Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CPSF3L	54973	broad.mit.edu	37	1	1249704	1249704	+	Silent	SNP	G	C	C			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1249704G>C	uc001aee.1	-	8	802	c.744C>G	c.(742-744)CTC>CTG	p.L248L	CPSF3L_uc009vjy.1_RNA|CPSF3L_uc001aef.1_Silent_p.L254L|CPSF3L_uc009vjz.1_Silent_p.L226L|CPSF3L_uc010nyj.1_Silent_p.L219L|CPSF3L_uc001aeg.1_Silent_p.L124L|CPSF3L_uc001aeh.1_Silent_p.L147L|CPSF3L_uc001aei.1_Silent_p.L150L|CPSF3L_uc001aej.1_Silent_p.L75L|CPSF3L_uc001aek.1_5'UTR	NM_017871	NP_060341	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor	248						Golgi apparatus|nucleus	hydrolase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		GGAGGATGCAGAGCTCCTGGG	0.667																0.277778	13.264637	14.066393	5	13	KEEP	---	---	---	---	4	3	13	4	-1	capture	Silent	SNP	1249704	1249704	CPSF3L	1	G	C	C	C	1	0	0	0	0	0	0	0	1	418	33	4	4	3792	63
THEM5	284486	broad.mit.edu	37	1	151820732	151820732	+	Silent	SNP	G	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151820732G>A	uc009wnd.2	-	4	633	c.501C>T	c.(499-501)GAC>GAT	p.D167D		NM_182578	NP_872384	Q8N1Q8	THEM5_HUMAN	thioesterase superfamily member 5	167							hydrolase activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AAAAGGTCTCGTCCATCATGG	0.587																0.132653	17.544159	30.357644	13	85	KEEP	---	---	---	---	4	12	52	39	-1	capture	Silent	SNP	151820732	151820732	THEM5	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15744	63
MUC2	4583	broad.mit.edu	37	11	1096432	1096432	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1096432G>A	uc001lsx.1	+	37	13570	c.13543G>A	c.(13543-13545)GTG>ATG	p.V4515M		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4515	VWFD 4.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CAGCCCCTCCGTGGACAACTT	0.607																0.109244	12.084434	29.998167	13	106	KEEP	---	---	---	---	4	11	50	75	-1	capture	Missense_Mutation	SNP	1096432	1096432	MUC2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9885	63
PTPRJ	5795	broad.mit.edu	37	11	48145364	48145364	+	Silent	SNP	G	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48145364G>A	uc001ngp.3	+	5	1171	c.816G>A	c.(814-816)CCG>CCA	p.P272P	PTPRJ_uc001ngo.3_Silent_p.P272P	NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	272	Extracellular (Potential).|Fibronectin type-III 2.|Fibronectin type-III 3.				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						ACATCAACCCGTATCTTCTAC	0.473																0.119048	13.038938	24.965613	10	74	KEEP	---	---	---	---	3	10	29	52	-1	capture	Silent	SNP	48145364	48145364	PTPRJ	11	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	12699	63
SPDYC	387778	broad.mit.edu	37	11	64939756	64939756	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64939756C>A	uc010rnz.1	+	4	298	c.298C>A	c.(298-300)CAC>AAC	p.H100N		NM_001008778	NP_001008778	Q5MJ68	SPDYC_HUMAN	speedy C	100	Speedy/Ringo box; Required for CDK- binding (By similarity).				cell cycle	nucleus	protein kinase binding				0						CCAGCGCGCCCACCTGAAGCT	0.597																0.1	10.039348	32.424109	14	126	KEEP	---	---	---	---	9	8	60	88	0.470588235294	capture	Missense_Mutation	SNP	64939756	64939756	SPDYC	11	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	14920	63
INTS4	92105	broad.mit.edu	37	11	77632412	77632412	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77632412G>C	uc001oys.2	-	14	1766	c.1738C>G	c.(1738-1740)CTT>GTT	p.L580V	INTS4_uc001oyt.2_RNA	NM_033547	NP_291025	Q96HW7	INT4_HUMAN	integrator complex subunit 4	580					snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			AGATGAGAAAGACTGTCTCGG	0.393																0.10989	11.688181	25.40182	10	81	KEEP	---	---	---	---	4	7	35	62	-1	capture	Missense_Mutation	SNP	77632412	77632412	INTS4	11	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	7703	63
PARP4	143	broad.mit.edu	37	13	25009059	25009059	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25009059C>T	uc001upl.2	-	31	4326	c.4220G>A	c.(4219-4221)AGC>AAC	p.S1407N		NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1407					cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CTGTGCAGAGCTTAATGAGCT	0.542																0.108108	4.572463	10.205732	4	33	KEEP	---	---	---	---	1	4	10	25	-1	capture	Missense_Mutation	SNP	25009059	25009059	PARP4	13	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	11366	63
GABRB3	2562	broad.mit.edu	37	15	26792999	26792999	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:26792999C>T	uc001zaz.2	-	9	1505	c.1363G>A	c.(1363-1365)GTG>ATG	p.V455M	GABRB3_uc010uae.1_Missense_Mutation_p.V370M|GABRB3_uc001zba.2_Missense_Mutation_p.V455M|GABRB3_uc001zbb.2_Missense_Mutation_p.V511M	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	455	Helical; (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	AATGGAAACACGATCCTGGAC	0.398																0.087379	4.208302	21.939841	9	94	KEEP	---	---	---	---	8	5	54	60	-1	capture	Missense_Mutation	SNP	26792999	26792999	GABRB3	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6110	63
UNC13C	440279	broad.mit.edu	37	15	54305644	54305644	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:54305644C>T	uc002ack.2	+	1	544	c.544C>T	c.(544-546)CGA>TGA	p.R182*		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	182					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GGGAGCTTTACGAAAACTGAG	0.458					2691											0.044248	-14.658585	10.401622	5	108	KEEP	---	---	---	---	2	3	65	55	-1	capture	Nonsense_Mutation	SNP	54305644	54305644	UNC13C	15	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	16868	63
IRF8	3394	broad.mit.edu	37	16	85952286	85952286	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:85952286G>A	uc002fjh.2	+	7	922	c.865G>A	c.(865-867)GTC>ATC	p.V289I	IRF8_uc010chp.2_Intron	NM_002163	NP_002154	Q02556	IRF8_HUMAN	interferon regulatory factor 8	289					interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(2)|ovary(1)	3		Prostate(104;0.0771)				GGGCGTGTTCGTCAAGCGGCT	0.677																0.069767	-1.608804	6.608613	3	40	KEEP	---	---	---	---	1	2	18	26	-1	capture	Missense_Mutation	SNP	85952286	85952286	IRF8	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7759	63
MYH2	4620	broad.mit.edu	37	17	10429979	10429979	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10429979G>C	uc010coi.2	-	30	4252	c.4124C>G	c.(4123-4125)GCC>GGC	p.A1375G	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.A1375G|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1375	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						CCTCCATTGGGCAACCTCGGT	0.567																0.119048	29.490406	53.461549	20	148	KEEP	---	---	---	---	8	14	72	94	-1	capture	Missense_Mutation	SNP	10429979	10429979	MYH2	17	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	9945	63
NPTX1	4884	broad.mit.edu	37	17	78447110	78447110	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78447110C>T	uc002jyp.1	-	3	945	c.787G>A	c.(787-789)GCC>ACC	p.A263T		NM_002522	NP_002513	Q15818	NPTX1_HUMAN	neuronal pentraxin I precursor	263	Pentaxin.				central nervous system development|synaptic transmission|transport	transport vesicle	metal ion binding				0	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			CCTGGCGTGGCGCTGGACTTG	0.587																0.091575	12.154248	57.954679	25	248	KEEP	---	---	---	---	10	20	131	150	-1	capture	Missense_Mutation	SNP	78447110	78447110	NPTX1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10509	63
APC2	10297	broad.mit.edu	37	19	1465389	1465389	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1465389C>T	uc002lsr.1	+	15	2297	c.2089C>T	c.(2089-2091)CAT>TAT	p.H697Y	APC2_uc002lss.1_Missense_Mutation_p.H279Y|APC2_uc002lst.1_Missense_Mutation_p.H697Y|APC2_uc002lsu.1_Missense_Mutation_p.H696Y|C19orf25_uc010xgn.1_Intron	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2	697					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGCTGGCCCATCGGCCCGC	0.716																0.2	8.39183	10.063766	4	16	KEEP	---	---	---	---	1	4	7	13	-1	capture	Missense_Mutation	SNP	1465389	1465389	APC2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	757	63
PLIN4	729359	broad.mit.edu	37	19	4512541	4512541	+	Silent	SNP	C	T	T	rs139885054	by1000genomes	TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4512541C>T	uc002mar.1	-	3	1389	c.1389G>A	c.(1387-1389)GCG>GCA	p.A463A	PLIN4_uc010dub.1_5'Flank	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	463	27 X 33 AA approximate tandem repeat.|12.					lipid particle|plasma membrane					0						TGGCCACATTCGCAGCACCGG	0.577																0.113208	28.452431	59.745045	24	188	KEEP	---	---	---	---	10	16	93	114	-1	capture	Silent	SNP	4512541	4512541	PLIN4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	11995	63
CD209	30835	broad.mit.edu	37	19	7810925	7810925	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7810925G>A	uc002mht.2	-	4	294	c.227C>T	c.(226-228)GCG>GTG	p.A76V	CD209_uc010xju.1_Missense_Mutation_p.A76V|CD209_uc010dvp.2_Missense_Mutation_p.A52V|CD209_uc002mhr.2_Missense_Mutation_p.A52V|CD209_uc002mhs.2_Missense_Mutation_p.A52V|CD209_uc002mhu.2_Missense_Mutation_p.A76V|CD209_uc010dvq.2_Missense_Mutation_p.A76V|CD209_uc002mhq.2_Missense_Mutation_p.A76V|CD209_uc002mhv.2_Missense_Mutation_p.A52V|CD209_uc002mhx.2_Missense_Mutation_p.A32V|CD209_uc002mhw.2_Missense_Mutation_p.A32V|CD209_uc010dvr.2_Intron	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	76	Extracellular (Probable).				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						CTGGTAGATCGCGTCTTGCCT	0.458																0.106145	16.45103	43.978737	19	160	KEEP	---	---	---	---	13	8	83	99	-1	capture	Missense_Mutation	SNP	7810925	7810925	CD209	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2955	63
HNRNPL	3191	broad.mit.edu	37	19	39330868	39330868	+	Silent	SNP	T	G	G			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39330868T>G	uc010xul.1	-	8	1112	c.1101A>C	c.(1099-1101)CCA>CCC	p.P367P	HNRNPL_uc010ege.1_Silent_p.P23P|HNRNPL_uc002ojj.1_Silent_p.P23P|HNRNPL_uc002ojo.1_5'Flank|HNRNPL_uc002ojk.2_Silent_p.P23P|HNRNPL_uc002ojl.2_Silent_p.P23P|HNRNPL_uc010xum.1_Silent_p.P234P|HNRNPL_uc002ojp.1_Silent_p.P23P|HNRNPL_uc010xun.1_Missense_Mutation_p.H75P	NM_001533	NP_001524	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	367	Pro-rich.				nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GGGGAGGGGGTGGGGGGTGCC	0.642																0.363636	6.584833	6.769272	4	7	KEEP	---	---	---	---	5	2	7	3	-1	capture	Silent	SNP	39330868	39330868	HNRNPL	19	T	G	G	G	1	0	0	0	0	0	0	0	1	756	59	4	4	7195	63
FCGBP	8857	broad.mit.edu	37	19	40432968	40432968	+	Missense_Mutation	SNP	C	T	T	rs142198641	byFrequency	TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40432968C>T	uc002omp.3	-	2	1309	c.1301G>A	c.(1300-1302)CGG>CAG	p.R434Q		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	434	IgGFc-binding.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TTACTTACTCCGGCCGCAATC	0.587																0.170213	36.079381	45.719604	16	78	KEEP	---	---	---	---	5	15	37	54	-1	capture	Missense_Mutation	SNP	40432968	40432968	FCGBP	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5724	63
NLRP5	126206	broad.mit.edu	37	19	56539808	56539808	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56539808C>T	uc002qmj.2	+	7	2209	c.2209C>T	c.(2209-2211)CGG>TGG	p.R737W	NLRP5_uc002qmi.2_Missense_Mutation_p.R718W	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	737	LRR 2.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GCGGAAAATTCGGGTGGATGT	0.498																0.096096	21.718157	76.132326	32	301	KEEP	---	---	---	---	14	20	177	155	-1	capture	Missense_Mutation	SNP	56539808	56539808	NLRP5	19	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	10387	63
C2orf89	129293	broad.mit.edu	37	2	85051124	85051124	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:85051124C>A	uc010ysl.1	-	6	1376	c.1287G>T	c.(1285-1287)AGG>AGT	p.R429S	C2orf89_uc002sou.3_Missense_Mutation_p.R380S	NM_001080824	NP_001074293	Q86V40	CB089_HUMAN	hypothetical protein LOC129293 precursor	429	Extracellular (Potential).					integral to membrane				ovary(1)	1						GGAGTCGCGGCCTCCGCTGTG	0.652																0.173077	16.640631	21.892065	9	43	KEEP	---	---	---	---	6	4	24	23	0.4	capture	Missense_Mutation	SNP	85051124	85051124	C2orf89	2	C	A	A	A	1	0	0	0	0	1	0	0	0	337	26	4	4	2183	63
TSHZ2	128553	broad.mit.edu	37	20	51870755	51870755	+	Missense_Mutation	SNP	C	T	T	rs141985599		TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:51870755C>T	uc002xwo.2	+	2	1714	c.758C>T	c.(757-759)ACG>ATG	p.T253M		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	253					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			CTCAGACCCACGAGCTATTCA	0.488																0.126984	10.555236	19.106996	8	55	KEEP	---	---	---	---	4	5	30	29	-1	capture	Missense_Mutation	SNP	51870755	51870755	TSHZ2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16507	63
CASR	846	broad.mit.edu	37	3	121976021	121976021	+	Silent	SNP	G	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121976021G>A	uc003eev.3	+	3	651	c.279G>A	c.(277-279)CTG>CTA	p.L93L	CASR_uc003eew.3_Silent_p.L93L	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	93	Extracellular (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	ACTTGACGCTGGGATACAGGA	0.448																0.128655	31.541064	54.504596	22	149	KEEP	---	---	---	---	15	9	82	92	-1	capture	Silent	SNP	121976021	121976021	CASR	3	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	2658	63
RBM47	54502	broad.mit.edu	37	4	40440364	40440364	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40440364C>T	uc003gvc.2	-	4	1257	c.547G>A	c.(547-549)GTC>ATC	p.V183I	RBM47_uc003gvd.2_Missense_Mutation_p.V183I|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.V145I|RBM47_uc003gvg.1_Missense_Mutation_p.V183I	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	183	RRM 2.					nucleus	nucleotide binding|RNA binding			breast(3)	3						CTGGCGTAGACGATCACGTCC	0.637																0.055944	-13.594503	16.03702	8	135	KEEP	---	---	---	---	2	7	73	91	-1	capture	Missense_Mutation	SNP	40440364	40440364	RBM47	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13036	63
CSN1S1	1446	broad.mit.edu	37	4	70810660	70810660	+	Silent	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70810660C>T	uc003hep.1	+	15	544	c.495C>T	c.(493-495)TCC>TCT	p.S165S	CSN1S1_uc003heq.1_Silent_p.S156S|CSN1S1_uc003her.1_Silent_p.S157S	NM_001890	NP_001881	P47710	CASA1_HUMAN	casein alpha s1 isoform 1	165						extracellular region	protein binding|transporter activity				0						CACCGTTTTCCGACATCTCCA	0.423																0.184	49.66016	61.364296	23	102	KEEP	---	---	---	---	10	15	54	54	-1	capture	Silent	SNP	70810660	70810660	CSN1S1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3912	63
FRAS1	80144	broad.mit.edu	37	4	79396642	79396642	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79396642C>T	uc003hlb.2	+	54	8173	c.7733C>T	c.(7732-7734)ACT>ATT	p.T2578I		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2577	Calx-beta 1.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						GTGCAGAGGACTGGGAACCTG	0.542																0.141509	23.448386	36.593909	15	91	KEEP	---	---	---	---	5	10	47	55	-1	capture	Missense_Mutation	SNP	79396642	79396642	FRAS1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	5986	63
FBN2	2201	broad.mit.edu	37	5	127800505	127800505	+	Silent	SNP	C	T	T	rs150087436	byFrequency;by1000genomes	TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127800505C>T	uc003kuu.2	-	6	1177	c.738G>A	c.(736-738)GCG>GCA	p.A246A	FBN2_uc003kuv.2_Silent_p.A213A|FBN2_uc003kuw.3_Silent_p.A246A|FBN2_uc003kux.1_Silent_p.A246A	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	246	TB 1.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GATGGCCCCACGCCCGTCCAA	0.607				p.A246A(HS688A.T-Tumor)|p.A246A(SCLC21H-Tumor)|p.A246A(A204-Tumor)	1552											0.086207	2.88547	22.985792	10	106	KEEP	---	---	---	---	7	3	41	72	-1	capture	Silent	SNP	127800505	127800505	FBN2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	5649	63
ABLIM3	22885	broad.mit.edu	37	5	148637907	148637907	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148637907G>C	uc003lpy.2	+	24	2243	c.1992G>C	c.(1990-1992)GAG>GAC	p.E664D	ABLIM3_uc003lpz.1_Missense_Mutation_p.E664D|ABLIM3_uc003lqa.1_Missense_Mutation_p.E561D|ABLIM3_uc003lqb.2_Intron|ABLIM3_uc003lqc.1_Missense_Mutation_p.E631D|ABLIM3_uc003lqd.1_Missense_Mutation_p.E569D|ABLIM3_uc003lqf.2_Intron|ABLIM3_uc003lqe.1_Missense_Mutation_p.E553D	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	664	HP.				axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCATCTCTGAGTTTGACCGGC	0.517																0.114286	14.046197	24.31403	8	62	KEEP	---	---	---	---	3	7	25	55	-1	capture	Missense_Mutation	SNP	148637907	148637907	ABLIM3	5	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	96	63
LY6G6F	259215	broad.mit.edu	37	6	31675363	31675363	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31675363C>A	uc003nwa.1	+	2	181	c.181C>A	c.(181-183)CTG>ATG	p.L61M	BAT5_uc011dnz.1_Intron|LY6G6F_uc003nwb.1_Missense_Mutation_p.L61M	NM_001003693	NP_001003693	Q5SQ64	LY66F_HUMAN	G6f protein precursor	61	Extracellular (Potential).|Ig-like V-type.					integral to membrane|plasma membrane				breast(1)|central_nervous_system(1)	2						CTTCACCACCCTGGTAGCCCA	0.592																0.075	-0.60904	6.805928	3	37	KEEP	---	---	---	---	3	1	16	24	0.25	capture	Missense_Mutation	SNP	31675363	31675363	LY6G6F	6	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	9011	63
TBX18	9096	broad.mit.edu	37	6	85446758	85446758	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:85446758G>A	uc003pkl.1	-	8	1469	c.1469C>T	c.(1468-1470)TCG>TTG	p.S490L	TBX18_uc010kbq.1_Intron	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	490					multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		GGACATTCCCGAAATCTGCAT	0.527					300											0.139241	52.93369	82.779591	33	204	KEEP	---	---	---	---	20	19	135	97	-1	capture	Missense_Mutation	SNP	85446758	85446758	TBX18	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15540	63
ASCC3	10973	broad.mit.edu	37	6	101037629	101037629	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:101037629C>T	uc003pqk.2	-	36	5760	c.5431G>A	c.(5431-5433)GAA>AAA	p.E1811K		NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1811					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GTTAGAGGTTCAATGCTGCGA	0.343																0.122137	17.40511	35.730576	16	115	KEEP	---	---	---	---	15	3	60	75	-1	capture	Missense_Mutation	SNP	101037629	101037629	ASCC3	6	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	1024	63
PNLDC1	154197	broad.mit.edu	37	6	160240368	160240368	+	Missense_Mutation	SNP	G	A	A	rs138386704		TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160240368G>A	uc003qsx.1	+	18	1654	c.1483G>A	c.(1483-1485)GTC>ATC	p.V495I	PNLDC1_uc003qsy.1_Missense_Mutation_p.V506I	NM_173516	NP_775787	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain	495	Helical; Anchor for type IV membrane protein; (Potential).					integral to membrane|nucleus	nucleic acid binding				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CTCCCCAAACGTCAACTGCCT	0.617																0.24	29.481873	32.562263	12	38	KEEP	---	---	---	---	8	5	18	25	-1	capture	Missense_Mutation	SNP	160240368	160240368	PNLDC1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12051	63
QKI	9444	broad.mit.edu	37	6	163956153	163956153	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:163956153C>G	uc003qui.2	+	4	1093	c.542C>G	c.(541-543)CCT>CGT	p.P181R	QKI_uc003que.2_Missense_Mutation_p.P181R|QKI_uc003quf.2_Missense_Mutation_p.P181R|QKI_uc003qug.2_Missense_Mutation_p.P181R|QKI_uc003quh.2_Missense_Mutation_p.P181R|QKI_uc003quj.2_Missense_Mutation_p.P181R	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform	181					mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		TTATTGGTACCTGCAGTAAGT	0.333																0.141176	21.058448	31.605139	12	73	KEEP	---	---	---	---	8	6	43	48	-1	capture	Missense_Mutation	SNP	163956153	163956153	QKI	6	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	12768	63
EGFR	1956	broad.mit.edu	37	7	55241677	55241677	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55241677G>A	uc003tqk.2	+	18	2371	c.2125G>A	c.(2125-2127)GAA>AAA	p.E709K	EGFR_uc010kzg.1_Missense_Mutation_p.E664K|EGFR_uc011kco.1_Missense_Mutation_p.E656K	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	709	Cytoplasmic (Potential).		E -> K (found in a lung cancer sample).|E -> A (found in a lung cancer sample).		activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.E709K(17)|p.E709A(11)|p.E709G(7)|p.E709V(5)|p.E709_T710>D(5)|p.E709H(2)|p.E709_T710>G(1)|p.E709_T710>A(1)|p.E709fs*1(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GATCTTGAAGGAAACTGAATT	0.567			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.019376	-214.415336	27.114502	18	911	KEEP	---	---	---	---	6	13	484	496	-1	capture	Missense_Mutation	SNP	55241677	55241677	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	4922	63
EGFR	1956	broad.mit.edu	37	7	55241708	55241708	+	Missense_Mutation	SNP	G	A	A	rs121913428		TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55241708G>A	uc003tqk.2	+	18	2402	c.2156G>A	c.(2155-2157)GGC>GAC	p.G719D	EGFR_uc010kzg.1_Missense_Mutation_p.G674D|EGFR_uc011kco.1_Missense_Mutation_p.G666D	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	719	Cytoplasmic (Potential).|Protein kinase.|ATP.		G -> A (found in a lung cancer sample).|G -> D (found in a lung cancer sample).|G -> S (found in a lung cancer sample; somatic mutation; strongly increased kinase activity).		activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G719S(61)|p.G719A(52)|p.G719C(31)|p.G719?(9)|p.G719D(6)|p.G719V(1)|p.G719fs*29(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AAAGTGCTGGGCTCCGGTGCG	0.582			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.018519	-163.605498	19.554241	13	689	KEEP	---	---	---	---	5	8	367	376	-1	capture	Missense_Mutation	SNP	55241708	55241708	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4922	63
MUC17	140453	broad.mit.edu	37	7	100678917	100678917	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100678917C>T	uc003uxp.1	+	3	4273	c.4220C>T	c.(4219-4221)CCG>CTG	p.P1407L	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1407	Extracellular (Potential).|59 X approximate tandem repeats.|21.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AGCACCACGCCGGTAGTCAGT	0.512																0.108527	47.965004	106.738114	42	345	KEEP	---	---	---	---	20	28	198	222	-1	capture	Missense_Mutation	SNP	100678917	100678917	MUC17	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9884	63
KCND2	3751	broad.mit.edu	37	7	120386073	120386073	+	Silent	SNP	G	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:120386073G>T	uc003vjj.1	+	5	2672	c.1707G>T	c.(1705-1707)CTG>CTT	p.L569L		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	569	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					GAACACCTCTGTCTAACAGGT	0.443																0.068182	-1.412498	7.076726	3	41	KEEP	---	---	---	---	1	2	26	21	0.333333333333	capture	Silent	SNP	120386073	120386073	KCND2	7	G	T	T	T	1	0	0	0	0	0	0	0	1	613	48	4	4	7941	63
TSGA14	95681	broad.mit.edu	37	7	130038800	130038800	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:130038800C>T	uc003vpz.2	-	11	1101	c.1054G>A	c.(1054-1056)GGC>AGC	p.G352S	TSGA14_uc003vpy.2_Missense_Mutation_p.G114S|TSGA14_uc010lmf.2_Missense_Mutation_p.G149S|TSGA14_uc003vqa.2_Missense_Mutation_p.G280S|TSGA14_uc011kpg.1_Missense_Mutation_p.G264S	NM_018718	NP_061188	Q9BYV8	CEP41_HUMAN	testis specific, 14	352					G2/M transition of mitotic cell cycle	centrosome|cytosol					0	Melanoma(18;0.0435)					CTGGCGGGGCCGCCACCTGGC	0.562																0.097059	19.529471	74.749421	33	307	KEEP	---	---	---	---	11	26	170	177	-1	capture	Missense_Mutation	SNP	130038800	130038800	TSGA14	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16503	63
RP1L1	94137	broad.mit.edu	37	8	10466088	10466088	+	Silent	SNP	A	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:10466088A>T	uc003wtc.2	-	4	5749	c.5520T>A	c.(5518-5520)GCT>GCA	p.A1840A		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1840					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CCTCCCCTTCAGCCTCCGGGG	0.632																0.132353	57.632997	93.324267	36	236	KEEP	---	---	---	---	22	16	128	142	-1	capture	Silent	SNP	10466088	10466088	RP1L1	8	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	13425	63
KCNB2	9312	broad.mit.edu	37	8	73848725	73848725	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:73848725A>G	uc003xzb.2	+	3	1723	c.1135A>G	c.(1135-1137)ATG>GTG	p.M379V		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	379					regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			CACCATCACCATGACCACTGT	0.448																0.105263	14.791261	38.334608	16	136	KEEP	---	---	---	---	4	12	64	84	-1	capture	Missense_Mutation	SNP	73848725	73848725	KCNB2	8	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	7935	63
PTPRD	5789	broad.mit.edu	37	9	8485910	8485910	+	Silent	SNP	C	T	T			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:8485910C>T	uc003zkk.2	-	27	3618	c.2907G>A	c.(2905-2907)GAG>GAA	p.E969E	PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Silent_p.E960E|PTPRD_uc003zkm.2_Silent_p.E956E|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	969	Fibronectin type-III 7.|Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CAATAAGCTGCTCCATCGGGA	0.468					1253								TSP Lung(15;0.13)			0.125	17.896603	32.189589	13	91	KEEP	---	---	---	---	3	10	45	63	-1	capture	Silent	SNP	8485910	8485910	PTPRD	9	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	12694	63
GPR143	4935	broad.mit.edu	37	X	9711677	9711677	+	Missense_Mutation	SNP	G	A	A	rs137852297		TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:9711677G>A	uc004cst.1	-	6	755	c.755C>T	c.(754-756)ACG>ATG	p.T252M		NM_000273	NP_000264	P51810	GP143_HUMAN	G protein-coupled receptor 143	232	Cytoplasmic (Potential).|Necessary for its G protein-activation ability and normal distribution of melanosomes.		T -> K (in OA1; abnormal distribution of melanosomes; Not delivered at the cell surface of melanocytic and non- melanocytic cells).		calcium-mediated signaling using intracellular calcium source|eye pigment biosynthetic process|melanosome organization|melanosome transport|phosphatidylinositol-mediated signaling|regulation of calcium-mediated signaling|visual perception	apical plasma membrane|Golgi apparatus|integral to membrane|lysosomal membrane|melanosome membrane|membrane fraction	dopamine binding|L-DOPA receptor activity|protein binding|tyrosine binding			ovary(1)	1		Hepatocellular(5;0.000888)				CTCGTTCTCCGTGTAAATGCC	0.383																0.116438	18.908666	40.016183	17	129	KEEP	---	---	---	---	12	10	82	72	-1	capture	Missense_Mutation	SNP	9711677	9711677	GPR143	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6585	63
WDR13	64743	broad.mit.edu	37	X	48463240	48463240	+	Silent	SNP	G	A	A	rs144018865		TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48463240G>A	uc004dkh.1	+	10	1425	c.1278G>A	c.(1276-1278)ACG>ACA	p.T426T	WDR13_uc004dki.1_Silent_p.T334T|WDR13_uc004dkj.1_Silent_p.T426T|WDR13_uc004dkk.1_Silent_p.T334T|WDR13_uc004dkl.3_Silent_p.T334T	NM_017883	NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13 protein	426	WD 4.					cytoplasm|nucleus				ovary(2)	2						CGACAGTGACGGGCAGTGAGG	0.622																0.1	3.979787	10.36381	4	36	KEEP	---	---	---	---	4	3	19	20	-1	capture	Silent	SNP	48463240	48463240	WDR13	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17156	63
GRIPAP1	56850	broad.mit.edu	37	X	48847434	48847434	+	Silent	SNP	G	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48847434G>A	uc004dly.1	-	7	581	c.546C>T	c.(544-546)ACC>ACT	p.T182T	GRIPAP1_uc004dlz.2_Silent_p.T72T|GRIPAP1_uc004dma.2_Silent_p.T129T	NM_020137	NP_064522	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1 isoform 1	182						early endosome				breast(2)|kidney(1)	3						GGGCCAGGACGGTGGGGGCCG	0.607																0.131579	13.60437	23.658009	10	66	KEEP	---	---	---	---	6	7	31	42	-1	capture	Silent	SNP	48847434	48847434	GRIPAP1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6722	63
FMR1NB	158521	broad.mit.edu	37	X	147063166	147063166	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:147063166G>A	uc004fcm.2	+	1	318	c.244G>A	c.(244-246)GTG>ATG	p.V82M		NM_152578	NP_689791	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	82	Helical; (Potential).					integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					CCTGCTGTTCGTGTGCTACTA	0.493																0.083744	4.913717	40.6456	17	186	KEEP	---	---	---	---	9	13	110	129	-1	capture	Missense_Mutation	SNP	147063166	147063166	FMR1NB	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5905	63
SRPK3	26576	broad.mit.edu	37	X	153049494	153049494	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153049494G>A	uc004fil.2	+	10	1005	c.973G>A	c.(973-975)GCC>ACC	p.A325T	SRPK3_uc004fik.2_Missense_Mutation_p.A391T|SRPK3_uc010nul.2_Intron|SRPK3_uc004fin.2_Missense_Mutation_p.A324T|SRPK3_uc004fim.2_Intron	NM_014370	NP_055185	Q9UPE1	SRPK3_HUMAN	serine arginine rich protein-specific kinase 3	325	Protein kinase.				cell differentiation|muscle organ development|muscle tissue development		ATP binding|protein serine/threonine kinase activity			pancreas(2)|lung(1)	3	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCCGGGGGCGCCAGAGCAGG	0.697	Esophageal Squamous(167;766 3400 32156)				307											0.176471	19.292014	24.28492	9	42	KEEP	---	---	---	---	5	5	19	27	-1	capture	Missense_Mutation	SNP	153049494	153049494	SRPK3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15053	63
HNRPLL	92906	broad.mit.edu	37	2	38812883	38812883	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:38812883delC	uc002rqw.2	-	3	859	c.449delG	c.(448-450)AGCfs	p.S150fs	HNRPLL_uc002rqx.2_Frame_Shift_Del_p.S145fs	NM_138394	NP_612403	Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	150	RRM 1.				mRNA processing|positive regulation of RNA splicing	nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding			skin(1)	1		all_hematologic(82;0.248)				GATCCTTTTGCTTGTAGAATA	0.408																0.10			15	133		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	38812883	38812883	HNRPLL	2	C	-	-	-	1	0	1	0	1	0	0	0	0	364	28	5	5	7202	63
EGFR	1956	broad.mit.edu	37	7	55223531	55223533	+	In_Frame_Del	DEL	GTG	-	-			TCGA-06-0650-01	TCGA-06-0650-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55223531_55223533delGTG	uc003tqk.2	+	8	1144_1146	c.898_900delGTG	c.(898-900)GTGdel	p.V301del	EGFR_uc003tqh.2_In_Frame_Del_p.V301del|EGFR_uc003tqi.2_In_Frame_Del_p.V301del|EGFR_uc003tqj.2_In_Frame_Del_p.V301del|EGFR_uc010kzg.1_In_Frame_Del_p.V256del|EGFR_uc011kco.1_In_Frame_Del_p.V248del|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	301	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V301V(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGGTAATTATGTGGTGACAGATC	0.601			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.01			18	1183		---	---	---	---						capture_indel	In_Frame_Del	DEL	55223531	55223533	EGFR	7	GTG	-	-	-	1	0	1	0	1	0	0	0	0	624	48	5	5	4922	63
