Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GNG5	2787	broad.mit.edu	37	1	84967630	84967630	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:84967630C>A	uc001djw.3	-	3	459	c.105G>T	c.(103-105)TTG>TTT	p.L35F		NM_005274	NP_005265	P63218	GBG5_HUMAN	guanine nucleotide binding protein (G protein),	35					cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0				all cancers(265;0.00634)|Epithelial(280;0.0175)|OV - Ovarian serous cystadenocarcinoma(397;0.159)		AGAACTGTTTCAAGTCTGCAG	0.433																0.125	11.352882	20.14732	8	56	KEEP	---	---	---	---	8	4	32	30	0.333333333333	capture	Missense_Mutation	SNP	84967630	84967630	GNG5	1	C	A	A	A	1	0	0	0	0	1	0	0	0	376	29	4	4	6466	101
SPAG17	200162	broad.mit.edu	37	1	118539227	118539227	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118539227A>T	uc001ehk.2	-	33	4984	c.4916T>A	c.(4915-4917)GTC>GAC	p.V1639D		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1639						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTACCTGGGGACATGTTCACC	0.299																0.384615	41.885617	42.350111	15	24	KEEP	---	---	---	---	11	5	11	17	-1	capture	Missense_Mutation	SNP	118539227	118539227	SPAG17	1	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	14871	101
BCL9	607	broad.mit.edu	37	1	147092093	147092093	+	Missense_Mutation	SNP	T	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:147092093T>G	uc001epq.2	+	8	2872	c.2132T>G	c.(2131-2133)ATG>AGG	p.M711R	BCL9_uc010ozr.1_Missense_Mutation_p.M637R	NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	711	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)					GAGTTTGGGATGGTTCCTAGT	0.527					202	T	IGH@|IGL@	B-ALL								0.063291	-2.288691	13.392913	5	74	KEEP	---	---	---	---	4	1	44	42	-1	capture	Missense_Mutation	SNP	147092093	147092093	BCL9	1	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	1370	101
KPRP	448834	broad.mit.edu	37	1	152732521	152732521	+	Missense_Mutation	SNP	T	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152732521T>G	uc001fal.1	+	2	515	c.457T>G	c.(457-459)TAT>GAT	p.Y153D		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	153	Gln-rich.					cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGTCCAGAACTATGTACCCTG	0.512																0.546053	289.032933	289.313345	83	69	KEEP	---	---	---	---	41	45	26	44	-1	capture	Missense_Mutation	SNP	152732521	152732521	KPRP	1	T	G	G	G	1	0	0	0	0	1	0	0	0	689	53	4	4	8356	101
NPR1	4881	broad.mit.edu	37	1	153657481	153657481	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153657481G>A	uc001fcs.3	+	8	1947	c.1526G>A	c.(1525-1527)CGG>CAG	p.R509Q	NPR1_uc010pdz.1_Missense_Mutation_p.R255Q|NPR1_uc010pea.1_Missense_Mutation_p.R13Q	NM_000906	NP_000897	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1 precursor	509	Cytoplasmic (Potential).				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity			ovary(3)|lung(2)|stomach(1)|breast(1)	7	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	GAGCTGTGGCGGGTGCGCTGG	0.647	Pancreas(141;1349 1870 15144 15830 40702)				382											0.275229	84.81653	89.767443	30	79	KEEP	---	---	---	---	18	16	50	60	-1	capture	Missense_Mutation	SNP	153657481	153657481	NPR1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10501	101
C1orf198	84886	broad.mit.edu	37	1	230979428	230979428	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:230979428C>T	uc001hub.2	-	3	643	c.599G>A	c.(598-600)GGG>GAG	p.G200E	C1orf198_uc009xfh.1_Missense_Mutation_p.G70E|C1orf198_uc001huc.1_5'UTR|C1orf198_uc001hud.1_Missense_Mutation_p.G162E	NM_032800	NP_116189	Q9H425	CA198_HUMAN	hypothetical protein LOC84886 isoform 1	200											0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				AGGCCCCTCCCCTCGGGACCG	0.632																0.360465	192.614423	195.55731	62	110	KEEP	---	---	---	---	35	33	57	64	-1	capture	Missense_Mutation	SNP	230979428	230979428	C1orf198	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	2008	101
OR2M3	127062	broad.mit.edu	37	1	248366725	248366725	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248366725C>A	uc010pzg.1	+	1	356	c.356C>A	c.(355-357)GCT>GAT	p.A119D		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	119	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GCTGTTATGGCTTATGACCGC	0.463																0.04142	-24.91086	13.300833	7	162	KEEP	---	---	---	---	3	5	93	74	0.625	capture	Missense_Mutation	SNP	248366725	248366725	OR2M3	1	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	10915	101
CDHR1	92211	broad.mit.edu	37	10	85962739	85962739	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:85962739G>T	uc001kcv.2	+	8	643	c.643G>T	c.(643-645)GGC>TGC	p.G215C	CDHR1_uc001kcw.2_Missense_Mutation_p.G215C|CDHR1_uc009xst.2_5'UTR	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN	protocadherin 21 precursor	215	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion		calcium ion binding|receptor activity			ovary(1)	1						TCTGCAGGATGGCGGTGGGAG	0.393																0.233333	17.710349	19.6625	7	23	KEEP	---	---	---	---	4	3	14	12	0.571428571429	capture	Missense_Mutation	SNP	85962739	85962739	CDHR1	10	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	3089	101
AHNAK	79026	broad.mit.edu	37	11	62286891	62286891	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62286891C>G	uc001ntl.2	-	5	15298	c.14998G>C	c.(14998-15000)GTT>CTT	p.V5000L	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	5000					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				GCCTCAGGAACAGTGACATCC	0.433																0.059322	-4.757509	19.207543	7	111	KEEP	---	---	---	---	2	5	45	75	-1	capture	Missense_Mutation	SNP	62286891	62286891	AHNAK	11	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	414	101
MTMR2	8898	broad.mit.edu	37	11	95580911	95580911	+	Silent	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:95580911G>A	uc001pfu.2	-	10	1399	c.1146C>T	c.(1144-1146)AAC>AAT	p.N382N	MTMR2_uc001pfv.2_Silent_p.N310N|MTMR2_uc001pfs.2_Silent_p.N310N|MTMR2_uc001pft.2_Silent_p.N310N|MTMR2_uc010ruj.1_Silent_p.N365N	NM_016156	NP_057240	Q13614	MTMR2_HUMAN	myotubularin-related protein 2 isoform 1	382	Myotubularin phosphatase.					nucleus	inositol or phosphatidylinositol phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TAGATTCCAAGTTAGACAACC	0.368																0.227273	23.423059	26.430485	10	34	KEEP	---	---	---	---	8	3	14	28	-1	capture	Silent	SNP	95580911	95580911	MTMR2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	9854	101
SCN3B	55800	broad.mit.edu	37	11	123513193	123513193	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123513193T>C	uc001pza.1	-	4	813	c.406A>G	c.(406-408)AAG>GAG	p.K136E	SCN3B_uc001pzb.1_Missense_Mutation_p.K136E	NM_001040151	NP_001035241	Q9NY72	SCN3B_HUMAN	voltage-gated sodium channel beta-3 subunit	136	Ig-like C2-type.|Extracellular (Potential).				axon guidance	integral to membrane|plasma membrane	voltage-gated sodium channel activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)		CGCGTCGTCTTCACAAAGGGC	0.592																0.657143	167.871836	169.399299	46	24	KEEP	---	---	---	---	21	26	10	17	-1	capture	Missense_Mutation	SNP	123513193	123513193	SCN3B	11	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	13812	101
EFCAB4B	84766	broad.mit.edu	37	12	3788105	3788105	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:3788105A>G	uc001qmj.2	-	6	1072	c.500T>C	c.(499-501)CTT>CCT	p.L167P	EFCAB4B_uc010sen.1_Missense_Mutation_p.L167P|EFCAB4B_uc010seo.1_Missense_Mutation_p.L167P	NM_032680	NP_116069	Q9BSW2	EFC4B_HUMAN	EF-hand calcium binding domain 4B isoform c	167					activation of store-operated calcium channel activity|store-operated calcium entry	cytoplasm	calcium ion binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			TTGGGCTCCAAGTCTGTCCAT	0.517																0.032209	-106.722521	49.236805	21	631	KEEP	---	---	---	---	17	11	338	405	-1	capture	Missense_Mutation	SNP	3788105	3788105	EFCAB4B	12	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	4892	101
NDUFA9	4704	broad.mit.edu	37	12	4771765	4771765	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:4771765T>C	uc001qnc.2	+	6	629	c.619T>C	c.(619-621)TTT>CTT	p.F207L	NDUFA9_uc009zei.1_Missense_Mutation_p.F207L|NDUFA9_uc010ses.1_5'UTR	NM_005002	NP_004993	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	207					mitochondrial electron transport, NADH to ubiquinone|sodium ion transport	mitochondrial matrix|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	GTCGGACATCTTTGGAAGAGA	0.393	Colon(75;996 1244 23946 25294 29232)															0.096154	16.309096	41.81807	15	141	KEEP	---	---	---	---	9	9	65	106	-1	capture	Missense_Mutation	SNP	4771765	4771765	NDUFA9	12	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	10179	101
PLEKHA5	54477	broad.mit.edu	37	12	19285373	19285373	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:19285373A>T	uc001reb.2	+	3	302	c.216A>T	c.(214-216)AGA>AGT	p.R72S	PLEKHA5_uc010sie.1_Missense_Mutation_p.R72S|PLEKHA5_uc001rea.2_Missense_Mutation_p.R72S|PLEKHA5_uc009zin.2_5'UTR|PLEKHA5_uc001rdz.3_Missense_Mutation_p.R72S	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	72	WW 2.						1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					AAGGTGCAAGATACTATATAA	0.313	Pancreas(196;329 2193 11246 14234 19524)				873											0.051282	-8.150289	8.461986	4	74	KEEP	---	---	---	---	1	3	47	40	-1	capture	Missense_Mutation	SNP	19285373	19285373	PLEKHA5	12	A	T	T	T	1	0	0	0	0	1	0	0	0	154	12	4	4	11962	101
H3F3C	440093	broad.mit.edu	37	12	31944878	31944878	+	Missense_Mutation	SNP	C	T	T	rs141415515		TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:31944878C>T	uc001rkr.2	-	1	298	c.223G>A	c.(223-225)GCG>ACG	p.A75T		NM_001013699	NP_001013721	Q6NXT2	H3C_HUMAN	histone H3-like	75					nucleosome assembly	nucleosome|nucleus	DNA binding				0						AAATCCTGCGCGATCTCCCTC	0.587													HNSCC(67;0.2)			0.036232	-23.736936	8.483155	5	133	KEEP	---	---	---	---	1	5	71	79	-1	capture	Missense_Mutation	SNP	31944878	31944878	H3F3C	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6862	101
OR6C75	390323	broad.mit.edu	37	12	55759176	55759176	+	Silent	SNP	G	T	T	rs113253007		TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55759176G>T	uc010spk.1	+	1	282	c.282G>T	c.(280-282)GGG>GGT	p.G94G		NM_001005497	NP_001005497	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C,	94	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3						CTTATAATGGGTGTGTGGCTC	0.448																0.115942	19.596423	39.639015	16	122	KEEP	---	---	---	---	8	9	66	71	0.470588235294	capture	Silent	SNP	55759176	55759176	OR6C75	12	G	T	T	T	1	0	0	0	0	0	0	0	1	561	44	4	4	11103	101
SMARCC2	6601	broad.mit.edu	37	12	56578637	56578637	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56578637C>G	uc001skb.2	-	5	589	c.483G>C	c.(481-483)AAG>AAC	p.K161N	SMARCC2_uc001skd.2_Missense_Mutation_p.K161N|SMARCC2_uc001ska.2_Missense_Mutation_p.K161N|SMARCC2_uc001skc.2_Missense_Mutation_p.K161N|SMARCC2_uc010sqf.1_Missense_Mutation_p.K50N	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated	161					chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CCTGGTGTCTCTTGATAATGT	0.418																0.064935	-2.692377	12.452505	5	72	KEEP	---	---	---	---	3	2	35	42	-1	capture	Missense_Mutation	SNP	56578637	56578637	SMARCC2	12	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	14668	101
MARCH9	92979	broad.mit.edu	37	12	58152353	58152353	+	Silent	SNP	C	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58152353C>A	uc001spx.1	+	4	1126	c.714C>A	c.(712-714)ATC>ATA	p.I238I	MARCH9_uc001spy.2_Silent_p.I125I	NM_138396	NP_612405	Q86YJ5	MARH9_HUMAN	membrane-associated RING-CH protein IX	238	Helical; (Potential).					Golgi membrane|Golgi stack|integral to membrane|lysosomal membrane|trans-Golgi network	ligase activity|zinc ion binding				0	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			CAGGCCTCATCATCCATGAAG	0.478																0.023573	-174.697578	28.893933	19	787	KEEP	---	---	---	---	11	12	393	494	0.521739130435	capture	Silent	SNP	58152353	58152353	MARCH9	12	C	A	A	A	1	0	0	0	0	0	0	0	1	369	29	4	4	9221	101
IFNG	3458	broad.mit.edu	37	12	68552011	68552011	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:68552011T>C	uc001stw.1	-	2	269	c.143A>G	c.(142-144)AAT>AGT	p.N48S		NM_000619	NP_000610	P01579	IFNG_HUMAN	interferon, gamma precursor	48					cell cycle arrest|interferon-gamma-mediated signaling pathway|negative regulation of interleukin-17 production|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of metanephric nephron tubule epithelial cell differentiation|negative regulation of smooth muscle cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity|positive regulation of fructose 1,6-bisphosphate metabolic process|positive regulation of interleukin-12 production|positive regulation of interleukin-23 production|positive regulation of killing of cells of other organism|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mesenchymal cell proliferation|positive regulation of nitric oxide biosynthetic process|positive regulation of osteoclast differentiation|positive regulation of peptidyl-serine phosphorylation of STAT protein|positive regulation of smooth muscle cell apoptosis|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of vitamin D biosynthetic process|protein import into nucleus, translocation|regulation of insulin secretion|regulation of interferon-gamma-mediated signaling pathway|response to virus	extracellular space	cytokine activity|interferon-gamma receptor binding				0			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Interferon gamma-1b(DB00033)|Simvastatin(DB00641)	AAGAGTTCCATTATCCGCTAC	0.308				p.N48S(PF382-Tumor)	63											0.768924	1426.07815	1459.376378	386	116	KEEP	---	---	---	---	208	234	51	79	-1	capture	Missense_Mutation	SNP	68552011	68552011	IFNG	12	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	7473	101
CNOT2	4848	broad.mit.edu	37	12	70732228	70732228	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70732228G>C	uc001svv.2	+	10	1485	c.906G>C	c.(904-906)TTG>TTC	p.L302F	CNOT2_uc009zro.2_Missense_Mutation_p.L302F|CNOT2_uc009zrp.2_Missense_Mutation_p.L282F|CNOT2_uc009zrq.2_Missense_Mutation_p.L302F|CNOT2_uc001svw.1_Missense_Mutation_p.L42F	NM_014515	NP_055330	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	302					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			GCTAGAATTTGAATACATCTG	0.294																0.202247	52.102907	59.428943	18	71	KEEP	---	---	---	---	9	10	47	32	-1	capture	Missense_Mutation	SNP	70732228	70732228	CNOT2	12	G	C	C	C	1	0	0	0	0	1	0	0	0	581	45	4	4	3584	101
CNOT2	4848	broad.mit.edu	37	12	70732315	70732315	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70732315G>C	uc001svv.2	+	10	1572	c.993G>C	c.(991-993)CAG>CAC	p.Q331H	CNOT2_uc009zro.2_Missense_Mutation_p.Q331H|CNOT2_uc009zrp.2_Missense_Mutation_p.Q311H|CNOT2_uc009zrq.2_Missense_Mutation_p.Q331H|CNOT2_uc001svw.1_Missense_Mutation_p.Q71H	NM_014515	NP_055330	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	331					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			ATAACCAGCAGAAAAAAGGGA	0.338																0.192	67.023967	78.100006	24	101	KEEP	---	---	---	---	17	14	65	59	-1	capture	Missense_Mutation	SNP	70732315	70732315	CNOT2	12	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	3584	101
FSCB	84075	broad.mit.edu	37	14	44974567	44974567	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:44974567C>A	uc001wvn.2	-	1	1933	c.1624G>T	c.(1624-1626)GCT>TCT	p.A542S		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	542	Ala-rich.					cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		GGAGACTGAGCTTCAGCAGGA	0.493					151											0.142857	7.86492	12.156405	5	30	KEEP	---	---	---	---	4	2	17	17	0.333333333333	capture	Missense_Mutation	SNP	44974567	44974567	FSCB	14	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	6009	101
ACTN1	87	broad.mit.edu	37	14	69349203	69349203	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:69349203A>C	uc001xkl.2	-	16	2235	c.1925T>G	c.(1924-1926)ATC>AGC	p.I642S	ACTN1_uc001xkk.2_Missense_Mutation_p.I238S|ACTN1_uc010ttb.1_Missense_Mutation_p.I577S|ACTN1_uc001xkm.2_Missense_Mutation_p.I642S|ACTN1_uc001xkn.2_Missense_Mutation_p.I642S|ACTN1_uc010ttc.1_Missense_Mutation_p.I227S	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b	642	Spectrin 4.|Interaction with DDN.				focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CCAGGGCCCGATGACATTGGC	0.642																0.125	7.278911	11.673315	4	28	KEEP	---	---	---	---	3	3	16	14	-1	capture	Missense_Mutation	SNP	69349203	69349203	ACTN1	14	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	204	101
ACOT4	122970	broad.mit.edu	37	14	74060458	74060458	+	Silent	SNP	C	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74060458C>A	uc001xoo.2	+	2	764	c.510C>A	c.(508-510)CTC>CTA	p.L170L		NM_152331	NP_689544	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	170					acyl-CoA metabolic process|dicarboxylic acid metabolic process|long-chain fatty acid metabolic process|saturated monocarboxylic acid metabolic process|short-chain fatty acid metabolic process|succinyl-CoA metabolic process|unsaturated monocarboxylic acid metabolic process|very long-chain fatty acid metabolic process	peroxisome	carboxylesterase activity|palmitoyl-CoA hydrolase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00331)		GAGGGGGCCTCTTGGAATATC	0.423																0.298246	86.3131	90.456961	34	80	KEEP	---	---	---	---	17	20	46	44	0.540540540541	capture	Silent	SNP	74060458	74060458	ACOT4	14	C	A	A	A	1	0	0	0	0	0	0	0	1	405	32	4	4	153	101
MAPKBP1	23005	broad.mit.edu	37	15	42107465	42107465	+	Silent	SNP	C	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42107465C>T	uc001zok.3	+	12	1483	c.1197C>T	c.(1195-1197)CCC>CCT	p.P399P	MAPKBP1_uc001zoj.3_Silent_p.P393P|MAPKBP1_uc010bcj.2_5'UTR|MAPKBP1_uc010bci.2_Silent_p.P393P|MAPKBP1_uc010udb.1_Intron|MAPKBP1_uc010bck.2_5'UTR|MAPKBP1_uc010bcl.2_5'UTR	NM_001128608	NP_001122080	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein	399	WD 6.									central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		AGGTCTACCCCGAGGTGAAGG	0.572					360											0.474576	89.412002	89.443603	28	31	KEEP	---	---	---	---	17	11	14	21	-1	capture	Silent	SNP	42107465	42107465	MAPKBP1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9205	101
SLC9A5	6553	broad.mit.edu	37	16	67298319	67298319	+	Missense_Mutation	SNP	T	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67298319T>G	uc002esm.2	+	13	1970	c.1907T>G	c.(1906-1908)GTC>GGC	p.V636G	SLC9A5_uc010cee.2_Missense_Mutation_p.V341G|SLC9A5_uc010vji.1_Missense_Mutation_p.V140G	NM_004594	NP_004585	Q14940	SL9A5_HUMAN	solute carrier family 9 (sodium/hydrogen	636					regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			ovary(1)|pancreas(1)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		GACAAGGAGGTCTTCCAGCAG	0.587																0.157895	1.986632	6.526254	6	32	KEEP	---	---	---	---	7	11	21	19	-1	capture	Missense_Mutation	SNP	67298319	67298319	SLC9A5	16	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	14609	101
CAMKK1	84254	broad.mit.edu	37	17	3772866	3772866	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3772866G>A	uc002fwt.2	-	14	1350	c.1256C>T	c.(1255-1257)TCG>TTG	p.S419L	CAMKK1_uc002fwu.2_Missense_Mutation_p.S419L|CAMKK1_uc002fwv.2_Missense_Mutation_p.S457L	NM_172206	NP_757343	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase 1	419					synaptic transmission	cytosol|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)	1				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		CTCCTCCTCCGAAGGAAGGGG	0.632					485											0.07438	-2.624878	19.885121	9	112	KEEP	---	---	---	---	6	4	61	66	-1	capture	Missense_Mutation	SNP	3772866	3772866	CAMKK1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2582	101
MED13	9969	broad.mit.edu	37	17	60061549	60061549	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:60061549C>A	uc002izo.2	-	15	2948	c.2871G>T	c.(2869-2871)ATG>ATT	p.M957I		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	957					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						TGATGAATGGCATTGAAGGCC	0.378																0.463636	161.713243	161.84011	51	59	KEEP	---	---	---	---	23	37	20	45	0.616666666667	capture	Missense_Mutation	SNP	60061549	60061549	MED13	17	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	9343	101
CBX8	57332	broad.mit.edu	37	17	77769275	77769275	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77769275G>A	uc002jxd.1	-	5	422	c.329C>T	c.(328-330)TCG>TTG	p.S110L		NM_020649	NP_065700	Q9HC52	CBX8_HUMAN	chromobox homolog 8	110					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear chromatin|PcG protein complex	methylated histone residue binding				0			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GTCCTGGGGCGAGCGGCCAGG	0.657																0.461538	36.899187	36.932414	12	14	KEEP	---	---	---	---	7	7	8	8	-1	capture	Missense_Mutation	SNP	77769275	77769275	CBX8	17	G	A	A	A	1	0	0	0	0	1	0	0	0	470	37	1	1	2698	101
POTEC	388468	broad.mit.edu	37	18	14543019	14543019	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14543019T>C	uc010dln.2	-	1	581	c.127A>G	c.(127-129)ATG>GTG	p.M43V	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	43										skin(3)	3						GAAGTGCCCATGTTGCTCTTG	0.587																0.050562	-23.067653	15.188659	9	169	KEEP	---	---	---	---	6	5	106	85	-1	capture	Missense_Mutation	SNP	14543019	14543019	POTEC	18	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	12164	101
INO80C	125476	broad.mit.edu	37	18	33077703	33077703	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:33077703A>T	uc002kyy.3	-	1	253	c.136T>A	c.(136-138)TCC>ACC	p.S46T	INO80C_uc002kyw.1_Missense_Mutation_p.S46T|INO80C_uc002kyx.3_5'Flank|INO80C_uc010dmt.2_Missense_Mutation_p.S46T	NM_194281	NP_919257	Q6PI98	IN80C_HUMAN	Ies6-similar protein isoform 2	46					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex|MLL1 complex					0						CTGGAAGCGGACGCTTTTTTC	0.672																0.090909	1.102472	6.667922	3	30	KEEP	---	---	---	---	3	0	15	16	-1	capture	Missense_Mutation	SNP	33077703	33077703	INO80C	18	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	7671	101
POLI	11201	broad.mit.edu	37	18	51820790	51820790	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:51820790G>A	uc002lfj.3	+	10	2244	c.2176G>A	c.(2176-2178)GCA>ACA	p.A726T	POLI_uc010xds.1_Missense_Mutation_p.A647T|POLI_uc002lfk.3_Missense_Mutation_p.A623T|POLI_uc010dpg.2_Missense_Mutation_p.A322T	NM_007195	NP_009126	Q9UNA4	POLI_HUMAN	DNA polymerase iota	726					DNA repair|DNA replication	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding|protein binding			ovary(2)|kidney(1)	3				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		GGAACTGCTGGCAGAGTGGAA	0.388											DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					0.590909	83.855404	84.172452	26	18	KEEP	---	---	---	---	4	27	9	12	-1	capture	Missense_Mutation	SNP	51820790	51820790	POLI	18	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12106	101
DUS3L	56931	broad.mit.edu	37	19	5790075	5790075	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5790075A>C	uc002mdc.2	-	2	467	c.370T>G	c.(370-372)TGT>GGT	p.C124G	DUS3L_uc002mdd.2_Intron|DUS3L_uc010duk.2_5'UTR|DUS3L_uc010xiw.1_Intron	NM_020175	NP_064560	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like isoform 1	124	C3H1-type 1.				tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding				0						AGGGAGGGACACAGCCTGTTC	0.607																0.089552	5.799689	17.191256	6	61	KEEP	---	---	---	---	4	3	29	42	-1	capture	Missense_Mutation	SNP	5790075	5790075	DUS3L	19	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	4762	101
ADAMTS10	81794	broad.mit.edu	37	19	8651442	8651442	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8651442C>A	uc002mkj.1	-	20	2677	c.2403G>T	c.(2401-2403)ATG>ATT	p.M801I	ADAMTS10_uc002mki.1_Missense_Mutation_p.M288I|ADAMTS10_uc002mkk.1_Missense_Mutation_p.M433I	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	801	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						TCCCTGTTACCATGACGATGA	0.597														OREG0025221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.336957	89.188983	91.355965	31	61	KEEP	---	---	---	---	17	17	34	36	0.5	capture	Missense_Mutation	SNP	8651442	8651442	ADAMTS10	19	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	256	101
CDC37	11140	broad.mit.edu	37	19	10506731	10506731	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10506731A>T	uc002mof.1	-	2	367	c.251T>A	c.(250-252)CTG>CAG	p.L84Q	CDC37_uc002moe.1_5'Flank|CDC37_uc010dxf.1_5'UTR|CDC37_uc002mog.1_Missense_Mutation_p.L84Q|CDC37_uc002moh.2_Missense_Mutation_p.L84Q	NM_007065	NP_008996	Q16543	CDC37_HUMAN	cell division cycle 37 protein	84					protein targeting|regulation of cyclin-dependent protein kinase activity|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway		unfolded protein binding				0			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		CTCGGCCTGCAGGCGCTCCAG	0.662																0.432432	189.136183	189.730322	64	84	KEEP	---	---	---	---	30	39	45	49	-1	capture	Missense_Mutation	SNP	10506731	10506731	CDC37	19	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	3039	101
CC2D1A	54862	broad.mit.edu	37	19	14029731	14029731	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14029731C>A	uc002mxo.2	+	10	1324	c.1025C>A	c.(1024-1026)CCC>CAC	p.P342H	CC2D1A_uc002mxn.2_Missense_Mutation_p.P241H|CC2D1A_uc002mxp.2_Missense_Mutation_p.P342H|CC2D1A_uc010dzh.2_5'UTR|CC2D1A_uc002mxq.1_5'UTR	NM_017721	NP_060191	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	342	Pro-rich.				positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			CCAGAGGTGCCCCCACCCCCG	0.672																0.521739	32.014034	32.025247	12	11	KEEP	---	---	---	---	5	7	3	11	0.583333333333	capture	Missense_Mutation	SNP	14029731	14029731	CC2D1A	19	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	2700	101
MYO9B	4650	broad.mit.edu	37	19	17212559	17212559	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17212559G>A	uc010eak.2	+	2	184	c.32G>A	c.(31-33)CGC>CAC	p.R11H	MYO9B_uc002nfi.2_Missense_Mutation_p.R11H|MYO9B_uc002nfj.1_Missense_Mutation_p.R11H	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	11	Myosin head-like.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						AGCTCGGGCCGCCGGGAGCAG	0.692																0.75	18.753034	19.207402	6	2	KEEP	---	---	---	---	1	5	3	0	-1	capture	Missense_Mutation	SNP	17212559	17212559	MYO9B	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9995	101
C2orf16	84226	broad.mit.edu	37	2	27799823	27799823	+	Silent	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27799823G>A	uc002rkz.3	+	1	435	c.384G>A	c.(382-384)CAG>CAA	p.Q128Q		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	128										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					CAGGGCATCAGTTTGCAAAAT	0.403																0.345679	86.874522	88.57832	28	53	KEEP	---	---	---	---	12	19	26	33	-1	capture	Silent	SNP	27799823	27799823	C2orf16	2	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	2137	101
MAP4K3	8491	broad.mit.edu	37	2	39560698	39560698	+	Missense_Mutation	SNP	T	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:39560698T>G	uc002rro.2	-	7	523	c.432A>C	c.(430-432)TTA>TTC	p.L144F	MAP4K3_uc002rrp.2_Missense_Mutation_p.L144F	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase	144	Protein kinase.				JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				CATTATCCGTTAATAGAATGT	0.269					525											0.107143	9.110307	17.683194	6	50	KEEP	---	---	---	---	3	3	26	35	-1	capture	Missense_Mutation	SNP	39560698	39560698	MAP4K3	2	T	G	G	G	1	0	0	0	0	1	0	0	0	790	61	4	4	9175	101
BCL11A	53335	broad.mit.edu	37	2	60688972	60688972	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:60688972G>C	uc002sae.1	-	4	1303	c.1075C>G	c.(1075-1077)CCC>GCC	p.P359A	BCL11A_uc002sab.2_Missense_Mutation_p.P359A|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Missense_Mutation_p.P325A|BCL11A_uc002sad.1_Missense_Mutation_p.P207A|BCL11A_uc002saf.1_Missense_Mutation_p.P325A	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	359	Pro-rich.				negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GGAGGGAGGGGGGGCGTCGCC	0.632					131	T	IGH@	B-CLL								0.211009	48.258308	56.687796	23	86	KEEP	---	---	---	---	13	11	44	51	-1	capture	Missense_Mutation	SNP	60688972	60688972	BCL11A	2	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	1352	101
GPR45	11250	broad.mit.edu	37	2	105859160	105859160	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:105859160C>T	uc002tco.1	+	1	961	c.845C>T	c.(844-846)CCC>CTC	p.P282L		NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	282	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						TGCTGGCTGCCCCACTCCGTC	0.592																0.324427	243.918034	251.122527	85	177	KEEP	---	---	---	---	42	49	89	102	-1	capture	Missense_Mutation	SNP	105859160	105859160	GPR45	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	6629	101
HCK	3055	broad.mit.edu	37	20	30661155	30661155	+	Missense_Mutation	SNP	A	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30661155A>T	uc002wxh.2	+	3	388	c.217A>T	c.(217-219)ATC>TTC	p.I73F	HCK_uc010gdy.2_Missense_Mutation_p.I52F|HCK_uc002wxi.2_Missense_Mutation_p.I52F	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	73					interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CACACCAGGAATCAGGGAGGG	0.468					262											0.275862	43.977136	46.599094	16	42	KEEP	---	---	---	---	9	9	23	24	-1	capture	Missense_Mutation	SNP	30661155	30661155	HCK	20	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	6920	101
R3HDML	140902	broad.mit.edu	37	20	42973947	42973947	+	Silent	SNP	C	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42973947C>T	uc002xls.1	+	4	730	c.558C>T	c.(556-558)ACC>ACT	p.T186T		NM_178491	NP_848586	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like precursor	186						extracellular region	peptidase inhibitor activity				0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			CCATCCACACCTGTAGTAGCA	0.582																0.064103	-11.676461	34.572759	15	219	KEEP	---	---	---	---	5	13	102	154	-1	capture	Silent	SNP	42973947	42973947	R3HDML	20	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	12784	101
SEMG2	6407	broad.mit.edu	37	20	43851147	43851147	+	Missense_Mutation	SNP	C	T	T	rs140069155		TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43851147C>T	uc010ggz.2	+	2	931	c.874C>T	c.(874-876)CGT>TGT	p.R292C	SEMG2_uc002xnk.2_Missense_Mutation_p.R292C|SEMG2_uc002xnl.2_Missense_Mutation_p.R292C	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	292	Repeat-rich region.|4 X 60 AA tandem repeats, type I.				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				CCCGTCTTCACGTACAGAAGA	0.393																0.408451	87.858588	88.378937	29	42	KEEP	---	---	---	---	14	15	13	31	-1	capture	Missense_Mutation	SNP	43851147	43851147	SEMG2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13938	101
LZTR1	8216	broad.mit.edu	37	22	21349003	21349003	+	Missense_Mutation	SNP	T	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21349003T>G	uc002zto.2	+	15	1875	c.1772T>G	c.(1771-1773)CTG>CGG	p.L591R	LZTR1_uc002ztn.2_Missense_Mutation_p.L550R|LZTR1_uc011ahy.1_Missense_Mutation_p.L572R|LZTR1_uc002ztp.2_5'Flank	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	591					anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CGGCTGCAGCTGAGCCAACTC	0.667					1299											0.121951	6.044888	11.788663	5	36	KEEP	---	---	---	---	5	0	21	21	-1	capture	Missense_Mutation	SNP	21349003	21349003	LZTR1	22	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	9052	101
PPIL2	23759	broad.mit.edu	37	22	22042378	22042378	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22042378C>A	uc010gtj.1	+	14	1120	c.1004C>A	c.(1003-1005)CCC>CAC	p.P335H	PPIL2_uc002zvh.3_Missense_Mutation_p.P335H|PPIL2_uc002zvi.3_Missense_Mutation_p.P335H|PPIL2_uc002zvg.3_Missense_Mutation_p.P335H|PPIL2_uc011aij.1_Missense_Mutation_p.P314H|PPIL2_uc002zvk.3_Missense_Mutation_p.P81H	NM_148175	NP_680480	Q13356	PPIL2_HUMAN	peptidylprolyl isomerase-like 2 isoform a	335	PPIase cyclophilin-type.				blood coagulation|leukocyte migration|protein folding|protein polyubiquitination	Golgi lumen|nucleus|ubiquitin ligase complex	peptidyl-prolyl cis-trans isomerase activity|ubiquitin-ubiquitin ligase activity			ovary(2)	2	Colorectal(54;0.105)					GGGGGCGACCCCACAGGCACA	0.642																0.178218	67.235422	86.998865	36	166	KEEP	---	---	---	---	29	16	102	90	0.355555555556	capture	Missense_Mutation	SNP	22042378	22042378	PPIL2	22	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	12228	101
PRRT3	285368	broad.mit.edu	37	3	9989638	9989638	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9989638G>A	uc003bul.2	-	4	1349	c.1219C>T	c.(1219-1221)CCC>TCC	p.P407S	CIDEC_uc003bto.2_Intron|PRRT3_uc003buk.2_RNA	NM_207351	NP_997234	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3 precursor	407	Extracellular (Potential).|Pro-rich.					integral to membrane					0						TGGACTGGGGGTGCTGGGGGA	0.607																0.277778	10.763207	11.56621	5	13	KEEP	---	---	---	---	2	4	8	7	-1	capture	Missense_Mutation	SNP	9989638	9989638	PRRT3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	12506	101
MUC7	4589	broad.mit.edu	37	4	71346565	71346565	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71346565A>G	uc011cat.1	+	4	392	c.104A>G	c.(103-105)CAT>CGT	p.H35R	MUC7_uc011cau.1_Missense_Mutation_p.H35R|MUC7_uc003hfj.2_Missense_Mutation_p.H35R|uc011cav.1_RNA	NM_001145006	NP_001138478	Q8TAX7	MUC7_HUMAN	mucin 7, secreted precursor	35						extracellular region	protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4			Lung(101;0.211)			AGAAGGCATCATCACCAATCA	0.318																0.171429	38.388877	49.102265	18	87	KEEP	---	---	---	---	14	10	48	47	-1	capture	Missense_Mutation	SNP	71346565	71346565	MUC7	4	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	9891	101
RASGEF1B	153020	broad.mit.edu	37	4	82380500	82380500	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:82380500C>A	uc003hmi.1	-	2	307	c.163G>T	c.(163-165)GAT>TAT	p.D55Y	RASGEF1B_uc003hmj.1_Missense_Mutation_p.D55Y|RASGEF1B_uc010ijq.1_Missense_Mutation_p.D55Y|RASGEF1B_uc003hmk.2_Missense_Mutation_p.D55Y	NM_152545	NP_689758	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B	55	N-terminal Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						GGATAGTAATCCACATTAGGT	0.443																0.028571	-27.309839	6.931865	4	136	KEEP	---	---	---	---	5	0	74	87	-1	capture	Missense_Mutation	SNP	82380500	82380500	RASGEF1B	4	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	12965	101
FNIP2	57600	broad.mit.edu	37	4	159790265	159790265	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159790265C>G	uc003iqe.3	+	13	2660	c.2477C>G	c.(2476-2478)GCA>GGA	p.A826G		NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	826	Interaction with PRKAA1.				DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TCCCACGGTGCAGGAGGAACG	0.607																0.389535	227.116147	228.94445	67	105	KEEP	---	---	---	---	35	36	57	56	-1	capture	Missense_Mutation	SNP	159790265	159790265	FNIP2	4	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	5920	101
NEK1	4750	broad.mit.edu	37	4	170345795	170345795	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:170345795C>A	uc003isb.1	-	29	3539	c.3047G>T	c.(3046-3048)CGA>CTA	p.R1016L	NEK1_uc003isc.1_Missense_Mutation_p.R972L|NEK1_uc003isd.1_Missense_Mutation_p.R1044L|NEK1_uc003ise.1_Missense_Mutation_p.R1000L|NEK1_uc003isf.1_Missense_Mutation_p.R947L	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	1016					cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		CGAGTGAGATCGAAATGCAAA	0.398					366											0.25	24.069384	26.106783	9	27	KEEP	---	---	---	---	5	5	14	15	0.5	capture	Missense_Mutation	SNP	170345795	170345795	NEK1	4	C	A	A	A	1	0	0	0	0	1	0	0	0	403	31	4	4	10228	101
SLC9A3	6550	broad.mit.edu	37	5	481703	481703	+	Silent	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:481703G>A	uc003jbe.2	-	9	1606	c.1494C>T	c.(1492-1494)ATC>ATT	p.I498I	SLC9A3_uc011clx.1_Silent_p.I489I	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen	498	Cytoplasmic (Potential).					cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			AATTGTGCCCGATCTGTCCGG	0.582																0.095808	21.39451	76.0874	32	302	KEEP	---	---	---	---	21	20	154	195	-1	capture	Silent	SNP	481703	481703	SLC9A3	5	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	14605	101
NSUN2	54888	broad.mit.edu	37	5	6600309	6600309	+	Silent	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:6600309G>A	uc003jdu.2	-	19	2099	c.2034C>T	c.(2032-2034)TGC>TGT	p.C678C	NSUN2_uc003jds.2_Silent_p.C124C|NSUN2_uc003jdt.2_Silent_p.C442C|NSUN2_uc011cmk.1_Silent_p.C643C|NSUN2_uc003jdv.2_Silent_p.C442C	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	678						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						CCCGCCATCCGCATAAGACGA	0.458																0.075472	-2.9273	6.876492	4	49	KEEP	---	---	---	---	1	3	21	37	-1	capture	Silent	SNP	6600309	6600309	NSUN2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	10585	101
MYO10	4651	broad.mit.edu	37	5	16668401	16668401	+	Silent	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:16668401G>A	uc003jft.3	-	40	6528	c.6060C>T	c.(6058-6060)CTC>CTT	p.L2020L	MYO10_uc011cnb.1_Silent_p.L649L|MYO10_uc011cnc.1_Silent_p.L899L|MYO10_uc011cnd.1_Silent_p.L1377L|MYO10_uc011cne.1_Silent_p.L1377L|MYO10_uc010itx.2_Silent_p.L1642L	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	2020	FERM.				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						TGGTTTCAAAGAGCAGCTCCC	0.463																0.497268	301.519594	301.520801	91	92	KEEP	---	---	---	---	62	50	49	60	-1	capture	Silent	SNP	16668401	16668401	MYO10	5	G	A	A	A	1	0	0	0	0	0	0	0	1	418	33	2	2	9972	101
HIST1H2AA	221613	broad.mit.edu	37	6	25726579	25726579	+	Silent	SNP	G	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:25726579G>T	uc003nfc.2	-	1	212	c.177C>A	c.(175-177)CTC>CTA	p.L59L	HIST1H2BA_uc003nfd.2_5'Flank	NM_170745	NP_734466	Q96QV6	H2A1A_HUMAN	histone cluster 1, H2aa	59					nucleosome assembly	nucleosome|nucleus	DNA binding				0						TTTCTGCTGTGAGATACTCTA	0.537																0.755102	117.892506	120.75391	37	12	KEEP	---	---	---	---	14	27	4	8	0.341463414634	capture	Silent	SNP	25726579	25726579	HIST1H2AA	6	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	7053	101
PSMB8	5696	broad.mit.edu	37	6	32811722	32811722	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32811722C>T	uc003oce.2	-	1	95	c.52G>A	c.(52-54)GCT>ACT	p.A18T	PSMB8_uc003ocf.2_Intron|PSMB8_uc011dqh.1_Missense_Mutation_p.A18T	NM_148919	NP_683720	P28062	PSB8_HUMAN	proteasome beta 8 subunit isoform E2 proprotein	18					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|type I interferon-mediated signaling pathway|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			skin(1)	1						ACCGGGAGAGCCGATTCCGGC	0.637	NSCLC(48;53 1172 10859 13624 22883)															0.037383	-17.185702	7.602756	4	103	KEEP	---	---	---	---	1	3	51	74	-1	capture	Missense_Mutation	SNP	32811722	32811722	PSMB8	6	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12578	101
CPVL	54504	broad.mit.edu	37	7	29152433	29152433	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:29152433C>T	uc003szv.2	-	3	294	c.175G>A	c.(175-177)GAA>AAA	p.E59K	CPVL_uc003szw.2_Missense_Mutation_p.E59K|CPVL_uc003szx.2_Missense_Mutation_p.E59K	NM_031311	NP_112601	Q9H3G5	CPVL_HUMAN	serine carboxypeptidase vitellogenic-like	59					proteolysis		protein binding|serine-type carboxypeptidase activity			ovary(2)	2						AAACTCAATTCTCTTCCTAGT	0.418																0.041096	-9.739733	6.799462	3	70	KEEP	---	---	---	---	2	1	44	34	-1	capture	Missense_Mutation	SNP	29152433	29152433	CPVL	7	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	3800	101
MYO1G	64005	broad.mit.edu	37	7	45016656	45016656	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45016656C>T	uc003tmh.2	-	2	254	c.110G>A	c.(109-111)CGC>CAC	p.R37H	MYO1G_uc003tmg.2_5'Flank|MYO1G_uc010kym.2_Intron|MYO1G_uc003tmi.1_5'UTR|MYO1G_uc003tmj.2_5'UTR	NM_033054	NP_149043	B0I1T2	MYO1G_HUMAN	myosin IG	37	Myosin head-like.					myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity			breast(2)|ovary(1)|pancreas(1)	4						GGTGTAGATGCGGCCCTTCTC	0.637																0.141026	18.092947	27.774861	11	67	KEEP	---	---	---	---	6	8	39	33	-1	capture	Missense_Mutation	SNP	45016656	45016656	MYO1G	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9984	101
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	T	T	rs149840192		TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>T	uc003tqk.2	+	7	1112	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592			8	p.A289V(HEC6-Tumor)|p.A289D(HS683-Tumor)|p.A289V(RL952-Tumor)	608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.542735	1602.925986	1604.422607	508	428	KEEP	---	---	---	---	272	281	198	249	-1	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	101
POM121	9883	broad.mit.edu	37	7	72413475	72413475	+	Silent	SNP	G	A	A			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72413475G>A	uc003twk.2	+	11	2943	c.2943G>A	c.(2941-2943)GGG>GGA	p.G981G	POM121_uc003twj.2_Silent_p.G716G|POM121_uc010lam.1_Silent_p.G716G	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	981	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				AGCCACCGGGGGCCGCCAAGC	0.652																0.04	-24.87261	9.440787	6	144	KEEP	---	---	---	---	0	8	78	89	-1	capture	Silent	SNP	72413475	72413475	POM121	7	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	12141	101
ZC3HAV1L	92092	broad.mit.edu	37	7	138719356	138719356	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138719356A>G	uc003vum.1	-	2	446	c.434T>C	c.(433-435)CTT>CCT	p.L145P		NM_080660	NP_542391	Q96H79	ZCCHL_HUMAN	zinc finger CCCH-type, antiviral 1-like	145											0						GAGACCAAAAAGTCCATGGCT	0.483																0.384615	121.407279	122.468286	35	56	KEEP	---	---	---	---	16	20	32	31	-1	capture	Missense_Mutation	SNP	138719356	138719356	ZC3HAV1L	7	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	17456	101
RP1L1	94137	broad.mit.edu	37	8	10467546	10467546	+	Silent	SNP	C	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:10467546C>T	uc003wtc.2	-	4	4291	c.4062G>A	c.(4060-4062)GCG>GCA	p.A1354A		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1354					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		cctctaactgcgcctcttctt	0.179																0.393939	153.055629	154.359152	52	80	KEEP	---	---	---	---	28	37	23	58	-1	capture	Silent	SNP	10467546	10467546	RP1L1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	13425	101
CDC37L1	55664	broad.mit.edu	37	9	4679887	4679887	+	Silent	SNP	C	G	G			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:4679887C>G	uc003zio.2	+	1	330	c.120C>G	c.(118-120)GGC>GGG	p.G40G		NM_017913	NP_060383	Q7L3B6	CD37L_HUMAN	cell division cycle 37 homolog (S.	40	Self-association.					cytoplasm					0	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		AGCTGCCAGGCGGCGGCGCCC	0.682														OREG0019085	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.233645	69.826848	76.769558	25	82	KEEP	---	---	---	---	15	13	52	47	-1	capture	Silent	SNP	4679887	4679887	CDC37L1	9	C	G	G	G	1	0	0	0	0	0	0	0	1	340	27	4	4	3040	101
KIAA2026	158358	broad.mit.edu	37	9	5922764	5922764	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:5922764G>T	uc003zjq.3	-	8	3448	c.3232C>A	c.(3232-3234)CTT>ATT	p.L1078I	KIAA2026_uc010mht.2_Missense_Mutation_p.L253I	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	1078										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		CTATTTTGAAGATCTATTGGC	0.418																0.657407	217.527016	219.855996	71	37	KEEP	---	---	---	---	33	42	20	23	0.44	capture	Missense_Mutation	SNP	5922764	5922764	KIAA2026	9	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	8192	101
C9orf131	138724	broad.mit.edu	37	9	35044886	35044886	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35044886T>C	uc003zvw.2	+	2	2289	c.2260T>C	c.(2260-2262)TGC>CGC	p.C754R	C9orf131_uc003zvu.2_Missense_Mutation_p.C706R|C9orf131_uc003zvv.2_Missense_Mutation_p.C681R|C9orf131_uc003zvx.2_Missense_Mutation_p.C719R	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	754											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			GGGAGTAACGTGCCCAGGGGT	0.587																0.387097	150.67183	152.056565	48	76	KEEP	---	---	---	---	19	33	35	51	-1	capture	Missense_Mutation	SNP	35044886	35044886	C9orf131	9	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	2434	101
FBP1	2203	broad.mit.edu	37	9	97380079	97380079	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:97380079C>T	uc004auw.3	-	3	728	c.397G>A	c.(397-399)GTT>ATT	p.V133I	FBP1_uc010mrl.2_Missense_Mutation_p.V133I	NM_000507	NP_000498	P09467	F16P1_HUMAN	fructose-1,6-bisphosphatase 1	133					gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)			Adenosine monophosphate(DB00131)	ATGGTTCCAACGGACACAAGG	0.388	Ovarian(142;590 2466 25593 44496)															0.118644	8.802292	17.213112	7	52	KEEP	---	---	---	---	4	4	27	31	-1	capture	Missense_Mutation	SNP	97380079	97380079	FBP1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5651	101
ZFX	7543	broad.mit.edu	37	X	24229156	24229156	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:24229156A>C	uc004dbf.2	+	9	2339	c.2081A>C	c.(2080-2082)CAT>CCT	p.H694P	ZFX_uc004dbe.2_3'UTR|ZFX_uc011mjv.1_Missense_Mutation_p.H733P|ZFX_uc010nfz.2_Missense_Mutation_p.H350P	NM_003410	NP_003401	P17010	ZFX_HUMAN	zinc finger protein, X-linked	694	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(2)	2						CAGTGTAGACATTGTGACTTT	0.433	Esophageal Squamous(20;306 562 7346 32868 37983)															0.886957	399.539788	416.539027	102	13	KEEP	---	---	---	---	46	62	5	8	-1	capture	Missense_Mutation	SNP	24229156	24229156	ZFX	23	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	17541	101
HDAC6	10013	broad.mit.edu	37	X	48681101	48681101	+	Silent	SNP	A	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48681101A>C	uc011mmi.1	+	24	2504	c.2409A>C	c.(2407-2409)CCA>CCC	p.P803P	HDAC6_uc004dks.1_Silent_p.P803P|HDAC6_uc010nig.1_Silent_p.P651P|HDAC6_uc004dkt.1_Silent_p.P803P|HDAC6_uc011mmk.1_Silent_p.P784P|HDAC6_uc004dkv.1_Silent_p.P451P|HDAC6_uc004dkw.1_Silent_p.P451P|HDAC6_uc004dkx.1_Silent_p.P166P	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	803					aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	GAGACCCACCACCCCTGCTGA	0.587	Pancreas(112;205 1675 2305 8976 15959)				170											0.230769	5.553697	7.38174	6	20	KEEP	---	---	---	---	3	9	13	8	-1	capture	Silent	SNP	48681101	48681101	HDAC6	23	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	6938	101
IL1RAPL2	26280	broad.mit.edu	37	X	105011638	105011638	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105011638C>T	uc004elz.1	+	11	2801	c.2045C>T	c.(2044-2046)ACC>ATC	p.T682I		NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	682	Cytoplasmic (Potential).				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3						CTTAGCTTTACCAGTGATATT	0.393																0.270833	35.759885	38.029516	13	35	KEEP	---	---	---	---	8	5	18	20	-1	capture	Missense_Mutation	SNP	105011638	105011638	IL1RAPL2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	7585	101
L1CAM	3897	broad.mit.edu	37	X	153141260	153141260	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153141260A>C	uc004fjb.2	-	1	140	c.32T>G	c.(31-33)CTC>CGC	p.L11R	L1CAM_uc004fjc.2_Missense_Mutation_p.L11R|L1CAM_uc010nuo.2_Missense_Mutation_p.L11R|L1CAM_uc004fje.1_Missense_Mutation_p.L11R	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	11					axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCAGAGGAGGAGAGGCCACAC	0.627														OREG0003586	type=REGULATORY REGION|Gene=L1CAM|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.678571	64.133701	64.926467	19	9	KEEP	---	---	---	---	11	11	5	4	-1	capture	Missense_Mutation	SNP	153141260	153141260	L1CAM	23	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	8508	101
ZMYM1	79830	broad.mit.edu	37	1	35580838	35580841	+	Frame_Shift_Del	DEL	TCAG	-	-			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:35580838_35580841delTCAG	uc001bym.2	+	11	3555_3558	c.3407_3410delTCAG	c.(3406-3411)ATCAGTfs	p.I1136fs	ZMYM1_uc001byn.2_Frame_Shift_Del_p.I1136fs|ZMYM1_uc010ohu.1_Frame_Shift_Del_p.I1117fs|ZMYM1_uc001byo.2_Frame_Shift_Del_p.I776fs|ZMYM1_uc009vut.2_Frame_Shift_Del_p.I1061fs	NM_024772	NP_079048	Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM domain containing 1	1136_1137						nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GAAAAGTTTATCAGTCAGATGAAA	0.348																0.29			16	39		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	35580838	35580841	ZMYM1	1	TCAG	-	-	-	1	0	1	0	1	0	0	0	0	650	50	5	5	17579	101
NUFIP2	57532	broad.mit.edu	37	17	27620990	27620992	+	In_Frame_Del	DEL	GCT	-	-			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27620990_27620992delGCT	uc002hdy.3	-	1	175_177	c.86_88delAGC	c.(85-90)CAGCCG>CCG	p.Q29del	NUFIP2_uc002hdx.3_In_Frame_Del_p.Q29del	NM_020772	NP_065823	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein	29	His-rich.					nucleus|polysomal ribosome	protein binding|RNA binding			skin(2)|ovary(1)|breast(1)	4			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			tggtggtgcggctgctgctgctg	0.251																0.03			7	203		---	---	---	---						capture_indel	In_Frame_Del	DEL	27620990	27620992	NUFIP2	17	GCT	-	-	-	1	0	1	0	1	0	0	0	0	546	42	5	5	10656	101
SCAF1	58506	broad.mit.edu	37	19	50155916	50155918	+	In_Frame_Del	DEL	CCT	-	-			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50155916_50155918delCCT	uc002poq.2	+	7	2394_2396	c.2270_2272delCCT	c.(2269-2274)GCCTCC>GCC	p.S763del		NM_021228	NP_067051	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	763	Ser-rich.				mRNA processing|RNA splicing	nucleus	RNA binding				0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		TCGGGGGCCGCCTCCTCCTCCTC	0.562																0.33			2	4		---	---	---	---						capture_indel	In_Frame_Del	DEL	50155916	50155918	SCAF1	19	CCT	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	13760	101
SCUBE3	222663	broad.mit.edu	37	6	35210070	35210072	+	In_Frame_Del	DEL	GAG	-	-			TCGA-06-5856-01	TCGA-06-5856-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35210070_35210072delGAG	uc003okf.1	+	13	1513_1515	c.1507_1509delGAG	c.(1507-1509)GAGdel	p.E504del	SCUBE3_uc003okg.1_In_Frame_Del_p.E503del|SCUBE3_uc003okh.1_In_Frame_Del_p.E391del	NM_152753	NP_689966	Q8IX30	SCUB3_HUMAN	signal peptide, CUB domain, EGF-like 3	504					protein heterooligomerization|protein homooligomerization	cell surface|extracellular region	calcium ion binding|protein binding			skin(1)	1						AGGCAAAACAGAGGAGGCTGGCA	0.547																0.07			7	100		---	---	---	---						capture_indel	In_Frame_Del	DEL	35210070	35210072	SCUBE3	6	GAG	-	-	-	1	0	1	0	1	0	0	0	0	429	33	5	5	13839	101
