Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
C1orf172	126695	broad.mit.edu	37	1	27278819	27278819	+	Missense_Mutation	SNP	G	A	A	rs145806681	byFrequency	TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:27278819G>A	uc001bni.1	-	2	142	c.53C>T	c.(52-54)CCG>CTG	p.P18L		NM_152365	NP_689578	Q8NAX2	CA172_HUMAN	hypothetical protein LOC126695	18	Pro-rich.									large_intestine(1)|ovary(1)	2		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		CCGCTCCCACGGTCCCAAGCG	0.652																0.173913	42.83664	54.372016	20	95	KEEP	---	---	---	---	15	8	60	52	-1	capture	Missense_Mutation	SNP	27278819	27278819	C1orf172	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1995	105
AHDC1	27245	broad.mit.edu	37	1	27876436	27876436	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:27876436C>A	uc009vsy.2	-	6	3160	c.2191G>T	c.(2191-2193)GTA>TTA	p.V731L	AHDC1_uc009vsz.1_Missense_Mutation_p.V731L	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	731	Gly-rich.						DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		ACAGCGTCTACCTCCCCCCGG	0.662																0.205882	16.605401	19.333113	7	27	KEEP	---	---	---	---	3	4	17	15	0.571428571429	capture	Missense_Mutation	SNP	27876436	27876436	AHDC1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	412	105
LAMC2	3918	broad.mit.edu	37	1	183177131	183177131	+	Silent	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183177131C>T	uc001gqa.2	+	2	509	c.195C>T	c.(193-195)TGC>TGT	p.C65C	LAMC2_uc001gpz.3_Silent_p.C65C|LAMC2_uc010poa.1_5'UTR	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	65	Laminin EGF-like 1.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						GCATTCACTGCGAGAAGTGCA	0.493																0.396867	450.631848	454.192147	152	231	KEEP	---	---	---	---	77	103	129	142	-1	capture	Silent	SNP	183177131	183177131	LAMC2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	8535	105
NEK2	4751	broad.mit.edu	37	1	211836944	211836944	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:211836944C>T	uc001hir.1	-	8	1308	c.1162G>A	c.(1162-1164)GGG>AGG	p.G388R	NEK2_uc001hiq.1_Missense_Mutation_p.G380R	NM_002497	NP_002488	P51955	NEK2_HUMAN	NIMA-related kinase 2	388	Necessary for interaction with MAD1L1.|Interaction with PCNT.				cell division|centrosome separation|G2/M transition of mitotic cell cycle|meiosis|protein autophosphorylation|regulation of mitosis	centrosome|condensed chromosome kinetochore|cytosol|nucleolus	ATP binding|metal ion binding|protein binding|protein phosphatase binding|protein serine/threonine kinase activity			breast(2)|stomach(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.00203)|all cancers(67;0.0339)|Epithelial(68;0.0546)		TTACTTTCCCCACTGAAATGA	0.403																0.107143	6.106786	14.684287	6	50	KEEP	---	---	---	---	5	2	30	28	-1	capture	Missense_Mutation	SNP	211836944	211836944	NEK2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	10231	105
OR2W5	441932	broad.mit.edu	37	1	247655038	247655038	+	Silent	SNP	G	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247655038G>A	uc001icz.1	+	1	609	c.609G>A	c.(607-609)GGG>GGA	p.G203G		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	203					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TTTGCCCTGGGGGTGGCTCTC	0.572																0.073171	-2.600723	35.771013	15	190	KEEP	---	---	---	---	7	10	97	113	-1	capture	Silent	SNP	247655038	247655038	OR2W5	1	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	10938	105
OR2L2	26246	broad.mit.edu	37	1	248202130	248202130	+	Silent	SNP	C	G	G			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248202130C>G	uc001idw.2	+	1	657	c.561C>G	c.(559-561)GCC>GCG	p.A187A	OR2L13_uc001ids.2_Intron	NM_001004686	NP_001004686	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L,	187	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TGACGCTAGCCTGCACAGACA	0.458																0.063197	-18.725821	34.722459	17	252	KEEP	---	---	---	---	8	9	127	160	-1	capture	Silent	SNP	248202130	248202130	OR2L2	1	C	G	G	G	1	0	0	0	0	0	0	0	1	301	24	4	4	10911	105
CDH23	64072	broad.mit.edu	37	10	73544851	73544851	+	Silent	SNP	T	C	C			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:73544851T>C	uc001jrx.3	+	41	6083	c.5706T>C	c.(5704-5706)AAT>AAC	p.N1902N		NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	1902	Cadherin 18.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						TCTTCATCAATGCCACGGTAG	0.597																0.191176	26.534275	32.596538	13	55	KEEP	---	---	---	---	6	10	29	32	-1	capture	Silent	SNP	73544851	73544851	CDH23	10	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	3079	105
RGR	5995	broad.mit.edu	37	10	86017694	86017694	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:86017694C>T	uc001kdc.1	+	6	714	c.676C>T	c.(676-678)CCC>TCC	p.P226S	RGR_uc001kdd.1_Missense_Mutation_p.P230S|RGR_uc001kde.1_Intron	NM_001012720	NP_001012738	P47804	RGR_HUMAN	retinal G-protein coupled receptor isoform 2	226	Helical; Name=6; (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity|protein binding			ovary(1)	1						CGGCTGGGGCCCCTATGCCAT	0.542	NSCLC(15;204 545 5889 6385 32445)															0.316667	55.799991	57.595294	19	41	KEEP	---	---	---	---	11	12	25	29	-1	capture	Missense_Mutation	SNP	86017694	86017694	RGR	10	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	13183	105
ABCC9	10060	broad.mit.edu	37	12	21968799	21968799	+	Silent	SNP	T	G	G			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21968799T>G	uc001rfi.1	-	32	3941	c.3921A>C	c.(3919-3921)CCA>CCC	p.P1307P	ABCC9_uc001rfh.2_Silent_p.P1307P|ABCC9_uc001rfj.1_Silent_p.P1271P	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1307	Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CCCCTTCTTGTGGCCAATGTT	0.383																0.431138	244.610657	245.311527	72	95	KEEP	---	---	---	---	38	42	53	56	-1	capture	Silent	SNP	21968799	21968799	ABCC9	12	T	G	G	G	1	0	0	0	0	0	0	0	1	756	59	4	4	59	105
CYP1A2	1544	broad.mit.edu	37	15	75042134	75042134	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75042134G>A	uc002ayr.1	+	2	119	c.55G>A	c.(55-57)GCC>ACC	p.A19T		NM_000761	NP_000752	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A,	19					alkaloid metabolic process|exogenous drug catabolic process|methylation|monocarboxylic acid metabolic process|monoterpenoid metabolic process|oxidative deethylation|oxidative demethylation|steroid catabolic process|toxin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|demethylase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding			ovary(3)|breast(1)	4					Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Aciclovir(DB00787)|Alosetron(DB00969)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Anagrelide(DB00261)|Azelastine(DB00972)|Bortezomib(DB00188)|Caffeine(DB00201)|Carmustine(DB00262)|Chlordiazepoxide(DB00475)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Ciprofloxacin(DB00537)|Clomipramine(DB01242)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Desloratadine(DB00967)|Diazepam(DB00829)|Dibucaine(DB00527)|Diclofenac(DB00586)|Duloxetine(DB00476)|Enoxacin(DB00467)|Esomeprazole(DB00736)|Estradiol(DB00783)|Estrone(DB00655)|Fluorouracil(DB00544)|Flutamide(DB00499)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Grepafloxacin(DB00365)|Haloperidol(DB00502)|Hesperetin(DB01094)|Imipramine(DB00458)|Ketoconazole(DB01026)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Melatonin(DB01065)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mirtazapine(DB00370)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pefloxacin(DB00487)|Pimozide(DB01100)|Propafenone(DB01182)|Propranolol(DB00571)|Quinidine(DB00908)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifampin(DB01045)|Riluzole(DB00740)|Rofecoxib(DB00533)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Tacrine(DB00382)|Telithromycin(DB00976)|Terfenadine(DB00342)|Theophylline(DB00277)|Thiabendazole(DB00730)|Tizanidine(DB00697)|Tolbutamide(DB01124)|Verapamil(DB00661)|Warfarin(DB00682)|Zileuton(DB00744)|Zolmitriptan(DB00315)	CCTGGCCTCTGCCATCTTCTG	0.587					140											0.057762	-26.743492	30.107599	16	261	KEEP	---	---	---	---	11	7	155	137	-1	capture	Missense_Mutation	SNP	75042134	75042134	CYP1A2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4110	105
DNAH3	55567	broad.mit.edu	37	16	21080790	21080790	+	Silent	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21080790C>T	uc010vbe.1	-	23	3327	c.3327G>A	c.(3325-3327)GAG>GAA	p.E1109E		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1109	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		ATTTCCTCCCCTCTTCTGGCA	0.428																0.171429	39.780043	50.500174	18	87	KEEP	---	---	---	---	8	10	57	41	-1	capture	Silent	SNP	21080790	21080790	DNAH3	16	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	4560	105
HYDIN	54768	broad.mit.edu	37	16	70977832	70977832	+	Silent	SNP	G	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:70977832G>A	uc002ezr.2	-	42	6677	c.6549C>T	c.(6547-6549)CCC>CCT	p.P2183P		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	2184										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				TGGGCCCCGGGGGGAGAGGGC	0.368																0.214286	6.215525	7.272872	3	11	KEEP	---	---	---	---	3	2	8	4	-1	capture	Silent	SNP	70977832	70977832	HYDIN	16	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	7392	105
C16orf3	750	broad.mit.edu	37	16	90095609	90095609	+	Missense_Mutation	SNP	C	T	T	rs76322535		TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:90095609C>T	uc002fqk.1	-	1	701	c.142G>A	c.(142-144)GTA>ATA	p.V48I	GAS8_uc010vps.1_Intron|GAS8_uc002fqh.2_Intron|GAS8_uc010vpt.1_Intron|GAS8_uc010vpu.1_Intron|GAS8_uc010vpv.1_Intron|GAS8_uc010cjc.1_Intron|GAS8_uc002fqi.1_Intron|GAS8_uc010vpw.1_Intron|GAS8_uc002fqj.1_Intron	NM_001214	NP_001205	O95177	CP003_HUMAN	hypothetical protein LOC750	48											0		all_cancers(9;9.01e-08)|Hepatocellular(780;0.000325)|Lung NSC(15;0.0104)|all_lung(18;0.0239)		BRCA - Breast invasive adenocarcinoma(80;0.0272)		gggcagcctacggggcaggct	0.303																0.571429	49.501612	49.625778	16	12	KEEP	---	---	---	---	12	4	8	8	-1	capture	Missense_Mutation	SNP	90095609	90095609	C16orf3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1798	105
TP53	7157	broad.mit.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	C	C	rs121912666		TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578190T>C	uc002gim.2	-	6	853	c.659A>G	c.(658-660)TAT>TGT	p.Y220C	TP53_uc002gig.1_Missense_Mutation_p.Y220C|TP53_uc002gih.2_Missense_Mutation_p.Y220C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y88C|TP53_uc010cng.1_Missense_Mutation_p.Y88C|TP53_uc002gii.1_Missense_Mutation_p.Y88C|TP53_uc010cnh.1_Missense_Mutation_p.Y220C|TP53_uc010cni.1_Missense_Mutation_p.Y220C|TP53_uc002gij.2_Missense_Mutation_p.Y220C|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.Y127C|TP53_uc002gio.2_Missense_Mutation_p.Y88C|TP53_uc010vug.1_Missense_Mutation_p.Y181C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	220	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> N (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y220C(205)|p.Y220N(12)|p.Y220H(9)|p.Y220S(9)|p.0?(7)|p.Y220fs*27(4)|p.Y220*(3)|p.Y220D(2)|p.Y127C(2)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.?(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*1(1)|p.Y220fs*2(1)|p.V218fs*26(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGGCGGCTCATAGGGCACCAC	0.557	Pancreas(47;798 1329 9957 10801)		111	p.Y220C(HCC2935-Tumor)|p.Y220C(BXPC3-Tumor)|p.Y220C(HCC366-Tumor)|p.Y220C(TE8-Tumor)|p.Y220C(NUGC3-Tumor)|p.Y220C(HUH7-Tumor)|p.Y220C(COV362-Tumor)|p.Y220C(HCC1419-Tumor)|p.Y220C(MFE319-Tumor)|p.Y220C(T3M4-Tumor)|p.Y220C(NCIH2342-Tumor)|p.Y220C(MFE296-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.916667	128.930736	135.057559	33	3	KEEP	---	---	---	---	18	18	0	3	-1	capture	Missense_Mutation	SNP	7578190	7578190	TP53	17	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	16264	105
MFSD6L	162387	broad.mit.edu	37	17	8700984	8700984	+	Silent	SNP	G	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8700984G>A	uc002glp.1	-	1	1603	c.1455C>T	c.(1453-1455)CCC>CCT	p.P485P		NM_152599	NP_689812	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing	485						integral to membrane				central_nervous_system(1)	1						TCTCCATGCGGGGAGTGGCCA	0.607																0.066667	-1.449647	10.227829	4	56	KEEP	---	---	---	---	1	3	30	28	-1	capture	Silent	SNP	8700984	8700984	MFSD6L	17	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	9448	105
KRTAP4-11	653240	broad.mit.edu	37	17	39274415	39274415	+	Silent	SNP	C	T	T	rs425487	by1000genomes	TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274415C>T	uc002hvz.2	-	1	192	c.153G>A	c.(151-153)AGG>AGA	p.R51R		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	51	6.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14).			keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCACTGGGGCCTGCAGCAGC	0.667																0.038462	-11.610105	6.313843	3	75	KEEP	---	---	---	---	3	2	50	41	-1	capture	Silent	SNP	39274415	39274415	KRTAP4-11	17	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	8469	105
PAK4	10298	broad.mit.edu	37	19	39663979	39663979	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39663979C>T	uc002okj.1	+	5	1087	c.626C>T	c.(625-627)CCG>CTG	p.P209L	PAK4_uc002okl.1_Missense_Mutation_p.P209L|PAK4_uc002okn.1_Missense_Mutation_p.P209L|PAK4_uc002okm.1_Intron|PAK4_uc002oko.1_Intron|PAK4_uc002okp.1_Intron	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1	209	Linker.				cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			AACACCTACCCGAGGGCTGAC	0.701					223											0.12	3.908412	7.448939	3	22	KEEP	---	---	---	---	2	1	11	16	-1	capture	Missense_Mutation	SNP	39663979	39663979	PAK4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11307	105
FABP1	2168	broad.mit.edu	37	2	88425819	88425819	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:88425819G>A	uc002sst.1	-	2	158	c.116C>T	c.(115-117)TCG>TTG	p.S39L	FABP1_uc002ssu.2_Missense_Mutation_p.S39L	NM_001443	NP_001434	P07148	FABPL_HUMAN	fatty acid binding protein 1, liver	39					organ morphogenesis						0						CACGATTTCCGACACCCCCTT	0.527																0.033981	-37.94109	10.824323	7	199	KEEP	---	---	---	---	4	3	108	115	-1	capture	Missense_Mutation	SNP	88425819	88425819	FABP1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5309	105
NCAPH	23397	broad.mit.edu	37	2	97007486	97007486	+	Silent	SNP	G	A	A	rs139287054		TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:97007486G>A	uc002svz.1	+	2	210	c.126G>A	c.(124-126)GCG>GCA	p.A42A	NCAPH_uc010fhu.1_Silent_p.A18A|NCAPH_uc010fhv.1_Silent_p.A31A|NCAPH_uc010yum.1_Silent_p.A18A|NCAPH_uc010fhw.1_Silent_p.A31A|NCAPH_uc010yun.1_Intron|NCAPH_uc002swa.1_Intron	NM_015341	NP_056156	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	42					cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus				urinary_tract(1)|skin(1)	2		Ovarian(717;0.0221)				CCAGGAAGGCGCCTCTCAATA	0.582																0.197917	40.591447	48.732787	19	77	KEEP	---	---	---	---	5	17	43	41	-1	capture	Silent	SNP	97007486	97007486	NCAPH	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10116	105
INHBB	3625	broad.mit.edu	37	2	121107075	121107075	+	Silent	SNP	C	T	T	rs61737548	byFrequency;by1000genomes	TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:121107075C>T	uc002tmn.2	+	2	895	c.849C>T	c.(847-849)GGC>GGT	p.G283G		NM_002193	NP_002184	P09529	INHBB_HUMAN	inhibin beta B subunit preproprotein	283					activin receptor signaling pathway|cellular response to insulin stimulus|cellular response to starvation|defense response|fat cell differentiation|growth|negative regulation of follicle-stimulating hormone secretion|negative regulation of hepatocyte growth factor biosynthetic process|negative regulation of insulin secretion|ovarian follicle development|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation	extracellular region|perinuclear region of cytoplasm	cytokine activity|growth factor activity|hormone activity|host cell surface receptor binding|protein homodimerization activity	p.G283G(1)		pancreas(2)|skin(1)	3		Prostate(154;0.122)				CTCGGCTGGGCGACAGCAGGC	0.642																0.144144	19.589443	33.258214	16	95	KEEP	---	---	---	---	14	5	53	61	-1	capture	Silent	SNP	121107075	121107075	INHBB	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7665	105
KCNH7	90134	broad.mit.edu	37	2	163302846	163302846	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:163302846C>G	uc002uch.1	-	7	1448	c.1236G>C	c.(1234-1236)TGG>TGC	p.W412C	KCNH7_uc002uci.2_Missense_Mutation_p.W405C	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	412	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	GCAGGATAAGCCAGTCCCAGA	0.458	GBM(196;1492 2208 17507 24132 45496)															0.15	21.03737	28.080757	9	51	KEEP	---	---	---	---	3	6	26	31	-1	capture	Missense_Mutation	SNP	163302846	163302846	KCNH7	2	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	7959	105
XIRP2	129446	broad.mit.edu	37	2	168103799	168103799	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:168103799A>G	uc002udx.2	+	8	5915	c.5897A>G	c.(5896-5898)CAG>CGG	p.Q1966R	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.Q1791R|XIRP2_uc010fpq.2_Missense_Mutation_p.Q1744R|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1791					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GATATTCATCAGGTTGCTGTC	0.448																0.029703	-17.265176	7.268307	3	98	KEEP	---	---	---	---	2	1	51	54	-1	capture	Missense_Mutation	SNP	168103799	168103799	XIRP2	2	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	17311	105
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393	Pancreas(158;264 1958 3300 35450 36047)				134	Mis		gliobastoma 								0.346667	74.072682	75.608693	26	49	KEEP	---	---	---	---	11	18	15	47	-1	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	105
SIRPB1	10326	broad.mit.edu	37	20	1600539	1600539	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1600539T>A	uc010gai.2	-	1	151	c.52A>T	c.(52-54)ACG>TCG	p.T18S	SIRPB1_uc002wfk.3_Missense_Mutation_p.T18S|SIRPB1_uc002wfl.3_Missense_Mutation_p.T18S	NM_006065	NP_006056	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1 isoform 1	18					cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding			ovary(1)	1						AGCAGTAGCGTCATCAGCAGG	0.567																0.163265	31.237289	41.796294	16	82	KEEP	---	---	---	---	10	9	44	55	-1	capture	Missense_Mutation	SNP	1600539	1600539	SIRPB1	20	T	A	A	A	1	0	0	0	0	1	0	0	0	754	58	4	4	14226	105
PLAGL2	5326	broad.mit.edu	37	20	30785118	30785118	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30785118G>C	uc002wxn.2	-	3	845	c.628C>G	c.(628-630)CTA>GTA	p.L210V		NM_002657	NP_002648	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	210	C2H2-type 5.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TGCACCACTAGGTGCCGCCGT	0.612	Colon(163;15 1893 11280 16306 47518)															0.555556	30.548062	30.59601	10	8	KEEP	---	---	---	---	5	5	6	3	-1	capture	Missense_Mutation	SNP	30785118	30785118	PLAGL2	20	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	11923	105
PPDPF	79144	broad.mit.edu	37	20	62153045	62153045	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62153045A>C	uc002yff.2	+	4	298	c.158A>C	c.(157-159)CAT>CCT	p.H53P		NM_024299	NP_077275	Q9H3Y8	PPDPF_HUMAN	pancreatic progenitor cell differentiation and	53					cell differentiation|multicellular organismal development						0						GACCCGGGTCATTGGTGGGCC	0.637																0.048387	-6.326874	7.116733	3	59	KEEP	---	---	---	---	2	2	34	40	-1	capture	Missense_Mutation	SNP	62153045	62153045	PPDPF	20	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	12207	105
C21orf91	54149	broad.mit.edu	37	21	19169182	19169182	+	Silent	SNP	T	C	C			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:19169182T>C	uc002yko.3	-	3	472	c.381A>G	c.(379-381)CCA>CCG	p.P127P	C21orf91_uc002ykq.3_Silent_p.P127P|C21orf91_uc002ykp.3_Silent_p.P127P	NM_001100420	NP_001093890	Q9NYK6	EURL_HUMAN	early undifferentiated retina and lens isoform	127										ovary(1)	1				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		ATTTTTCTTCTGGCTTATGCC	0.383																0.18552	92.244652	112.73303	41	180	KEEP	---	---	---	---	20	28	78	125	-1	capture	Silent	SNP	19169182	19169182	C21orf91	21	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	2115	105
KRTAP22-1	337979	broad.mit.edu	37	21	31973461	31973461	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31973461C>T	uc011add.1	+	1	22	c.22C>T	c.(22-24)CAT>TAT	p.H8Y	KRTAP6-2_uc011adc.1_5'Flank	NM_181620	NP_853651	Q3MIV0	KR221_HUMAN	keratin associated protein 22-1	8						intermediate filament					0						TAACAACTACCATGGTGGCCA	0.423																0.194969	75.826651	89.627026	31	128	KEEP	---	---	---	---	16	21	59	93	-1	capture	Missense_Mutation	SNP	31973461	31973461	KRTAP22-1	21	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	8460	105
APOBEC3B	9582	broad.mit.edu	37	22	39382073	39382073	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:39382073G>A	uc003awo.1	+	3	485	c.431G>A	c.(430-432)CGC>CAC	p.R144H	APOBEC3A_uc011aoc.1_Intron|APOBEC3B_uc003awp.1_Missense_Mutation_p.R144H|APOBEC3B_uc003awq.1_RNA|APOBEC3D_uc011aod.1_Intron|APOBEC3D_uc011aoe.1_Intron|APOBEC3D_uc011aof.1_Intron	NM_004900	NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	144					negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(58;0.04)					GCAGGAGCCCGCGTGACGATC	0.587																0.333333	63.900856	65.598871	23	46	KEEP	---	---	---	---	11	16	31	23	-1	capture	Missense_Mutation	SNP	39382073	39382073	APOBEC3B	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	783	105
CELSR1	9620	broad.mit.edu	37	22	46805742	46805742	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46805742G>A	uc003bhw.1	-	8	4969	c.4969C>T	c.(4969-4971)CGG>TGG	p.R1657W	CELSR1_uc011arc.1_5'Flank	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	1657	Extracellular (Potential).|EGF-like 4; calcium-binding.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TTCTGACACCGCCTCCCATCG	0.622																0.048	-15.035835	12.117318	6	119	KEEP	---	---	---	---	2	4	58	86	-1	capture	Missense_Mutation	SNP	46805742	46805742	CELSR1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	3189	105
KIF9	64147	broad.mit.edu	37	3	47284680	47284680	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47284680A>G	uc010hjp.2	-	17	2174	c.1570T>C	c.(1570-1572)TAC>CAC	p.Y524H	KIF9_uc003cqx.2_Missense_Mutation_p.Y524H|KIF9_uc003cqy.2_Intron|KIF9_uc011bat.1_Intron|uc003cqw.1_RNA	NM_001134878	NP_001128350	Q9HAQ2	KIF9_HUMAN	kinesin family member 9 isoform 2	524					blood coagulation|microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(1)	1		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GTGGAAACGTAATCCAAGTCC	0.557	Colon(44;962 1147 15977 24541)															0.081633	2.862481	11.592751	4	45	KEEP	---	---	---	---	1	3	32	17	-1	capture	Missense_Mutation	SNP	47284680	47284680	KIF9	3	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	8232	105
CACNA2D2	9254	broad.mit.edu	37	3	50405101	50405101	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50405101C>T	uc003daq.2	-	27	2328	c.2290G>A	c.(2290-2292)GGT>AGT	p.G764S	CACNA2D2_uc003dap.2_Missense_Mutation_p.G757S|CACNA2D2_uc003dao.2_5'Flank	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha	764	Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)	GTGATGCCACCGTCTGTGGCA	0.642																0.113636	5.843568	12.322473	5	39	KEEP	---	---	---	---	3	2	17	29	-1	capture	Missense_Mutation	SNP	50405101	50405101	CACNA2D2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2525	105
HPS3	84343	broad.mit.edu	37	3	148877986	148877986	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148877986G>C	uc003ewu.1	+	11	2166	c.2026G>C	c.(2026-2028)GTG>CTG	p.V676L	HPS3_uc011bnq.1_Missense_Mutation_p.V511L|HPS3_uc003ewv.1_RNA	NM_032383	NP_115759	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3 protein	676						cytoplasm				ovary(5)|large_intestine(1)	6			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ATCGATCTTAGTGACATTGAC	0.438												Hermansky-Pudlak_syndrome				0.025424	-22.382469	7.063071	3	115	KEEP	---	---	---	---	2	1	68	60	-1	capture	Missense_Mutation	SNP	148877986	148877986	HPS3	3	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	7265	105
IL7R	3575	broad.mit.edu	37	5	35871249	35871249	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:35871249G>C	uc003jjs.2	+	4	560	c.471G>C	c.(469-471)AAG>AAC	p.K157N	IL7R_uc011coo.1_Missense_Mutation_p.K157N|IL7R_uc011cop.1_RNA	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor	157	Extracellular (Potential).|Fibronectin type-III.				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			ACTTGCAAAAGAAGTATGTAA	0.378																0.230769	35.372793	38.826577	12	40	KEEP	---	---	---	---	7	6	22	24	-1	capture	Missense_Mutation	SNP	35871249	35871249	IL7R	5	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	7628	105
PLCXD3	345557	broad.mit.edu	37	5	41382006	41382006	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41382006G>T	uc003jmm.1	-	2	836	c.734C>A	c.(733-735)TCT>TAT	p.S245Y		NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X	245					intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						CACCACCTGAGATATAAAAAA	0.483																0.236364	61.788718	68.782119	26	84	KEEP	---	---	---	---	9	19	42	54	0.321428571429	capture	Missense_Mutation	SNP	41382006	41382006	PLCXD3	5	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	11946	105
IL17B	27190	broad.mit.edu	37	5	148754111	148754111	+	Silent	SNP	G	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148754111G>A	uc003lqo.2	-	3	414	c.364C>T	c.(364-366)CTG>TTG	p.L122L		NM_014443	NP_055258	Q9UHF5	IL17B_HUMAN	interleukin 17B precursor	122					cell-cell signaling|immune response|inflammatory response	extracellular space	cytokine activity|signal transducer activity			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCAGACACAGGCACCGTGCC	0.647																0.254902	37.049693	39.829888	13	38	KEEP	---	---	---	---	5	8	24	23	-1	capture	Silent	SNP	148754111	148754111	IL17B	5	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	7558	105
EHMT2	10919	broad.mit.edu	37	6	31847948	31847948	+	Silent	SNP	A	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31847948A>T	uc003nxz.1	-	28	3556	c.3546T>A	c.(3544-3546)ATT>ATA	p.I1182I	EHMT2_uc003nxv.1_Silent_p.I221I|EHMT2_uc003nxw.1_Silent_p.I221I|EHMT2_uc003nxx.1_Silent_p.I380I|EHMT2_uc003nxy.1_Silent_p.I980I|EHMT2_uc011don.1_Silent_p.I1205I|EHMT2_uc003nya.1_Silent_p.I1148I|SLC44A4_uc010jti.2_5'Flank|SLC44A4_uc011dol.1_5'Flank|SLC44A4_uc011dom.1_5'Flank	NM_006709	NP_006700	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	1182					DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			ovary(1)	1						GCTCCAGGGCAATGGCTTCGG	0.592																0.525	68.278085	68.299989	21	19	KEEP	---	---	---	---	13	9	11	10	-1	capture	Silent	SNP	31847948	31847948	EHMT2	6	A	T	T	T	1	0	0	0	0	0	0	0	1	60	5	4	4	4939	105
AMD1	262	broad.mit.edu	37	6	111214026	111214026	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:111214026C>T	uc003puk.1	+	7	1026	c.704C>T	c.(703-705)TCG>TTG	p.S235L	AMD1_uc011eay.1_Missense_Mutation_p.S166L|AMD1_uc011eaz.1_Missense_Mutation_p.S206L|AMD1_uc011eba.1_Missense_Mutation_p.S115L|AMD1_uc003pul.1_Missense_Mutation_p.S87L	NM_001634	NP_001625	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1 isoform 1	235					spermidine biosynthetic process|spermine biosynthetic process	cytosol	adenosylmethionine decarboxylase activity			upper_aerodigestive_tract(1)	1		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	GGAATGAAATCGGATGTGAGT	0.388																0.2	52.969187	62.587787	23	92	KEEP	---	---	---	---	12	12	43	57	-1	capture	Missense_Mutation	SNP	111214026	111214026	AMD1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	566	105
RNF148	378925	broad.mit.edu	37	7	122342705	122342705	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:122342705C>T	uc003vkk.1	-	1	317	c.100G>A	c.(100-102)GGA>AGA	p.G34R	CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron|RNF148_uc010lkr.1_Missense_Mutation_p.G34R	NM_198085	NP_932351	Q8N7C7	RN148_HUMAN	ring finger protein 148 precursor	34						integral to membrane	zinc ion binding				0						ATGGCTTTTCCGTTTGAGTCA	0.423																0.114286	5.47564	10.607918	4	31	KEEP	---	---	---	---	2	2	20	15	-1	capture	Missense_Mutation	SNP	122342705	122342705	RNF148	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13341	105
TEX15	56154	broad.mit.edu	37	8	30705338	30705338	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30705338A>T	uc003xil.2	-	1	1196	c.1196T>A	c.(1195-1197)GTT>GAT	p.V399D		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	399										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		AGATGAAATAACTGTATCAAT	0.333																0.397163	171.577199	172.879718	56	85	KEEP	---	---	---	---	25	36	40	49	-1	capture	Missense_Mutation	SNP	30705338	30705338	TEX15	8	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	15664	105
SYBU	55638	broad.mit.edu	37	8	110587269	110587269	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110587269G>A	uc003ynj.3	-	7	2021	c.1858C>T	c.(1858-1860)CCC>TCC	p.P620S	SYBU_uc003yni.3_Missense_Mutation_p.P617S|SYBU_uc003ynk.3_Missense_Mutation_p.P501S|SYBU_uc010mco.2_Missense_Mutation_p.P619S|SYBU_uc003ynl.3_Missense_Mutation_p.P619S|SYBU_uc010mcp.2_Missense_Mutation_p.P620S|SYBU_uc010mcq.2_Missense_Mutation_p.P620S|SYBU_uc003yno.3_Missense_Mutation_p.P501S|SYBU_uc010mcr.2_Missense_Mutation_p.P620S|SYBU_uc003ynm.3_Missense_Mutation_p.P619S|SYBU_uc003ynn.3_Missense_Mutation_p.P619S|SYBU_uc010mcs.2_Missense_Mutation_p.P501S|SYBU_uc010mct.2_Missense_Mutation_p.P620S|SYBU_uc010mcu.2_Missense_Mutation_p.P619S|SYBU_uc003ynp.3_Missense_Mutation_p.P552S|SYBU_uc010mcv.2_Missense_Mutation_p.P620S|SYBU_uc003ynh.3_Missense_Mutation_p.P414S|SYBU_uc011lhw.1_Missense_Mutation_p.P490S	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	620	Helical; (Potential).					cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						AGAACCGTGGGGACCACGGGG	0.622																0.121622	23.884053	44.620987	18	130	KEEP	---	---	---	---	7	13	69	78	-1	capture	Missense_Mutation	SNP	110587269	110587269	SYBU	8	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	15315	105
HAS2	3037	broad.mit.edu	37	8	122641322	122641322	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:122641322G>A	uc003yph.2	-	2	797	c.259C>T	c.(259-261)CTT>TTT	p.L87F		NM_005328	NP_005319	Q92819	HAS2_HUMAN	hyaluronan synthase 2	87	Cytoplasmic (Potential).					integral to plasma membrane	hyaluronan synthase activity		HAS2/PLAG1(10)	soft_tissue(10)|ovary(5)	15	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			GCGATGCAAAGGGCAACTGTT	0.423																0.036179	-106.221298	55.057038	25	666	KEEP	---	---	---	---	13	17	392	384	-1	capture	Missense_Mutation	SNP	122641322	122641322	HAS2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	6889	105
C9orf152	401546	broad.mit.edu	37	9	112963591	112963591	+	Silent	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112963591C>T	uc011lwk.1	-	2	911	c.357G>A	c.(355-357)ACG>ACA	p.T119T		NM_001012993	NP_001013011	Q5JTZ5	CI152_HUMAN	hypothetical protein LOC401546	119											0						TCTCCAGGTGCGTGTGCCATG	0.587																0.107843	9.182157	24.713302	11	91	KEEP	---	---	---	---	5	6	49	44	-1	capture	Silent	SNP	112963591	112963591	C9orf152	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	2440	105
FCN1	2219	broad.mit.edu	37	9	137801822	137801822	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137801822G>A	uc004cfi.2	-	9	895	c.803C>T	c.(802-804)TCG>TTG	p.S268L		NM_002003	NP_001994	O00602	FCN1_HUMAN	ficolin 1 precursor	268	Fibrinogen C-terminal.				opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|receptor binding|sugar binding			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		AGCACAATTCGAAGAACTCAC	0.488																0.160377	63.937499	87.197954	34	178	KEEP	---	---	---	---	20	19	84	114	-1	capture	Missense_Mutation	SNP	137801822	137801822	FCN1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5737	105
ACE2	59272	broad.mit.edu	37	X	15589843	15589843	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:15589843C>T	uc004cxa.1	-	13	1909	c.1741G>A	c.(1741-1743)GTA>ATA	p.V581I	ACE2_uc004cxb.2_Missense_Mutation_p.V581I	NM_021804	NP_068576	Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2 precursor	581	Extracellular (Potential).				angiotensin-mediated drinking behavior|proteolysis|receptor biosynthetic process|regulation of cell proliferation|virion attachment, binding of host cell surface receptor	cell surface|extracellular space|integral to membrane|membrane raft|plasma membrane	carboxypeptidase activity|glycoprotein binding|metallopeptidase activity|peptidyl-dipeptidase activity|viral receptor activity|zinc ion binding			ovary(3)	3	Hepatocellular(33;0.183)				Moexipril(DB00691)	AGTGGCCTTACATTCATGTTC	0.448																0.252033	75.388537	82.243722	31	92	KEEP	---	---	---	---	12	21	44	56	-1	capture	Missense_Mutation	SNP	15589843	15589843	ACE2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	137	105
DMD	1756	broad.mit.edu	37	X	32490283	32490283	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:32490283G>C	uc004dda.1	-	22	3191	c.2947C>G	c.(2947-2949)CAG>GAG	p.Q983E	DMD_uc004dcz.2_Missense_Mutation_p.Q860E|DMD_uc004dcy.1_Missense_Mutation_p.Q979E|DMD_uc004ddb.1_Missense_Mutation_p.Q975E|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	983	Spectrin 6.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCACAGACCTGCAATTCCCCG	0.388																0.027397	-26.130722	9.848576	4	142	KEEP	---	---	---	---	3	1	84	80	-1	capture	Missense_Mutation	SNP	32490283	32490283	DMD	23	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	4538	105
PHKA1	5255	broad.mit.edu	37	X	71843109	71843109	+	Silent	SNP	A	G	G			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:71843109A>G	uc004eax.3	-	18	2111	c.1810T>C	c.(1810-1812)TTG>CTG	p.L604L	PHKA1_uc004eay.3_Silent_p.L604L|PHKA1_uc011mqi.1_Silent_p.L604L	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform	604					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)					AACTCTGACAATTTACCTGTT	0.383																0.140351	16.461952	23.578034	8	49	KEEP	---	---	---	---	4	5	31	27	-1	capture	Silent	SNP	71843109	71843109	PHKA1	23	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	11746	105
P2RY10	27334	broad.mit.edu	37	X	78216344	78216344	+	Silent	SNP	C	T	T			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:78216344C>T	uc004ede.2	+	4	696	c.327C>T	c.(325-327)TGC>TGT	p.C109C	P2RY10_uc004edf.2_Silent_p.C109C	NM_014499	NP_055314	O00398	P2Y10_HUMAN	G-protein coupled purinergic receptor P2Y10	109	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(2)|breast(1)	5						GCCTGCTCTGCTTCTACCTGA	0.483																0.154762	51.780094	70.880517	26	142	KEEP	---	---	---	---	14	14	75	79	-1	capture	Silent	SNP	78216344	78216344	P2RY10	23	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	11251	105
COL4A6	1288	broad.mit.edu	37	X	107435807	107435807	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107435807T>C	uc004enw.3	-	18	1182	c.1079A>G	c.(1078-1080)AAT>AGT	p.N360S	COL4A6_uc004env.3_Missense_Mutation_p.N359S|COL4A6_uc011msn.1_Missense_Mutation_p.N359S|COL4A6_uc010npk.2_Missense_Mutation_p.N359S	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	360	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						ATCTCCAGGATTACCTGGCAT	0.502	Melanoma(87;1895 1945 2589 7165)											Alport_syndrome_with_Diffuse_Leiomyomatosis				0.333333	20.044764	20.487193	6	12	KEEP	---	---	---	---	2	5	9	3	-1	capture	Missense_Mutation	SNP	107435807	107435807	COL4A6	23	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	3660	105
GABRQ	55879	broad.mit.edu	37	X	151820028	151820028	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151820028A>C	uc004ffp.1	+	8	961	c.941A>C	c.(940-942)CAT>CCT	p.H314P		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	314						cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ATCGACTCACATCTGCGGGAT	0.468																0.323232	102.666901	105.412413	32	67	KEEP	---	---	---	---	7	28	35	39	-1	capture	Missense_Mutation	SNP	151820028	151820028	GABRQ	23	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	6117	105
IFT172	26160	broad.mit.edu	37	2	27669199	27669200	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-06-6389-01	TCGA-06-6389-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27669199_27669200delAG	uc002rku.2	-	43	4733_4734	c.4682_4683delCT	c.(4681-4683)TCTfs	p.S1561fs	IFT172_uc010ezb.2_RNA	NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog	1561					cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					AGAGTGAAACAGAAAGCCTGGC	0.505																0.13			8	52		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	27669199	27669200	IFT172	2	AG	-	-	-	1	0	1	0	1	0	0	0	0	80	7	5	5	7482	105
