Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ATP13A2	23400	broad.mit.edu	37	1	17316634	17316634	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17316634C>T	uc001baa.2	-	21	2590	c.2400G>A	c.(2398-2400)GTG>GTA	p.V800V	ATP13A2_uc001azz.1_5'Flank|ATP13A2_uc001bab.2_Silent_p.V795V|ATP13A2_uc001bac.2_Silent_p.V795V	NM_022089	NP_071372	Q9NQ11	AT132_HUMAN	ATPase type 13A2 isoform 1	800	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		TAACGCCATTCACGGCTGTGG	0.642																0.324074	94.183639	97.152736	35	73	KEEP	---	---	---	---	23	25	46	47	-1	capture	Silent	SNP	17316634	17316634	ATP13A2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	1115	79
TAS1R2	80834	broad.mit.edu	37	1	19166669	19166669	+	Silent	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19166669G>A	uc001bba.1	-	6	1945	c.1944C>T	c.(1942-1944)ATC>ATT	p.I648I		NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor	648	Helical; Name=3; (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	AACGCACGGCGATACAGGAGA	0.627																0.422619	426.116064	427.865254	142	194	KEEP	---	---	---	---	60	98	97	114	-1	capture	Silent	SNP	19166669	19166669	TAS1R2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	15451	79
KIF17	57576	broad.mit.edu	37	1	21009290	21009290	+	Silent	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:21009290G>A	uc001bdr.3	-	11	2437	c.2319C>T	c.(2317-2319)TAC>TAT	p.Y773Y	KIF17_uc001bdp.3_Silent_p.Y51Y|KIF17_uc001bdq.3_Silent_p.Y51Y|KIF17_uc009vpx.2_Silent_p.Y143Y|KIF17_uc001bds.3_Silent_p.Y773Y	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	773	Potential.				microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GCTCGTCTGCGTAGCGCTTGC	0.622																0.38806	148.378033	149.845758	52	82	KEEP	---	---	---	---	20	37	41	47	-1	capture	Silent	SNP	21009290	21009290	KIF17	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8201	79
GJB4	127534	broad.mit.edu	37	1	35227336	35227336	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:35227336G>A	uc001bxv.1	+	2	851	c.481G>A	c.(481-483)GTG>ATG	p.V161M	GJB4_uc001bxw.3_Missense_Mutation_p.V161M	NM_153212	NP_694944	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4	161	Extracellular (Potential).				cell communication	connexon complex|integral to membrane	gap junction channel activity			ovary(2)|central_nervous_system(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				CATGCCCCGCGTGGTGGCCTG	0.582																0.402985	77.00391	77.557192	27	40	KEEP	---	---	---	---	17	15	22	23	-1	capture	Missense_Mutation	SNP	35227336	35227336	GJB4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6347	79
CD53	963	broad.mit.edu	37	1	111439300	111439300	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:111439300C>T	uc001dzw.2	+	7	620	c.449C>T	c.(448-450)ACG>ATG	p.T150M	CD53_uc001dzx.2_Missense_Mutation_p.T150M|CD53_uc010owa.1_Intron|CD53_uc001dzy.2_Intron	NM_001040033	NP_001035122	P19397	CD53_HUMAN	CD53 antigen	150	Extracellular (Potential).				signal transduction	integral to membrane|plasma membrane					0		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		ATAAATGGCACGAGTGATTGG	0.428																0.31746	55.07708	56.943654	20	43	KEEP	---	---	---	---	10	13	31	22	-1	capture	Missense_Mutation	SNP	111439300	111439300	CD53	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2994	79
SPAG17	200162	broad.mit.edu	37	1	118558655	118558655	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118558655C>A	uc001ehk.2	-	29	4288	c.4220G>T	c.(4219-4221)GGA>GTA	p.G1407V		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1407						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TCTTTCTAATCCTTTGGTGCC	0.448																0.434783	51.975221	52.148336	20	26	KEEP	---	---	---	---	14	8	10	18	0.363636363636	capture	Missense_Mutation	SNP	118558655	118558655	SPAG17	1	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	14871	79
FLG	2312	broad.mit.edu	37	1	152275641	152275641	+	Silent	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152275641G>A	uc001ezu.1	-	3	11757	c.11721C>T	c.(11719-11721)CGC>CGT	p.R3907R		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3907	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGCTGTATCGCGGTGAGAGG	0.502												Ichthyosis				0.366337	104.462476	106.043056	37	64	KEEP	---	---	---	---	20	18	39	30	-1	capture	Silent	SNP	152275641	152275641	FLG	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5867	79
MUC1	4582	broad.mit.edu	37	1	155161953	155161953	+	Silent	SNP	T	C	C			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155161953T>C	uc010pft.1	-	2	246	c.180A>G	c.(178-180)GTA>GTG	p.V60V	RAG1AP1_uc010pey.1_Intron|MUC1_uc001fhy.2_5'Flank|MUC1_uc001fhz.2_5'Flank|MUC1_uc010pfb.1_Intron|MUC1_uc010pfc.1_Intron|MUC1_uc009wph.2_Intron|MUC1_uc010pfd.1_Intron|MUC1_uc010pfe.1_Intron|MUC1_uc010pff.1_Intron|MUC1_uc009wpi.2_Intron|MUC1_uc010pfg.1_Intron|MUC1_uc010pfh.1_Intron|MUC1_uc010pfi.1_Intron|MUC1_uc010pfj.1_Intron|MUC1_uc010pfk.1_Intron|MUC1_uc010pfl.1_Intron|MUC1_uc001fin.2_Intron|MUC1_uc009wpk.2_Intron|MUC1_uc001fip.2_Intron|MUC1_uc009wqg.2_Intron|MUC1_uc009wpo.2_Intron|MUC1_uc009wps.2_Intron|MUC1_uc009wpt.2_Intron|MUC1_uc001fic.2_Intron|MUC1_uc009wpu.2_Intron|MUC1_uc009wpq.2_Intron|MUC1_uc009wpv.2_Intron|MUC1_uc001fim.2_Intron|MUC1_uc001fib.2_Intron|MUC1_uc009wpw.2_Intron|MUC1_uc001fie.2_Intron|MUC1_uc009wpr.2_Intron|MUC1_uc001fig.2_Intron|MUC1_uc001fif.2_Intron|MUC1_uc009wpx.2_Intron|MUC1_uc001fid.2_Intron|MUC1_uc009wpj.2_Intron|MUC1_uc001fij.2_Intron|MUC1_uc009wpy.2_Intron|MUC1_uc010pfm.1_Intron|MUC1_uc001fiq.2_Intron|MUC1_uc009wpz.2_Intron|MUC1_uc010pfn.1_Intron|MUC1_uc009wqa.2_Intron|MUC1_uc010pfo.1_Intron|MUC1_uc010pfp.1_Intron|MUC1_uc001fii.2_Intron|MUC1_uc001fih.2_Intron|MUC1_uc001fia.2_Intron|MUC1_uc009wqc.2_Intron|MUC1_uc009wqd.2_Intron|MUC1_uc009wqb.2_Intron|MUC1_uc010pfq.1_Intron|MUC1_uc010pfr.1_Intron|MUC1_uc001fit.2_Intron|MUC1_uc009wqe.2_Intron|MUC1_uc001fil.2_Intron|MUC1_uc009wpm.2_Intron|MUC1_uc009wpp.2_Intron|MUC1_uc010pfs.1_Intron|MUC1_uc001fik.2_Intron|MUC1_uc001fio.2_Intron|MUC1_uc009wqf.2_Intron|MUC1_uc009wpl.2_Intron|MUC1_uc009wpn.2_Intron|MUC1_uc001fis.1_Intron|uc009wqh.2_5'Flank|MUC1_uc001fiv.1_Silent_p.V69V|MUC1_uc001fiw.1_Silent_p.V60V			P15941	MUC1_HUMAN	SubName: Full=MUC1 isoform M13;	60	Extracellular (Potential).					apical plasma membrane|cell surface|cytoplasm|extracellular region|integral to plasma membrane|nucleus	protein binding			large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGCTGGAGAGTACGCTGCTGG	0.587					107	T	IGH@	B-NHL								0.44	395.651144	396.506977	121	154	KEEP	---	---	---	---	62	79	81	97	-1	capture	Silent	SNP	155161953	155161953	MUC1	1	T	C	C	C	1	0	0	0	0	0	0	0	1	729	57	3	3	9880	79
RIT1	6016	broad.mit.edu	37	1	155870206	155870206	+	Missense_Mutation	SNP	G	C	C			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155870206G>C	uc001fmh.1	-	6	820	c.633C>G	c.(631-633)TTC>TTG	p.F211L	RIT1_uc010pgr.1_Missense_Mutation_p.F175L	NM_006912	NP_008843	Q92963	RIT1_HUMAN	Ras-like without CAAX 1	211					nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			breast(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)			TCTTCTTCCGGAATGGTGATT	0.423																0.360656	299.514146	303.692008	88	156	KEEP	---	---	---	---	44	50	82	104	-1	capture	Missense_Mutation	SNP	155870206	155870206	RIT1	1	G	C	C	C	1	0	0	0	0	1	0	0	0	529	41	4	4	13278	79
IQGAP3	128239	broad.mit.edu	37	1	156503843	156503843	+	Silent	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156503843G>A	uc001fpf.2	-	30	3906	c.3831C>T	c.(3829-3831)CCC>CCT	p.P1277P		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1277					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGTACACCATGGGTTTGGCCA	0.592																0.382812	135.788394	137.34784	49	79	KEEP	---	---	---	---	17	35	46	40	-1	capture	Silent	SNP	156503843	156503843	IQGAP3	1	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	7739	79
SLAMF1	6504	broad.mit.edu	37	1	160607074	160607074	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160607074G>A	uc001fwl.3	-	2	668	c.322C>T	c.(322-324)CGG>TGG	p.R108W	SLAMF1_uc010pjk.1_RNA|SLAMF1_uc010pjl.1_RNA|SLAMF1_uc010pjm.1_RNA|SLAMF1_uc001fwm.2_Missense_Mutation_p.R108W	NM_003037	NP_003028	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family	108	Extracellular (Potential).				interspecies interaction between organisms|lymphocyte activation|positive regulation of cell proliferation	integral to membrane	antigen binding|transmembrane receptor activity			ovary(1)|breast(1)	2	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CTGCTTTCCCGTATCCCCAGG	0.468																0.378947	102.575223	103.797191	36	59	KEEP	---	---	---	---	12	30	30	35	-1	capture	Missense_Mutation	SNP	160607074	160607074	SLAMF1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	14260	79
MYO3A	53904	broad.mit.edu	37	10	26305807	26305807	+	Silent	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:26305807G>A	uc001isn.2	+	7	927	c.567G>A	c.(565-567)CCG>CCA	p.P189P	MYO3A_uc009xko.1_Silent_p.P189P|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Silent_p.P189P|MYO3A_uc001ism.2_Silent_p.P189P	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	189	Protein kinase.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						TAGGAACACCGTTTTGGATGG	0.448					781											0.578947	34.727025	34.830172	11	8	KEEP	---	---	---	---	6	7	8	2	-1	capture	Silent	SNP	26305807	26305807	MYO3A	10	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	9986	79
PTEN	5728	broad.mit.edu	37	10	89653833	89653833	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89653833G>A	uc001kfb.2	+	3	1162	c.131G>A	c.(130-132)GGC>GAC	p.G44D		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	44	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(4)|p.G44G(3)|p.Y27fs*1(2)|p.G44D(2)|p.Y27_N212>Y(2)|p.G44fs*8(1)|p.G44fs*11(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGACTTGAAGGCGTATACAGG	0.294			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.785714	34.93034	35.984469	11	3	KEEP	---	---	---	---	6	7	3	1	-1	capture	Missense_Mutation	SNP	89653833	89653833	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12633	79
NLRP6	171389	broad.mit.edu	37	11	285212	285212	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:285212G>T	uc010qvs.1	+	8	2587	c.2587G>T	c.(2587-2589)GCT>TCT	p.A863S	NLRP6_uc010qvt.1_Missense_Mutation_p.A862S	NM_138329	NP_612202	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	863	LRR 5.					cytoplasm	ATP binding			upper_aerodigestive_tract(1)|skin(1)	2		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GGAGCTTCAGGCTGTGAAGAG	0.617					236											0.588235	29.946722	30.061839	10	7	KEEP	---	---	---	---	6	4	4	5	0.6	capture	Missense_Mutation	SNP	285212	285212	NLRP6	11	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	10388	79
OR51A2	401667	broad.mit.edu	37	11	4976634	4976634	+	Missense_Mutation	SNP	A	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4976634A>T	uc010qyt.1	-	1	310	c.310T>A	c.(310-312)TTC>ATC	p.F104I		NM_001004748	NP_001004748	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A,	104	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGAATGAAGAATTCCTGGGCA	0.448																0.862745	154.835382	161.330152	44	7	KEEP	---	---	---	---	27	20	5	7	-1	capture	Missense_Mutation	SNP	4976634	4976634	OR51A2	11	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	10990	79
OR52E2	119678	broad.mit.edu	37	11	5080295	5080295	+	Missense_Mutation	SNP	T	C	C			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5080295T>C	uc010qyw.1	-	1	563	c.563A>G	c.(562-564)CAT>CGT	p.H188R		NM_001005164	NP_001005164	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E,	188	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		ACAAGATAGATGAGCAAGACC	0.388																0.3	25.963299	27.035439	9	21	KEEP	---	---	---	---	4	6	11	11	-1	capture	Missense_Mutation	SNP	5080295	5080295	OR52E2	11	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	11019	79
PAX6	5080	broad.mit.edu	37	11	31824337	31824337	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:31824337C>A	uc001mtd.3	-	4	946	c.56G>T	c.(55-57)CGG>CTG	p.R19L	PAX6_uc001mte.3_Missense_Mutation_p.R19L|PAX6_uc001mtg.3_Missense_Mutation_p.R19L|PAX6_uc001mtf.3_Missense_Mutation_p.R19L|PAX6_uc001mth.3_Missense_Mutation_p.R19L|PAX6_uc009yjr.2_Missense_Mutation_p.R19L	NM_001127612	NP_001121084	P26367	PAX6_HUMAN	paired box gene 6 isoform a	19	Paired.		R -> P (in AN).		blood vessel development|central nervous system development|cornea development in camera-type eye|glucose homeostasis|iris morphogenesis|negative regulation of neurogenesis|neuron fate commitment|pancreatic A cell development|positive regulation of transcription, DNA-dependent|response to wounding|visual perception	cytoplasm|nuclear chromatin	R-SMAD binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|ubiquitin-protein ligase activity			lung(4)|ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	9	Lung SC(675;0.225)					CGGCAGTGGCCGCCCGTTGAC	0.498												Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				0.081967	1.733457	12.576663	5	56	KEEP	---	---	---	---	6	1	29	38	0.142857142857	capture	Missense_Mutation	SNP	31824337	31824337	PAX6	11	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	11386	79
OR4D6	219983	broad.mit.edu	37	11	59224437	59224437	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59224437G>T	uc010rku.1	+	1	4	c.4G>T	c.(4-6)GAC>TAC	p.D2Y		NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D,	2	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CCCCATCATGGACCAGATCAA	0.423																0.379845	136.337356	137.973415	49	80	KEEP	---	---	---	---	21	32	40	51	0.396226415094	capture	Missense_Mutation	SNP	59224437	59224437	OR4D6	11	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	10962	79
MS4A8B	83661	broad.mit.edu	37	11	60470943	60470943	+	Silent	SNP	C	T	T	rs144254483		TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60470943C>T	uc001npv.2	+	3	515	c.312C>T	c.(310-312)TAC>TAT	p.Y104Y	MS4A8B_uc009yne.1_Silent_p.Y104Y	NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member	104	Helical; (Potential).					integral to membrane	receptor activity				0						TTTCATTCTACGGAGGCTTTC	0.567																0.373684	202.931391	205.572176	71	119	KEEP	---	---	---	---	43	40	66	69	-1	capture	Silent	SNP	60470943	60470943	MS4A8B	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9777	79
CD6	923	broad.mit.edu	37	11	60739382	60739382	+	Silent	SNP	C	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60739382C>A	uc001nqq.2	+	1	268	c.45C>A	c.(43-45)CTC>CTA	p.L15L	CD6_uc009yni.2_Silent_p.L15L|CD6_uc009ynj.2_Silent_p.L15L|CD6_uc001nqp.2_Silent_p.L15L|CD6_uc001nqr.2_Silent_p.L15L|CD6_uc001nqs.2_RNA|CD6_uc001nqt.2_Silent_p.L15L	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor	15					cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						CGGCAGCCCTCTCAGGTAGGC	0.602	Pancreas(169;904 2017 4767 38890 42505)															0.463415	50.856087	50.909271	19	22	KEEP	---	---	---	---	8	12	11	15	0.6	capture	Silent	SNP	60739382	60739382	CD6	11	C	A	A	A	1	0	0	0	0	0	0	0	1	405	32	4	4	2999	79
DDB1	1642	broad.mit.edu	37	11	61079499	61079499	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61079499C>G	uc001nrc.3	-	17	2353	c.2127G>C	c.(2125-2127)AAG>AAC	p.K709N	DDB1_uc010rle.1_Intron|DDB1_uc010rlf.1_Missense_Mutation_p.K709N	NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	709	Interaction with CDT1.|Interaction with CUL4A.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4						GAATGTGCAGCTTCTGGATCT	0.547											NER					0.339041	314.12001	320.816148	99	193	KEEP	---	---	---	---	60	59	101	134	-1	capture	Missense_Mutation	SNP	61079499	61079499	DDB1	11	C	G	G	G	1	0	0	0	0	1	0	0	0	363	28	4	4	4282	79
NPAS4	266743	broad.mit.edu	37	11	66190325	66190325	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66190325G>A	uc001ohx.1	+	4	787	c.611G>A	c.(610-612)GGC>GAC	p.G204D	NPAS4_uc010rpc.1_Missense_Mutation_p.A31T	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	204	PAS 2.				transcription, DNA-dependent		DNA binding|signal transducer activity				0						CCAGGTCCTGGCCCTGGCCCT	0.632																0.423077	148.171249	148.848123	55	75	KEEP	---	---	---	---	23	36	35	48	-1	capture	Missense_Mutation	SNP	66190325	66190325	NPAS4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10472	79
ODZ4	26011	broad.mit.edu	37	11	78380034	78380034	+	Missense_Mutation	SNP	G	C	C			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:78380034G>C	uc001ozl.3	-	32	7819	c.7356C>G	c.(7354-7356)TTC>TTG	p.F2452L	ODZ4_uc001ozk.3_Missense_Mutation_p.F677L|ODZ4_uc009yvb.1_Missense_Mutation_p.F1036L	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	2452	Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						TGTTGTTTTTGAACATATAGA	0.507																0.321739	122.634285	125.879802	37	78	KEEP	---	---	---	---	21	22	43	46	-1	capture	Missense_Mutation	SNP	78380034	78380034	ODZ4	11	G	C	C	C	1	0	0	0	0	1	0	0	0	581	45	4	4	10742	79
FOLH1B	219595	broad.mit.edu	37	11	89405127	89405127	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89405127C>G	uc001pda.2	+	5	780	c.254C>G	c.(253-255)GCT>GGT	p.A85G		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	85					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						AGTGGAGCAGCTGTTGTTCAT	0.368																0.452381	66.616475	66.699736	19	23	KEEP	---	---	---	---	11	10	13	13	-1	capture	Missense_Mutation	SNP	89405127	89405127	FOLH1B	11	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	5924	79
ERC1	23085	broad.mit.edu	37	12	1291107	1291107	+	Missense_Mutation	SNP	G	A	A	rs138512011	byFrequency	TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:1291107G>A	uc001qjb.2	+	10	2133	c.1892G>A	c.(1891-1893)CGC>CAC	p.R631H	ERC1_uc001qiz.2_RNA|ERC1_uc001qjc.2_Missense_Mutation_p.R603H|ERC1_uc001qja.2_RNA|ERC1_uc001qjd.2_RNA|ERC1_uc001qjf.2_Missense_Mutation_p.R631H|ERC1_uc010sdv.1_Missense_Mutation_p.R379H|ERC1_uc009zdp.2_Missense_Mutation_p.R271H	NM_178040	NP_829884	Q8IUD2	RB6I2_HUMAN	RAB6-interacting protein 2 isoform epsilon	631	Potential.				I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			ACAATTGAACGCTTAAAGGAG	0.378					378											0.323529	30.613865	31.553419	11	23	KEEP	---	---	---	---	6	5	13	12	-1	capture	Missense_Mutation	SNP	1291107	1291107	ERC1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5165	79
FOXJ2	55810	broad.mit.edu	37	12	8192492	8192492	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8192492G>A	uc001qtu.2	+	2	1149	c.64G>A	c.(64-66)GCT>ACT	p.A22T	FOXJ2_uc001qtt.1_Missense_Mutation_p.A22T	NM_018416	NP_060886	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	22					embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	nucleolus|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding			upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				Kidney(36;0.0944)		GACCCTCCGAGCTACCATTGA	0.582																0.098039	10.711179	35.452369	15	138	KEEP	---	---	---	---	3	12	72	80	-1	capture	Missense_Mutation	SNP	8192492	8192492	FOXJ2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	5956	79
C12orf35	55196	broad.mit.edu	37	12	32138039	32138039	+	Missense_Mutation	SNP	G	C	C			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:32138039G>C	uc001rks.2	+	4	4564	c.4150G>C	c.(4150-4152)GAT>CAT	p.D1384H	C12orf35_uc001rkt.2_5'Flank	NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	1384										ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			GAACGTATTAGATATGGAAGT	0.343																0.16129	12.254297	15.637972	5	26	KEEP	---	---	---	---	3	2	7	20	-1	capture	Missense_Mutation	SNP	32138039	32138039	C12orf35	12	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	1668	79
LARP4	113251	broad.mit.edu	37	12	50831593	50831593	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:50831593G>A	uc001rwp.1	+	6	755	c.611G>A	c.(610-612)AGA>AAA	p.R204K	LARP4_uc001rwo.1_Missense_Mutation_p.R210K|LARP4_uc001rwq.1_Missense_Mutation_p.R204K|LARP4_uc001rwr.1_Missense_Mutation_p.R204K|LARP4_uc001rws.1_Missense_Mutation_p.R203K|LARP4_uc009zlr.1_Missense_Mutation_p.R23K|LARP4_uc001rwm.2_Missense_Mutation_p.R204K|LARP4_uc001rwn.2_Missense_Mutation_p.R134K	NM_052879	NP_443111	Q71RC2	LARP4_HUMAN	c-Mpl binding protein isoform a	204	RRM.						nucleotide binding|RNA binding			ovary(1)	1						GTAATTCTTAGAGAGATTCCT	0.338																0.347826	71.077395	72.488552	24	45	KEEP	---	---	---	---	15	11	17	37	-1	capture	Missense_Mutation	SNP	50831593	50831593	LARP4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	8550	79
C12orf63	374467	broad.mit.edu	37	12	97052014	97052014	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:97052014C>A	uc001tet.1	+	5	703	c.625C>A	c.(625-627)CCA>ACA	p.P209T		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	209										skin(6)|ovary(1)	7						ACAAGTGACACCACTTCTGGT	0.388																0.432836	91.460732	91.72496	29	38	KEEP	---	---	---	---	13	20	19	24	0.606060606061	capture	Missense_Mutation	SNP	97052014	97052014	C12orf63	12	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	1692	79
CHD8	57680	broad.mit.edu	37	14	21876716	21876716	+	Splice_Site	SNP	T	C	C			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21876716T>C	uc001was.1	-	13	1744	c.1650_splice	c.e13-1	p.R550_splice	CHD8_uc001war.1_Splice_Site_p.R446_splice|CHD8_uc001wav.1_Splice_Site	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8						ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CAGTTCTGCCTGCAGATTCAC	0.353					886											0.4	15.945613	16.077142	6	9	KEEP	---	---	---	---	4	2	6	3	-1	capture	Splice_Site	SNP	21876716	21876716	CHD8	14	T	C	C	C	1	0	0	0	0	0	0	1	0	715	55	5	3	3297	79
LRRC16B	90668	broad.mit.edu	37	14	24538046	24538046	+	Missense_Mutation	SNP	A	G	G			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24538046A>G	uc001wlj.2	+	38	4010	c.3853A>G	c.(3853-3855)AGG>GGG	p.R1285G	LRRC16B_uc001wlk.2_Missense_Mutation_p.R338G|CPNE6_uc010tnv.1_5'Flank|CPNE6_uc001wlm.2_5'Flank|CPNE6_uc001wll.2_5'Flank	NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	1285										ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)		GGCTGTGCCCAGGGGCCGCCA	0.637																0.25	24.257045	26.302763	9	27	KEEP	---	---	---	---	5	10	13	24	-1	capture	Missense_Mutation	SNP	24538046	24538046	LRRC16B	14	A	G	G	G	1	0	0	0	0	1	0	0	0	88	7	3	3	8888	79
KIAA0284	283638	broad.mit.edu	37	14	105353636	105353636	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105353636G>A	uc010axb.2	+	12	3284	c.3060G>A	c.(3058-3060)ATG>ATA	p.M1020I	INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Missense_Mutation_p.M950I|KIAA0284_uc001yps.2_Missense_Mutation_p.M926I|KIAA0284_uc001ypt.2_5'Flank	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1	1020						cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		CGACGGACATGGGCCGTGGAG	0.701																0.388889	41.643236	42.032105	14	22	KEEP	---	---	---	---	8	6	12	11	-1	capture	Missense_Mutation	SNP	105353636	105353636	KIAA0284	14	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	8088	79
UNKL	64718	broad.mit.edu	37	16	1417320	1417320	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1417320C>T	uc010brn.1	-	8	958	c.940G>A	c.(940-942)GAG>AAG	p.E314K	UNKL_uc002cln.2_Missense_Mutation_p.E106K|UNKL_uc002clo.2_Missense_Mutation_p.E103K|UNKL_uc002clp.2_Missense_Mutation_p.E106K			Q9H9P5	UNKL_HUMAN	SubName: Full=Putative ubiquitin-protein ligase;          EC=6.3.2.19; Flags: Fragment;	604	Potential.					cytoplasm|nucleus	ligase activity|nucleic acid binding|zinc ion binding				0		Hepatocellular(780;0.0893)				TCCTTGGCCTCCTGCGCCTCT	0.667																0.538462	22.225396	22.24206	7	6	KEEP	---	---	---	---	6	2	4	3	-1	capture	Missense_Mutation	SNP	1417320	1417320	UNKL	16	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	16883	79
ABCA3	21	broad.mit.edu	37	16	2369841	2369841	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2369841C>T	uc002cpy.1	-	8	1326	c.614G>A	c.(613-615)GGG>GAG	p.G205E	ABCA3_uc010bsk.1_Missense_Mutation_p.G205E|ABCA3_uc010bsl.1_Missense_Mutation_p.G205E	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	205					response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				CCGGATGTACCCTGGGTGCGG	0.657					701											0.447368	160.012219	160.28715	51	63	KEEP	---	---	---	---	23	36	27	46	-1	capture	Missense_Mutation	SNP	2369841	2369841	ABCA3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	33	79
GRIN2A	2903	broad.mit.edu	37	16	10274212	10274212	+	Silent	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10274212G>A	uc002czo.3	-	2	605	c.57C>T	c.(55-57)CGC>CGT	p.R19R	GRIN2A_uc010uym.1_Silent_p.R19R|GRIN2A_uc002czr.3_Silent_p.R19R|GRIN2A_uc010buk.2_Silent_p.R19R	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	19					response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GCGCCGGACCGCGCCAGACCA	0.657					324											0.169014	21.179865	28.525988	12	59	KEEP	---	---	---	---	2	12	23	43	-1	capture	Silent	SNP	10274212	10274212	GRIN2A	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6712	79
GGA2	23062	broad.mit.edu	37	16	23505700	23505700	+	Splice_Site	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23505700C>T	uc002dlq.2	-	3	253	c.177_splice	c.e3-1	p.G59_splice	GGA2_uc010bxo.1_Splice_Site	NM_015044	NP_055859	Q9UJY4	GGA2_HUMAN	ADP-ribosylation factor binding protein 2						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0386)		ATGTGTGGGGCTACAGGGAAA	0.522																0.070796	-4.293307	17.17684	8	105	KEEP	---	---	---	---	3	5	52	63	-1	capture	Splice_Site	SNP	23505700	23505700	GGA2	16	C	T	T	T	1	0	0	0	0	0	0	1	0	364	28	5	2	6292	79
CETP	1071	broad.mit.edu	37	16	57017290	57017290	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57017290C>T	uc002eki.2	+	15	1431	c.1374C>T	c.(1372-1374)TTC>TTT	p.F458F	CETP_uc002ekj.2_Silent_p.F398F	NM_000078	NP_000069	P11597	CETP_HUMAN	cholesteryl ester transfer protein, plasma	458					cholesterol homeostasis|cholesterol metabolic process|high-density lipoprotein particle remodeling|lipoprotein metabolic process|low-density lipoprotein particle remodeling|phosphatidylcholine metabolic process|phospholipid homeostasis|receptor-mediated endocytosis|regulation of cholesterol efflux|triglyceride homeostasis|triglyceride metabolic process|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle|vesicle	cholesterol binding|cholesterol transporter activity|phosphatidylcholine binding|phospholipid transporter activity|triglyceride binding			central_nervous_system(1)|skin(1)	2						TGAGCCTCTTCGACATCATCA	0.592																0.46281	174.293684	174.438727	56	65	KEEP	---	---	---	---	28	44	30	41	-1	capture	Silent	SNP	57017290	57017290	CETP	16	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	3245	79
GPR114	221188	broad.mit.edu	37	16	57609404	57609404	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57609404C>T	uc002elx.3	+	12	1626	c.1541C>T	c.(1540-1542)GCC>GTC	p.A514V	GPR114_uc010vhr.1_3'UTR|GPR114_uc002ely.2_Missense_Mutation_p.A514V	NM_153837	NP_722579	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114 precursor	514	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)	1						GAAGCAGAGGCCAAGGCACAG	0.612																0.358974	80.176683	81.543373	28	50	KEEP	---	---	---	---	11	21	22	37	-1	capture	Missense_Mutation	SNP	57609404	57609404	GPR114	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	6565	79
SPDYE4	388333	broad.mit.edu	37	17	8658884	8658884	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8658884C>T	uc010cnz.1	-	4	616	c.439G>A	c.(439-441)GGC>AGC	p.G147S		NM_001128076	NP_001121548	A6NLX3	SPDE4_HUMAN	speedy homolog E4	147											0						GAGAAGAGGCCGGCACGGCTA	0.493																0.404762	316.440798	318.424529	102	150	KEEP	---	---	---	---	60	65	108	80	-1	capture	Missense_Mutation	SNP	8658884	8658884	SPDYE4	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14923	79
PIK3R5	23533	broad.mit.edu	37	17	8784088	8784088	+	Silent	SNP	C	T	T	rs141893152	byFrequency	TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8784088C>T	uc002glt.2	-	19	2578	c.2511G>A	c.(2509-2511)CCG>CCA	p.P837P	PIK3R5_uc010vuz.1_Silent_p.P837P|PIK3R5_uc002glu.3_Silent_p.P451P	NM_014308	NP_055123	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	837					platelet activation	cytosol|membrane|nucleus				breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						GCTTGTAGCACGGTGAGACCT	0.647	NSCLC(18;589 615 7696 20311 50332)															0.347222	69.952636	71.436383	25	47	KEEP	---	---	---	---	17	11	27	26	-1	capture	Silent	SNP	8784088	8784088	PIK3R5	17	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	11825	79
KCNJ12	3768	broad.mit.edu	37	17	21318735	21318735	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21318735C>T	uc002gyv.1	+	3	786	c.81C>T	c.(79-81)GGC>GGT	p.G27G		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	27	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	CCATGTCGGGCGCCAACGGCT	0.657													Prostate(3;0.18)			0.089888	1.437516	16.570978	8	81	KEEP	---	---	---	---	4	4	46	46	-1	capture	Silent	SNP	21318735	21318735	KCNJ12	17	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7968	79
ERN1	2081	broad.mit.edu	37	17	62144066	62144066	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62144066C>T	uc002jdz.2	-	8	920	c.807G>A	c.(805-807)CCG>CCA	p.P269P		NM_001433	NP_001424	O75460	ERN1_HUMAN	endoplasmic reticulum to nucleus signalling 1	269	Lumenal (Potential).				activation of signaling protein activity involved in unfolded protein response|apoptosis|cell cycle arrest|induction of apoptosis|mRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to endoplasmic reticulum membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(4)|lung(2)|stomach(1)|ovary(1)|kidney(1)	9						CCTTGGGGAACGGGTACTTCC	0.592					295											0.325581	35.930789	37.093809	14	29	KEEP	---	---	---	---	6	8	17	14	-1	capture	Silent	SNP	62144066	62144066	ERN1	17	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	5192	79
SLC16A5	9121	broad.mit.edu	37	17	73096774	73096774	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73096774G>A	uc002jmr.2	+	5	1388	c.1016G>A	c.(1015-1017)AGC>AAC	p.S339N	SLC16A5_uc002jms.1_Missense_Mutation_p.S339N|SLC16A5_uc002jmt.2_Missense_Mutation_p.S339N|SLC16A5_uc002jmu.2_Missense_Mutation_p.S339N|SLC16A5_uc010wrt.1_Missense_Mutation_p.S379N	NM_004695	NP_004686	O15375	MOT6_HUMAN	solute carrier family 16, member 5	339	Helical; (Potential).				organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	CTGGCGTACAGCGTGTCCATG	0.592																0.395634	824.189541	831.176452	290	443	KEEP	---	---	---	---	163	216	262	296	-1	capture	Missense_Mutation	SNP	73096774	73096774	SLC16A5	17	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	14304	79
ENGASE	64772	broad.mit.edu	37	17	77081747	77081747	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77081747C>T	uc002jwv.2	+	13	1754	c.1746C>T	c.(1744-1746)CTC>CTT	p.L582L	ENGASE_uc002jww.2_Silent_p.L287L	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	582						cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						TAGACCTCCTCGTTTGCTTCT	0.662																0.157143	18.886472	26.733157	11	59	KEEP	---	---	---	---	7	5	37	39	-1	capture	Silent	SNP	77081747	77081747	ENGASE	17	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	5073	79
CCDC68	80323	broad.mit.edu	37	18	52604167	52604167	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:52604167C>T	uc002lfs.2	-	6	540	c.368G>A	c.(367-369)GGA>GAA	p.G123E	CCDC68_uc002lft.2_Missense_Mutation_p.G123E	NM_001143829	NP_001137301	Q9H2F9	CCD68_HUMAN	coiled-coil domain containing 68	123	Potential.									skin(1)	1				Colorectal(16;0.0256)|READ - Rectum adenocarcinoma(59;0.21)		AGCTGCTGCTCCTGCTTCTCT	0.418																0.385542	95.979221	96.932926	32	51	KEEP	---	---	---	---	16	25	21	37	-1	capture	Missense_Mutation	SNP	52604167	52604167	CCDC68	18	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	2814	79
DOK6	220164	broad.mit.edu	37	18	67365777	67365777	+	Missense_Mutation	SNP	T	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:67365777T>A	uc002lkl.2	+	5	737	c.547T>A	c.(547-549)TCA>ACA	p.S183T		NM_152721	NP_689934	Q6PKX4	DOK6_HUMAN	docking protein 6	183	IRS-type PTB.						insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				GCCTCTCAGCTCACTGAGGAG	0.463																0.166667	4.712233	6.611263	3	15	KEEP	---	---	---	---	3	0	11	6	-1	capture	Missense_Mutation	SNP	67365777	67365777	DOK6	18	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	4657	79
FZR1	51343	broad.mit.edu	37	19	3531983	3531983	+	Missense_Mutation	SNP	A	C	C			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3531983A>C	uc010dtk.2	+	9	932	c.898A>C	c.(898-900)ACC>CCC	p.T300P	FZR1_uc002lxt.2_Missense_Mutation_p.T300P|FZR1_uc002lxv.2_Missense_Mutation_p.T211P	NM_001136198	NP_001129670	Q9UM11	FZR_HUMAN	Fzr1 protein isoform 1	300	WD 3.				activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|DNA repair|G2/M transition DNA damage checkpoint|mitosis|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	protein binding			lung(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACATCCGCACCCCGCCACT	0.711																0.538462	7.473952	7.471714	7	6	KEEP	---	---	---	---	7	5	3	6	-1	capture	Missense_Mutation	SNP	3531983	3531983	FZR1	19	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	6080	79
ZNF442	79973	broad.mit.edu	37	19	12461021	12461021	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12461021G>A	uc002mtr.1	-	6	1989	c.1378C>T	c.(1378-1380)CCC>TCC	p.P460S	ZNF442_uc010xmk.1_Missense_Mutation_p.P391S	NM_030824	NP_110451	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	460					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(2)|breast(1)|kidney(1)	4						CATTTATAGGGTTTCTCTCCA	0.378																0.421875	79.110442	79.452086	27	37	KEEP	---	---	---	---	15	12	29	14	-1	capture	Missense_Mutation	SNP	12461021	12461021	ZNF442	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	17795	79
PSG8	440533	broad.mit.edu	37	19	43268388	43268388	+	Missense_Mutation	SNP	G	A	A	rs142689447		TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43268388G>A	uc002ouo.2	-	2	208	c.110C>T	c.(109-111)ACG>ATG	p.T37M	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc002oui.2_Intron|PSG8_uc002ouh.2_Missense_Mutation_p.T37M|PSG8_uc010ein.2_Intron|PSG8_uc002ouj.3_Translation_Start_Site|PSG8_uc002ouk.3_Intron|PSG8_uc002oul.3_Missense_Mutation_p.T37M|PSG8_uc002oum.3_Missense_Mutation_p.T37M|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Missense_Mutation_p.T37M	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	37	Ig-like V-type.					extracellular region					0		Prostate(69;0.00899)				GGCTTCAATCGTGACTTGGGC	0.463																0.383212	298.701133	301.981038	105	169	KEEP	---	---	---	---	66	43	91	85	-1	capture	Missense_Mutation	SNP	43268388	43268388	PSG8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12556	79
RTN2	6253	broad.mit.edu	37	19	45998164	45998164	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45998164C>T	uc002pcb.2	-	3	407	c.179G>A	c.(178-180)CGG>CAG	p.R60Q	RTN2_uc002pcc.2_Missense_Mutation_p.R60Q|RTN2_uc002pcd.2_RNA	NM_005619	NP_005610	O75298	RTN2_HUMAN	reticulon 2 isoform A	60						integral to endoplasmic reticulum membrane	signal transducer activity			ovary(3)	3		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GGTCAGCTCCCGGGGGGTGCC	0.662																0.378788	76.760461	77.610783	25	41	KEEP	---	---	---	---	14	13	18	26	-1	capture	Missense_Mutation	SNP	45998164	45998164	RTN2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13618	79
TRPM4	54795	broad.mit.edu	37	19	49686170	49686170	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49686170C>T	uc002pmw.2	+	11	1671	c.1599C>T	c.(1597-1599)TTC>TTT	p.F533F	TRPM4_uc010emu.2_Silent_p.F533F|TRPM4_uc010yak.1_Intron|TRPM4_uc002pmx.2_Silent_p.F359F|TRPM4_uc010emv.2_Silent_p.F418F|TRPM4_uc010yal.1_Silent_p.F179F|TRPM4_uc002pmy.2_5'UTR	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,	533	Cytoplasmic (Potential).				dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		GCCAGGGCTTCGGGGAGAGCG	0.711																0.206897	13.039489	15.344442	6	23	KEEP	---	---	---	---	5	1	11	14	-1	capture	Silent	SNP	49686170	49686170	TRPM4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	16471	79
PIKFYVE	200576	broad.mit.edu	37	2	209179975	209179975	+	Missense_Mutation	SNP	C	G	G			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209179975C>G	uc002vcz.2	+	15	2043	c.1885C>G	c.(1885-1887)CTG>GTG	p.L629V	PIKFYVE_uc010fun.1_Missense_Mutation_p.L310V|PIKFYVE_uc002vcy.1_Missense_Mutation_p.L573V	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	629					cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						TAGTGACTCACTGTCATCATC	0.423					756											0.064516	-2.253483	9.969177	4	58	KEEP	---	---	---	---	1	5	28	42	-1	capture	Missense_Mutation	SNP	209179975	209179975	PIKFYVE	2	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	11827	79
TNS1	7145	broad.mit.edu	37	2	218749762	218749762	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:218749762G>T	uc002vgt.2	-	14	1265	c.867C>A	c.(865-867)TTC>TTA	p.F289L	TNS1_uc002vgr.2_Missense_Mutation_p.F289L|TNS1_uc002vgs.2_Missense_Mutation_p.F289L|TNS1_uc010zjv.1_Missense_Mutation_p.F289L|TNS1_uc010fvj.1_Missense_Mutation_p.F357L|TNS1_uc010fvk.1_Missense_Mutation_p.F414L|TNS1_uc002vgu.3_Missense_Mutation_p.F320L|TNS1_uc010fvi.1_5'UTR	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	289	C2 tensin-type.					cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GCGCACCTTTGAAAGCATCAT	0.572																0.409524	124.401543	125.153433	43	62	KEEP	---	---	---	---	20	28	25	44	0.416666666667	capture	Missense_Mutation	SNP	218749762	218749762	TNS1	2	G	T	T	T	1	0	0	0	0	1	0	0	0	581	45	4	4	16226	79
ITM2C	81618	broad.mit.edu	37	2	231740464	231740464	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:231740464G>A	uc002vqz.2	+	3	511	c.391G>A	c.(391-393)GTG>ATG	p.V131M	ITM2C_uc002vra.2_Missense_Mutation_p.V84M|ITM2C_uc002vrb.2_Missense_Mutation_p.V131M|ITM2C_uc002vrc.2_Missense_Mutation_p.V20M|ITM2C_uc002vrd.2_Missense_Mutation_p.V20M	NM_030926	NP_112188	Q9NQX7	ITM2C_HUMAN	integral membrane protein 2C isoform 1	131					negative regulation of neuron projection development|neuron differentiation	Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	beta-amyloid binding				0		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;8.47e-12)|all cancers(144;3.44e-09)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GCGCATCAACGTGCCTGTGCC	0.617																0.394619	254.442588	256.612495	88	135	KEEP	---	---	---	---	45	54	82	73	-1	capture	Missense_Mutation	SNP	231740464	231740464	ITM2C	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7837	79
COL6A3	1293	broad.mit.edu	37	2	238275697	238275697	+	Nonsense_Mutation	SNP	G	C	C			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238275697G>C	uc002vwl.2	-	11	5418	c.5133C>G	c.(5131-5133)TAC>TAG	p.Y1711*	COL6A3_uc002vwo.2_Nonsense_Mutation_p.Y1505*|COL6A3_uc010znj.1_Nonsense_Mutation_p.Y1104*	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1711	VWFA 9.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTCCCCCTTTGTAGACCACTT	0.557																0.365079	77.908749	78.917272	23	40	KEEP	---	---	---	---	13	14	22	22	-1	capture	Nonsense_Mutation	SNP	238275697	238275697	COL6A3	2	G	C	C	C	1	0	0	0	0	0	1	0	0	620	48	5	4	3666	79
SULF2	55959	broad.mit.edu	37	20	46318884	46318884	+	Silent	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:46318884G>A	uc002xto.2	-	5	1053	c.723C>T	c.(721-723)AAC>AAT	p.N241N	SULF2_uc002xtr.2_Silent_p.N241N|SULF2_uc002xtq.2_Silent_p.N241N|SULF2_uc010ghv.1_Silent_p.N241N	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	241					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						GCTGAGATGCGTTTGGGAAGA	0.567				p.N241N(U138MG-Tumor)	709											0.407895	92.211156	92.774281	31	45	KEEP	---	---	---	---	18	22	26	25	-1	capture	Silent	SNP	46318884	46318884	SULF2	20	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15261	79
HRH3	11255	broad.mit.edu	37	20	60791774	60791774	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60791774G>A	uc002ycf.2	-	3	923	c.626C>T	c.(625-627)ACG>ATG	p.T209M	HRH3_uc002ycg.2_Missense_Mutation_p.T209M|HRH3_uc002ych.2_Missense_Mutation_p.T209M|HRH3_uc002yci.2_Missense_Mutation_p.T209M	NM_007232	NP_009163	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	209	Helical; Name=5; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|neurotransmitter secretion	integral to plasma membrane	histamine receptor activity				0	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Histamine Phosphate(DB00667)	GAGGAAGGGCGTAAAGAACTC	0.612																0.434109	168.682712	169.170464	56	73	KEEP	---	---	---	---	22	46	36	53	-1	capture	Missense_Mutation	SNP	60791774	60791774	HRH3	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7282	79
COL6A2	1292	broad.mit.edu	37	21	47535812	47535812	+	Silent	SNP	G	A	A	rs140790797		TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47535812G>A	uc002zia.1	+	6	910	c.828G>A	c.(826-828)CCG>CCA	p.P276P	COL6A2_uc002zhy.1_Silent_p.P276P|COL6A2_uc002zhz.1_Silent_p.P276P|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	276	Triple-helical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		TGGGTGAGCCGGGAGAGCCTG	0.662																0.294872	62.619205	65.541725	23	55	KEEP	---	---	---	---	16	15	28	34	-1	capture	Silent	SNP	47535812	47535812	COL6A2	21	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3665	79
TRIOBP	11078	broad.mit.edu	37	22	38119624	38119624	+	Missense_Mutation	SNP	C	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38119624C>A	uc003atr.2	+	7	1332	c.1061C>A	c.(1060-1062)CCC>CAC	p.P354H	TRIOBP_uc003atu.2_Missense_Mutation_p.P182H|TRIOBP_uc003atq.1_Missense_Mutation_p.P354H|TRIOBP_uc003ats.1_Missense_Mutation_p.P182H	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	354					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					CTGGATAACCCCAGAACCTCT	0.577																0.613497	311.823442	313.660681	100	63	KEEP	---	---	---	---	53	56	21	48	0.51376146789	capture	Missense_Mutation	SNP	38119624	38119624	TRIOBP	22	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	16436	79
PNPLA5	150379	broad.mit.edu	37	22	44287074	44287074	+	Missense_Mutation	SNP	C	A	A	rs79793310	byFrequency	TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:44287074C>A	uc003beg.2	-	2	391	c.294G>T	c.(292-294)CAG>CAT	p.Q98H	PNPLA5_uc011aqc.1_5'UTR|PNPLA5_uc003beh.2_Intron	NM_138814	NP_620169	Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	98	Patatin.				lipid catabolic process		hydrolase activity				0		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				CCTGCAGCTGCTGCTTGACGT	0.662																0.794118	87.838909	90.564305	27	7	KEEP	---	---	---	---	13	15	4	7	0.535714285714	capture	Missense_Mutation	SNP	44287074	44287074	PNPLA5	22	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	12071	79
ATP2B2	491	broad.mit.edu	37	3	10387071	10387071	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10387071C>T	uc003bvt.2	-	18	3139	c.2700G>A	c.(2698-2700)ACG>ACA	p.T900T	ATP2B2_uc003bvv.2_Silent_p.T855T|ATP2B2_uc003bvw.2_Silent_p.T855T|ATP2B2_uc010hdo.2_Silent_p.T605T	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	900	Extracellular (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						GACCCACCTGCGTGATGCAGG	0.627	Ovarian(125;1619 1709 15675 19819 38835)															0.211268	33.68291	39.158981	15	56	KEEP	---	---	---	---	11	5	42	19	-1	capture	Silent	SNP	10387071	10387071	ATP2B2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1131	79
CCDC52	152185	broad.mit.edu	37	3	113169336	113169336	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:113169336G>T	uc003eag.3	-	15	2461	c.2170C>A	c.(2170-2172)CCA>ACA	p.P724T	CCDC52_uc003eaf.3_RNA|CCDC52_uc003eah.1_Missense_Mutation_p.P620T	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52	724					cell division|mitosis	centriole|spindle	protein binding				0						ATACTACCTGGTGTTAGAGAC	0.373																0.040404	-14.390134	8.138639	4	95	KEEP	---	---	---	---	1	3	52	59	0.25	capture	Missense_Mutation	SNP	113169336	113169336	CCDC52	3	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	2796	79
KIAA1257	57501	broad.mit.edu	37	3	128696988	128696988	+	Silent	SNP	T	C	C			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:128696988T>C	uc003elj.3	-	5	904	c.708A>G	c.(706-708)GAA>GAG	p.E236E	KIAA1257_uc003elg.1_Silent_p.E236E|KIAA1257_uc003eli.3_Silent_p.E124E	NM_020741	NP_065792	Q9ULG3	K1257_HUMAN	hypothetical protein LOC57501	236											0						CAATGCCCTGTTCAGATAATT	0.358																0.371901	155.4509	157.192603	45	76	KEEP	---	---	---	---	20	30	38	46	-1	capture	Silent	SNP	128696988	128696988	KIAA1257	3	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	8140	79
CLDN18	51208	broad.mit.edu	37	3	137717743	137717743	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:137717743C>T	uc003ero.1	+	1	86	c.33C>T	c.(31-33)TTC>TTT	p.F11F		NM_001002026	NP_001002026	P56856	CLD18_HUMAN	claudin 18 isoform 2	11	Helical; (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity			upper_aerodigestive_tract(1)|ovary(1)	2						GCTTGGGGTTCGTGGTTTCAC	0.557																0.314103	129.012836	133.875461	49	107	KEEP	---	---	---	---	26	30	52	70	-1	capture	Silent	SNP	137717743	137717743	CLDN18	3	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	3444	79
PLCH1	23007	broad.mit.edu	37	3	155203313	155203313	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:155203313C>T	uc011bok.1	-	22	3107	c.2830G>A	c.(2830-2832)GAT>AAT	p.D944N	PLCH1_uc011boj.1_Missense_Mutation_p.D944N|PLCH1_uc011bol.1_Missense_Mutation_p.D906N	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	944					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GACACAGAATCCTTTATCTCC	0.522																0.421687	106.008789	106.453558	35	48	KEEP	---	---	---	---	15	27	24	34	-1	capture	Missense_Mutation	SNP	155203313	155203313	PLCH1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	11940	79
PEX5L	51555	broad.mit.edu	37	3	179526143	179526143	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:179526143C>T	uc003fki.1	-	13	1565	c.1435G>A	c.(1435-1437)GGT>AGT	p.G479S	PEX5L_uc011bqd.1_Missense_Mutation_p.G436S|PEX5L_uc011bqe.1_Missense_Mutation_p.G287S|PEX5L_uc011bqf.1_Missense_Mutation_p.G371S|PEX5L_uc003fkj.1_Missense_Mutation_p.G444S|PEX5L_uc010hxd.1_Missense_Mutation_p.G477S|PEX5L_uc011bqg.1_Missense_Mutation_p.G455S|PEX5L_uc011bqh.1_Missense_Mutation_p.G420S	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	479	TPR 3.				protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			ACCCCTAGACCTGTCTGCAGG	0.458					648											0.368421	108.500873	109.946404	35	60	KEEP	---	---	---	---	16	21	34	30	-1	capture	Missense_Mutation	SNP	179526143	179526143	PEX5L	3	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	11652	79
HTR3E	285242	broad.mit.edu	37	3	183823993	183823993	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183823993G>A	uc010hxq.2	+	8	1469	c.1003G>A	c.(1003-1005)GTG>ATG	p.V335M	HTR3E_uc003fml.3_Missense_Mutation_p.V320M|HTR3E_uc003fmm.2_Missense_Mutation_p.V350M|HTR3E_uc010hxr.2_Missense_Mutation_p.V361M|HTR3E_uc003fmn.2_Missense_Mutation_p.V335M	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	335	Cytoplasmic (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			CCTGCTGCACGTGGCCACCAC	0.667	Melanoma(7;227 727 6634 44770)															0.375839	157.763622	159.779565	56	93	KEEP	---	---	---	---	33	34	40	72	-1	capture	Missense_Mutation	SNP	183823993	183823993	HTR3E	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7373	79
UNC5C	8633	broad.mit.edu	37	4	96199412	96199412	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:96199412C>T	uc003htp.1	-	4	746	c.592G>A	c.(592-594)GAG>AAG	p.E198K	UNC5C_uc010ilc.1_Missense_Mutation_p.E198K|UNC5C_uc003htq.2_Missense_Mutation_p.E198K	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	198	Extracellular (Potential).|Ig-like C2-type.				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TTATTCACCTCAGCCACTGGG	0.453																0.483871	47.122909	47.129971	15	16	KEEP	---	---	---	---	11	6	10	9	-1	capture	Missense_Mutation	SNP	96199412	96199412	UNC5C	4	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	16875	79
ANK2	287	broad.mit.edu	37	4	114277204	114277204	+	Missense_Mutation	SNP	A	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:114277204A>T	uc003ibe.3	+	38	7530	c.7430A>T	c.(7429-7431)AAG>ATG	p.K2477M	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Intron|ANK2_uc011cgb.1_Missense_Mutation_p.K2492M	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	2444					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GTTGAACCAAAGATGAAGGCT	0.502																0.234234	60.628075	67.873878	26	85	KEEP	---	---	---	---	11	19	37	59	-1	capture	Missense_Mutation	SNP	114277204	114277204	ANK2	4	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	618	79
IL2	3558	broad.mit.edu	37	4	123374886	123374886	+	Silent	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:123374886G>A	uc003ier.2	-	3	385	c.330C>T	c.(328-330)AAC>AAT	p.N110N		NM_000586	NP_000577	P60568	IL2_HUMAN	interleukin 2 precursor	110					anti-apoptosis|cell adhesion|cell-cell signaling|immune response|natural killer cell activation|negative regulation of B cell apoptosis|positive regulation of activated T cell proliferation|positive regulation of B cell proliferation|positive regulation of cell growth|positive regulation of interleukin-17 production|positive regulation of tyrosine phosphorylation of Stat5 protein|T cell differentiation	extracellular space	cytokine activity|growth factor activity|interleukin-2 receptor binding|kinase activator activity			skin(1)	1				LUSC - Lung squamous cell carcinoma(721;0.185)		GAACTATTACGTTGATATTGC	0.353					34	T	TNFRSF17	intestinal T-cell lymphoma								0.368421	20.219755	20.50901	7	12	KEEP	---	---	---	---	0	9	5	7	-1	capture	Silent	SNP	123374886	123374886	IL2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7589	79
RBM46	166863	broad.mit.edu	37	4	155719190	155719190	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155719190C>T	uc003ioo.2	+	3	552	c.379C>T	c.(379-381)CGA>TGA	p.R127*	RBM46_uc011cim.1_Nonsense_Mutation_p.R127*|RBM46_uc003iop.1_Nonsense_Mutation_p.R127*	NM_144979	NP_659416	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	127	RRM 1.						nucleotide binding|RNA binding			central_nervous_system(1)|skin(1)	2	all_hematologic(180;0.24)	Renal(120;0.0854)				TTATGAAATTCGACCAGGGAA	0.338																0.414634	50.471549	50.731262	17	24	KEEP	---	---	---	---	7	12	8	19	-1	capture	Nonsense_Mutation	SNP	155719190	155719190	RBM46	4	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	13035	79
GUCY1A3	2982	broad.mit.edu	37	4	156632019	156632019	+	Silent	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:156632019G>A	uc003iov.2	+	7	1238	c.702G>A	c.(700-702)TCG>TCA	p.S234S	GUCY1A3_uc003iou.2_Silent_p.S234S|GUCY1A3_uc010iqc.2_Silent_p.S234S|GUCY1A3_uc003iow.2_Silent_p.S234S|GUCY1A3_uc010iqd.2_Silent_p.S233S|GUCY1A3_uc003iox.2_Silent_p.S234S|GUCY1A3_uc003ioz.2_5'UTR|GUCY1A3_uc003ioy.2_Silent_p.S234S|GUCY1A3_uc010iqe.2_5'UTR|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Silent_p.S234S	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	234					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		TGGAAGTGTCGTTAATGCCTC	0.468																0.333333	44.38599	45.565825	16	32	KEEP	---	---	---	---	9	9	20	17	-1	capture	Silent	SNP	156632019	156632019	GUCY1A3	4	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	6823	79
KIAA0947	23379	broad.mit.edu	37	5	5464633	5464633	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5464633G>T	uc003jdm.3	+	13	5408	c.5186G>T	c.(5185-5187)GGC>GTC	p.G1729V		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1729	Pro-rich.									ovary(1)|central_nervous_system(1)	2						CCTGTGCCTGGCCGACTCCCA	0.587																0.317073	69.978826	72.388616	26	56	KEEP	---	---	---	---	17	12	28	29	0.586206896552	capture	Missense_Mutation	SNP	5464633	5464633	KIAA0947	5	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	8124	79
CDH9	1007	broad.mit.edu	37	5	26885950	26885950	+	Missense_Mutation	SNP	C	T	T	rs150128137		TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:26885950C>T	uc003jgs.1	-	11	1824	c.1655G>A	c.(1654-1656)CGG>CAG	p.R552Q	CDH9_uc011cnv.1_Missense_Mutation_p.R145Q	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	552	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						GCCATCTTTCCGAGTCATGAT	0.343	Melanoma(8;187 585 15745 40864 52829)															0.358974	44.645547	45.325791	14	25	KEEP	---	---	---	---	10	8	18	10	-1	capture	Missense_Mutation	SNP	26885950	26885950	CDH9	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3088	79
PCDHA12	56137	broad.mit.edu	37	5	140256671	140256671	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140256671C>T	uc003lic.2	+	1	1741	c.1614C>T	c.(1612-1614)CGC>CGT	p.R538R	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.R538R	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	538	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGCGCGCGCGACGCCGGCG	0.692	Pancreas(113;759 1672 13322 24104 50104)															0.396154	278.463682	280.913367	103	157	KEEP	---	---	---	---	46	64	82	88	-1	capture	Silent	SNP	140256671	140256671	PCDHA12	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11425	79
PPP2R2B	5521	broad.mit.edu	37	5	146030195	146030195	+	Silent	SNP	A	T	T	rs146742970	byFrequency	TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:146030195A>T	uc003loe.2	-	5	1065	c.540T>A	c.(538-540)TCT>TCA	p.S180S	PPP2R2B_uc010jgm.2_Silent_p.S169S|PPP2R2B_uc003log.3_Silent_p.S180S|PPP2R2B_uc003lof.3_Silent_p.S180S|PPP2R2B_uc003loi.3_Silent_p.S183S|PPP2R2B_uc003loh.3_Silent_p.S180S|PPP2R2B_uc003loj.3_Silent_p.S160S|PPP2R2B_uc003lok.3_Silent_p.S169S|PPP2R2B_uc011dbu.1_Silent_p.S186S|PPP2R2B_uc011dbv.1_Silent_p.S238S	NM_004576	NP_004567	Q00005	2ABB_HUMAN	beta isoform of regulatory subunit B55, protein	180	WD 3.				apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CGCTGTTGACAGATATGGAGT	0.458																0.40625	38.331054	38.58588	13	19	KEEP	---	---	---	---	4	9	7	13	-1	capture	Silent	SNP	146030195	146030195	PPP2R2B	5	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	12286	79
FAM71B	153745	broad.mit.edu	37	5	156589483	156589483	+	Missense_Mutation	SNP	A	G	G			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156589483A>G	uc003lwn.2	-	2	1893	c.1793T>C	c.(1792-1794)ATC>ACC	p.I598T		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	598						nucleus		p.I598I(1)		ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTCAAAGACGATCATCTCCGT	0.517																0.379135	489.858274	494.901305	149	244	KEEP	---	---	---	---	78	87	120	141	-1	capture	Missense_Mutation	SNP	156589483	156589483	FAM71B	5	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	5556	79
ABCC10	89845	broad.mit.edu	37	6	43403588	43403588	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43403588C>T	uc003ouy.1	+	5	1923	c.1708C>T	c.(1708-1710)CGG>TGG	p.R570W	ABCC10_uc003ouz.1_Missense_Mutation_p.R527W|ABCC10_uc010jyo.1_5'UTR	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	570						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GTCCTTGGACCGGATCCAGCT	0.567																0.421053	148.579072	149.199376	48	66	KEEP	---	---	---	---	19	32	30	40	-1	capture	Missense_Mutation	SNP	43403588	43403588	ABCC10	6	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	50	79
PKHD1	5314	broad.mit.edu	37	6	51523897	51523897	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51523897C>T	uc003pah.1	-	61	11303	c.11027G>A	c.(11026-11028)GGA>GAA	p.G3676E		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3676	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TGAAATCATTCCAGTGCTCCT	0.403					1537											0.433962	68.215341	68.417154	23	30	KEEP	---	---	---	---	12	12	17	17	-1	capture	Missense_Mutation	SNP	51523897	51523897	PKHD1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	11874	79
ZNF292	23036	broad.mit.edu	37	6	87865454	87865454	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:87865454G>T	uc003plm.3	+	1	186	c.145G>T	c.(145-147)GAC>TAC	p.D49Y	ZNF292_uc003plk.2_RNA|ZNF292_uc003pll.1_Missense_Mutation_p.D49Y	NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	49					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		AGCGGCCACCGACTACTGTCA	0.726																0.096774	1.603246	6.653515	3	28	KEEP	---	---	---	---	2	2	9	22	0.5	capture	Missense_Mutation	SNP	87865454	87865454	ZNF292	6	G	T	T	T	1	0	0	0	0	1	0	0	0	481	37	4	4	17706	79
GPR6	2830	broad.mit.edu	37	6	110300407	110300407	+	Missense_Mutation	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:110300407C>T	uc011eaw.1	+	2	272	c.92C>T	c.(91-93)CCG>CTG	p.P31L	GPR6_uc011eav.1_Missense_Mutation_p.P46L|GPR6_uc003ptu.2_Missense_Mutation_p.P31L	NM_005284	NP_005275	P46095	GPR6_HUMAN	G protein-coupled receptor 6	31	Extracellular (Potential).					integral to plasma membrane					0		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		gcaggggggccggACACGGGC	0.502																0.411111	102.952089	103.574	37	53	KEEP	---	---	---	---	20	25	25	35	-1	capture	Missense_Mutation	SNP	110300407	110300407	GPR6	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6634	79
EGFR	1956	broad.mit.edu	37	7	55221722	55221722	+	Missense_Mutation	SNP	G	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221722G>T	uc003tqk.2	+	7	1012	c.766G>T	c.(766-768)GAC>TAC	p.D256Y	EGFR_uc003tqh.2_Missense_Mutation_p.D256Y|EGFR_uc003tqi.2_Missense_Mutation_p.D256Y|EGFR_uc003tqj.2_Missense_Mutation_p.D256Y|EGFR_uc010kzg.1_Missense_Mutation_p.D211Y|EGFR_uc011kco.1_Missense_Mutation_p.D203Y|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	256	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.D256A(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAAATTCCGAGACGAAGCCAC	0.582			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.142857	34.074901	54.743476	24	144	KEEP	---	---	---	---	17	12	74	88	0.586206896552	capture	Missense_Mutation	SNP	55221722	55221722	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	4922	79
MYL10	93408	broad.mit.edu	37	7	101256837	101256837	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:101256837G>A	uc003uyr.2	-	8	777	c.599C>T	c.(598-600)GCA>GTA	p.A200V		NM_138403	NP_612412	Q9BUA6	MYL10_HUMAN	myosin, light chain 10, regulatory	200	EF-hand 3.					mitochondrion	calcium ion binding			ovary(1)|breast(1)	2						GGGAAATGCTGCAAACATCTG	0.562	Esophageal Squamous(24;575 709 17516 40384 51639)															0.235897	101.434405	113.886853	46	149	KEEP	---	---	---	---	16	35	91	81	-1	capture	Missense_Mutation	SNP	101256837	101256837	MYL10	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	9954	79
PTPRZ1	5803	broad.mit.edu	37	7	121653409	121653409	+	Missense_Mutation	SNP	T	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:121653409T>A	uc003vjy.2	+	12	4704	c.4309T>A	c.(4309-4311)TTA>ATA	p.L1437I	PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	1437	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						TAGTGATGGCTTATCCATTCA	0.308																0.060241	-6.190933	10.586404	5	78	KEEP	---	---	---	---	3	2	31	50	-1	capture	Missense_Mutation	SNP	121653409	121653409	PTPRZ1	7	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	12709	79
UBE3C	9690	broad.mit.edu	37	7	157046771	157046771	+	Missense_Mutation	SNP	C	T	T	rs142140245		TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:157046771C>T	uc010lqs.2	+	20	3130	c.2818C>T	c.(2818-2820)CGC>TGC	p.R940C	UBE3C_uc003wni.3_Missense_Mutation_p.R303C	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	940	HECT.				protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		CCTGGCTTTCCGCCAGGGCCT	0.562																0.516667	102.929153	102.943779	31	29	KEEP	---	---	---	---	16	19	14	15	-1	capture	Missense_Mutation	SNP	157046771	157046771	UBE3C	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16763	79
ADAM28	10863	broad.mit.edu	37	8	24200682	24200682	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24200682C>A	uc003xdy.2	+	17	1982	c.1899C>A	c.(1897-1899)TGC>TGA	p.C633*	ADAM28_uc011laa.1_RNA|ADAM28_uc010lua.2_Nonsense_Mutation_p.C320*	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	633	EGF-like.|Extracellular (Potential).				proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		CATCTAAGTGCAAAGGACATG	0.358	NSCLC(193;488 2149 22258 34798 40734)				410											0.517241	46.824769	46.832211	15	14	KEEP	---	---	---	---	7	10	9	6	0.588235294118	capture	Nonsense_Mutation	SNP	24200682	24200682	ADAM28	8	C	A	A	A	1	0	0	0	0	0	1	0	0	324	25	5	4	246	79
DOCK5	80005	broad.mit.edu	37	8	25203034	25203034	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25203034C>T	uc003xeg.2	+	26	2798	c.2661C>T	c.(2659-2661)AGC>AGT	p.S887S	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Silent_p.S601S|DOCK5_uc003xei.2_Silent_p.S457S|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	887						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		ACCAGCTCAGCGGCCAGTTAG	0.557	Pancreas(145;34 1887 3271 10937 30165)															0.36	149.123676	151.705054	54	96	KEEP	---	---	---	---	19	38	56	55	-1	capture	Silent	SNP	25203034	25203034	DOCK5	8	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	4646	79
TGS1	96764	broad.mit.edu	37	8	56699365	56699365	+	Missense_Mutation	SNP	A	G	G			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:56699365A>G	uc003xsj.3	+	4	1295	c.908A>G	c.(907-909)GAT>GGT	p.D303G	TGS1_uc010lyh.2_Missense_Mutation_p.D207G	NM_024831	NP_079107	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase homolog	303					cellular lipid metabolic process|ncRNA metabolic process|regulation of transcription, DNA-dependent|RNA capping|spliceosomal snRNP assembly|transcription, DNA-dependent	Cajal body|cytosol	RNA trimethylguanosine synthase activity			ovary(1)|lung(1)|breast(1)	3		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			ATTATGGTTGATAATGATAGC	0.333	Esophageal Squamous(34;275 823 4842 34837 48447)				978											0.212121	19.908361	22.434779	7	26	KEEP	---	---	---	---	2	5	15	11	-1	capture	Missense_Mutation	SNP	56699365	56699365	TGS1	8	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	15722	79
SYBU	55638	broad.mit.edu	37	8	110588241	110588241	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110588241C>A	uc003ynj.3	-	7	1049	c.886G>T	c.(886-888)GAA>TAA	p.E296*	SYBU_uc003yni.3_Nonsense_Mutation_p.E293*|SYBU_uc003ynk.3_Nonsense_Mutation_p.E177*|SYBU_uc010mco.2_Nonsense_Mutation_p.E295*|SYBU_uc003ynl.3_Nonsense_Mutation_p.E295*|SYBU_uc010mcp.2_Nonsense_Mutation_p.E296*|SYBU_uc010mcq.2_Nonsense_Mutation_p.E296*|SYBU_uc003yno.3_Nonsense_Mutation_p.E177*|SYBU_uc010mcr.2_Nonsense_Mutation_p.E296*|SYBU_uc003ynm.3_Nonsense_Mutation_p.E295*|SYBU_uc003ynn.3_Nonsense_Mutation_p.E295*|SYBU_uc010mcs.2_Nonsense_Mutation_p.E177*|SYBU_uc010mct.2_Nonsense_Mutation_p.E296*|SYBU_uc010mcu.2_Nonsense_Mutation_p.E295*|SYBU_uc003ynp.3_Nonsense_Mutation_p.E228*|SYBU_uc010mcv.2_Nonsense_Mutation_p.E296*|SYBU_uc003ynh.3_Nonsense_Mutation_p.E90*|SYBU_uc011lhw.1_Nonsense_Mutation_p.E166*	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	296	Potential.|Sufficient for interaction with KIF5B.					cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						ATTTCACTTTCCCTAGAGTGC	0.463																0.48	65.978699	65.996754	24	26	KEEP	---	---	---	---	11	15	13	14	0.576923076923	capture	Nonsense_Mutation	SNP	110588241	110588241	SYBU	8	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	15315	79
RFX3	5991	broad.mit.edu	37	9	3225104	3225104	+	Missense_Mutation	SNP	C	T	T	rs137899630	byFrequency	TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:3225104C>T	uc003zhr.2	-	18	2500	c.2188G>A	c.(2188-2190)GTC>ATC	p.V730I	RFX3_uc010mhd.2_Missense_Mutation_p.V730I	NM_134428	NP_602304	P48380	RFX3_HUMAN	regulatory factor X3 isoform b	730					cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		GTACTTGTGACAATGTGCTCG	0.478																0.2	6.315847	7.571999	3	12	KEEP	---	---	---	---	1	3	7	5	-1	capture	Missense_Mutation	SNP	3225104	3225104	RFX3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	13159	79
FLJ46321	389763	broad.mit.edu	37	9	84609494	84609494	+	Missense_Mutation	SNP	A	G	G			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:84609494A>G	uc004amn.2	+	4	4156	c.4109A>G	c.(4108-4110)GAA>GGA	p.E1370G		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	1370						integral to membrane					0						TCATATGAAGAACAAGAAAGT	0.433																0.35	47.039819	47.833082	14	26	KEEP	---	---	---	---	6	8	8	20	-1	capture	Missense_Mutation	SNP	84609494	84609494	FLJ46321	9	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	5876	79
CACNA1B	774	broad.mit.edu	37	9	140904511	140904511	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140904511C>T	uc004cog.2	+	17	2287	c.2142C>T	c.(2140-2142)AAC>AAT	p.N714N	CACNA1B_uc011mfd.1_Silent_p.N245N	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	714	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	ACCTGGCCAACGCCCAAGAGC	0.607																0.337209	79.92984	81.954753	29	57	KEEP	---	---	---	---	11	22	33	38	-1	capture	Silent	SNP	140904511	140904511	CACNA1B	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2515	79
VCX2	51480	broad.mit.edu	37	X	8138151	8138151	+	Silent	SNP	C	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:8138151C>T	uc004csb.2	-	3	649	c.342G>A	c.(340-342)CTG>CTA	p.L114L		NM_016378	NP_057462	Q9H322	VCX2_HUMAN	variable charge, X-linked 2	114	2.|2 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.										0		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				TCTCCTGACTCAGTGGTTCTT	0.642																0.038462	-29.137581	12.769879	7	175	KEEP	---	---	---	---	5	3	123	89	-1	capture	Silent	SNP	8138151	8138151	VCX2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	17025	79
PHEX	5251	broad.mit.edu	37	X	22112133	22112133	+	Silent	SNP	T	C	C			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:22112133T>C	uc004dah.2	+	7	968	c.765T>C	c.(763-765)GAT>GAC	p.D255D	PHEX_uc011mjr.1_Silent_p.D255D|PHEX_uc011mjs.1_Silent_p.D158D	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase	255	Extracellular (Potential).				biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						TCATGGTGGATACTGCCGTGC	0.408																0.069231	-1.1952	23.692858	9	121	KEEP	---	---	---	---	3	7	76	67	-1	capture	Silent	SNP	22112133	22112133	PHEX	23	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	11722	79
SLC9A7	84679	broad.mit.edu	37	X	46618211	46618211	+	Missense_Mutation	SNP	A	T	T			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:46618211A>T	uc004dgu.1	-	1	262	c.254T>A	c.(253-255)ATC>AAC	p.I85N	SLC9A7_uc004dgv.1_Missense_Mutation_p.I85N	NM_032591	NP_115980	Q96T83	SL9A7_HUMAN	solute carrier family 9, member 7	85	Helical; (Potential).				regulation of pH	Golgi membrane|integral to membrane|recycling endosome membrane|trans-Golgi network	potassium:hydrogen antiporter activity|protein homodimerization activity|sodium:hydrogen antiporter activity			ovary(2)	2						GATGGTGAGGATGGTGAGCGT	0.632	Pancreas(118;454 1696 1930 13865 39976)															0.2875	61.992699	65.232375	23	57	KEEP	---	---	---	---	10	18	32	35	-1	capture	Missense_Mutation	SNP	46618211	46618211	SLC9A7	23	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	14611	79
HUWE1	10075	broad.mit.edu	37	X	53600812	53600812	+	Silent	SNP	A	G	G			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53600812A>G	uc004dsp.2	-	47	6612	c.6210T>C	c.(6208-6210)ACT>ACC	p.T2070T	HUWE1_uc004dsn.2_Silent_p.T894T	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	2070					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						GACGAAGGATAGTGGAGGTAG	0.502																0.04065	-16.42398	11.509092	5	118	KEEP	---	---	---	---	3	2	51	79	-1	capture	Silent	SNP	53600812	53600812	HUWE1	23	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	7386	79
POF1B	79983	broad.mit.edu	37	X	84634246	84634246	+	Missense_Mutation	SNP	G	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:84634246G>A	uc004eer.2	-	2	360	c.214C>T	c.(214-216)CGG>TGG	p.R72W	POF1B_uc004ees.2_Missense_Mutation_p.R72W	NM_024921	NP_079197	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	72							actin binding				0						AGCACTTCCCGTGAGTTGAAG	0.517																0.352941	51.134481	52.107199	18	33	KEEP	---	---	---	---	9	12	14	22	-1	capture	Missense_Mutation	SNP	84634246	84634246	POF1B	23	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	12085	79
AGTR2	186	broad.mit.edu	37	X	115303791	115303791	+	Silent	SNP	C	T	T	rs13306157		TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:115303791C>T	uc004eqh.3	+	3	465	c.258C>T	c.(256-258)CTC>CTT	p.L86L		NM_000686	NP_000677	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	86	Helical; Name=2; (Potential).				behavior|blood vessel remodeling|brain development|G-protein signaling, coupled to cGMP nucleotide second messenger|intracellular protein kinase cascade|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of heart rate|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of nitric-oxide synthase activity|positive regulation of phosphoprotein phosphatase activity|positive regulation of vasodilation|regulation of systemic arterial blood pressure by circulatory renin-angiotensin		angiotensin type II receptor activity|receptor antagonist activity			ovary(2)|lung(1)	3						TCTTCAACCTCGCTGTGGCTG	0.378																0.357798	112.591236	114.533918	39	70	KEEP	---	---	---	---	24	22	36	49	-1	capture	Silent	SNP	115303791	115303791	AGTR2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	402	79
MAGEA5	4104	broad.mit.edu	37	X	151283685	151283685	+	Missense_Mutation	SNP	T	A	A			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151283685T>A	uc004ffj.2	-	3	533	c.328A>T	c.(328-330)AGT>TGT	p.S110C		NM_021049	NP_066387	P43359	MAGA5_HUMAN	melanoma antigen family A, 5	110	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					ACCTTCTTACTGAGTGCTGCT	0.488																0.388889	255.564022	257.895435	84	132	KEEP	---	---	---	---	47	48	69	75	-1	capture	Missense_Mutation	SNP	151283685	151283685	MAGEA5	23	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	9083	79
BCOR	54880	broad.mit.edu	37	X	39922999	39923002	+	Frame_Shift_Del	DEL	CTTC	-	-			TCGA-06-1804-01	TCGA-06-1804-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:39922999_39923002delCTTC	uc004den.3	-	8	3998_4001	c.3706_3709delGAAG	c.(3706-3711)GAAGTGfs	p.E1236fs	BCOR_uc004dep.3_Frame_Shift_Del_p.E1202fs|BCOR_uc004deo.3_Frame_Shift_Del_p.E1184fs|BCOR_uc010nhb.2_5'Flank|BCOR_uc004dem.3_Frame_Shift_Del_p.E1202fs	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	1236_1237					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						GCCTGGGTCACTTCCTTCCTGCTT	0.559																0.04			10	245		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	39922999	39923002	BCOR	23	CTTC	-	-	-	1	0	1	0	1	0	0	0	0	260	20	5	5	1375	79
