Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA0467	23334	broad.mit.edu	37	1	43906999	43906999	+	Missense_Mutation	SNP	C	T	T	rs150927632		TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43906999C>T	uc001cjk.1	+	38	5224	c.4762C>T	c.(4762-4764)CCT>TCT	p.P1588S		NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	2487						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGTTCGGACTCCTGGTGGAGC	0.582																0.308989	149.261247	155.047457	55	123	KEEP	---	---	---	---	29	30	59	72	-1	capture	Missense_Mutation	SNP	43906999	43906999	KIAA0467	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	8100	46
CYP4A11	1579	broad.mit.edu	37	1	47400170	47400170	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47400170C>G	uc001cqp.3	-	7	903	c.852G>C	c.(850-852)AAG>AAC	p.K284N	CYP4A11_uc001cqq.2_Missense_Mutation_p.K284N|CYP4A11_uc010omm.1_RNA	NM_000778	NP_000769	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A,	284					long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding			ovary(2)|skin(2)	4					NADH(DB00157)	GCCTCTTCCTCTTGATCTTCT	0.498																0.333333	263.552717	269.086497	75	150	KEEP	---	---	---	---	40	54	93	102	-1	capture	Missense_Mutation	SNP	47400170	47400170	CYP4A11	1	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	4143	46
C1orf175	374977	broad.mit.edu	37	1	55136211	55136211	+	Silent	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55136211C>T	uc010ooe.1	+	6	1755	c.1431C>T	c.(1429-1431)TCC>TCT	p.S477S	C1orf175_uc001cxq.2_RNA|C1orf175_uc010ooc.1_Silent_p.S45S|C1orf175_uc001cxs.2_RNA|C1orf175_uc010ood.1_5'UTR|C1orf175_uc010oof.1_RNA|C1orf175_uc001cxr.1_RNA|C1orf175_uc010oog.1_Silent_p.S477S|C1orf175_uc010ooh.1_RNA|C1orf175_uc009vzq.1_Intron|C1orf175_uc001cxt.1_RNA	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN	hypothetical protein LOC374977	477						integral to membrane	binding				0						TCTCAAGCTCCGTCCGCAAGC	0.473																0.444444	37.90169	37.97329	12	15	KEEP	---	---	---	---	9	9	15	12	-1	capture	Silent	SNP	55136211	55136211	C1orf175	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	1998	46
CSDE1	7812	broad.mit.edu	37	1	115269683	115269683	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115269683T>C	uc001efk.2	-	13	1851	c.1385A>G	c.(1384-1386)GAT>GGT	p.D462G	CSDE1_uc001efi.2_Missense_Mutation_p.D508G|CSDE1_uc001efj.2_RNA|CSDE1_uc001efl.2_Missense_Mutation_p.D431G|CSDE1_uc001efm.2_Missense_Mutation_p.D477G|CSDE1_uc009wgv.2_Missense_Mutation_p.D462G|CSDE1_uc001efn.2_Missense_Mutation_p.D431G	NM_001007553	NP_001007554	O75534	CSDE1_HUMAN	upstream of NRAS isoform 1	462	CSD 6.				male gonad development|regulation of transcription, DNA-dependent	cytoplasm	DNA binding|protein binding|RNA binding			ovary(1)	1	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCCACAGTCATCATAAGCAAT	0.373																0.210145	81.402728	92.126693	29	109	KEEP	---	---	---	---	14	20	56	66	-1	capture	Missense_Mutation	SNP	115269683	115269683	CSDE1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	3894	46
TCHH	7062	broad.mit.edu	37	1	152084091	152084091	+	Silent	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152084091G>A	uc001ezp.2	-	2	1602	c.1602C>T	c.(1600-1602)AGC>AGT	p.S534S	TCHH_uc009wne.1_Silent_p.S534S	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	534	9 X 28 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTGTTGCTCGCTCCTCAACC	0.652																0.261628	105.809544	114.586903	45	127	KEEP	---	---	---	---	22	27	78	77	-1	capture	Silent	SNP	152084091	152084091	TCHH	1	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	15585	46
LGR6	59352	broad.mit.edu	37	1	202287327	202287327	+	Silent	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:202287327C>T	uc001gxu.2	+	18	1896	c.1896C>T	c.(1894-1896)TAC>TAT	p.Y632Y	LGR6_uc001gxv.2_Silent_p.Y580Y|LGR6_uc009xab.2_RNA|LGR6_uc001gxw.2_Silent_p.Y493Y	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled	632	Extracellular (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						TCTCTGAGTACGGAGCCCGCT	0.622																0.133333	8.330037	14.194232	6	39	KEEP	---	---	---	---	5	3	14	33	-1	capture	Silent	SNP	202287327	202287327	LGR6	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8678	46
OR1C1	26188	broad.mit.edu	37	1	247921487	247921487	+	Silent	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247921487C>T	uc010pza.1	-	1	222	c.222G>A	c.(220-222)ACG>ACA	p.T74T		NM_012353	NP_036485	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CTGTAGTCGACGTAAAGCAGA	0.463																0.269841	44.153767	47.160625	17	46	KEEP	---	---	---	---	13	7	25	26	-1	capture	Silent	SNP	247921487	247921487	OR1C1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	10856	46
C10orf2	56652	broad.mit.edu	37	10	102749558	102749558	+	Silent	SNP	A	G	G			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:102749558A>G	uc001ksf.2	+	2	2076	c.1401A>G	c.(1399-1401)CAA>CAG	p.Q467Q	MRPL43_uc001kry.1_5'Flank|MRPL43_uc010qpu.1_5'Flank|MRPL43_uc001krz.1_5'Flank|MRPL43_uc001ksa.1_5'Flank|MRPL43_uc001ksb.1_5'Flank|MRPL43_uc001ksd.1_5'Flank|MRPL43_uc001ksc.2_5'Flank|MRPL43_uc001kse.2_5'Flank|C10orf2_uc001ksg.2_Silent_p.Q467Q|C10orf2_uc001ksi.2_Silent_p.Q13Q|C10orf2_uc010qpv.1_Silent_p.Q13Q|C10orf2_uc001ksh.2_RNA	NM_021830	NP_068602	Q96RR1	PEO1_HUMAN	twinkle isoform A	467	SF4 helicase.				cell death|mitochondrial DNA replication|protein hexamerization|protein homooligomerization|transcription from mitochondrial promoter	mitochondrial nucleoid	5'-3' DNA helicase activity|ATP binding|protease binding|single-stranded DNA binding			ovary(1)	1		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TGGAAGATCAACTGGACAAAT	0.542																0.169697	65.598392	82.631708	28	137	KEEP	---	---	---	---	18	11	88	66	-1	capture	Silent	SNP	102749558	102749558	C10orf2	10	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	1585	46
OR56A4	120793	broad.mit.edu	37	11	6024337	6024337	+	Silent	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6024337C>T	uc010qzv.1	-	1	42	c.42G>A	c.(40-42)CAG>CAA	p.Q14Q		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	Error:Variant_position_missing_in_Q8NGH8_after_alignment					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACTGAGGCCCTGTATCTGTC	0.299																0.211111	102.44747	116.340575	38	142	KEEP	---	---	---	---	24	18	67	97	-1	capture	Silent	SNP	6024337	6024337	OR56A4	11	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	11039	46
OR4P4	81300	broad.mit.edu	37	11	55406071	55406071	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55406071A>G	uc010rij.1	+	1	238	c.238A>G	c.(238-240)ATG>GTG	p.M80V		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	80	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						CCCCAAATTAATGGTTGACTT	0.413																0.245283	200.557893	216.205393	65	200	KEEP	---	---	---	---	36	34	106	115	-1	capture	Missense_Mutation	SNP	55406071	55406071	OR4P4	11	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	10984	46
GLYATL1	92292	broad.mit.edu	37	11	58723260	58723260	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58723260G>A	uc001nnf.2	+	8	1045	c.669G>A	c.(667-669)ATG>ATA	p.M223I	uc001nng.1_Intron|GLYATL1_uc001nnh.1_Missense_Mutation_p.M254I|GLYATL1_uc001nni.1_Missense_Mutation_p.M223I|GLYATL1_uc001nnj.1_Missense_Mutation_p.M223I			Q969I3	GLYL1_HUMAN	SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;	223						mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)	GGGTAACCATGGACCCTTCTT	0.522																0.225	46.005333	51.56539	18	62	KEEP	---	---	---	---	7	15	33	33	-1	capture	Missense_Mutation	SNP	58723260	58723260	GLYATL1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	6416	46
TRPC6	7225	broad.mit.edu	37	11	101347101	101347101	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:101347101C>T	uc001pgk.3	-	6	2100	c.1675G>A	c.(1675-1677)GAC>AAC	p.D559N	TRPC6_uc009ywy.2_Missense_Mutation_p.D443N|TRPC6_uc009ywz.1_Missense_Mutation_p.D504N	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,	559	Extracellular (Potential).				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TCATTTGCGTCAATGATGCTC	0.378	Colon(166;1315 1927 11094 12848 34731)															0.24031	78.86147	86.799959	31	98	KEEP	---	---	---	---	21	16	55	56	-1	capture	Missense_Mutation	SNP	101347101	101347101	TRPC6	11	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	16466	46
USP28	57646	broad.mit.edu	37	11	113677209	113677209	+	Splice_Site	SNP	A	G	G			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113677209A>G	uc001poh.2	-	19	2433	c.2400_splice	c.e19+1	p.K800_splice	USP28_uc001pog.2_Intron|USP28_uc010rwy.1_Intron|USP28_uc001poi.2_Intron	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28						cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		AAACAGAGATACCTTAATCAG	0.398	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)															0.076923	2.061269	11.585401	4	48	KEEP	---	---	---	---	2	3	31	25	-1	capture	Splice_Site	SNP	113677209	113677209	USP28	11	A	G	G	G	1	0	0	0	0	0	0	1	0	182	14	5	3	16940	46
LRP6	4040	broad.mit.edu	37	12	12311913	12311913	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:12311913C>T	uc001rah.3	-	12	2783	c.2641G>A	c.(2641-2643)GTC>ATC	p.V881I	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Missense_Mutation_p.V881I	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	881	Extracellular (Potential).|Beta-propeller 3.|LDL-receptor class B 15.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding	p.V881L(1)		lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				GAGTGAAAGACGAGGATGTCC	0.537					618											0.141304	19.309897	30.734406	13	79	KEEP	---	---	---	---	9	5	46	38	-1	capture	Missense_Mutation	SNP	12311913	12311913	LRP6	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8878	46
OVCH1	341350	broad.mit.edu	37	12	29628100	29628100	+	Silent	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:29628100G>A	uc001rix.1	-	14	1494	c.1494C>T	c.(1492-1494)ACC>ACT	p.T498T		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	498	CUB 2.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TTGAAGTGATGGTCAACATTC	0.299																0.315789	17.142413	17.716279	6	13	KEEP	---	---	---	---	2	5	7	8	-1	capture	Silent	SNP	29628100	29628100	OVCH1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	11227	46
LRP1	4035	broad.mit.edu	37	12	57600507	57600507	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57600507G>T	uc001snd.2	+	76	12308	c.11842G>T	c.(11842-11844)GGT>TGT	p.G3948C		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3948	Extracellular (Potential).|LDL-receptor class B 31.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GATTGACCGGGGTGTCACCCA	0.607					1456											0.1375	18.669077	28.840004	11	69	KEEP	---	---	---	---	12	7	38	53	0.631578947368	capture	Missense_Mutation	SNP	57600507	57600507	LRP1	12	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	8867	46
GRIP1	23426	broad.mit.edu	37	12	66911726	66911726	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66911726C>T	uc001stk.2	-	6	774	c.533G>A	c.(532-534)CGT>CAT	p.R178H	GRIP1_uc010sta.1_Missense_Mutation_p.R122H|GRIP1_uc001stl.1_Missense_Mutation_p.R122H|GRIP1_uc001stm.2_Missense_Mutation_p.R178H	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	178	PDZ 2.				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		CACAACTGGACGAGATTTATT	0.388																0.197531	36.397376	43.265844	16	65	KEEP	---	---	---	---	6	14	37	37	-1	capture	Missense_Mutation	SNP	66911726	66911726	GRIP1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6720	46
METT11D1	64745	broad.mit.edu	37	14	21458199	21458199	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21458199G>C	uc001vyn.2	+	1	235	c.38G>C	c.(37-39)AGA>ACA	p.R13T	METT11D1_uc010tlk.1_Missense_Mutation_p.R13T|METT11D1_uc001vym.2_Missense_Mutation_p.R13T|METT11D1_uc001vyo.2_Missense_Mutation_p.R13T|METT11D1_uc001vyp.2_5'UTR|METT11D1_uc001vyq.2_5'UTR	NM_022734	NP_073571	Q9H7H0	MET17_HUMAN	methyltransferase 11 domain containing 1 isoform	13					translation	mitochondrion|ribosome	copper ion binding|methyltransferase activity				0	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0191)		ACATTAGGAAGATGGTGCCCC	0.617																0.241758	66.011041	71.541689	22	69	KEEP	---	---	---	---	13	15	48	55	-1	capture	Missense_Mutation	SNP	21458199	21458199	METT11D1	14	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	9403	46
METT11D1	64745	broad.mit.edu	37	14	21458453	21458453	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21458453G>C	uc001vyn.2	+	2	337	c.140G>C	c.(139-141)AGG>ACG	p.R47T	METT11D1_uc010tlk.1_Missense_Mutation_p.R47T|METT11D1_uc001vym.2_Missense_Mutation_p.R47T|METT11D1_uc001vyo.2_Missense_Mutation_p.R47T|METT11D1_uc001vyp.2_5'UTR|METT11D1_uc001vyq.2_5'UTR	NM_022734	NP_073571	Q9H7H0	MET17_HUMAN	methyltransferase 11 domain containing 1 isoform	47					translation	mitochondrion|ribosome	copper ion binding|methyltransferase activity				0	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0191)		CTGCAGAAGAGGCCTCATCGC	0.587														OREG0022561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.188073	85.328556	105.207867	41	177	KEEP	---	---	---	---	19	24	87	96	-1	capture	Missense_Mutation	SNP	21458453	21458453	METT11D1	14	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	9403	46
GNG2	54331	broad.mit.edu	37	14	52433353	52433353	+	Missense_Mutation	SNP	C	T	T	rs139067662	by1000genomes	TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:52433353C>T	uc001wzi.2	+	4	693	c.164C>T	c.(163-165)CCG>CTG	p.P55L	GNG2_uc001wzh.2_RNA|GNG2_uc010aoc.1_RNA|GNG2_uc001wzj.2_RNA|GNG2_uc001wzk.2_Missense_Mutation_p.P55L	NM_053064	NP_444292	P59768	GBG2_HUMAN	guanine nucleotide binding protein (G protein),	55					cellular response to glucagon stimulus|energy reserve metabolic process|platelet activation|synaptic transmission	heterotrimeric G-protein complex	protein binding|signal transducer activity				0	all_epithelial(31;0.0659)|Breast(41;0.0684)				Halothane(DB01159)	ACCCCTGTTCCGGCTTCAGAA	0.527																0.244275	173.876219	189.482449	64	198	KEEP	---	---	---	---	35	34	115	101	-1	capture	Missense_Mutation	SNP	52433353	52433353	GNG2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6463	46
LTBP2	4053	broad.mit.edu	37	14	74970199	74970199	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74970199G>A	uc001xqa.2	-	32	5080	c.4693C>T	c.(4693-4695)CGC>TGC	p.R1565C		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	1565	EGF-like 18; calcium-binding (Potential).				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TTCATGCAGCGCTGCTGGCTG	0.672																0.368421	39.940184	40.518399	14	24	KEEP	---	---	---	---	11	4	16	11	-1	capture	Missense_Mutation	SNP	74970199	74970199	LTBP2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8989	46
PSMC1	5700	broad.mit.edu	37	14	90736610	90736610	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:90736610C>T	uc001xyf.2	+	10	1150	c.1102C>T	c.(1102-1104)CAC>TAC	p.H368Y	PSMC1_uc001xyg.2_Missense_Mutation_p.H295Y|PSMC1_uc001xyh.2_Missense_Mutation_p.H295Y	NM_002802	NP_002793	P62191	PRS4_HUMAN	proteasome 26S ATPase subunit 1	368					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding				0		all_cancers(154;0.142)		COAD - Colon adenocarcinoma(157;0.21)		CTTTCAGATTCACACAAGCAG	0.502																0.231481	57.011644	64.151793	25	83	KEEP	---	---	---	---	6	21	50	44	-1	capture	Missense_Mutation	SNP	90736610	90736610	PSMC1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	12580	46
SERPINA3	12	broad.mit.edu	37	14	95080911	95080911	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95080911G>A	uc001ydp.2	+	2	212	c.133G>A	c.(133-135)GTG>ATG	p.V45M	SERPINA3_uc001ydo.3_Missense_Mutation_p.V70M|SERPINA3_uc010avf.1_RNA|SERPINA3_uc001ydr.2_RNA|SERPINA3_uc001ydq.2_Missense_Mutation_p.V45M|SERPINA3_uc001yds.2_Missense_Mutation_p.V45M|SERPINA3_uc010avg.2_Missense_Mutation_p.V45M	NM_001085	NP_001076	P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A, member 3	45					acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity	p.V45M(1)		ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		AGGGACACACGTGGACCTCGG	0.572																0.240838	112.872224	124.565854	46	145	KEEP	---	---	---	---	24	30	91	78	-1	capture	Missense_Mutation	SNP	95080911	95080911	SERPINA3	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13983	46
BCL11B	64919	broad.mit.edu	37	14	99642475	99642475	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:99642475G>A	uc001yga.2	-	4	965	c.698C>T	c.(697-699)GCG>GTG	p.A233V	BCL11B_uc001ygb.2_Missense_Mutation_p.A162V	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1	233	C2H2-type 1.					nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CAGGAACCACGCGCTGTTGAA	0.617					98	T	TLX3	T-ALL								0.257143	23.459105	25.329982	9	26	KEEP	---	---	---	---	7	4	18	13	-1	capture	Missense_Mutation	SNP	99642475	99642475	BCL11B	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1353	46
HDC	3067	broad.mit.edu	37	15	50535347	50535347	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50535347C>T	uc001zxz.2	-	11	1341	c.1235G>A	c.(1234-1236)CGT>CAT	p.R412H	HDC_uc001zxy.2_Missense_Mutation_p.R155H|HDC_uc010uff.1_Missense_Mutation_p.R379H	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	412					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	TACCTTTAGACGAAAAACCAC	0.483	GBM(95;1627 1936 6910 9570)															0.11236	9.584322	22.795976	10	79	KEEP	---	---	---	---	7	5	41	47	-1	capture	Missense_Mutation	SNP	50535347	50535347	HDC	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6942	46
CP110	9738	broad.mit.edu	37	16	19547973	19547973	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:19547973C>T	uc002dgl.3	+	4	1229	c.982C>T	c.(982-984)CGA>TGA	p.R328*	CP110_uc002dgk.3_Nonsense_Mutation_p.R328*			O43303	CP110_HUMAN	RecName: Full=Centrosomal protein of 110 kDa;          Short=Cep110;	328					centriole replication|G2/M transition of mitotic cell cycle|regulation of cytokinesis	centriole|cytosol	protein binding				0						CATACCTATACGAACTGGCCA	0.373																0.314286	124.751738	129.04689	44	96	KEEP	---	---	---	---	27	23	52	53	-1	capture	Nonsense_Mutation	SNP	19547973	19547973	CP110	16	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	3753	46
CACNG3	10368	broad.mit.edu	37	16	24358110	24358110	+	Silent	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24358110C>T	uc002dmf.2	+	2	1467	c.267C>T	c.(265-267)TAC>TAT	p.Y89Y		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	89					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		ATGCTGACTACGAACAGGACA	0.562																0.185567	39.495096	48.482798	18	79	KEEP	---	---	---	---	8	15	47	41	-1	capture	Silent	SNP	24358110	24358110	CACNG3	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2534	46
OGFOD1	55239	broad.mit.edu	37	16	56510097	56510097	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56510097T>C	uc002ejb.2	+	13	1710	c.1609T>C	c.(1609-1611)TCA>CCA	p.S537P	OGFOD1_uc002ejc.2_Missense_Mutation_p.S397P	NM_018233	NP_060703	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase	537							iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)	1					Vitamin C(DB00126)	CTGGGACTTTTCATTCATCTA	0.418																0.264368	72.486911	76.852195	23	64	KEEP	---	---	---	---	15	9	36	34	-1	capture	Missense_Mutation	SNP	56510097	56510097	OGFOD1	16	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	10746	46
MYH2	4620	broad.mit.edu	37	17	10428349	10428349	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10428349G>A	uc010coi.2	-	34	4824	c.4696C>T	c.(4696-4698)CGC>TGC	p.R1566C	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.R1566C|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1566	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						AGCTGGATGCGCAGGATCTTT	0.408																0.302439	169.799911	176.927307	62	143	KEEP	---	---	---	---	33	33	119	104	-1	capture	Missense_Mutation	SNP	10428349	10428349	MYH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9945	46
XYLT2	64132	broad.mit.edu	37	17	48433460	48433460	+	Silent	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48433460G>A	uc002iqo.2	+	7	1429	c.1320G>A	c.(1318-1320)ACG>ACA	p.T440T	XYLT2_uc010dbo.2_RNA	NM_022167	NP_071450	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	440	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			pancreas(1)	1	Breast(11;7.18e-19)					TCTTCCACACGGTGCTGGAGA	0.617																0.123596	15.467766	27.796119	11	78	KEEP	---	---	---	---	3	9	44	51	-1	capture	Silent	SNP	48433460	48433460	XYLT2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17345	46
VEZF1	7716	broad.mit.edu	37	17	56060219	56060219	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56060219T>C	uc002ivf.1	-	2	712	c.569A>G	c.(568-570)AAT>AGT	p.N190S	VEZF1_uc010dcn.1_Missense_Mutation_p.N34S	NM_007146	NP_009077	Q14119	VEZF1_HUMAN	zinc finger protein 161	190	C2H2-type 2.				cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						CTTGTGTCGATTGAGATGGTA	0.483																0.205882	41.113689	46.565675	14	54	KEEP	---	---	---	---	10	7	27	30	-1	capture	Missense_Mutation	SNP	56060219	56060219	VEZF1	17	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	17037	46
QRICH2	84074	broad.mit.edu	37	17	74276228	74276228	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74276228C>T	uc002jrd.1	-	12	4316	c.4136G>A	c.(4135-4137)CGC>CAC	p.R1379H	QRICH2_uc010wsz.1_Intron|QRICH2_uc010dgw.1_Missense_Mutation_p.R223H	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1379							protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						CAGCTCCAGGCGGTCCAGCTG	0.657																0.257143	68.576245	74.189965	27	78	KEEP	---	---	---	---	24	13	46	58	-1	capture	Missense_Mutation	SNP	74276228	74276228	QRICH2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12775	46
DSG3	1830	broad.mit.edu	37	18	29038537	29038537	+	Missense_Mutation	SNP	G	A	A	rs137884016	byFrequency	TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29038537G>A	uc002kws.2	+	4	455	c.346G>A	c.(346-348)GAC>AAC	p.D116N		NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	116	Extracellular (Potential).|Cadherin 1.				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AGCTATAGTCGACCGGGAGGA	0.443																0.11811	16.929237	35.184702	15	112	KEEP	---	---	---	---	7	9	67	64	-1	capture	Missense_Mutation	SNP	29038537	29038537	DSG3	18	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4733	46
ALPK2	115701	broad.mit.edu	37	18	56203942	56203942	+	Silent	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:56203942C>T	uc002lhj.3	-	5	3691	c.3477G>A	c.(3475-3477)ACG>ACA	p.T1159T	ALPK2_uc002lhk.1_Silent_p.T490T	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	1159							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						CAGCAGATGTCGTAGGCAAAC	0.567					343											0.202055	134.173933	158.246266	59	233	KEEP	---	---	---	---	38	27	127	130	-1	capture	Silent	SNP	56203942	56203942	ALPK2	18	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	545	46
MAP2K7	5609	broad.mit.edu	37	19	7975352	7975352	+	Silent	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7975352C>T	uc002mit.2	+	5	527	c.462C>T	c.(460-462)TCC>TCT	p.S154S	MAP2K7_uc002miv.2_Silent_p.S154S|MAP2K7_uc010xka.1_RNA|MAP2K7_uc010xkb.1_Silent_p.S154S|MAP2K7_uc010dvv.2_Silent_p.S29S	NM_145185	NP_660186	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7	154	Protein kinase.				activation of JUN kinase activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus	ATP binding|JUN kinase kinase activity|magnesium ion binding|protein binding|protein kinase binding|protein phosphatase binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			large_intestine(7)|central_nervous_system(2)|ovary(1)|lung(1)	11					Etoposide(DB00773)	TGCGGCGCTCCGGGAACAAGG	0.632					108											0.212121	17.807887	20.334882	7	26	KEEP	---	---	---	---	4	4	14	16	-1	capture	Silent	SNP	7975352	7975352	MAP2K7	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9156	46
MUC16	94025	broad.mit.edu	37	19	9047027	9047027	+	Missense_Mutation	SNP	G	A	A	rs111231164		TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9047027G>A	uc002mkp.2	-	5	34808	c.34604C>T	c.(34603-34605)ACG>ATG	p.T11535M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11537	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GATAGTTGTCGTTGAAACAGC	0.512																0.20155	59.784332	70.456558	26	103	KEEP	---	---	---	---	13	16	66	55	-1	capture	Missense_Mutation	SNP	9047027	9047027	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9883	46
MRPS12	6183	broad.mit.edu	37	19	39423173	39423173	+	Missense_Mutation	SNP	C	T	T	rs140018981	by1000genomes	TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39423173C>T	uc002okc.2	+	3	560	c.250C>T	c.(250-252)CGG>TGG	p.R84W	SARS2_uc002ojz.2_5'Flank|SARS2_uc010xup.1_5'Flank|SARS2_uc002oka.2_5'Flank|SARS2_uc002okb.2_5'Flank|SARS2_uc010xuq.1_Intron|SARS2_uc010xur.1_5'Flank|SARS2_uc010xus.1_5'Flank|MRPS12_uc002okd.2_Missense_Mutation_p.R84W|MRPS12_uc002oke.2_Missense_Mutation_p.R84W	NM_033362	NP_203526	O15235	RT12_HUMAN	mitochondrial ribosomal protein S12 precursor	84					translation	mitochondrial ribosome|small ribosomal subunit	protein binding|structural constituent of ribosome				0	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CTGTCGAGTGCGGCTCAGCAC	0.662																0.196262	41.312398	50.516366	21	86	KEEP	---	---	---	---	12	15	63	58	-1	capture	Missense_Mutation	SNP	39423173	39423173	MRPS12	19	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	9733	46
PSG5	5673	broad.mit.edu	37	19	43689122	43689122	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43689122G>A	uc002ovu.2	-	2	373	c.242C>T	c.(241-243)TCA>TTA	p.S81L	PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Missense_Mutation_p.S9L|PSG5_uc002ovx.2_Missense_Mutation_p.S81L|PSG5_uc002ovv.2_Missense_Mutation_p.S81L|PSG5_uc002ovw.2_Missense_Mutation_p.S81L	NM_002781	NP_002772	Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	81	Ig-like V-type.				female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)				TACTACATATGATGTAATGTA	0.433																0.17446	188.402017	244.031265	97	459	KEEP	---	---	---	---	59	41	250	239	-1	capture	Missense_Mutation	SNP	43689122	43689122	PSG5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	12553	46
XRCC1	7515	broad.mit.edu	37	19	44055781	44055781	+	Missense_Mutation	SNP	C	T	T	rs2271980		TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44055781C>T	uc002owt.2	-	10	1261	c.1141G>A	c.(1141-1143)GTG>ATG	p.V381M	XRCC1_uc010xwp.1_Missense_Mutation_p.V350M	NM_006297	NP_006288	P18887	XRCC1_HUMAN	X-ray repair cross complementing protein 1	381	BRCT 1.				base-excision repair|single strand break repair	nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(2)|large_intestine(1)|prostate(1)|breast(1)	7		Prostate(69;0.0153)				TCCTTACGCACGATGCGGCCT	0.622											Other_BER_factors					0.20354	101.8133	120.261841	46	180	KEEP	---	---	---	---	26	26	96	113	-1	capture	Missense_Mutation	SNP	44055781	44055781	XRCC1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17333	46
GLI2	2736	broad.mit.edu	37	2	121747197	121747197	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:121747197G>A	uc010flp.2	+	13	3737	c.3707G>A	c.(3706-3708)GGC>GAC	p.G1236D	GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Missense_Mutation_p.G908D|GLI2_uc002tmu.3_Missense_Mutation_p.G891D	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	1236					axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				CAGTGTCCTGGCATGACTACC	0.652					376											0.208333	18.326978	22.109158	10	38	KEEP	---	---	---	---	5	7	22	28	-1	capture	Missense_Mutation	SNP	121747197	121747197	GLI2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	6374	46
POTEF	728378	broad.mit.edu	37	2	130877687	130877687	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:130877687G>C	uc010fmh.2	-	3	802	c.402C>G	c.(400-402)CAC>CAG	p.H134Q		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	134						cell cortex	ATP binding			skin(3)|ovary(2)	5						CTCCACGGACGTGGTACCTGG	0.592																0.202532	90.620599	103.596789	32	126	KEEP	---	---	---	---	18	23	88	76	-1	capture	Missense_Mutation	SNP	130877687	130877687	POTEF	2	G	C	C	C	1	0	0	0	0	1	0	0	0	516	40	4	4	12166	46
KCNJ3	3760	broad.mit.edu	37	2	155711294	155711294	+	Silent	SNP	T	C	C			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:155711294T>C	uc002tyv.1	+	3	1170	c.975T>C	c.(973-975)CAT>CAC	p.H325H	KCNJ3_uc010zce.1_3'UTR	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	325	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	TTTGGGGTCATCGTTTTTTTC	0.383																0.22619	112.664552	124.226477	38	130	KEEP	---	---	---	---	24	21	81	68	-1	capture	Silent	SNP	155711294	155711294	KCNJ3	2	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	7974	46
UPP2	151531	broad.mit.edu	37	2	158971751	158971751	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:158971751G>A	uc002tzp.2	+	3	513	c.319G>A	c.(319-321)GGG>AGG	p.G107R	UPP2_uc002tzo.2_Missense_Mutation_p.G164R	NM_173355	NP_775491	O95045	UPP2_HUMAN	uridine phosphorylase 2 isoform a	107					nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|uridine metabolic process	cytosol|type III intermediate filament	uridine phosphorylase activity				0						GTACAAAACCGGGCCTGTGCT	0.438																0.261682	75.750081	81.251091	28	79	KEEP	---	---	---	---	11	21	44	44	-1	capture	Missense_Mutation	SNP	158971751	158971751	UPP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16895	46
ITGB6	3694	broad.mit.edu	37	2	160964323	160964323	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:160964323A>G	uc002ubh.2	-	14	2151	c.2135T>C	c.(2134-2136)ATG>ACG	p.M712T	ITGB6_uc010fou.2_Missense_Mutation_p.M712T|ITGB6_uc010zcq.1_Missense_Mutation_p.M670T|ITGB6_uc010fov.1_Missense_Mutation_p.M712T	NM_000888	NP_000879	P18564	ITB6_HUMAN	integrin, beta 6 precursor	712	Helical; (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3						AACCCCTAACATGATCATGGG	0.403					575											0.061224	-5.230415	14.464704	6	92	KEEP	---	---	---	---	2	4	45	56	-1	capture	Missense_Mutation	SNP	160964323	160964323	ITGB6	2	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	7822	46
TTN	7273	broad.mit.edu	37	2	179431071	179431071	+	Silent	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179431071G>A	uc010zfg.1	-	275	72308	c.72084C>T	c.(72082-72084)TCC>TCT	p.S24028S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.S17723S|TTN_uc010zfi.1_Silent_p.S17656S|TTN_uc010zfj.1_Silent_p.S17531S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24955							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTTAATTCGGAGTCAAGGT	0.453					8722											0.205387	153.313048	177.216372	61	236	KEEP	---	---	---	---	29	37	131	136	-1	capture	Silent	SNP	179431071	179431071	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	16617	46
UGT1A1	54658	broad.mit.edu	37	2	234669059	234669059	+	Silent	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234669059C>T	uc002vvb.2	+	1	141	c.126C>T	c.(124-126)AGC>AGT	p.S42S	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron|UGT1A9_uc002vva.2_Intron|UGT1A1_uc010znc.1_Silent_p.S42S	NM_000463	NP_000454	P22309	UD11_HUMAN	UDP glycosyltransferase 1 family, polypeptide A1	42					bilirubin conjugation|digestion|estrogen metabolic process|flavone metabolic process|heme catabolic process	endoplasmic reticulum membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding|steroid binding			central_nervous_system(1)|skin(1)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Adenine(DB00173)|Diclofenac(DB00586)|Estradiol(DB00783)|Ezetimibe(DB00973)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Rifampin(DB01045)|Troglitazone(DB00197)	ACTGGCTGAGCATGCTTGGGG	0.577																0.142857	6.174686	10.460408	5	30	KEEP	---	---	---	---	6	1	20	25	-1	capture	Silent	SNP	234669059	234669059	UGT1A1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	324	25	2	2	16826	46
UGT1A1	54658	broad.mit.edu	37	2	234669074	234669074	+	Silent	SNP	C	T	T	rs34526305	byFrequency;by1000genomes	TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234669074C>T	uc002vvb.2	+	1	156	c.141C>T	c.(139-141)ATC>ATT	p.I47I	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron|UGT1A9_uc002vva.2_Intron|UGT1A1_uc010znc.1_Silent_p.I47I	NM_000463	NP_000454	P22309	UD11_HUMAN	UDP glycosyltransferase 1 family, polypeptide A1	47					bilirubin conjugation|digestion|estrogen metabolic process|flavone metabolic process|heme catabolic process	endoplasmic reticulum membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding|steroid binding			central_nervous_system(1)|skin(1)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Adenine(DB00173)|Diclofenac(DB00586)|Estradiol(DB00783)|Ezetimibe(DB00973)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Rifampin(DB01045)|Troglitazone(DB00197)	TTGGGGCCATCCAGCAGCTGC	0.567																0.114754	7.97799	16.902528	7	54	KEEP	---	---	---	---	7	2	32	33	-1	capture	Silent	SNP	234669074	234669074	UGT1A1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	382	30	2	2	16826	46
BPIL1	80341	broad.mit.edu	37	20	31606076	31606076	+	Missense_Mutation	SNP	G	A	A	rs147688509	byFrequency;by1000genomes	TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31606076G>A	uc002wyj.2	+	8	783	c.589G>A	c.(589-591)GTG>ATG	p.V197M		NM_025227	NP_079503	Q8N4F0	BPIL1_HUMAN	bactericidal/permeability-increasing	197						extracellular region	lipid binding			skin(2)|large_intestine(1)|ovary(1)	4						CCTCAACCCCGTGGGTCCTGA	0.483																0.262411	98.813888	106.011941	37	104	KEEP	---	---	---	---	32	11	64	55	-1	capture	Missense_Mutation	SNP	31606076	31606076	BPIL1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1479	46
RBM38	55544	broad.mit.edu	37	20	55968365	55968365	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:55968365C>G	uc010zzj.1	+	3	567	c.392C>G	c.(391-393)CCC>CGC	p.P131R	RBM38_uc010zzk.1_Intron	NM_017495	NP_059965	Q9H0Z9	RBM38_HUMAN	RNA-binding region containing protein 1 isoform	131					3'-UTR-mediated mRNA stabilization|cell cycle|cell cycle arrest|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mRNA processing|negative regulation of cell proliferation|regulation of RNA splicing|RNA splicing	cytosol|cytosol|nucleus|nucleus	mRNA 3'-UTR binding|mRNA binding|nucleotide binding|RNA binding				0	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)			CAGCTGCACCCCACCTTGATC	0.597																0.153333	85.863223	120.358111	46	254	KEEP	---	---	---	---	20	35	165	153	-1	capture	Missense_Mutation	SNP	55968365	55968365	RBM38	20	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	13027	46
KRTAP19-4	337971	broad.mit.edu	37	21	31869311	31869311	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31869311C>T	uc011acz.1	-	1	118	c.118G>A	c.(118-120)GGC>AGC	p.G40S		NM_181610	NP_853641	Q3LI73	KR194_HUMAN	keratin associated protein 19-4	40						intermediate filament				ovary(2)	2						CCTCCAAAGCCACAGCCATAA	0.527																0.141104	43.510708	63.76913	23	140	KEEP	---	---	---	---	19	16	122	98	-1	capture	Missense_Mutation	SNP	31869311	31869311	KRTAP19-4	21	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	8451	46
COL7A1	1294	broad.mit.edu	37	3	48629808	48629808	+	Missense_Mutation	SNP	G	A	A	rs146041612		TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48629808G>A	uc003ctz.2	-	8	1070	c.1069C>T	c.(1069-1071)CGT>TGT	p.R357C		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	357	Nonhelical region (NC1).|Fibronectin type-III 2.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CATGTCACACGGTAGCCAGTG	0.637																0.175	15.009952	18.987477	7	33	KEEP	---	---	---	---	6	5	33	26	-1	capture	Missense_Mutation	SNP	48629808	48629808	COL7A1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3669	46
IFT57	55081	broad.mit.edu	37	3	107938379	107938379	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:107938379A>T	uc003dwx.3	-	2	501	c.253T>A	c.(253-255)TAC>AAC	p.Y85N		NM_018010	NP_060480	Q9NWB7	IFT57_HUMAN	estrogen-related receptor beta like 1	85					activation of caspase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cilium|microtubule basal body	DNA binding|protein binding			ovary(1)|skin(1)|pancreas(1)	3			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			CAAAACATGTAGAACTGTTCG	0.408																0.285714	101.192069	106.675185	38	95	KEEP	---	---	---	---	17	25	60	49	-1	capture	Missense_Mutation	SNP	107938379	107938379	IFT57	3	A	T	T	T	1	0	0	0	0	1	0	0	0	195	15	4	4	7487	46
COL6A6	131873	broad.mit.edu	37	3	130354555	130354555	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:130354555G>A	uc010htl.2	+	27	5072	c.5041G>A	c.(5041-5043)GAC>AAC	p.D1681N	COL6A6_uc003eni.3_5'UTR	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1681	Triple-helical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						TGAGATTGGGGACCCTGGTGG	0.373																0.180328	23.985863	29.84848	11	50	KEEP	---	---	---	---	5	8	32	28	-1	capture	Missense_Mutation	SNP	130354555	130354555	COL6A6	3	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	3668	46
FRAS1	80144	broad.mit.edu	37	4	79399128	79399128	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79399128G>A	uc003hlb.2	+	55	8451	c.8011G>A	c.(8011-8013)GAG>AAG	p.E2671K		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2666	Extracellular (Potential).|Calx-beta 2.				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CAACGATACCGAGGATGAACC	0.458																0.121212	5.175221	9.816808	4	29	KEEP	---	---	---	---	4	2	19	14	-1	capture	Missense_Mutation	SNP	79399128	79399128	FRAS1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5986	46
NR3C2	4306	broad.mit.edu	37	4	149073647	149073647	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:149073647T>C	uc003ilj.3	-	6	2817	c.2483A>G	c.(2482-2484)TAT>TGT	p.Y828C	NR3C2_uc003ilk.3_Missense_Mutation_p.Y711C|NR3C2_uc010iph.2_Intron	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	828	Steroid-binding.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	TGGTGCAAAATAGAGAAATTG	0.358	Melanoma(27;428 957 40335 51025 51111)															0.239316	89.746767	97.000714	28	89	KEEP	---	---	---	---	10	23	55	46	-1	capture	Missense_Mutation	SNP	149073647	149073647	NR3C2	4	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	10538	46
ADAM29	11086	broad.mit.edu	37	4	175897719	175897719	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175897719G>A	uc003iuc.2	+	5	1713	c.1043G>A	c.(1042-1044)CGT>CAT	p.R348H	ADAM29_uc003iud.2_Missense_Mutation_p.R348H|ADAM29_uc010irr.2_Missense_Mutation_p.R348H|ADAM29_uc011cki.1_Missense_Mutation_p.R348H	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	348	Peptidase M12B.|Extracellular (Potential).				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GATACATGTCGTTGTTCACAA	0.373	Ovarian(140;1727 1835 21805 25838 41440)				106											0.223485	140.484164	159.043846	59	205	KEEP	---	---	---	---	38	27	119	115	-1	capture	Missense_Mutation	SNP	175897719	175897719	ADAM29	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	247	46
SRP19	6728	broad.mit.edu	37	5	112227799	112227799	+	Missense_Mutation	SNP	A	G	G	rs712665	by1000genomes	TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:112227799A>G	uc011cvv.1	+	4	793	c.538A>G	c.(538-540)AGT>GGT	p.S180G	SRP19_uc011cvu.1_Missense_Mutation_p.S165G|REEP5_uc011cvw.1_Intron|REEP5_uc003kqe.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron			P09132	SRP19_HUMAN	SubName: Full=Zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2;	Error:Variant_position_missing_in_P09132_after_alignment					response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|mitochondrion|nucleolus|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding				0		all_cancers(142;0.00328)|all_epithelial(76;6.39e-05)|Prostate(80;0.00174)|Colorectal(10;0.00372)|Ovarian(225;0.156)		Epithelial(69;1.7e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.17e-08)|all cancers(49;3.96e-07)|Colorectal(14;0.0056)|COAD - Colon adenocarcinoma(37;0.0104)		TTTAGAAAATAGTACCACATG	0.328																0.059829	-4.564141	19.134163	7	110	KEEP	---	---	---	---	3	5	44	75	-1	capture	Missense_Mutation	SNP	112227799	112227799	SRP19	5	A	G	G	G	1	0	0	0	0	1	0	0	0	183	15	3	3	15046	46
KIF3A	11127	broad.mit.edu	37	5	132038627	132038627	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:132038627C>A	uc003kxo.2	-	11	1670	c.1516G>T	c.(1516-1518)GAA>TAA	p.E506*	KIF3A_uc003kxm.2_Nonsense_Mutation_p.E88*|KIF3A_uc003kxn.2_Nonsense_Mutation_p.E491*|KIF3A_uc011cxf.1_Nonsense_Mutation_p.E533*|KIF3A_uc003kxp.2_Nonsense_Mutation_p.E509*	NM_007054	NP_008985	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	506	Potential.				blood coagulation|organelle organization|plus-end-directed vesicle transport along microtubule	centrosome|cytosol|kinesin II complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|protein binding			pancreas(1)	1		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTCCTCCTTTCTTCCAGTTCC	0.408																0.332609	415.76809	427.21176	153	307	KEEP	---	---	---	---	84	88	176	182	0.511627906977	capture	Nonsense_Mutation	SNP	132038627	132038627	KIF3A	5	C	A	A	A	1	0	0	0	0	0	1	0	0	416	32	5	4	8222	46
SPOCK1	6695	broad.mit.edu	37	5	136324273	136324273	+	Silent	SNP	A	G	G			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:136324273A>G	uc003lbo.2	-	7	957	c.766T>C	c.(766-768)TTG>CTG	p.L256L	SPOCK1_uc003lbp.2_Silent_p.L256L	NM_004598	NP_004589	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains	256					cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTCATGTCCAACTTGTTGAAC	0.498																0.322148	161.655486	165.836591	48	101	KEEP	---	---	---	---	19	37	51	62	-1	capture	Silent	SNP	136324273	136324273	SPOCK1	5	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	14971	46
ETF1	2107	broad.mit.edu	37	5	137848498	137848498	+	Silent	SNP	G	T	T	rs145474099	byFrequency	TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137848498G>T	uc003ldc.3	-	6	852	c.687C>A	c.(685-687)TCC>TCA	p.S229S	ETF1_uc011cyv.1_Silent_p.S215S|ETF1_uc010jex.2_RNA|ETF1_uc003ldd.3_Silent_p.S196S|ETF1_uc010jey.1_Silent_p.S35S	NM_004730	NP_004721	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	229					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|protein methylation|regulation of translational termination	cytoplasm	protein binding|ribosome binding|translation release factor activity, codon specific			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TAAAGTCAGCGGATCCAGCTA	0.403																0.126761	28.856002	48.148845	18	124	KEEP	---	---	---	---	8	11	60	70	0.421052631579	capture	Silent	SNP	137848498	137848498	ETF1	5	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	5223	46
PCDHA2	56146	broad.mit.edu	37	5	140176802	140176802	+	Silent	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140176802G>A	uc003lhd.2	+	1	2359	c.2253G>A	c.(2251-2253)TCG>TCA	p.S751S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Silent_p.S751S|PCDHA2_uc011czy.1_Silent_p.S751S	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	751	Cytoplasmic (Potential).|5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTCTTACTCGCAGCAGAGGC	0.672																0.447917	130.713676	130.940386	43	53	KEEP	---	---	---	---	21	32	27	39	-1	capture	Silent	SNP	140176802	140176802	PCDHA2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11427	46
ARAP3	64411	broad.mit.edu	37	5	141041288	141041288	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:141041288G>A	uc003llm.2	-	21	3160	c.3082C>T	c.(3082-3084)CGC>TGC	p.R1028C	ARAP3_uc003lll.2_5'UTR|ARAP3_uc011dbe.1_Missense_Mutation_p.R690C|ARAP3_uc003lln.2_Missense_Mutation_p.R859C	NM_022481	NP_071926	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1028	Rho-GAP.				cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding			breast(5)|ovary(1)|large_intestine(1)	7						AGTGTGCGGCGGTTGACCCGC	0.552																0.301887	132.778741	138.328844	48	111	KEEP	---	---	---	---	25	40	105	88	-1	capture	Missense_Mutation	SNP	141041288	141041288	ARAP3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	833	46
ZNF165	7718	broad.mit.edu	37	6	28053436	28053436	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28053436T>C	uc003nkg.2	+	3	1262	c.178T>C	c.(178-180)TCT>CCT	p.S60P	ZNF165_uc003nkh.2_Missense_Mutation_p.S60P|ZNF165_uc003nki.3_Missense_Mutation_p.S60P	NM_003447	NP_003438	P49910	ZN165_HUMAN	zinc finger protein 165	60					viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CTACCAGGATTCTCCTGGACC	0.537																0.292818	162.505503	169.460609	53	128	KEEP	---	---	---	---	27	28	64	70	-1	capture	Missense_Mutation	SNP	28053436	28053436	ZNF165	6	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	17620	46
ITPR3	3710	broad.mit.edu	37	6	33653482	33653482	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33653482C>T	uc011drk.1	+	41	5764	c.5545C>T	c.(5545-5547)CGC>TGC	p.R1849C	ITPR3_uc003oey.2_5'Flank	NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	1849	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding	p.R1849C(1)		ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						CCCCAGCCTGCGCCGGGGGCA	0.662																0.302326	67.11685	70.117726	26	60	KEEP	---	---	---	---	19	17	34	45	-1	capture	Missense_Mutation	SNP	33653482	33653482	ITPR3	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7845	46
SNAP91	9892	broad.mit.edu	37	6	84292053	84292053	+	Silent	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:84292053C>T	uc011dze.1	-	22	2354	c.2037G>A	c.(2035-2037)GCG>GCA	p.A679A	SNAP91_uc011dzd.1_Silent_p.A182A|SNAP91_uc003pkb.2_Silent_p.A588A|SNAP91_uc003pkc.2_Silent_p.A649A|SNAP91_uc003pkd.2_Silent_p.A372A|SNAP91_uc003pka.2_Silent_p.A677A	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog	679					clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		ATGGGGAAGGCGCCATGAAAG	0.433																0.340909	44.012394	44.99624	15	29	KEEP	---	---	---	---	10	5	12	17	-1	capture	Silent	SNP	84292053	84292053	SNAP91	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14725	46
PM20D2	135293	broad.mit.edu	37	6	89868090	89868090	+	Missense_Mutation	SNP	A	G	G	rs141826904	byFrequency	TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:89868090A>G	uc003pmz.2	+	5	1054	c.959A>G	c.(958-960)AAT>AGT	p.N320S		NM_001010853	NP_001010853	Q8IYS1	P20D2_HUMAN	aminoacylase 1-like 2	320							hydrolase activity				0		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)		GTTCTTCCCAATAAGAGCCTA	0.318																0.112426	33.102275	58.165685	19	150	KEEP	---	---	---	---	10	10	79	91	-1	capture	Missense_Mutation	SNP	89868090	89868090	PM20D2	6	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	12032	46
SIM1	6492	broad.mit.edu	37	6	100841583	100841583	+	Silent	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:100841583C>T	uc003pqj.3	-	10	1557	c.1350G>A	c.(1348-1350)GCG>GCA	p.A450A	SIM1_uc010kcu.2_Silent_p.A450A	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	450	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		AGTGGTCAAGCGCAAAGCCAT	0.622																0.276596	101.567573	107.900037	39	102	KEEP	---	---	---	---	14	36	58	63	-1	capture	Silent	SNP	100841583	100841583	SIM1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14216	46
BCLAF1	9774	broad.mit.edu	37	6	136599630	136599630	+	Missense_Mutation	SNP	C	T	T	rs147614051		TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:136599630C>T	uc003qgx.1	-	4	642	c.389G>A	c.(388-390)CGC>CAC	p.R130H	BCLAF1_uc003qgw.1_Missense_Mutation_p.R130H|BCLAF1_uc003qgy.1_Missense_Mutation_p.R128H|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R128H	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	130					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ATATGACCGGCGAGATCTGCT	0.458	Colon(142;1534 1789 5427 7063 28491)															0.144886	88.30298	131.002312	51	301	KEEP	---	---	---	---	29	29	158	180	-1	capture	Missense_Mutation	SNP	136599630	136599630	BCLAF1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1372	46
OPRM1	4988	broad.mit.edu	37	6	154412347	154412347	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:154412347G>A	uc003qpr.2	+	3	1141	c.904G>A	c.(904-906)GTC>ATC	p.V302I	OPRM1_uc011efc.1_Missense_Mutation_p.V221I|OPRM1_uc011efd.1_Missense_Mutation_p.V202I|OPRM1_uc011efe.1_Missense_Mutation_p.V395I|OPRM1_uc003qpn.2_Missense_Mutation_p.V302I|OPRM1_uc003qpo.1_Missense_Mutation_p.V302I|OPRM1_uc011eff.1_Missense_Mutation_p.V302I|OPRM1_uc011efg.1_Missense_Mutation_p.V302I|OPRM1_uc011efh.1_Missense_Mutation_p.V302I|OPRM1_uc003qpq.1_Missense_Mutation_p.V302I|OPRM1_uc003qpt.1_Missense_Mutation_p.V302I|OPRM1_uc011efi.1_Missense_Mutation_p.V302I|OPRM1_uc003qpp.2_RNA|OPRM1_uc003qps.2_RNA|OPRM1_uc010kjg.2_Missense_Mutation_p.V202I|OPRM1_uc003qpu.2_Missense_Mutation_p.V202I	NM_000914	NP_000905	P35372	OPRM_HUMAN	opioid receptor, mu 1 isoform MOR-1	302	Helical; Name=6; (Potential).				behavior|negative regulation of cell proliferation|sensory perception	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	mu-opioid receptor activity|protein binding			ovary(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tramadol(DB00193)	TCACATTTACGTCATCATTAA	0.483																0.125	16.209716	30.493079	13	91	KEEP	---	---	---	---	8	5	43	55	-1	capture	Missense_Mutation	SNP	154412347	154412347	OPRM1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10791	46
SDK1	221935	broad.mit.edu	37	7	4011107	4011107	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4011107C>A	uc003smx.2	+	12	1863	c.1724C>A	c.(1723-1725)TCC>TAC	p.S575Y		NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	575	Ig-like C2-type 6.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GATCGGACGTCCATCGTCCAC	0.552																0.086207	0.527715	10.592766	5	53	KEEP	---	---	---	---	5	1	32	29	0.166666666667	capture	Missense_Mutation	SNP	4011107	4011107	SDK1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	13861	46
IKZF1	10320	broad.mit.edu	37	7	50468038	50468038	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50468038G>A	uc003tow.3	+	9	1441	c.1273G>A	c.(1273-1275)GGG>AGG	p.G425R	IKZF1_uc003tox.3_Missense_Mutation_p.G383R|IKZF1_uc003toy.3_Missense_Mutation_p.G383R|IKZF1_uc011kck.1_Missense_Mutation_p.G338R|IKZF1_uc003toz.3_Missense_Mutation_p.G395R|IKZF1_uc010kyx.2_Missense_Mutation_p.G165R|IKZF1_uc003tpa.3_Missense_Mutation_p.G167R	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	425				PHARNGL -> RRAQRV (in Ref. 2; AAB50683).	cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding			haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				CGCGCGCAACGGGCTGTCGCT	0.677					226	D		ALL								0.15	12.031787	16.722135	6	34	KEEP	---	---	---	---	5	2	24	16	-1	capture	Missense_Mutation	SNP	50468038	50468038	IKZF1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7537	46
VSTM2A	222008	broad.mit.edu	37	7	54636702	54636702	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:54636702G>C	uc010kzf.2	+	5	1040	c.635G>C	c.(634-636)GGT>GCT	p.G212A	VSTM2A_uc003tqc.3_Intron|uc003tqd.2_5'Flank	NM_182546	NP_872352	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2	212						extracellular region					0			STAD - Stomach adenocarcinoma(5;0.0525)			TCTTCCGCAGGTGCGAGGATA	0.383																0.961039	1213.205403	1237.391512	296	12	KEEP	---	---	---	---	167	152	5	7	-1	capture	Missense_Mutation	SNP	54636702	54636702	VSTM2A	7	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	17111	46
CALCR	799	broad.mit.edu	37	7	93106887	93106887	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93106887G>A	uc003umv.1	-	5	614	c.353C>T	c.(352-354)CCG>CTG	p.P118L	CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.P100L|CALCR_uc003umw.2_Missense_Mutation_p.P100L	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	100	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	ATCAAAATCCGGAAAATAATC	0.413																0.278481	62.119935	65.604523	22	57	KEEP	---	---	---	---	14	11	40	24	-1	capture	Missense_Mutation	SNP	93106887	93106887	CALCR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2555	46
ZAN	7455	broad.mit.edu	37	7	100357434	100357434	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100357434G>A	uc003uwj.2	+	18	3827	c.3662G>A	c.(3661-3663)AGC>AAC	p.S1221N	ZAN_uc003uwk.2_Missense_Mutation_p.S1221N|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kkd.1_5'Flank	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	1221	VWFD 1.|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CTGCCCGAGAGCACCGTCACC	0.602																0.179487	15.202701	18.97046	7	32	KEEP	---	---	---	---	7	2	22	16	-1	capture	Missense_Mutation	SNP	100357434	100357434	ZAN	7	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	17394	46
C7orf58	79974	broad.mit.edu	37	7	120655897	120655897	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:120655897A>G	uc003vjq.3	+	3	875	c.428A>G	c.(427-429)GAA>GGA	p.E143G	C7orf58_uc003vjr.1_Missense_Mutation_p.E143G|C7orf58_uc003vjs.3_Missense_Mutation_p.E143G	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	143						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					GGGCTACTAGAACAAGGTCAG	0.423																0.122449	10.915233	17.752258	6	43	KEEP	---	---	---	---	3	3	22	25	-1	capture	Missense_Mutation	SNP	120655897	120655897	C7orf58	7	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	2382	46
JHDM1D	80853	broad.mit.edu	37	7	139826573	139826573	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139826573A>T	uc003vvm.2	-	6	756	c.752T>A	c.(751-753)GTG>GAG	p.V251E		NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase	251	JmjC.				midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					ATAATTTTCCACCCAGGAAAG	0.378																0.157576	49.548415	67.996392	26	139	KEEP	---	---	---	---	16	12	70	82	-1	capture	Missense_Mutation	SNP	139826573	139826573	JHDM1D	7	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	7871	46
GSTK1	373156	broad.mit.edu	37	7	142964771	142964771	+	Missense_Mutation	SNP	C	T	T	rs41275042	byFrequency;by1000genomes	TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142964771C>T	uc003wci.2	+	6	567	c.482C>T	c.(481-483)ACG>ATG	p.T161M	GSTK1_uc011ksy.1_Missense_Mutation_p.T118M|GSTK1_uc003wcj.2_Missense_Mutation_p.T217M|GSTK1_uc011ksz.1_Missense_Mutation_p.T149M	NM_015917	NP_057001	Q9Y2Q3	GSTK1_HUMAN	glutathione S-transferase kappa 1 isoform a	161						outer membrane-bounded periplasmic space|peroxisome	glutathione transferase activity|identical protein binding|protein disulfide oxidoreductase activity				0	Melanoma(164;0.059)				Glutathione(DB00143)	AAGATCGCAACGCCAAAGGTG	0.512																0.184332	81.77135	102.058538	40	177	KEEP	---	---	---	---	20	26	103	89	-1	capture	Missense_Mutation	SNP	142964771	142964771	GSTK1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6768	46
NOBOX	135935	broad.mit.edu	37	7	144098495	144098495	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:144098495C>T	uc011kue.1	-	4	488	c.488G>A	c.(487-489)CGC>CAC	p.R163H		NM_001080413	NP_001073882	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	163					cell differentiation|oogenesis	nucleus	sequence-specific DNA binding			ovary(1)	1	Melanoma(164;0.14)					AGCCCTGGAGCGGGGGGGCGG	0.627																0.19697	23.400284	29.004931	13	53	KEEP	---	---	---	---	7	6	30	32	-1	capture	Missense_Mutation	SNP	144098495	144098495	NOBOX	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10419	46
AGAP3	116988	broad.mit.edu	37	7	150840441	150840441	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150840441C>T	uc003wjg.1	+	17	2290	c.2287C>T	c.(2287-2289)CGC>TGC	p.R763C	AGAP3_uc003wje.1_Missense_Mutation_p.R432C|AGAP3_uc003wjj.1_Missense_Mutation_p.R262C|AGAP3_uc003wjk.1_Missense_Mutation_p.R181C	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN	centaurin, gamma 3 isoform a	727	Arf-GAP.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3						GGAGAAGGAACGCTGGATACG	0.617																0.165289	40.88632	53.69977	20	101	KEEP	---	---	---	---	14	12	61	56	-1	capture	Missense_Mutation	SNP	150840441	150840441	AGAP3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	369	46
RBM33	155435	broad.mit.edu	37	7	155538204	155538204	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:155538204G>T	uc010lqk.1	+	14	3255	c.2887G>T	c.(2887-2889)GTG>TTG	p.V963L	RBM33_uc011kvv.1_Missense_Mutation_p.V772L|RBM33_uc003wmg.2_5'Flank	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	963							nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		AAAGCCTGGCGTGAAAAGGAC	0.602																0.216216	21.081096	23.828818	8	29	KEEP	---	---	---	---	3	7	11	21	0.3	capture	Missense_Mutation	SNP	155538204	155538204	RBM33	7	G	T	T	T	1	0	0	0	0	1	0	0	0	520	40	4	4	13025	46
RB1CC1	9821	broad.mit.edu	37	8	53571454	53571454	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:53571454G>A	uc003xre.3	-	13	2330	c.1772C>T	c.(1771-1773)TCG>TTG	p.S591L	RB1CC1_uc003xrf.3_Missense_Mutation_p.S591L	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1	591					autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				CTGAACTTCCGAAGGACAAAA	0.323	GBM(180;1701 2102 13475 42023 52570)															0.211009	54.865261	63.284245	23	86	KEEP	---	---	---	---	14	15	61	46	-1	capture	Missense_Mutation	SNP	53571454	53571454	RB1CC1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12994	46
KIAA2022	340533	broad.mit.edu	37	X	73963609	73963609	+	Silent	SNP	G	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:73963609G>A	uc004eby.2	-	3	1400	c.783C>T	c.(781-783)TTC>TTT	p.F261F		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	261					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						TAAAAGTCTCGAAGTAACCCC	0.393					126											0.603015	398.33827	400.185965	120	79	KEEP	---	---	---	---	72	54	44	39	-1	capture	Silent	SNP	73963609	73963609	KIAA2022	23	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	8191	46
NRK	203447	broad.mit.edu	37	X	105152945	105152945	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105152945C>T	uc004emd.2	+	13	1615	c.1312C>T	c.(1312-1314)CGA>TGA	p.R438*	NRK_uc010npc.1_Nonsense_Mutation_p.R106*	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	438	Gln-rich.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						GGCACCTCAACGACTACAAGG	0.557					430								HNSCC(51;0.14)			0.534884	69.023877	69.069239	23	20	KEEP	---	---	---	---	14	11	14	10	-1	capture	Nonsense_Mutation	SNP	105152945	105152945	NRK	23	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	10562	46
OR10Z1	128368	broad.mit.edu	37	1	158577031	158577032	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158577031_158577032delTT	uc010pio.1	+	1	803_804	c.803_804delTT	c.(802-804)CTTfs	p.L268fs		NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z,	268	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2	all_hematologic(112;0.0378)					AGCTACTCTCTTGAGAGAGATC	0.470																0.01			7	533		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	158577031	158577032	OR10Z1	1	TT	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	10827	46
ZNF546	339327	broad.mit.edu	37	19	40520966	40520969	+	Frame_Shift_Del	DEL	ACTC	-	-			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40520966_40520969delACTC	uc002oms.2	+	7	2045_2048	c.1789_1792delACTC	c.(1789-1794)ACTCAAfs	p.T597fs	ZNF546_uc002omt.2_Frame_Shift_Del_p.T571fs	NM_178544	NP_848639	Q86UE3	ZN546_HUMAN	zinc finger protein 546	597_598	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CTATAATCTTACTCAACATTTTAA	0.353																0.12			15	105		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	40520966	40520969	ZNF546	19	ACTC	-	-	-	1	0	1	0	1	0	0	0	0	182	14	5	5	17857	46
APOB	338	broad.mit.edu	37	2	21255225	21255225	+	Splice_Site	DEL	C	-	-			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21255225delC	uc002red.2	-	10	1480	c.1352_splice	c.e10+1	p.N451_splice		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor						cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TGGAAACTCACTTGTTGACCG	0.537																0.23			48	162		---	---	---	---						capture_indel	Splice_Site	DEL	21255225	21255225	APOB	2	C	-	-	-	1	0	1	0	1	0	0	1	0	260	20	5	5	778	46
FAM123C	205147	broad.mit.edu	37	2	131522112	131522112	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131522112delG	uc002trw.2	+	2	2657	c.2467delG	c.(2467-2469)GGGfs	p.G823fs	FAM123C_uc010fmv.2_Frame_Shift_Del_p.G823fs|FAM123C_uc010fms.1_Frame_Shift_Del_p.G823fs|FAM123C_uc010fmt.1_Frame_Shift_Del_p.G823fs|FAM123C_uc010fmu.1_Frame_Shift_Del_p.G823fs	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	823										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		CCAGCAGGAAGGGGGGGTCTC	0.677																0.41			7	10		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	131522112	131522112	FAM123C	2	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	5378	46
PIGU	128869	broad.mit.edu	37	20	33169458	33169460	+	In_Frame_Del	DEL	GAA	-	-			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:33169458_33169460delGAA	uc002xas.2	-	10	1143_1145	c.943_945delTTC	c.(943-945)TTCdel	p.F315del	PIGU_uc010zul.1_In_Frame_Del_p.F315del|PIGU_uc002xat.2_In_Frame_Del_p.F295del	NM_080476	NP_536724	Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	315	Helical; (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0						GGATAAACATGAAGAAGATGGGG	0.562					160											0.20			13	53		---	---	---	---						capture_indel	In_Frame_Del	DEL	33169458	33169460	PIGU	20	GAA	-	-	-	1	0	1	0	1	0	0	0	0	581	45	5	5	11803	46
SH2D1A	4068	broad.mit.edu	37	X	123504148	123504149	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-0209-01	TCGA-06-0209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123504148_123504149insA	uc004euf.3	+	3	669_670	c.324_325insA	c.(322-327)GCTAGAfs	p.A108fs	SH2D1A_uc004euh.3_Frame_Shift_Ins_p.A108fs|SH2D1A_uc004eug.3_RNA|SH2D1A_uc010nqw.2_RNA|SH2D1A_uc004eui.3_RNA|SH2D1A_uc010nqx.2_RNA	NM_002351	NP_002342	O60880	SH21A_HUMAN	SH2 domain protein 1A isoform 1	108_109					cell-cell signaling|cellular defense response	cytoplasm	SH3/SH2 adaptor activity				0						AGTCCTCAGCTAGAAGTACACA	0.371												X-linked_Lymphoproliferative_syndrome				0.19			36	158		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	123504148	123504149	SH2D1A	23	-	A	A	A	1	0	1	1	0	0	0	0	0	678	53	5	5	14123	46
