	c.(4033-4035)CGG>CAG	p.R1345Q	MYH11_uc002ddv.2_Missense_Mutation_p.R1352Q|MYH11_uc002ddw.2_Missense_Mutation_p.R1345Q|MYH11_uc002ddx.2_Missense_Mutation_p.R1352Q|MYH11_uc010bvg.2_Missense_Mutation_p.R1177Q|NDE1_uc010uzy.1_3'UTR|NDE1_uc002dds.2_3'UTR|MYH11_uc010bvh.2_Missense_Mutation_p.R51Q|NDE1_uc002ddz.1_RNA	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	1345	Potential.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						CAGGCTGTTCCGCTCCTCCTC	0.597					1257	T	CBFB	AML								0.32872	259.833331	267.346785	95	194	KEEP	---	---	---	---	54	69	125	99	-1	capture	Missense_Mutation	SNP	15818586	15818586	MYH11	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9941	40
PRKCB	5579	broad.mit.edu	37	16	24231309	24231309	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24231309G>A	uc002dmd.2	+	17	2088	c.1891G>A	c.(1891-1893)GAC>AAC	p.D631N	PRKCB_uc002dme.2_3'UTR	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	631	AGC-kinase C-terminal.				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	CTCCAACTTCGACAAAGAGTT	0.433					395											0.506173	124.97817	124.980948	41	40	KEEP	---	---	---	---	30	12	19	24	-1	capture	Missense_Mutation	SNP	24231309	24231309	PRKCB	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12404	40
CHD9	80205	broad.mit.edu	37	16	53337775	53337775	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53337775C>T	uc002ehb.2	+	30	6021	c.5857C>T	c.(5857-5859)CCA>TCA	p.P1953S	CHD9_uc002egy.2_Missense_Mutation_p.P1953S|CHD9_uc002ehc.2_Missense_Mutation_p.P1953S|CHD9_uc002ehf.2_Missense_Mutation_p.P1067S|CHD9_uc010cbw.2_Intron|CHD9_uc002ehg.1_5'UTR	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1953					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				GCTTTGCCATCCAAATCCAGA	0.478					1157											0.061224	-9.76477	10.116055	6	92	KEEP	---	---	---	---	5	2	60	46	-1	capture	Missense_Mutation	SNP	53337775	53337775	CHD9	16	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	3298	40
ASGR2	433	broad.mit.edu	37	17	7005462	7005462	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7005462G>T	uc002gep.3	-	8	982	c.717C>A	c.(715-717)GAC>GAA	p.D239E	ASGR2_uc010vtk.1_Missense_Mutation_p.D76E|ASGR2_uc002gem.1_Missense_Mutation_p.D178E|ASGR2_uc002gen.1_Missense_Mutation_p.D220E|ASGR2_uc002geo.1_Missense_Mutation_p.D234E|ASGR2_uc002ger.3_Missense_Mutation_p.D239E|ASGR2_uc002geq.3_Missense_Mutation_p.D215E	NM_001181	NP_001172	P07307	ASGR2_HUMAN	asialoglycoprotein receptor 2 isoform a	239	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway|endocytosis	focal adhesion|integral to membrane|nucleolus	asialoglycoprotein receptor activity|protein binding|sugar binding			ovary(1)	1					Antihemophilic Factor(DB00025)	AGCCATCACTGTCCGTGAGAC	0.458																0.085317	15.103811	103.020822	43	461	KEEP	---	---	---	---	24	26	318	260	0.48	capture	Missense_Mutation	SNP	7005462	7005462	ASGR2	17	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	1031	40
KIF19	124602	broad.mit.edu	37	17	72346919	72346919	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72346919G>A	uc002jkm.3	+	12	1600	c.1462G>A	c.(1462-1464)GAC>AAC	p.D488N	KIF19_uc002jkj.2_Missense_Mutation_p.D488N|KIF19_uc002jkk.2_Missense_Mutation_p.D446N|KIF19_uc002jkl.2_Missense_Mutation_p.D446N	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	488					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						CGCTAAGGACGACAGCGAGAA	0.637																0.219858	69.461812	79.645125	31	110	KEEP	---	---	---	---	18	14	43	76	-1	capture	Missense_Mutation	SNP	72346919	72346919	KIF19	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8204	40
DSG3	1830	broad.mit.edu	37	18	29056162	29056162	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29056162C>T	uc002kws.2	+	16	3048	c.2939C>T	c.(2938-2940)ACG>ATG	p.T980M	DSG3_uc002kwt.2_Missense_Mutation_p.T262M	NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	980	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GCTGGCCCAACGCAGCTACGA	0.488																0.381148	257.506164	260.532642	93	151	KEEP	---	---	---	---	68	39	92	83	-1	capture	Missense_Mutation	SNP	29056162	29056162	DSG3	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4733	40
ZBTB7C	201501	broad.mit.edu	37	18	45567452	45567452	+	Silent	SNP	A	G	G			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:45567452A>G	uc002lda.2	-	1	43	c.27T>C	c.(25-27)ATT>ATC	p.I9I	ZBTB7C_uc002ldb.2_Silent_p.I9I|ZBTB7C_uc010dnu.2_Silent_p.I18I|ZBTB7C_uc010dnv.2_Silent_p.I31I|ZBTB7C_uc010dnw.2_Silent_p.I9I|ZBTB7C_uc010dnx.1_Silent_p.I9I|ZBTB7C_uc010dny.1_Silent_p.I9I|ZBTB7C_uc010dnz.1_Silent_p.I31I|ZBTB7C_uc010dob.1_Silent_p.I9I|ZBTB7C_uc010doc.1_Silent_p.I18I|ZBTB7C_uc010dod.1_Silent_p.I31I|ZBTB7C_uc010doe.1_Silent_p.I9I|ZBTB7C_uc010dof.1_Silent_p.I9I|ZBTB7C_uc010dog.1_Silent_p.I9I|ZBTB7C_uc010doh.1_Silent_p.I18I|ZBTB7C_uc010doi.1_Silent_p.I9I|ZBTB7C_uc010doj.1_Silent_p.I18I|ZBTB7C_uc010dok.1_Silent_p.I58I|ZBTB7C_uc010dol.1_Silent_p.I18I|ZBTB7C_uc010doa.1_Silent_p.I31I|ZBTB7C_uc010don.1_Silent_p.I17I|ZBTB7C_uc010doo.1_Silent_p.I9I|ZBTB7C_uc010dop.1_Silent_p.I9I|ZBTB7C_uc010doq.1_Silent_p.I18I|ZBTB7C_uc010dor.1_Silent_p.I31I|ZBTB7C_uc010dos.1_Silent_p.I9I|ZBTB7C_uc010dot.1_Silent_p.I9I|ZBTB7C_uc010dou.1_Silent_p.I18I|ZBTB7C_uc010dom.1_Silent_p.I18I	NM_001039360	NP_001034449	A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	9						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						AGGGAATGCCAATGAGCTCAT	0.582																0.320513	76.150123	78.381043	25	53	KEEP	---	---	---	---	16	16	28	37	-1	capture	Silent	SNP	45567452	45567452	ZBTB7C	18	A	G	G	G	1	0	0	0	0	0	0	0	1	60	5	3	3	17435	40
CHAF1A	10036	broad.mit.edu	37	19	4409752	4409752	+	Missense_Mutation	SNP	G	A	A	rs112018734		TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4409752G>A	uc002mal.2	+	3	1056	c.956G>A	c.(955-957)CGC>CAC	p.R319H		NM_005483	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	319					cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGCCCCTCCGCAGAGTGAGT	0.627											Chromatin_Structure					0.036269	-33.24949	11.793254	7	186	KEEP	---	---	---	---	2	6	123	105	-1	capture	Missense_Mutation	SNP	4409752	4409752	CHAF1A	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3277	40
PAPL	390928	broad.mit.edu	37	19	39589268	39589268	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39589268C>T	uc002oki.2	+	3	566	c.292C>T	c.(292-294)CTT>TTT	p.L98F	PAPL_uc010egl.2_Missense_Mutation_p.L98F	NM_001004318	NP_001004318	Q6ZNF0	PAPL_HUMAN	iron/zinc purple acid phosphatase-like protein	98						extracellular region	acid phosphatase activity|metal ion binding				0						CCGAGTCACGCTTCGCAAGCT	0.647																0.333333	71.622502	73.5421	26	52	KEEP	---	---	---	---	15	20	37	31	-1	capture	Missense_Mutation	SNP	39589268	39589268	PAPL	19	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	11331	40
PSG9	5678	broad.mit.edu	37	19	43766068	43766068	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43766068T>C	uc002owd.3	-	3	752	c.653A>G	c.(652-654)GAA>GGA	p.E218G	PSG9_uc002owe.3_Missense_Mutation_p.E218G|PSG9_uc010xwm.1_Intron|PSG9_uc002owf.3_Intron|PSG9_uc002owg.2_Missense_Mutation_p.E218G|PSG9_uc002owh.2_Intron	NM_002784	NP_002775	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	218	Ig-like C2-type 1.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				GTTCCGTATTTCACATTCATA	0.512																0.026573	-134.595253	42.514304	19	696	KEEP	---	---	---	---	8	14	417	425	-1	capture	Missense_Mutation	SNP	43766068	43766068	PSG9	19	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	12557	40
NLRP5	126206	broad.mit.edu	37	19	56539799	56539799	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56539799C>T	uc002qmj.2	+	7	2200	c.2200C>T	c.(2200-2202)CGG>TGG	p.R734W	NLRP5_uc002qmi.2_Missense_Mutation_p.R715W	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	734	LRR 2.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TCCGTATTTGCGGAAAATTCG	0.502																0.262729	305.869991	330.866028	129	362	KEEP	---	---	---	---	69	70	199	191	-1	capture	Missense_Mutation	SNP	56539799	56539799	NLRP5	19	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	10387	40
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393																0.09375	1.298862	6.609562	3	29	KEEP	---	---	---	---	0	3	12	17	-1	capture	Missense_Mutation	SNP	58385546	58385546	ZNF814	19	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	18052	40
TCF23	150921	broad.mit.edu	37	2	27373157	27373157	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27373157G>A	uc010ylg.1	+	2	389	c.389G>A	c.(388-390)CGC>CAC	p.R130H		NM_175769	NP_786951	Q7RTU1	TCF23_HUMAN	transcription factor 23	130	Helix-loop-helix motif.				cell differentiation|muscle organ development|regulation of transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCTCACCCGCACACTCGGC	0.652																0.018182	-78.008103	8.278559	6	324	KEEP	---	---	---	---	3	3	166	188	-1	capture	Missense_Mutation	SNP	27373157	27373157	TCF23	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15577	40
PLB1	151056	broad.mit.edu	37	2	28764631	28764631	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:28764631G>A	uc002rmb.1	+	13	832	c.832G>A	c.(832-834)GTG>ATG	p.V278M	PLB1_uc010ezj.1_Missense_Mutation_p.V289M	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor	278	4 X 308-326 AA approximate repeats.|Extracellular (Potential).|1.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity	p.V278M(1)		ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					GTCCTTCACCGTGGTTTTCCA	0.537																0.357143	108.764797	110.779669	40	72	KEEP	---	---	---	---	30	17	47	42	-1	capture	Missense_Mutation	SNP	28764631	28764631	PLB1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11927	40
TTN	7273	broad.mit.edu	37	2	179455353	179455353	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179455353G>A	uc010zfg.1	-	253	53619	c.53395C>T	c.(53395-53397)CGG>TGG	p.R17799W	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R11494W|TTN_uc010zfi.1_Missense_Mutation_p.R11427W|TTN_uc010zfj.1_Missense_Mutation_p.R11302W	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18726							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGATGGGCCGGCAAGCTTTT	0.433				p.R17799W(OC316-Tumor)|p.R17799W(BICR16-Tumor)	8722											0.384146	188.18489	190.114965	63	101	KEEP	---	---	---	---	35	37	68	52	-1	capture	Missense_Mutation	SNP	179455353	179455353	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16617	40
STAT1	6772	broad.mit.edu	37	2	191862974	191862974	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:191862974T>A	uc002usj.2	-	8	990	c.602A>T	c.(601-603)AAG>ATG	p.K201M	STAT1_uc010fse.1_Missense_Mutation_p.K201M|STAT1_uc002usk.2_Missense_Mutation_p.K201M|STAT1_uc002usl.2_Missense_Mutation_p.K203M|STAT1_uc010fsf.1_Intron	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription	201					activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity	p.K201M(1)		lung(3)|breast(3)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Fludarabine(DB01073)	TAAATACATCTTCTTGAGTAA	0.338					350											0.301435	162.434528	169.799627	63	146	KEEP	---	---	---	---	38	37	87	88	-1	capture	Missense_Mutation	SNP	191862974	191862974	STAT1	2	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	15154	40
COL6A3	1293	broad.mit.edu	37	2	238283533	238283533	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238283533C>T	uc002vwl.2	-	8	3486	c.3201G>A	c.(3199-3201)GTG>GTA	p.V1067V	COL6A3_uc002vwo.2_Silent_p.V861V|COL6A3_uc010znj.1_Silent_p.V460V|COL6A3_uc002vwq.2_Silent_p.V861V|COL6A3_uc002vwr.2_Silent_p.V660V	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1067	Nonhelical region.|VWFA 6.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCACCACGGCCACGCGGACCC	0.602																0.115789	12.053867	25.865359	11	84	KEEP	---	---	---	---	6	9	54	45	-1	capture	Silent	SNP	238283533	238283533	COL6A3	2	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	3666	40
LBP	3929	broad.mit.edu	37	20	36989406	36989406	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36989406C>T	uc002xic.1	+	6	672	c.637C>T	c.(637-639)CTC>TTC	p.L213F		NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor	213					acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				ACAGCCTTATCTCCAAACTCT	0.418																0.298137	276.762233	288.497978	96	226	KEEP	---	---	---	---	53	59	127	146	-1	capture	Missense_Mutation	SNP	36989406	36989406	LBP	20	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	8571	40
SEMG1	6406	broad.mit.edu	37	20	43836503	43836503	+	Nonsense_Mutation	SNP	G	T	T	rs113377758	byFrequency;by1000genomes	TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43836503G>T	uc002xni.2	+	2	622	c.565G>T	c.(565-567)GGA>TGA	p.G189*	SEMG1_uc002xnj.2_Nonsense_Mutation_p.G189*|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Nonsense_Mutation_p.G189*	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	189	42 AA repeat 1.				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				AAAACAAGGCGGATCCCAAAG	0.388																0.057143	-13.991962	22.03428	10	165	KEEP	---	---	---	---	5	6	83	93	0.454545454545	capture	Nonsense_Mutation	SNP	43836503	43836503	SEMG1	20	G	T	T	T	1	0	0	0	0	0	1	0	0	507	39	5	4	13937	40
ZNF831	128611	broad.mit.edu	37	20	57769723	57769723	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:57769723C>T	uc002yan.2	+	1	3649	c.3649C>T	c.(3649-3651)CGA>TGA	p.R1217*		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1217						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					TAGCAGCCTCCGAGATGAGGG	0.627																0.32	68.278517	70.434903	24	51	KEEP	---	---	---	---	18	8	29	29	-1	capture	Nonsense_Mutation	SNP	57769723	57769723	ZNF831	20	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	18061	40
PKNOX1	5316	broad.mit.edu	37	21	44437070	44437070	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:44437070C>T	uc002zcq.1	+	6	763	c.575C>T	c.(574-576)CCG>CTG	p.P192L	PKNOX1_uc002zcp.1_Missense_Mutation_p.P192L|PKNOX1_uc011aex.1_Missense_Mutation_p.P75L|PKNOX1_uc002zcr.2_Missense_Mutation_p.P192L	NM_004571	NP_004562	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1	192							sequence-specific DNA binding			large_intestine(2)	2						ATTGTGGTGCCGGCGTCCGCG	0.502																0.337349	76.175995	78.117525	28	55	KEEP	---	---	---	---	13	19	40	31	-1	capture	Missense_Mutation	SNP	44437070	44437070	PKNOX1	21	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11885	40
C21orf56	84221	broad.mit.edu	37	21	47588353	47588353	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47588353C>T	uc011afu.1	-	3	1475	c.413G>A	c.(412-414)AGC>AAC	p.S138N	C21orf56_uc002zii.2_5'UTR	NM_001142854	NP_001136326	Q9H0A9	CU056_HUMAN	hypothetical protein LOC84221 isoform 1	138							protein binding			skin(1)	1	Breast(49;0.214)			Colorectal(79;0.241)		TTGCAAGGGGCTCAGGAGCGG	0.652																0.194444	16.403269	19.538965	7	29	KEEP	---	---	---	---	4	4	20	12	-1	capture	Missense_Mutation	SNP	47588353	47588353	C21orf56	21	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	2108	40
FBLN2	2199	broad.mit.edu	37	3	13679197	13679197	+	Silent	SNP	C	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13679197C>A	uc011avb.1	+	17	3458	c.3333C>A	c.(3331-3333)GCC>GCA	p.A1111A	FBLN2_uc011auz.1_Silent_p.A1137A|FBLN2_uc011ava.1_Silent_p.A1158A|FBLN2_uc011avc.1_Silent_p.A1158A	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	1111	Domain III.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CCGCGCCAGCCTTCACGGGGG	0.622																0.111111	6.945755	17.714925	8	64	KEEP	---	---	---	---	4	4	42	30	0.5	capture	Silent	SNP	13679197	13679197	FBLN2	3	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	5645	40
C3orf67	200844	broad.mit.edu	37	3	58849423	58849423	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58849423C>T	uc003dkt.1	-	12	1488	c.1079G>A	c.(1078-1080)CGA>CAA	p.R360Q	C3orf67_uc003dks.1_Missense_Mutation_p.R175Q|uc003dku.1_Intron|C3orf67_uc003dkv.1_Missense_Mutation_p.R175Q|C3orf67_uc003dkw.2_Missense_Mutation_p.R255Q	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844	360											0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		AGGTGCTGATCGTGGTCTTGA	0.473																0.421053	163.783071	164.504743	56	77	KEEP	---	---	---	---	35	35	50	45	-1	capture	Missense_Mutation	SNP	58849423	58849423	C3orf67	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2221	40
IQCB1	9657	broad.mit.edu	37	3	121489274	121489274	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121489274G>A	uc010hre.1	-	15	1930	c.1715C>T	c.(1714-1716)TCT>TTT	p.S572F	IQCB1_uc003eek.2_Missense_Mutation_p.S439F|IQCB1_uc010hrf.1_RNA	NM_001023570	NP_001018864	Q15051	IQCB1_HUMAN	IQ motif containing B1 isoform a	572					cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding				0				GBM - Glioblastoma multiforme(114;0.0983)		CTCATCTCCAGATTCTTCTCC	0.448																0.015291	-78.327119	8.86742	5	322	KEEP	---	---	---	---	3	2	213	149	-1	capture	Missense_Mutation	SNP	121489274	121489274	IQCB1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	7726	40
AMOTL2	51421	broad.mit.edu	37	3	134080563	134080563	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:134080563C>T	uc003eqf.2	-	6	1657	c.1540G>A	c.(1540-1542)GAG>AAG	p.E514K	AMOTL2_uc003eqg.1_Missense_Mutation_p.E456K|AMOTL2_uc003eqh.1_Missense_Mutation_p.E456K|AMOTL2_uc003eqe.1_Missense_Mutation_p.E81K	NM_016201	NP_057285	Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	456	Potential.									large_intestine(1)	1						TCCAGCAGCTCGGCACGCCGC	0.652																0.47619	26.96803	26.976527	10	11	KEEP	---	---	---	---	6	8	10	8	-1	capture	Missense_Mutation	SNP	134080563	134080563	AMOTL2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	584	40
EPHB1	2047	broad.mit.edu	37	3	134920443	134920443	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:134920443A>G	uc003eqt.2	+	12	2478	c.2258A>G	c.(2257-2259)AAC>AGC	p.N753S	EPHB1_uc003equ.2_Missense_Mutation_p.N314S	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	753	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding	p.N753S(1)|p.N753N(1)		lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						ATTCTGGTCAACAGTAACCTG	0.552					376											0.460526	370.386672	370.691555	105	123	KEEP	---	---	---	---	56	56	72	60	-1	capture	Missense_Mutation	SNP	134920443	134920443	EPHB1	3	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	5129	40
TRIM59	286827	broad.mit.edu	37	3	160156161	160156161	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:160156161C>T	uc003fdm.2	-	3	1006	c.811G>A	c.(811-813)GAG>AAG	p.E271K	IFT80_uc003fda.2_RNA	NM_173084	NP_775107	Q8IWR1	TRI59_HUMAN	tripartite motif-containing 59	271						integral to membrane|intracellular	zinc ion binding				0			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GGTTGAACCTCAGGAAGTGGT	0.363																0.40942	319.103995	321.087314	113	163	KEEP	---	---	---	---	63	60	99	81	-1	capture	Missense_Mutation	SNP	160156161	160156161	TRIM59	3	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	16415	40
SPATA5	166378	broad.mit.edu	37	4	123868606	123868606	+	Silent	SNP	C	T	T	rs139834687	byFrequency	TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:123868606C>T	uc003iez.3	+	9	1750	c.1677C>T	c.(1675-1677)TAC>TAT	p.Y559Y	SPATA5_uc003iey.2_Silent_p.Y558Y	NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	559					cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						CTCATGGATACGTTGGAGCAG	0.468																0.142857	30.649115	49.580268	22	132	KEEP	---	---	---	---	10	13	90	72	-1	capture	Silent	SNP	123868606	123868606	SPATA5	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14903	40
PHF17	79960	broad.mit.edu	37	4	129770286	129770286	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:129770286T>A	uc003igk.2	+	5	728	c.448T>A	c.(448-450)TGG>AGG	p.W150R	PHF17_uc003igj.2_Missense_Mutation_p.W150R|PHF17_uc003igl.2_Missense_Mutation_p.W138R|PHF17_uc011cgy.1_Missense_Mutation_p.W150R|PHF17_uc003igm.2_Missense_Mutation_p.W150R	NM_199320	NP_955352	Q6IE81	JADE1_HUMAN	PHD finger protein 17 long isoform	150					apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding				0						GGATGCTGCATGGCTGGAACT	0.468																0.492754	113.951768	113.954845	34	35	KEEP	---	---	---	---	15	19	14	22	-1	capture	Missense_Mutation	SNP	129770286	129770286	PHF17	4	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	11731	40
FNIP2	57600	broad.mit.edu	37	4	159789510	159789510	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159789510C>T	uc003iqe.3	+	13	1905	c.1722C>T	c.(1720-1722)AAC>AAT	p.N574N		NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	574	Interaction with PRKAA1.				DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CGGTGAGGAACGAGCCCGCTC	0.537																0.056075	-10.736034	11.434988	6	101	KEEP	---	---	---	---	7	4	50	62	-1	capture	Silent	SNP	159789510	159789510	FNIP2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5920	40
HEATR7B2	133558	broad.mit.edu	37	5	41052628	41052628	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41052628C>T	uc003jmj.3	-	12	1659	c.1169G>A	c.(1168-1170)CGG>CAG	p.R390Q	HEATR7B2_uc003jmi.3_Intron	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	390							binding			ovary(6)|central_nervous_system(2)	8						CCATCCTTCCCGAGCTTCAAT	0.393																0.401709	136.094556	137.084535	47	70	KEEP	---	---	---	---	19	36	43	34	-1	capture	Missense_Mutation	SNP	41052628	41052628	HEATR7B2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6961	40
TRPC7	57113	broad.mit.edu	37	5	135692669	135692669	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:135692669C>T	uc003lbn.1	-	1	407	c.404G>A	c.(403-405)CGC>CAC	p.R135H	TRPC7_uc010jef.1_Missense_Mutation_p.R127H|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.R127H|TRPC7_uc010jei.1_Missense_Mutation_p.R127H|TRPC7_uc010jej.1_5'UTR	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	136	Cytoplasmic (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GAGCGTCAGGCGCTGGCCCTG	0.672																0.440476	101.569772	101.826969	37	47	KEEP	---	---	---	---	16	23	23	29	-1	capture	Missense_Mutation	SNP	135692669	135692669	TRPC7	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16467	40
UNC5A	90249	broad.mit.edu	37	5	176304269	176304269	+	Silent	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176304269G>A	uc003mey.2	+	9	1647	c.1455G>A	c.(1453-1455)CCG>CCA	p.P485P		NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1 precursor	485	ZU5.|Cytoplasmic (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGCACAAGCCGGAAGACGTGA	0.652																0.333333	60.152442	61.703063	21	42	KEEP	---	---	---	---	21	15	54	30	-1	capture	Silent	SNP	176304269	176304269	UNC5A	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	16873	40
ATXN1	6310	broad.mit.edu	37	6	16306892	16306892	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:16306892C>T	uc003nbt.2	-	9	3087	c.2116G>A	c.(2116-2118)GTC>ATC	p.V706I	ATXN1_uc010jpi.2_Missense_Mutation_p.V706I|ATXN1_uc010jpj.1_RNA	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1	706	Interaction with USP7.|RNA-binding.				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				TTCAGCAGGACGCTGGCGGGA	0.582																0.356522	108.3398	110.426391	41	74	KEEP	---	---	---	---	33	14	44	35	-1	capture	Missense_Mutation	SNP	16306892	16306892	ATXN1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1200	40
MICB	4277	broad.mit.edu	37	6	31474865	31474865	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31474865C>T	uc003ntn.3	+	4	796	c.680C>T	c.(679-681)GCT>GTT	p.A227V	MICB_uc011dnm.1_Missense_Mutation_p.A195V|MICB_uc003nto.3_Missense_Mutation_p.A184V	NM_005931	NP_005922	Q29980	MICB_HUMAN	MHC class I polypeptide-related sequence B	227	Ig-like C1-type.|Extracellular (Potential).				antigen processing and presentation|cytolysis|gamma-delta T cell activation|immune response|immune response-activating cell surface receptor signaling pathway|interspecies interaction between organisms|negative regulation of defense response to virus by host|response to heat|response to oxidative stress|response to retinoic acid	integral to plasma membrane|MHC class I protein complex	natural killer cell lectin-like receptor binding				0						ACATGCAGGGCTTCCAGCTTC	0.587																0.312057	120.565878	124.990993	44	97	KEEP	---	---	---	---	28	21	51	63	-1	capture	Missense_Mutation	SNP	31474865	31474865	MICB	6	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	9487	40
KATNA1	11104	broad.mit.edu	37	6	149918283	149918283	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:149918283A>C	uc003qmr.1	-	9	1238	c.1193T>G	c.(1192-1194)TTG>TGG	p.L398W	KATNA1_uc003qms.2_Missense_Mutation_p.L398W|KATNA1_uc003qmt.2_Intron	NM_007044	NP_008975	O75449	KTNA1_HUMAN	katanin p60 subunit A 1	398					cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		AGCCAATTCCAACTCACGTAG	0.388																0.063158	-2.825899	16.045936	6	89	KEEP	---	---	---	---	4	2	51	53	-1	capture	Missense_Mutation	SNP	149918283	149918283	KATNA1	6	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	7907	40
SYTL3	94120	broad.mit.edu	37	6	159178400	159178400	+	Missense_Mutation	SNP	C	T	T	rs147104644		TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:159178400C>T	uc003qrp.2	+	13	1539	c.1295C>T	c.(1294-1296)CCG>CTG	p.P432L	SYTL3_uc011efp.1_Missense_Mutation_p.P432L|SYTL3_uc003qro.2_Missense_Mutation_p.P364L|SYTL3_uc003qrq.2_Missense_Mutation_p.P364L|SYTL3_uc003qrr.2_Missense_Mutation_p.P432L|SYTL3_uc003qrs.2_Missense_Mutation_p.P364L|SYTL3_uc011efq.1_Missense_Mutation_p.P158L	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	432					intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		CGCTGGCATCCGCTCCGGGCC	0.527																0.401961	123.853949	124.711433	41	61	KEEP	---	---	---	---	28	22	38	45	-1	capture	Missense_Mutation	SNP	159178400	159178400	SYTL3	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15372	40
MLLT4	4301	broad.mit.edu	37	6	168363130	168363130	+	Silent	SNP	G	C	C			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:168363130G>C	uc003qwd.2	+	31	5002	c.4860G>C	c.(4858-4860)CGG>CGC	p.R1620R	MLLT4_uc003qwc.1_Silent_p.R1608R|MLLT4_uc003qwg.1_Silent_p.R919R	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1610	Potential.				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		ACGAGGAGCGGAGGCGGCAGC	0.537					1250	T	MLL	AL								0.4375	71.768456	71.931884	21	27	KEEP	---	---	---	---	16	9	22	26	-1	capture	Silent	SNP	168363130	168363130	MLLT4	6	G	C	C	C	1	0	0	0	0	0	0	0	1	522	41	4	4	9541	40
MLLT4	4301	broad.mit.edu	37	6	168363191	168363191	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:168363191G>C	uc003qwd.2	+	31	5063	c.4921G>C	c.(4921-4923)GAG>CAG	p.E1641Q	MLLT4_uc003qwc.1_Missense_Mutation_p.E1629Q|MLLT4_uc003qwg.1_Missense_Mutation_p.E940Q	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1631	Potential.				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		AGCGAGGCAAGAGGAAGAGCG	0.542					1250	T	MLL	AL								0.341935	170.926912	174.349321	53	102	KEEP	---	---	---	---	30	43	62	75	-1	capture	Missense_Mutation	SNP	168363191	168363191	MLLT4	6	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	9541	40
ABCB5	340273	broad.mit.edu	37	7	20689724	20689724	+	Translation_Start_Site	SNP	C	T	T	rs144527025	by1000genomes	TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:20689724C>T	uc003suw.3	+	3	497	c.-49C>T	c.(-51--47)TACGG>TATGG		ABCB5_uc010kuh.2_Missense_Mutation_p.T429M|ABCB5_uc003suv.3_Translation_Start_Site|ABCB5_uc011jyi.1_Translation_Start_Site	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						GGGAAGAGTACGGTAGTCCAG	0.468																0.141667	22.09014	36.960109	17	103	KEEP	---	---	---	---	10	8	58	61	-1	capture	Translation_Start_Site	SNP	20689724	20689724	ABCB5	7	C	T	T	T	1	0	0	0	0	0	0	0	0	247	19	1	1	44	40
EGFR	1956	broad.mit.edu	37	7	55240707	55240707	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55240707G>A	uc003tqk.2	+	17	2197	c.1951G>A	c.(1951-1953)GTG>ATG	p.V651M	EGFR_uc010kzg.1_Missense_Mutation_p.V606M|EGFR_uc011kco.1_Missense_Mutation_p.V598M	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	651	Helical; (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V651M(2)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CACTGGGATGGTGGGGGCCCT	0.622			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.246173	418.256721	464.24087	193	591	KEEP	---	---	---	---	129	144	360	365	-1	capture	Missense_Mutation	SNP	55240707	55240707	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	4922	40
SEPT14	346288	broad.mit.edu	37	7	55874788	55874788	+	Silent	SNP	T	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55874788T>A	uc003tqz.2	-	8	1098	c.981A>T	c.(979-981)CCA>CCT	p.P327P		NM_207366	NP_997249	Q6ZU15	SEP14_HUMAN	septin 14	327					cell cycle|cell division	septin complex	GTP binding|protein binding				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTCACCTAACTGGCTGGTTGT	0.348																0.3	157.497957	164.289858	57	133	KEEP	---	---	---	---	31	42	83	74	-1	capture	Silent	SNP	55874788	55874788	SEPT14	7	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	13956	40
PSPH	5723	broad.mit.edu	37	7	56085002	56085002	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:56085002C>T	uc003trg.2	-	5	709	c.346G>A	c.(346-348)GTA>ATA	p.V116I	PSPH_uc003trh.2_Missense_Mutation_p.V116I|PSPH_uc003tri.2_Missense_Mutation_p.V116I|PSPH_uc003trj.2_Missense_Mutation_p.V145I	NM_004577	NP_004568	P78330	SERB_HUMAN	phosphoserine phosphatase	116					L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACATGCTCTACAATACTCCTA	0.393																0.04	-20.539539	7.986526	5	120	KEEP	---	---	---	---	3	3	74	61	-1	capture	Missense_Mutation	SNP	56085002	56085002	PSPH	7	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	12612	40
DYNC1I1	1780	broad.mit.edu	37	7	95499217	95499217	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:95499217G>A	uc003uoc.3	+	6	725	c.448G>A	c.(448-450)GTG>ATG	p.V150M	DYNC1I1_uc003uod.3_Missense_Mutation_p.V133M|DYNC1I1_uc003uob.2_Missense_Mutation_p.V113M|DYNC1I1_uc003uoe.3_Missense_Mutation_p.V130M|DYNC1I1_uc010lfl.2_Missense_Mutation_p.V139M	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	150					vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TAAACTGGGCGTGTCAAAGGT	0.453																0.321101	273.448655	282.751018	105	222	KEEP	---	---	---	---	47	74	122	125	-1	capture	Missense_Mutation	SNP	95499217	95499217	DYNC1I1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4797	40
RABL5	64792	broad.mit.edu	37	7	100959700	100959700	+	Silent	SNP	C	T	T	rs145991606	byFrequency;by1000genomes	TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100959700C>T	uc003uyl.2	-	4	433	c.330G>A	c.(328-330)CCG>CCA	p.P110P	RABL5_uc011kkk.1_Silent_p.P33P|RABL5_uc011kkl.1_Silent_p.P33P|RABL5_uc003uym.2_Silent_p.P80P|RABL5_uc010lhw.2_RNA|RABL5_uc011kkm.1_Silent_p.P110P	NM_022777	NP_073614	Q9H7X7	RABL5_HUMAN	RAB, member RAS oncogene family-like 5 isoform	110							GTP binding				0	Lung NSC(181;0.215)					CCTGTAAGGACGGCTGTTGGA	0.473																0.058182	-25.128129	31.153455	16	259	KEEP	---	---	---	---	7	10	152	135	-1	capture	Silent	SNP	100959700	100959700	RABL5	7	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	12868	40
LAMB4	22798	broad.mit.edu	37	7	107671256	107671256	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107671256C>T	uc010ljo.1	-	32	5071	c.4987G>A	c.(4987-4989)GAG>AAG	p.E1663K	LAMB4_uc003vey.2_Missense_Mutation_p.E1663K|LAMB4_uc010ljp.1_Missense_Mutation_p.E632K	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	1663	Potential.|Domain I.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						ATGACCTTCTCAAGACTCCCA	0.473																0.023018	-85.792227	13.350668	9	382	KEEP	---	---	---	---	4	6	233	214	-1	capture	Missense_Mutation	SNP	107671256	107671256	LAMB4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	8533	40
BRAF	673	broad.mit.edu	37	7	140453148	140453148	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140453148C>T	uc003vwc.3	-	15	1848	c.1787G>A	c.(1786-1788)GGT>GAT	p.G596D		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	596	Protein kinase.		G -> R (in a colorectal adenocarcinoma sample; somatic mutation).|G -> V (in CFC syndrome).		activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	p.G596R(4)|p.G596D(2)|p.G596fs*2(1)|p.D594_T599del(1)|p.G596S(1)	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	TGTAGCTAGACCAAAATCACC	0.388	Colon(40;35 892 2973 5743 27438)		61		451	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				0.100478	14.824759	48.131471	21	188	KEEP	---	---	---	---	10	14	104	114	-1	capture	Missense_Mutation	SNP	140453148	140453148	BRAF	7	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	1484	40
ADAM9	8754	broad.mit.edu	37	8	38873654	38873654	+	Silent	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:38873654G>A	uc003xmr.2	+	5	429	c.351G>A	c.(349-351)CGG>CGA	p.R117R	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	117	Extracellular (Potential).			Missing (in Ref. 2; no nucleotide entry).|R -> Q (in Ref. 4; BAA03499).	activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			GTCATTATCGGGGCTATGTGG	0.338																0.383562	254.601711	257.185685	84	135	KEEP	---	---	---	---	57	40	95	68	-1	capture	Silent	SNP	38873654	38873654	ADAM9	8	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	253	40
RP1	6101	broad.mit.edu	37	8	55539225	55539225	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:55539225C>A	uc003xsd.1	+	4	2931	c.2783C>A	c.(2782-2784)ACT>AAT	p.T928N	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	928					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCATATCCAACTTTAAAGCCT	0.328	Colon(91;1014 1389 7634 14542 40420)															0.0875	2.668818	16.435992	7	73	KEEP	---	---	---	---	6	1	46	37	0.142857142857	capture	Missense_Mutation	SNP	55539225	55539225	RP1	8	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	13424	40
RALYL	138046	broad.mit.edu	37	8	85774590	85774590	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:85774590G>A	uc003ycq.3	+	7	889	c.473G>A	c.(472-474)CGT>CAT	p.R158H	RALYL_uc003ycr.3_Missense_Mutation_p.R158H|RALYL_uc003ycs.3_Missense_Mutation_p.R158H|RALYL_uc010lzy.2_Missense_Mutation_p.R147H|RALYL_uc003yct.3_Missense_Mutation_p.R171H|RALYL_uc003ycu.3_Missense_Mutation_p.R85H|RALYL_uc003ycv.3_Missense_Mutation_p.R70H	NM_001100392	NP_001093862	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like isoform 2	158							identical protein binding|nucleotide binding|RNA binding			ovary(1)	1						CCGCTGAAGCGTCCCAGAGTG	0.507																0.490196	71.876885	71.88094	25	26	KEEP	---	---	---	---	14	20	18	12	-1	capture	Missense_Mutation	SNP	85774590	85774590	RALYL	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12915	40
COL22A1	169044	broad.mit.edu	37	8	139856384	139856384	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:139856384C>T	uc003yvd.2	-	4	1123	c.676G>A	c.(676-678)GTT>ATT	p.V226I		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	226					cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TCTACACGAACGCTAGGACAG	0.463													HNSCC(7;0.00092)			0.43295	326.934361	327.957202	113	148	KEEP	---	---	---	---	65	63	99	74	-1	capture	Missense_Mutation	SNP	139856384	139856384	COL22A1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3646	40
C9orf131	138724	broad.mit.edu	37	9	35043416	35043416	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35043416G>A	uc003zvw.2	+	2	819	c.790G>A	c.(790-792)GAA>AAA	p.E264K	C9orf131_uc003zvu.2_Missense_Mutation_p.E216K|C9orf131_uc003zvv.2_Missense_Mutation_p.E191K|C9orf131_uc003zvx.2_Missense_Mutation_p.E229K	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	264											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			GGAAGATCTAGAAGGGATGGC	0.547																0.220884	131.380181	149.24746	55	194	KEEP	---	---	---	---	33	31	104	108	-1	capture	Missense_Mutation	SNP	35043416	35043416	C9orf131	9	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	2434	40
C9orf131	138724	broad.mit.edu	37	9	35043985	35043985	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35043985G>C	uc003zvw.2	+	2	1388	c.1359G>C	c.(1357-1359)TGG>TGC	p.W453C	C9orf131_uc003zvu.2_Missense_Mutation_p.W405C|C9orf131_uc003zvv.2_Missense_Mutation_p.W380C|C9orf131_uc003zvx.2_Missense_Mutation_p.W418C	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	453											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			AGACACCATGGAAGGGCATGC	0.542																0.223048	171.551799	190.529463	60	209	KEEP	---	---	---	---	36	29	130	99	-1	capture	Missense_Mutation	SNP	35043985	35043985	C9orf131	9	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	2434	40
RUSC2	9853	broad.mit.edu	37	9	35548294	35548294	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35548294C>A	uc003zww.2	+	2	2031	c.1776C>A	c.(1774-1776)TGC>TGA	p.C592*	RUSC2_uc010mkq.2_Intron|RUSC2_uc003zwx.3_Nonsense_Mutation_p.C592*	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	592						cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			AGGGCACTTGCTGTAGCCATA	0.637																0.477612	91.872319	91.902455	32	35	KEEP	---	---	---	---	15	26	27	18	0.634146341463	capture	Nonsense_Mutation	SNP	35548294	35548294	RUSC2	9	C	A	A	A	1	0	0	0	0	0	1	0	0	363	28	5	4	13643	40
EXOSC3	51010	broad.mit.edu	37	9	37785036	37785036	+	Silent	SNP	G	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:37785036G>T	uc004aal.2	-	1	32	c.6C>A	c.(4-6)GCC>GCA	p.A2A	EXOSC3_uc010mly.1_Silent_p.A2A|EXOSC3_uc004aam.2_Silent_p.A2A	NM_016042	NP_057126	Q9NQT5	EXOS3_HUMAN	exosome component 3 isoform 1	2					CUT catabolic process|DNA deamination|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|isotype switching|rRNA processing	cytoplasmic exosome (RNase complex)|cytosol|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5'-exoribonuclease activity|protein binding|RNA binding			breast(2)	2				GBM - Glioblastoma multiforme(29;0.00771)|Lung(182;0.221)		ACGCAGGTTCGGCCATCGCGG	0.662																0.447368	47.363329	47.455826	17	21	KEEP	---	---	---	---	13	6	14	12	0.684210526316	capture	Silent	SNP	37785036	37785036	EXOSC3	9	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	5271	40
OR13F1	138805	broad.mit.edu	37	9	107266629	107266629	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107266629C>T	uc011lvm.1	+	1	86	c.86C>T	c.(85-87)GCG>GTG	p.A29V		NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F,	29	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)|skin(1)	3						ATCATATTTGCGGTGTGCTTG	0.418																0.065041	-16.768141	31.553666	16	230	KEEP	---	---	---	---	9	10	146	115	-1	capture	Missense_Mutation	SNP	107266629	107266629	OR13F1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10845	40
ACAP3	116983	broad.mit.edu	37	1	1229200	1229201	+	Splice_Site	DEL	CA	-	-			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1229200_1229201delCA	uc001aeb.2	-	23	2434	c.2360_splice	c.e23+1	p.L787_splice	ACAP3_uc001ady.2_Splice_Site_p.L517_splice|ACAP3_uc001aea.2_Splice_Site_p.L712_splice	NM_030649	NP_085152	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH						filopodium assembly|regulation of ARF GTPase activity|signal transduction		ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding				0						CGGCCGCGCTCACAGTGTCACG	0.752																0.40			19	29		---	---	---	---						capture_indel	Splice_Site	DEL	1229200	1229201	ACAP3	1	CA	-	-	-	1	0	1	0	1	0	0	1	0	365	29	5	5	120	40
SPTA1	6708	broad.mit.edu	37	1	158622276	158622276	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158622276delT	uc001fst.1	-	23	3555	c.3356delA	c.(3355-3357)AAGfs	p.K1119fs		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1119	Spectrin 11.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTCATCAAACTTTTTCTGCAG	0.398																0.40			109	164		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	158622276	158622276	SPTA1	1	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	15008	40
RAB11FIP5	26056	broad.mit.edu	37	2	73315522	73315544	+	Frame_Shift_Del	DEL	AGCACTCAGCTCCTCCTGTCCAA	-	-	rs138135562		TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73315522_73315544delAGCACTCAGCTCCTCCTGTCCAA	uc002siu.3	-	3	1443_1465	c.1202_1224delTTGGACAGGAGGAGCTGAGTGCT	c.(1201-1224)CTTGGACAGGAGGAGCTGAGTGCTfs	p.L401fs	RAB11FIP5_uc002sit.3_Frame_Shift_Del_p.L323fs	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	401_408					protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0						CTTTAGCCTGAGCACTCAGCTCCTCCTGTCCAAGCACTGCCTC	0.637																0.37			37	64		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	73315522	73315544	RAB11FIP5	2	AGCACTCAGCTCCTCCTGTCCAA	-	-	-	1	0	1	0	1	0	0	0	0	132	11	5	5	12792	40
TRAPPC10	7109	broad.mit.edu	37	21	45472274	45472275	+	Frame_Shift_Ins	INS	-	A	A	rs149217788	byFrequency	TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45472274_45472275insA	uc002zea.2	+	4	568_569	c.399_400insA	c.(397-402)AAGAAAfs	p.K133fs	TRAPPC10_uc010gpo.2_5'UTR|TRAPPC10_uc002zdz.2_Frame_Shift_Ins_p.K133fs	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	133_134					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						ATGATGCCAAGAAAAAAAACAA	0.356																0.04			7	170		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	45472274	45472275	TRAPPC10	21	-	A	A	A	1	0	1	1	0	0	0	0	0	425	33	5	5	16340	40
ZNF318	24149	broad.mit.edu	37	6	43323502	43323502	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0185-01	TCGA-06-0185-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43323502delT	uc003oux.2	-	4	1648	c.1570delA	c.(1570-1572)AGGfs	p.R524fs	ZNF318_uc003ouw.2_RNA	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	524					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CTACGTCGCCTTTTTTCCTGT	0.493																0.01			7	657		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	43323502	43323502	ZNF318	6	T	-	-	-	1	0	1	0	1	0	0	0	0	726	56	5	5	17716	40
