Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SPRR1B	6699	broad.mit.edu	37	1	153004854	153004854	+	Silent	SNP	C	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153004854C>G	uc001fba.2	+	2	97	c.33C>G	c.(31-33)ACC>ACG	p.T11T	SPRR1B_uc009wnx.1_RNA	NM_003125	NP_003116	P22528	SPR1B_HUMAN	small proline-rich protein 1B	11	1.|2 X 12 AA approximate repeats.				keratinization|peptide cross-linking	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity			ovary(1)	1	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCCTTGCACCCCACCCCCTC	0.557																0.121076	25.33472	56.727693	27	196	KEEP	---	---	---	---	41	51	75	140	-1	capture	Silent	SNP	153004854	153004854	SPRR1B	1	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	14988	131
NUP210L	91181	broad.mit.edu	37	1	154062058	154062058	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154062058G>A	uc001fdw.2	-	16	2272	c.2200C>T	c.(2200-2202)CGA>TGA	p.R734*	NUP210L_uc009woq.2_5'UTR|NUP210L_uc010peh.1_Nonsense_Mutation_p.R734*	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	734						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TTTCCAATTCGGAATGTGAGA	0.423																0.373239	161.237045	163.241868	53	89	KEEP	---	---	---	---	22	38	42	53	-1	capture	Nonsense_Mutation	SNP	154062058	154062058	NUP210L	1	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	10668	131
ATP1A4	480	broad.mit.edu	37	1	160136448	160136448	+	Missense_Mutation	SNP	G	A	A	rs139315814		TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160136448G>A	uc001fve.3	+	8	1657	c.1178G>A	c.(1177-1179)CGC>CAC	p.R393H	ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_5'UTR	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	393	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACCCAGAACCGCATGACCGTC	0.577																0.028736	-35.972105	6.578456	5	169	KEEP	---	---	---	---	0	5	94	95	-1	capture	Missense_Mutation	SNP	160136448	160136448	ATP1A4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1122	131
SELP	6403	broad.mit.edu	37	1	169562857	169562857	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169562857C>T	uc001ggi.3	-	14	2458	c.2393G>A	c.(2392-2394)CGT>CAT	p.R798H	SELP_uc001ggh.2_Intron|SELP_uc009wvr.2_Missense_Mutation_p.R797H	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	798	Cytoplasmic (Potential).				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	TTGTCTGAAACGCTTTCTTAG	0.423																0.443182	103.79943	104.048752	39	49	KEEP	---	---	---	---	17	26	37	18	-1	capture	Missense_Mutation	SNP	169562857	169562857	SELP	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13912	131
FMO3	2328	broad.mit.edu	37	1	171080061	171080061	+	Silent	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:171080061C>T	uc001ghi.2	+	6	861	c.750C>T	c.(748-750)GCC>GCT	p.A250A	FMO3_uc001ghh.2_Silent_p.A250A|FMO3_uc010pmb.1_Silent_p.A230A|FMO3_uc010pmc.1_Silent_p.A187A	NM_001002294	NP_001002294	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	250					xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TACCGACAGCCATCTCTGACT	0.468																0.024735	-61.946103	9.044405	7	276	KEEP	---	---	---	---	4	3	150	156	-1	capture	Silent	SNP	171080061	171080061	FMO3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	5900	131
TNN	63923	broad.mit.edu	37	1	175067712	175067712	+	Silent	SNP	C	T	T	rs150075962	by1000genomes	TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:175067712C>T	uc001gkl.1	+	9	2213	c.2100C>T	c.(2098-2100)GCC>GCT	p.A700A	TNN_uc010pmx.1_Silent_p.A611A	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	700	Fibronectin type-III 5.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCAAGAAGGCCGACACCAAGG	0.572				p.A700A(JHOS2-Tumor)|p.A700A(RERFLCAD2-Tumor)	470											0.382166	169.291828	171.192273	60	97	KEEP	---	---	---	---	30	39	50	66	-1	capture	Silent	SNP	175067712	175067712	TNN	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16206	131
OR2T11	127077	broad.mit.edu	37	1	248790297	248790297	+	Silent	SNP	A	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248790297A>G	uc001ier.1	-	1	133	c.133T>C	c.(133-135)TTG>CTG	p.L45L		NM_001001964	NP_001001964	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T,	45	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCTGAATCAAGAATATCATG	0.502																0.409091	223.799542	224.910802	63	91	KEEP	---	---	---	---	20	46	38	66	-1	capture	Silent	SNP	248790297	248790297	OR2T11	1	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	10922	131
C10orf47	254427	broad.mit.edu	37	10	11908649	11908649	+	Silent	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:11908649G>A	uc001ikx.2	+	3	412	c.258G>A	c.(256-258)GTG>GTA	p.V86V	uc001iky.1_Intron	NM_153256	NP_694988	Q86WR7	CJ047_HUMAN	hypothetical protein LOC254427	86										central_nervous_system(1)	1						ATGGAGGAGTGTGCTGCCTCT	0.577																0.72	99.703327	101.874578	36	14	KEEP	---	---	---	---	26	15	10	6	-1	capture	Silent	SNP	11908649	11908649	C10orf47	10	G	A	A	A	1	0	0	0	0	0	0	0	1	613	48	2	2	1593	131
PPYR1	5540	broad.mit.edu	37	10	47086808	47086808	+	Missense_Mutation	SNP	T	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:47086808T>A	uc001jee.2	+	3	444	c.25T>A	c.(25-27)TTG>ATG	p.L9M	ANXA8_uc001jed.3_Intron|PPYR1_uc009xna.2_Missense_Mutation_p.L9M	NM_005972	NP_005963	P50391	NPY4R_HUMAN	pancreatic polypeptide receptor 1	9	Extracellular (Potential).				blood circulation|digestion|feeding behavior	integral to plasma membrane				ovary(1)|skin(1)	2						CCTCCTGGCCTTGCTGCTCCC	0.493																0.292683	113.527175	119.843946	48	116	KEEP	---	---	---	---	21	31	66	64	-1	capture	Missense_Mutation	SNP	47086808	47086808	PPYR1	10	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	12317	131
PPYR1	5540	broad.mit.edu	37	10	47087737	47087737	+	Silent	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:47087737C>T	uc001jee.2	+	3	1373	c.954C>T	c.(952-954)AAC>AAT	p.N318N	ANXA8_uc001jed.3_Intron|PPYR1_uc009xna.2_Silent_p.N318N	NM_005972	NP_005963	P50391	NPY4R_HUMAN	pancreatic polypeptide receptor 1	318	Helical; Name=7; (Potential).				blood circulation|digestion|feeding behavior	integral to plasma membrane				ovary(1)|skin(1)	2						CCTGCGTCAACCCATTCATCT	0.572																0.288	88.740876	93.783993	36	89	KEEP	---	---	---	---	24	14	48	45	-1	capture	Silent	SNP	47087737	47087737	PPYR1	10	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	12317	131
KIAA0913	23053	broad.mit.edu	37	10	75553915	75553915	+	Missense_Mutation	SNP	C	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:75553915C>G	uc009xrl.2	+	13	2668	c.2636C>G	c.(2635-2637)GCA>GGA	p.A879G	KIAA0913_uc001jve.2_Missense_Mutation_p.A879G|KIAA0913_uc001jvf.2_Missense_Mutation_p.A879G|KIAA0913_uc001jvh.2_RNA|KIAA0913_uc001jvi.2_Missense_Mutation_p.A302G|KIAA0913_uc010qkr.1_Missense_Mutation_p.A302G|KIAA0913_uc001jvj.2_Missense_Mutation_p.A302G	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053	879							zinc ion binding			breast(1)	1	Prostate(51;0.0112)					GTGAAGCTGGCATACCAGGAG	0.552																0.719626	295.322618	299.962088	77	30	KEEP	---	---	---	---	36	53	18	17	-1	capture	Missense_Mutation	SNP	75553915	75553915	KIAA0913	10	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	8122	131
EBF3	253738	broad.mit.edu	37	10	131755521	131755521	+	Splice_Site	SNP	C	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:131755521C>G	uc001lki.1	-	6	613	c.554_splice	c.e6+1	p.R185_splice		NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		GTCATCCTTACCTGTCAATGA	0.423																0.020548	-31.213901	6.384931	3	143	KEEP	---	---	---	---	1	3	82	79	-1	capture	Splice_Site	SNP	131755521	131755521	EBF3	10	C	G	G	G	1	0	0	0	0	0	0	1	0	234	18	5	4	4837	131
IFITM1	8519	broad.mit.edu	37	11	314253	314253	+	Missense_Mutation	SNP	A	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:314253A>G	uc001loy.3	+	1	263	c.83A>G	c.(82-84)CAC>CGC	p.H28R		NM_003641	NP_003632	P13164	IFM1_HUMAN	interferon induced transmembrane protein 1	28	Extracellular (Potential).				negative regulation of cell proliferation|regulation of immune response|response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane	protein binding|receptor signaling protein activity				0		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		ATCAACATCCACAGCGAGACC	0.582																0.023474	-45.586337	8.211144	5	208	KEEP	---	---	---	---	3	5	114	108	-1	capture	Missense_Mutation	SNP	314253	314253	IFITM1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	7451	131
ZNF215	7762	broad.mit.edu	37	11	6977376	6977376	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6977376C>T	uc001mey.2	+	7	1756	c.1168C>T	c.(1168-1170)CGA>TGA	p.R390*	ZNF215_uc010raw.1_3'UTR|ZNF215_uc010rax.1_Nonsense_Mutation_p.R152*|ZNF215_uc001mez.1_Intron	NM_013250	NP_037382	Q9UL58	ZN215_HUMAN	zinc finger protein 215	390	C2H2-type 1.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		AGCCTTCTGCCGAAGTTCATC	0.393																0.365385	164.235363	166.720568	57	99	KEEP	---	---	---	---	24	36	33	75	-1	capture	Nonsense_Mutation	SNP	6977376	6977376	ZNF215	11	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	17651	131
OR5P2	120065	broad.mit.edu	37	11	7818191	7818191	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7818191G>A	uc001mfp.1	-	1	299	c.299C>T	c.(298-300)GCG>GTG	p.A100V		NM_153444	NP_703145	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P,	100	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AAAGAAAGCCGCTGAACCAAG	0.483																0.427562	317.995654	319.29631	121	162	KEEP	---	---	---	---	67	63	94	92	-1	capture	Missense_Mutation	SNP	7818191	7818191	OR5P2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11082	131
OR5I1	10798	broad.mit.edu	37	11	55703444	55703444	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55703444G>A	uc010ris.1	-	1	433	c.433C>T	c.(433-435)CGG>TGG	p.R145W		NM_006637	NP_006628	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I,	145	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						ACAATCAACCGCATACAGATG	0.428																0.421569	113.21012	113.756151	43	59	KEEP	---	---	---	---	19	28	28	45	-1	capture	Missense_Mutation	SNP	55703444	55703444	OR5I1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	11068	131
FGD4	121512	broad.mit.edu	37	12	32763711	32763711	+	Silent	SNP	A	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:32763711A>G	uc001rkz.2	+	9	1611	c.1134A>G	c.(1132-1134)AAA>AAG	p.K378K	FGD4_uc001rlc.2_Silent_p.K463K|FGD4_uc001rky.2_Silent_p.K130K|FGD4_uc001rla.2_Silent_p.K34K|FGD4_uc010ske.1_Silent_p.K490K|FGD4_uc001rlb.1_RNA	NM_139241	NP_640334	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	378	DH.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					CCCATTTAGAATCACTTGAAA	0.343																0.375	139.70382	141.128922	39	65	KEEP	---	---	---	---	20	23	42	29	-1	capture	Silent	SNP	32763711	32763711	FGD4	12	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	5781	131
KRT75	9119	broad.mit.edu	37	12	52818468	52818468	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52818468C>T	uc001saj.2	-	9	1511	c.1489G>A	c.(1489-1491)GGT>AGT	p.G497S		NM_004693	NP_004684	O95678	K2C75_HUMAN	keratin 75	497	Tail.					keratin filament	structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.192)		CTGCCCCCACCGAGGCCCAGG	0.622																0.149425	14.917469	25.203975	13	74	KEEP	---	---	---	---	15	13	72	86	-1	capture	Missense_Mutation	SNP	52818468	52818468	KRT75	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8408	131
KRT6B	3854	broad.mit.edu	37	12	52841572	52841572	+	Missense_Mutation	SNP	C	T	T	rs60627726		TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52841572C>T	uc001sak.2	-	7	1462	c.1414G>A	c.(1414-1416)GAG>AAG	p.E472K		NM_005555	NP_005546	P04259	K2C6B_HUMAN	keratin 6B	472	Rod.|Coil 2.				ectoderm development	keratin filament	structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.083)		CTGCACTCCTCGCCCTCCAGC	0.597																0.364103	189.857632	193.031463	71	124	KEEP	---	---	---	---	42	40	81	72	-1	capture	Missense_Mutation	SNP	52841572	52841572	KRT6B	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8401	131
ANO4	121601	broad.mit.edu	37	12	101295584	101295584	+	Silent	SNP	A	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101295584A>G	uc010svm.1	+	2	593	c.21A>G	c.(19-21)GGA>GGG	p.G7G	ANO4_uc010svl.1_RNA|ANO4_uc001thw.2_Silent_p.G7G|ANO4_uc001thx.2_Silent_p.G7G	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	7	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						GCTCTTCTGGAATCACTAATG	0.522													HNSCC(74;0.22)			0.454545	322.441951	322.796444	90	108	KEEP	---	---	---	---	46	55	62	64	-1	capture	Silent	SNP	101295584	101295584	ANO4	12	A	G	G	G	1	0	0	0	0	0	0	0	1	106	9	3	3	693	131
ACACB	32	broad.mit.edu	37	12	109629703	109629703	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109629703G>A	uc001tob.2	+	15	2466	c.2347G>A	c.(2347-2349)GCC>ACC	p.A783T	ACACB_uc001toc.2_Missense_Mutation_p.A783T	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	783					acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	CTTGAACGTGGCCGATGCGAT	0.532					1843											0.043956	-12.28055	7.98838	4	87	KEEP	---	---	---	---	5	1	53	49	-1	capture	Missense_Mutation	SNP	109629703	109629703	ACACB	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	107	131
VPS33A	65082	broad.mit.edu	37	12	122734578	122734578	+	Missense_Mutation	SNP	C	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:122734578C>G	uc001ucd.2	-	6	728	c.615G>C	c.(613-615)ATG>ATC	p.M205I	VPS33A_uc001ucc.2_RNA	NM_022916	NP_075067	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33A	205					lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			skin(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		TCCTGATCATCATATTGGCCA	0.383																0.033708	-14.058471	7.035942	3	86	KEEP	---	---	---	---	1	2	37	57	-1	capture	Missense_Mutation	SNP	122734578	122734578	VPS33A	12	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	17083	131
PARP4	143	broad.mit.edu	37	13	25052379	25052379	+	Missense_Mutation	SNP	T	C	C			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25052379T>C	uc001upl.2	-	13	1590	c.1484A>G	c.(1483-1485)GAT>GGT	p.D495G	PARP4_uc010tdc.1_Missense_Mutation_p.D495G	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	495	PARP catalytic.				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TCTGGTGCCATCTGTCTCTCC	0.438																0.424242	199.088915	199.74756	56	76	KEEP	---	---	---	---	26	35	42	55	-1	capture	Missense_Mutation	SNP	25052379	25052379	PARP4	13	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	11366	131
NBEA	26960	broad.mit.edu	37	13	36124652	36124652	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:36124652G>A	uc001uvb.2	+	42	6830	c.6624G>A	c.(6622-6624)ATG>ATA	p.M2208I	NBEA_uc010abi.2_Missense_Mutation_p.M864I|NBEA_uc010tee.1_Missense_Mutation_p.M1I|NBEA_uc010tef.1_Missense_Mutation_p.M1I|NBEA_uc010teg.1_Missense_Mutation_p.M1I	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	2208						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GAAAATGGATGTTCAGCGAGA	0.363																0.137255	16.880743	29.872873	14	88	KEEP	---	---	---	---	9	8	48	54	-1	capture	Missense_Mutation	SNP	36124652	36124652	NBEA	13	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	10094	131
SLITRK1	114798	broad.mit.edu	37	13	84455093	84455093	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:84455093G>C	uc001vlk.2	-	1	1436	c.550C>G	c.(550-552)CTC>GTC	p.L184V		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	184	Extracellular (Potential).|LRR 6.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TTACCCCGGAGGTCGAGGTGG	0.532																0.408451	278.593269	280.17548	87	126	KEEP	---	---	---	---	46	53	69	74	-1	capture	Missense_Mutation	SNP	84455093	84455093	SLITRK1	13	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	14634	131
NALCN	259232	broad.mit.edu	37	13	101707744	101707744	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:101707744G>A	uc001vox.1	-	44	5309	c.5120C>T	c.(5119-5121)ACT>ATT	p.T1707I		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1707	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AGCCGCGTCAGTCATGGGGTT	0.507																0.418879	437.079583	439.028714	142	197	KEEP	---	---	---	---	78	70	105	112	-1	capture	Missense_Mutation	SNP	101707744	101707744	NALCN	13	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	10057	131
OR4M1	441670	broad.mit.edu	37	14	20248846	20248846	+	Missense_Mutation	SNP	G	A	A	rs143164519	byFrequency	TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20248846G>A	uc010tku.1	+	1	365	c.365G>A	c.(364-366)CGC>CAC	p.R122H		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GCCTATGACCGCTATGCTGCT	0.502																0.202622	305.169731	374.060215	170	669	KEEP	---	---	---	---	86	88	378	337	-1	capture	Missense_Mutation	SNP	20248846	20248846	OR4M1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10979	131
SUPT16H	11198	broad.mit.edu	37	14	21826560	21826560	+	Silent	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21826560C>T	uc001wao.2	-	20	2667	c.2328G>A	c.(2326-2328)CTG>CTA	p.L776L	SUPT16H_uc001wan.2_5'UTR	NM_007192	NP_009123	Q9Y5B9	SP16H_HUMAN	chromatin-specific transcription elongation	776					DNA repair|DNA replication|nucleosome disassembly|positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|nucleoplasm	GTP binding				0	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		AGGCTGTTTTCAGTTTGTGCC	0.378																0.43617	111.652279	111.987606	41	53	KEEP	---	---	---	---	25	20	33	25	-1	capture	Silent	SNP	21826560	21826560	SUPT16H	14	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	15284	131
CTSG	1511	broad.mit.edu	37	14	25044566	25044566	+	Silent	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:25044566C>T	uc001wpq.2	-	2	145	c.108G>A	c.(106-108)GCG>GCA	p.A36A		NM_001911	NP_001902	P08311	CATG_HUMAN	cathepsin G preproprotein	36	Peptidase S1.				immune response|proteolysis	cell surface|extracellular space|plasma membrane|stored secretory granule	heparin binding|serine-type endopeptidase activity			ovary(2)	2				GBM - Glioblastoma multiforme(265;0.0269)		TCTGAAGATACGCCATGTAGG	0.572																0.396721	316.188791	319.040537	121	184	KEEP	---	---	---	---	74	75	111	121	-1	capture	Silent	SNP	25044566	25044566	CTSG	14	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	3996	131
ANPEP	290	broad.mit.edu	37	15	90348339	90348339	+	Nonsense_Mutation	SNP	G	C	C			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90348339G>C	uc002bop.3	-	4	1159	c.867C>G	c.(865-867)TAC>TAG	p.Y289*		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	289	Extracellular.|Interaction with HCoV-229E.|Metalloprotease.			DYVEKQAS->QSVEETAQ: No change in receptor activity and HCoV-229E infection.|DYVEKQAS->QSVNETAQ: Complete loss of receptor activity and blocks HCoV-229E infection. No loss of enzymatic activity.|DYVEKQAS->QSVNEQAQ: No change in receptor activity and HCoV-229E infection.	angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	GCTTCTCCACGTAGTCGAACT	0.567	NSCLC(30;827 977 2459 19669 26125)															0.480144	469.042195	469.137344	133	144	KEEP	---	---	---	---	65	78	71	80	-1	capture	Nonsense_Mutation	SNP	90348339	90348339	ANPEP	15	G	C	C	C	1	0	0	0	0	0	1	0	0	516	40	5	4	704	131
TPSD1	23430	broad.mit.edu	37	16	1306608	1306608	+	Silent	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1306608C>T	uc002clb.1	+	2	183	c.174C>T	c.(172-174)CGC>CGT	p.R58R	TPSD1_uc010brm.1_5'UTR	NM_012217	NP_036349	Q9BZJ3	TRYD_HUMAN	tryptase delta 1 precursor	58	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)				TGAGAGTCCGCGGCCCATACT	0.697																0.403846	158.752561	160.023077	63	93	KEEP	---	---	---	---	31	42	54	57	-1	capture	Silent	SNP	1306608	1306608	TPSD1	16	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	16308	131
RBBP6	5930	broad.mit.edu	37	16	24552109	24552109	+	Silent	SNP	A	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24552109A>G	uc002dmh.2	+	1	1202	c.162A>G	c.(160-162)AAA>AAG	p.K54K	RBBP6_uc010vcb.1_Intron|RBBP6_uc002dmg.2_Silent_p.K54K|RBBP6_uc002dmi.2_Silent_p.K54K|RBBP6_uc010bxr.2_Silent_p.K54K	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1	54	DWNN.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)		CGCAGACGAAAGAAGGTAAGG	0.517																0.724638	193.082505	196.218886	50	19	KEEP	---	---	---	---	27	28	13	8	-1	capture	Silent	SNP	24552109	24552109	RBBP6	16	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	12998	131
OR1A1	8383	broad.mit.edu	37	17	3119210	3119210	+	Missense_Mutation	SNP	C	T	T	rs144175148	byFrequency	TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3119210C>T	uc010vrc.1	+	1	296	c.296C>T	c.(295-297)ACG>ATG	p.T99M		NM_014565	NP_055380	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A,	99	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GGATGCCTAACGCAGATGTAT	0.488																0.507109	296.705492	296.714567	107	104	KEEP	---	---	---	---	47	64	53	55	-1	capture	Missense_Mutation	SNP	3119210	3119210	OR1A1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10853	131
DNAH2	146754	broad.mit.edu	37	17	7679385	7679385	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7679385G>A	uc002giu.1	+	30	4879	c.4865G>A	c.(4864-4866)CGG>CAG	p.R1622Q		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1622	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GTGACCCTGCGGGACCTTCTC	0.627																0.488506	263.515332	263.533167	85	89	KEEP	---	---	---	---	50	47	45	53	-1	capture	Missense_Mutation	SNP	7679385	7679385	DNAH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4559	131
MYO15A	51168	broad.mit.edu	37	17	18047889	18047889	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18047889G>A	uc010vxh.1	+	28	6594	c.6256G>A	c.(6256-6258)GTG>ATG	p.V2086M		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	2086	Tail.|MyTH4 1.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					TGCAGAAGCCGTGAGCATCTT	0.607																0.414141	110.254791	110.892157	41	58	KEEP	---	---	---	---	34	29	42	54	-1	capture	Missense_Mutation	SNP	18047889	18047889	MYO15A	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9973	131
GPR179	440435	broad.mit.edu	37	17	36484987	36484987	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:36484987C>T	uc002hpz.2	-	11	4486	c.4465G>A	c.(4465-4467)GGG>AGG	p.G1489R		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	1489	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				ATTTCCTGCCCCATCACGTTA	0.512																0.389881	392.841549	396.413337	131	205	KEEP	---	---	---	---	72	70	109	109	-1	capture	Missense_Mutation	SNP	36484987	36484987	GPR179	17	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	6608	131
PGAP3	93210	broad.mit.edu	37	17	37844120	37844120	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37844120G>A	uc002hsj.2	-	1	191	c.148C>T	c.(148-150)CGC>TGC	p.R50C	ERBB2_uc002hsm.2_5'Flank|ERBB2_uc010cwa.2_5'Flank|PGAP3_uc010wej.1_Missense_Mutation_p.R50C|PGAP3_uc002hsk.2_Missense_Mutation_p.R50C|PGAP3_uc010cvz.2_Missense_Mutation_p.R50C|ERBB2_uc002hsl.2_5'Flank	NM_033419	NP_219487	Q96FM1	PGAP3_HUMAN	per1-like domain containing 1 precursor	50	Lumenal (Potential).				GPI anchor biosynthetic process	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	hydrolase activity, acting on ester bonds			upper_aerodigestive_tract(1)	1						TGGCGGGAGCGGAAGTGATTC	0.657					90											0.176471	5.149782	6.800509	3	14	KEEP	---	---	---	---	3	0	9	6	-1	capture	Missense_Mutation	SNP	37844120	37844120	PGAP3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11682	131
CLTC	1213	broad.mit.edu	37	17	57746279	57746279	+	Missense_Mutation	SNP	A	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:57746279A>G	uc002ixq.1	+	14	2713	c.2270A>G	c.(2269-2271)GAG>GGG	p.E757G	CLTC_uc002ixp.2_Missense_Mutation_p.E757G|CLTC_uc002ixr.1_Missense_Mutation_p.E761G	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	757	Heavy chain arm.|Proximal segment.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TACGATCCTGAGCGAGTCAAG	0.398					397	T	ALK|TFE3	ALCL|renal 								0.014085	-50.868482	6.387677	3	210	KEEP	---	---	---	---	0	3	126	109	-1	capture	Missense_Mutation	SNP	57746279	57746279	CLTC	17	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	3531	131
GAA	2548	broad.mit.edu	37	17	78082609	78082609	+	Silent	SNP	G	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78082609G>T	uc002jxo.2	+	9	1490	c.1308G>T	c.(1306-1308)CGG>CGT	p.R436R	GAA_uc002jxp.2_Silent_p.R436R|GAA_uc002jxq.2_Silent_p.R436R	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein	436					cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	AGGGCGGCCGGCGCTACATGA	0.642																0.5	54.051782	54.051782	18	18	KEEP	---	---	---	---	14	9	9	9	0.608695652174	capture	Silent	SNP	78082609	78082609	GAA	17	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	6089	131
CEP76	79959	broad.mit.edu	37	18	12699056	12699056	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:12699056G>A	uc002kri.2	-	4	598	c.442C>T	c.(442-444)CGT>TGT	p.R148C	PSMG2_uc002krg.2_Intron|CEP76_uc002krh.3_5'UTR|CEP76_uc010wzz.1_Intron|CEP76_uc010xaa.1_5'UTR|CEP76_uc010xab.1_3'UTR	NM_024899	NP_079175	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	148					G2/M transition of mitotic cell cycle|regulation of centriole replication	centriole|cytosol	protein binding				0						GGTTTAGAACGAAAACGTTGG	0.373																0.353659	147.286315	150.388965	58	106	KEEP	---	---	---	---	26	34	59	60	-1	capture	Missense_Mutation	SNP	12699056	12699056	CEP76	18	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3229	131
MC5R	4161	broad.mit.edu	37	18	13826367	13826367	+	Silent	SNP	G	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:13826367G>T	uc010xaf.1	+	1	603	c.603G>T	c.(601-603)CTG>CTT	p.L201L		NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor	201	Helical; Name=5; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)|lung(2)|breast(1)	6						TGTTCCTCCTGGTGTCTCTGT	0.587																0.392473	767.63557	775.19589	292	452	KEEP	---	---	---	---	175	219	297	309	0.444162436548	capture	Silent	SNP	13826367	13826367	MC5R	18	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	9280	131
POTEC	388468	broad.mit.edu	37	18	14542740	14542740	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14542740G>A	uc010dln.2	-	1	860	c.406C>T	c.(406-408)CGT>TGT	p.R136C	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	136										skin(3)	3						TCTTCTCGACGGACGTGGTAC	0.602																0.373077	268.688572	272.374202	97	163	KEEP	---	---	---	---	49	55	101	102	-1	capture	Missense_Mutation	SNP	14542740	14542740	POTEC	18	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12164	131
ATP8B1	5205	broad.mit.edu	37	18	55328473	55328473	+	Silent	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:55328473C>T	uc002lgw.2	-	21	2640	c.2640G>A	c.(2638-2640)GTG>GTA	p.V880V	uc002lgu.1_Intron|uc002lgv.1_Intron	NM_005603	NP_005594	O43520	AT8B1_HUMAN	ATPase, class I, type 8B, member 1	880	Cytoplasmic (Potential).				ATP biosynthetic process|bile acid and bile salt transport|negative regulation of transcription, DNA-dependent	apical plasma membrane|integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			breast(5)|ovary(2)|central_nervous_system(2)|lung(1)	10		Colorectal(73;0.229)				TGTACCTCTTCACCAGGTCCA	0.582					950							Byler_disease				0.263636	69.317905	74.880268	29	81	KEEP	---	---	---	---	28	13	58	29	-1	capture	Silent	SNP	55328473	55328473	ATP8B1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	1185	131
TNFSF9	8744	broad.mit.edu	37	19	6535064	6535064	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6535064C>T	uc002mfh.2	+	3	790	c.752C>T	c.(751-753)CCG>CTG	p.P251L		NM_003811	NP_003802	P41273	TNFL9_HUMAN	tumor necrosis factor (ligand) superfamily,	251	Extracellular (Potential).				apoptosis|cell proliferation|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1						CTCCCTTCACCGAGGTCGGAA	0.637																0.340426	42.185792	43.243537	16	31	KEEP	---	---	---	---	11	7	13	18	-1	capture	Missense_Mutation	SNP	6535064	6535064	TNFSF9	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16195	131
MUC16	94025	broad.mit.edu	37	19	9068085	9068085	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9068085G>A	uc002mkp.2	-	3	19565	c.19361C>T	c.(19360-19362)GCG>GTG	p.A6454V		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6456	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTGTGATGTCGCCCTATGAGG	0.498																0.445055	428.768661	429.728891	162	202	KEEP	---	---	---	---	104	81	114	108	-1	capture	Missense_Mutation	SNP	9068085	9068085	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9883	131
SLC25A42	284439	broad.mit.edu	37	19	19217127	19217127	+	Missense_Mutation	SNP	A	C	C	rs145774094	by1000genomes	TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19217127A>C	uc002nlf.1	+	6	581	c.430A>C	c.(430-432)ACA>CCA	p.T144P	SLC25A42_uc010xqn.1_Missense_Mutation_p.T196P	NM_178526	NP_848621	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	144	Helical; Name=3; (Potential).|Solcar 2.				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			GGCTGGAACGACAGCCGCTTC	0.642																0.140845	-1.819377	7.576898	10	61	KEEP	---	---	---	---	19	6	56	53	-1	capture	Missense_Mutation	SNP	19217127	19217127	SLC25A42	19	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	14399	131
MLL4	9757	broad.mit.edu	37	19	36219962	36219962	+	Silent	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36219962G>A	uc010eei.2	+	22	4764	c.4764G>A	c.(4762-4764)GGG>GGA	p.G1588G		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	1588					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TCAAATACGGGGATGCAGACT	0.607																0.409836	154.027711	154.894049	50	72	KEEP	---	---	---	---	24	31	34	44	-1	capture	Silent	SNP	36219962	36219962	MLL4	19	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	9535	131
NLRP12	91662	broad.mit.edu	37	19	54314124	54314124	+	Silent	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54314124G>A	uc002qch.3	-	3	1009	c.789C>T	c.(787-789)AGC>AGT	p.S263S	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Silent_p.S263S|NLRP12_uc002qcj.3_Silent_p.S263S|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Silent_p.S263S	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	263	NACHT.				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GGTCTTGCATGCTGCATTCCG	0.567																0.373494	78.695205	79.864828	31	52	KEEP	---	---	---	---	17	17	31	27	-1	capture	Silent	SNP	54314124	54314124	NLRP12	19	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	10381	131
THADA	63892	broad.mit.edu	37	2	43768396	43768396	+	Missense_Mutation	SNP	T	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:43768396T>G	uc002rsw.3	-	21	3518	c.3166A>C	c.(3166-3168)AGT>CGT	p.S1056R	THADA_uc010far.2_Missense_Mutation_p.S325R|THADA_uc002rsx.3_Missense_Mutation_p.S1056R|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_Missense_Mutation_p.S765R|THADA_uc010fat.1_Missense_Mutation_p.S203R|THADA_uc002rta.2_Missense_Mutation_p.S766R	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1056							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TCCTTCATACTTCTCCAACAA	0.418																0.411028	501.423168	504.182821	164	235	KEEP	---	---	---	---	85	100	124	145	-1	capture	Missense_Mutation	SNP	43768396	43768396	THADA	2	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	15725	131
SLC9A4	389015	broad.mit.edu	37	2	103095704	103095704	+	Silent	SNP	C	T	T	rs115868705	byFrequency;by1000genomes	TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103095704C>T	uc002tbz.3	+	2	1120	c.663C>T	c.(661-663)AAC>AAT	p.N221N		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	221	Cytoplasmic (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						CGCGCGTGAACGAGCAGCTCT	0.612																0.410714	60.812468	61.202642	23	33	KEEP	---	---	---	---	13	17	17	26	-1	capture	Silent	SNP	103095704	103095704	SLC9A4	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14608	131
VIL1	7429	broad.mit.edu	37	2	219295468	219295468	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219295468G>C	uc002via.2	+	10	1034	c.969G>C	c.(967-969)CAG>CAC	p.Q323H	VIL1_uc010zke.1_Missense_Mutation_p.Q12H|VIL1_uc002vib.2_Missense_Mutation_p.Q323H|VIL1_uc002vic.1_Missense_Mutation_p.Q323H	NM_007127	NP_009058	P09327	VILI_HUMAN	villin 1	323	Core.				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGCCAAGCAGTACCCACCAA	0.557																0.330986	154.979941	158.572872	47	95	KEEP	---	---	---	---	25	27	41	66	-1	capture	Missense_Mutation	SNP	219295468	219295468	VIL1	2	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	17046	131
JPH2	57158	broad.mit.edu	37	20	42788558	42788558	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42788558G>C	uc002xli.1	-	2	1742	c.869C>G	c.(868-870)ACC>AGC	p.T290S		NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1	290	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GCCCATGTAGGTCTCGGTGGT	0.701																0.5	67.30686	67.30686	19	19	KEEP	---	---	---	---	11	10	9	15	-1	capture	Missense_Mutation	SNP	42788558	42788558	JPH2	20	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	7884	131
CDH22	64405	broad.mit.edu	37	20	44828064	44828064	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44828064G>A	uc002xrm.2	-	7	1822	c.1421C>T	c.(1420-1422)GCG>GTG	p.A474V	CDH22_uc010ghk.1_Missense_Mutation_p.A474V	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN	cadherin 22 precursor	474	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				CAGCTCACCCGCCTCCATGGC	0.667																0.428571	30.090859	30.216076	12	16	KEEP	---	---	---	---	5	7	10	8	-1	capture	Missense_Mutation	SNP	44828064	44828064	CDH22	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3078	131
USP16	10600	broad.mit.edu	37	21	30409731	30409731	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:30409731G>A	uc002ymy.2	+	6	785	c.583G>A	c.(583-585)GTG>ATG	p.V195M	USP16_uc002ymx.2_Missense_Mutation_p.V194M|USP16_uc002ymw.2_Missense_Mutation_p.V195M|USP16_uc011acm.1_Missense_Mutation_p.V180M|USP16_uc011acn.1_Intron|USP16_uc011aco.1_5'Flank	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN	ubiquitin specific protease 16 isoform a	195					cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(2)|breast(1)|pancreas(1)	4						CCAAATAACCGTGAAAGGACT	0.348	Melanoma(92;625 1444 27493 34101 44971)															0.46281	156.680732	156.827026	56	65	KEEP	---	---	---	---	30	35	36	41	-1	capture	Missense_Mutation	SNP	30409731	30409731	USP16	21	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16929	131
TUBGCP6	85378	broad.mit.edu	37	22	50657589	50657589	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50657589G>A	uc003bkb.1	-	20	5046	c.4534C>T	c.(4534-4536)CAC>TAC	p.H1512Y	TUBGCP6_uc003bka.1_Missense_Mutation_p.H599Y|TUBGCP6_uc010har.1_Missense_Mutation_p.H1504Y|TUBGCP6_uc010has.1_RNA	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1512					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GCCTCCAGGTGCAGCTCCACG	0.642																0.480769	63.054522	63.072	25	27	KEEP	---	---	---	---	17	10	14	16	-1	capture	Missense_Mutation	SNP	50657589	50657589	TUBGCP6	22	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	16652	131
FGD5	152273	broad.mit.edu	37	3	14861427	14861427	+	Silent	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14861427G>A	uc003bzc.2	+	1	959	c.849G>A	c.(847-849)ACG>ACA	p.T283T	FGD5_uc011avk.1_Silent_p.T283T	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	283	Glu-rich.				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						AAGAGGCCACGGGTGTCACAG	0.607																0.466667	116.260952	116.344605	42	48	KEEP	---	---	---	---	18	31	25	26	-1	capture	Silent	SNP	14861427	14861427	FGD5	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5782	131
TRANK1	9881	broad.mit.edu	37	3	36874402	36874402	+	Silent	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:36874402C>T	uc003cgj.2	-	12	5192	c.4890G>A	c.(4888-4890)TCG>TCA	p.S1630S		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	2180					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						AGTTCATTTTCGACTGAACTA	0.378																0.516129	89.296318	89.310285	32	30	KEEP	---	---	---	---	14	19	21	11	-1	capture	Silent	SNP	36874402	36874402	TRANK1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	16337	131
ZNF167	55888	broad.mit.edu	37	3	44611913	44611913	+	Missense_Mutation	SNP	A	C	C			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:44611913A>C	uc010hin.2	+	6	1699	c.1311A>C	c.(1309-1311)AAA>AAC	p.K437N	ZNF167_uc003cnh.2_RNA|ZNF167_uc003cni.2_Intron|ZNF167_uc010hio.2_Missense_Mutation_p.K286N|ZNF167_uc003cnj.2_Missense_Mutation_p.K437N|ZNF167_uc003cnk.2_Intron	NM_018651	NP_061121	Q9P0L1	ZN167_HUMAN	zinc finger protein 167 isoform 1	437					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(197;0.0486)|Kidney(197;0.0609)		CAGGGGAAAAACCCTATGAAT	0.473	Esophageal Squamous(121;907 1626 38429 48584 52774)															0.393617	126.761528	127.690612	37	57	KEEP	---	---	---	---	14	25	29	29	-1	capture	Missense_Mutation	SNP	44611913	44611913	ZNF167	3	A	C	C	C	1	0	0	0	0	1	0	0	0	24	2	4	4	17621	131
AMT	275	broad.mit.edu	37	3	49455400	49455400	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49455400C>T	uc003cww.2	-	8	1013	c.884G>A	c.(883-885)CGC>CAC	p.R295H	AMT_uc011bcn.1_Intron|AMT_uc003cwx.2_Missense_Mutation_p.R295H|AMT_uc011bco.1_Missense_Mutation_p.R251H|AMT_uc003cwy.2_Missense_Mutation_p.R247H|AMT_uc011bcp.1_Missense_Mutation_p.R198H|AMT_uc011bcq.1_Missense_Mutation_p.R239H	NM_000481	NP_000472	P48728	GCST_HUMAN	aminomethyltransferase isoform 1 precursor	295					glycine catabolic process	mitochondrion	aminomethyltransferase activity|transaminase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	AGCTCGGCGGCGCTTCCCTGG	0.582																0.404255	49.634467	50.00482	19	28	KEEP	---	---	---	---	10	10	13	16	-1	capture	Missense_Mutation	SNP	49455400	49455400	AMT	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	589	131
CACNA1D	776	broad.mit.edu	37	3	53531323	53531323	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53531323C>T	uc003dgv.3	+	2	375	c.212C>T	c.(211-213)ACC>ATC	p.T71I	CACNA1D_uc003dgu.3_Missense_Mutation_p.T71I|CACNA1D_uc003dgy.3_Missense_Mutation_p.T71I	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	71	Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	ACTATGAGCACCTCTGCACCC	0.542																0.344444	164.483736	168.289633	62	118	KEEP	---	---	---	---	31	37	55	76	-1	capture	Missense_Mutation	SNP	53531323	53531323	CACNA1D	3	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	2517	131
GCET2	257144	broad.mit.edu	37	3	111846908	111846908	+	Silent	SNP	T	C	C			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111846908T>C	uc003dys.1	-	3	249	c.99A>G	c.(97-99)AGA>AGG	p.R33R	C3orf52_uc011bht.1_Intron|C3orf52_uc003dyr.1_Intron|GCET2_uc003dyt.1_5'UTR	NM_152785	NP_689998	Q8N6F7	GCET2_HUMAN	germinal center expressed transcript 2 isoform	33						mitochondrion					0						GATCCCAGCATCTAAAATACC	0.408																0.047619	-8.268187	10.026627	4	80	KEEP	---	---	---	---	3	1	43	51	-1	capture	Silent	SNP	111846908	111846908	GCET2	3	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	6228	131
SLC9A10	285335	broad.mit.edu	37	3	111898484	111898484	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111898484G>A	uc003dyu.2	-	23	3035	c.2813C>T	c.(2812-2814)CCG>CTG	p.P938L	SLC9A10_uc011bhu.1_Missense_Mutation_p.P201L|SLC9A10_uc010hqc.2_Missense_Mutation_p.P890L	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	938	cNMP.				cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						GTCAATTATCGGAAAATCTTT	0.358																0.36747	176.826707	179.391821	61	105	KEEP	---	---	---	---	39	27	64	49	-1	capture	Missense_Mutation	SNP	111898484	111898484	SLC9A10	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14602	131
PIK3CA	5290	broad.mit.edu	37	3	178916876	178916876	+	Missense_Mutation	SNP	G	A	A	rs121913287		TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916876G>A	uc003fjk.2	+	2	420	c.263G>A	c.(262-264)CGA>CAA	p.R88Q		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	88	PI3K-ABD.		R -> Q (in cancer; may disrupt the interaction between the PI3K-ABD domain and the N-terminal lobe of PI3K/PI4K kinase domain possibly affecting the conformation of the kinase domain).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.R88Q(26)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GAAACAAGACGACTTTGTGAC	0.363	Colon(199;1504 1750 3362 26421 31210 32040)	R88Q(SKUT1_SOFT_TISSUE)|R88Q(JHUEM1_ENDOMETRIUM)|R88Q(SNGM_ENDOMETRIUM)	57	p.R88Q(JHUEM1-Tumor)|p.R88Q(SNGM-Tumor)|p.R88Q(HT115-Tumor)|p.R88Q(SKUT1-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.439815	264.786471	265.469161	95	121	KEEP	---	---	---	---	37	64	68	65	-1	capture	Missense_Mutation	SNP	178916876	178916876	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11816	131
PIK3CA	5290	broad.mit.edu	37	3	178916936	178916936	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916936G>A	uc003fjk.2	+	2	480	c.323G>A	c.(322-324)CGT>CAT	p.R108H		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	108	PI3K-ABD.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.R108H(5)|p.G106_R108del(2)|p.R108P(1)|p.R108del(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GTAGGCAACCGTGAAGAAAAG	0.338	Colon(199;1504 1750 3362 26421 31210 32040)		57	p.R108H(HEC6-Tumor)|p.R108H(OC316-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.405229	168.509123	169.713061	62	91	KEEP	---	---	---	---	24	44	44	54	-1	capture	Missense_Mutation	SNP	178916936	178916936	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11816	131
MUC4	4585	broad.mit.edu	37	3	195484190	195484190	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195484190G>A	uc011bto.1	-	19	15072	c.14612C>T	c.(14611-14613)ACG>ATG	p.T4871M	MUC4_uc003fuz.2_Missense_Mutation_p.T597M|MUC4_uc003fva.2_Missense_Mutation_p.T479M|MUC4_uc003fvb.2_Missense_Mutation_p.T515M|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Missense_Mutation_p.T515M|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Missense_Mutation_p.T479M|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Missense_Mutation_p.T563M|MUC4_uc011bti.1_Missense_Mutation_p.T563M|MUC4_uc011btj.1_Missense_Mutation_p.T740M|MUC4_uc011btk.1_Missense_Mutation_p.T479M|MUC4_uc011btl.1_Missense_Mutation_p.T508M|MUC4_uc011btm.1_Missense_Mutation_p.T688M|MUC4_uc011btn.1_Missense_Mutation_p.T479M|MUC4_uc003fvo.2_Missense_Mutation_p.T763M|MUC4_uc003fvp.2_Missense_Mutation_p.T712M	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1756					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CCACAGCAACGTCCCATTCTC	0.572																0.367347	86.042576	87.570165	36	62	KEEP	---	---	---	---	17	26	41	31	-1	capture	Missense_Mutation	SNP	195484190	195484190	MUC4	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9888	131
MFSD7	84179	broad.mit.edu	37	4	680077	680077	+	Silent	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:680077C>T	uc003gay.2	-	3	366	c.309G>A	c.(307-309)GCG>GCA	p.A103A	MFSD7_uc003gaw.2_5'Flank|MFSD7_uc003gax.2_Silent_p.A103A|MFSD7_uc003gaz.2_Intron|MFSD7_uc003gba.2_Intron|MFSD7_uc003gbb.1_Silent_p.A39A	NM_032219	NP_115595	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing	103	Helical; (Potential).				transmembrane transport	integral to membrane					0						AGTTCAGCCACGCACCCAGGA	0.652																0.428571	92.665235	93.042325	36	48	KEEP	---	---	---	---	15	28	24	28	-1	capture	Silent	SNP	680077	680077	MFSD7	4	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	9449	131
KDR	3791	broad.mit.edu	37	4	55961059	55961059	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55961059G>A	uc003has.2	-	21	3183	c.2881C>T	c.(2881-2883)CGG>TGG	p.R961W	KDR_uc003hat.1_Missense_Mutation_p.R961W	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	961	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	TCCAAGCGCCGTTTCAGATCC	0.488					1022	Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			0.39819	233.939682	235.947145	88	133	KEEP	---	---	---	---	43	53	73	66	-1	capture	Missense_Mutation	SNP	55961059	55961059	KDR	4	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	8061	131
FBN2	2201	broad.mit.edu	37	5	127623046	127623046	+	Silent	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127623046C>T	uc003kuu.2	-	54	7273	c.6834G>A	c.(6832-6834)ACG>ACA	p.T2278T		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	2278	EGF-like 38; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CAATCGGGCACGTGCATTCAT	0.483					1552											0.396396	233.241187	235.329201	88	134	KEEP	---	---	---	---	53	47	86	65	-1	capture	Silent	SNP	127623046	127623046	FBN2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	5649	131
WNT8A	7478	broad.mit.edu	37	5	137426568	137426568	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137426568C>T	uc003lcd.1	+	6	867	c.862C>T	c.(862-864)CGT>TGT	p.R288C	BRD8_uc003lcc.1_Intron|WNT8A_uc011cyj.1_Missense_Mutation_p.R306C|WNT8A_uc011cyk.1_Missense_Mutation_p.R306C	NM_058244	NP_490645	Q9H1J5	WNT8A_HUMAN	wingless-type MMTV integration site family,	288					brain segmentation|canonical Wnt receptor signaling pathway involved in neural crest cell differentiation|cell migration involved in gastrulation|dorsal/ventral pattern formation|ectoderm development|endoderm development|eye development|hindbrain development|mesodermal cell fate commitment|negative regulation of Wnt receptor signaling pathway|neural crest cell fate commitment|neural plate pattern specification|notochord development|palate development|polarity specification of anterior/posterior axis|polarity specification of proximal/distal axis|positive regulation of fibroblast growth factor receptor signaling pathway|regulation of transcription involved in anterior/posterior axis specification|response to retinoic acid|somitogenesis|spinal cord anterior/posterior patterning|tail morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity			ovary(1)|lung(1)|breast(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GTGGGAGCGACGTAGCTGTGG	0.542																0.338843	99.604833	102.399228	41	80	KEEP	---	---	---	---	27	28	43	64	-1	capture	Missense_Mutation	SNP	137426568	137426568	WNT8A	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17277	131
DND1	373863	broad.mit.edu	37	5	140052370	140052370	+	Silent	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140052370G>A	uc003lgt.2	-	3	308	c.264C>T	c.(262-264)CGC>CGT	p.R88R		NM_194249	NP_919225	Q8IYX4	DND1_HUMAN	dead end homolog 1	88	RRM 1.				multicellular organismal development|negative regulation of gene silencing by miRNA	cytoplasm|nucleus	AU-rich element binding|nucleotide binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCATCATCAGGCGGAACTCGT	0.667																0.15	4.510772	6.860982	3	17	KEEP	---	---	---	---	0	3	10	8	-1	capture	Silent	SNP	140052370	140052370	DND1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	4622	131
GABRB2	2561	broad.mit.edu	37	5	160721276	160721276	+	Missense_Mutation	SNP	A	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:160721276A>G	uc003lys.1	-	11	1569	c.1351T>C	c.(1351-1353)TTT>CTT	p.F451L	GABRB2_uc011deh.1_Missense_Mutation_p.F252L|GABRB2_uc003lyr.1_Missense_Mutation_p.F413L|GABRB2_uc003lyt.1_Missense_Mutation_p.F413L|GABRB2_uc010jiu.1_Missense_Mutation_p.F350L	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	451	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TTTCGGCCAAAACTATGCCTG	0.527																0.36129	196.569421	199.189452	56	99	KEEP	---	---	---	---	27	36	55	65	-1	capture	Missense_Mutation	SNP	160721276	160721276	GABRB2	5	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	6109	131
ZNF451	26036	broad.mit.edu	37	6	57013164	57013164	+	Missense_Mutation	SNP	A	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:57013164A>G	uc003pdm.1	+	10	2505	c.2281A>G	c.(2281-2283)ACA>GCA	p.T761A	ZNF451_uc003pdl.2_Missense_Mutation_p.T761A|ZNF451_uc003pdn.1_Missense_Mutation_p.T761A|uc003pdq.1_Intron|ZNF451_uc003pdk.1_Missense_Mutation_p.T761A	NM_001031623	NP_001026794	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451 isoform 1	761	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			ATGTTCGGCAACAGCACAGAA	0.408																0.39759	115.163126	115.923203	33	50	KEEP	---	---	---	---	15	19	30	25	-1	capture	Missense_Mutation	SNP	57013164	57013164	ZNF451	6	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	17801	131
C6orf221	154288	broad.mit.edu	37	6	74073368	74073368	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:74073368C>T	uc003pgt.3	+	3	492	c.439C>T	c.(439-441)CGT>TGT	p.R147C		NM_001017361	NP_001017361	Q587J8	ECAT1_HUMAN	hypothetical protein LOC154288	147										skin(2)	2						CGGGACGCAGCGTTCGGTGGA	0.667																0.345455	90.215038	92.535396	38	72	KEEP	---	---	---	---	19	23	52	27	-1	capture	Missense_Mutation	SNP	74073368	74073368	C6orf221	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2332	131
HEY2	23493	broad.mit.edu	37	6	126080280	126080280	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:126080280G>A	uc003qad.2	+	5	537	c.346G>A	c.(346-348)GCT>ACT	p.A116T	HEY2_uc011ebr.1_Missense_Mutation_p.A70T	NM_012259	NP_036391	Q9UBP5	HEY2_HUMAN	hairy/enhancer-of-split related with YRPW motif	116	Transcriptional repression and interaction with NCOR1 and SIN3A (By similarity).				negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription initiation from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|smooth muscle cell differentiation|transcription, DNA-dependent	transcriptional repressor complex	histone deacetylase binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		TGACGCACACGCTCTTGCCAT	0.522																0.474453	176.354378	176.432517	65	72	KEEP	---	---	---	---	41	38	42	36	-1	capture	Missense_Mutation	SNP	126080280	126080280	HEY2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7004	131
CALCR	799	broad.mit.edu	37	7	93072970	93072970	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93072970C>T	uc003umv.1	-	10	1111	c.850G>A	c.(850-852)GTG>ATG	p.V284M	CALCR_uc011kia.1_Missense_Mutation_p.V64M|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.V250M|CALCR_uc003umw.2_Missense_Mutation_p.V250M	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	266	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	AACACAGCCACGACAATGAGT	0.448																0.265823	147.927547	159.666665	63	174	KEEP	---	---	---	---	30	41	93	101	-1	capture	Missense_Mutation	SNP	93072970	93072970	CALCR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2555	131
JHDM1D	80853	broad.mit.edu	37	7	139833358	139833358	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139833358G>A	uc003vvm.2	-	3	383	c.379C>T	c.(379-381)CGC>TGC	p.R127C		NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase	127					midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					ACTCGAGAGCGTAATTCCTTA	0.378																0.242798	127.994491	142.660845	59	184	KEEP	---	---	---	---	28	33	97	104	-1	capture	Missense_Mutation	SNP	139833358	139833358	JHDM1D	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7871	131
EPHB6	2051	broad.mit.edu	37	7	142568575	142568575	+	Missense_Mutation	SNP	T	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142568575T>A	uc011kst.1	+	20	3771	c.2984T>A	c.(2983-2985)CTG>CAG	p.L995Q	EPHB6_uc011ksu.1_Missense_Mutation_p.L995Q|EPHB6_uc003wbs.2_Missense_Mutation_p.L703Q|EPHB6_uc003wbt.2_Missense_Mutation_p.L469Q|EPHB6_uc003wbu.2_Missense_Mutation_p.L703Q|EPHB6_uc003wbv.2_Missense_Mutation_p.L379Q	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	995	SAM.|Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)					GGCATCACCCTGGCTGGCCAC	0.617					313											0.281879	104.501354	110.863302	42	107	KEEP	---	---	---	---	30	22	84	47	-1	capture	Missense_Mutation	SNP	142568575	142568575	EPHB6	7	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	5133	131
KEL	3792	broad.mit.edu	37	7	142638355	142638355	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142638355C>T	uc003wcb.2	-	19	2393	c.2183G>A	c.(2182-2184)CGC>CAC	p.R728H		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	728	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					GAGCTGGCAGCGGCTGGAGGG	0.567																0.229008	61.090896	69.910738	30	101	KEEP	---	---	---	---	29	34	73	94	-1	capture	Missense_Mutation	SNP	142638355	142638355	KEL	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8064	131
XKR6	286046	broad.mit.edu	37	8	11058779	11058779	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:11058779C>T	uc003wtk.1	-	1	97	c.70G>A	c.(70-72)GTG>ATG	p.V24M		NM_173683	NP_775954	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related	24	Gly-rich.					integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		CCGCTGCCCACCGCCTCGTCC	0.552																0.157895	4.311795	6.433937	3	16	KEEP	---	---	---	---	2	1	9	8	-1	capture	Missense_Mutation	SNP	11058779	11058779	XKR6	8	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	17316	131
TMEM215	401498	broad.mit.edu	37	9	32784817	32784817	+	Silent	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32784817C>T	uc003zri.3	+	2	1001	c.636C>T	c.(634-636)AAC>AAT	p.N212N		NM_212558	NP_997723	Q68D42	TM215_HUMAN	transmembrane protein 215	212						integral to membrane					0						ACAAGCAGAACAGCCCGTATG	0.493																0.366812	216.816765	220.397094	84	145	KEEP	---	---	---	---	48	46	78	85	-1	capture	Silent	SNP	32784817	32784817	TMEM215	9	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	16021	131
CCIN	881	broad.mit.edu	37	9	36170861	36170861	+	Silent	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:36170861C>T	uc003zzb.3	+	1	1473	c.1362C>T	c.(1360-1362)GAC>GAT	p.D454D		NM_005893	NP_005884	Q13939	CALI_HUMAN	calicin	454	Kelch 4.				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			ovary(1)|skin(1)	2			STAD - Stomach adenocarcinoma(86;0.228)			GCACTGGGGACGTGGTCCAGT	0.557																0.443902	243.583125	244.146503	91	114	KEEP	---	---	---	---	40	58	81	45	-1	capture	Silent	SNP	36170861	36170861	CCIN	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2851	131
FOXB2	442425	broad.mit.edu	37	9	79634932	79634932	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:79634932C>T	uc004ako.1	+	1	362	c.362C>T	c.(361-363)GCG>GTG	p.A121V		NM_001013735	NP_001013757	Q5VYV0	FOXB2_HUMAN	forkhead box B2	121					brain development|embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0						CACTTGCACGCGGGAAGCACC	0.507																0.543478	69.57227	69.647504	25	21	KEEP	---	---	---	---	17	14	13	13	-1	capture	Missense_Mutation	SNP	79634932	79634932	FOXB2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5937	131
ZNF618	114991	broad.mit.edu	37	9	116731434	116731434	+	Missense_Mutation	SNP	C	T	T	rs143368881	by1000genomes	TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116731434C>T	uc004bid.2	+	2	170	c.71C>T	c.(70-72)GCG>GTG	p.A24V	ZNF618_uc004bib.1_Missense_Mutation_p.A24V|ZNF618_uc004bic.2_Missense_Mutation_p.A24V|ZNF618_uc011lxi.1_Missense_Mutation_p.A24V|ZNF618_uc011lxj.1_Missense_Mutation_p.A24V	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	24					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAAAGCACTGCGAGCAGGTAC	0.557																0.426056	317.425682	318.752946	121	163	KEEP	---	---	---	---	76	71	112	88	-1	capture	Missense_Mutation	SNP	116731434	116731434	ZNF618	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17920	131
DBH	1621	broad.mit.edu	37	9	136517375	136517375	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136517375G>A	uc004cel.2	+	8	1352	c.1343G>A	c.(1342-1344)CGC>CAC	p.R448H		NM_000787	NP_000778	P09172	DOPO_HUMAN	dopamine beta hydroxylase precursor	448	Intragranular (Potential).				hormone biosynthetic process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Dopamine(DB00988)|Vitamin C(DB00126)	CAGGAGATCCGCATGTTGAAG	0.672																0.459259	165.5207	165.717008	62	73	KEEP	---	---	---	---	45	27	52	37	-1	capture	Missense_Mutation	SNP	136517375	136517375	DBH	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4209	131
SLC34A3	142680	broad.mit.edu	37	9	140127306	140127306	+	Silent	SNP	C	T	T	rs142873841	byFrequency	TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140127306C>T	uc004cmf.1	+	5	561	c.375C>T	c.(373-375)GGC>GGT	p.G125G	SLC34A3_uc004cmc.1_5'UTR|SLC34A3_uc004cmd.1_Silent_p.G125G|SLC34A3_uc011met.1_Silent_p.G125G	NM_080877	NP_543153	Q8N130	NPT2C_HUMAN	solute carrier family 34 (sodium phosphate),	125	Helical; Name=M2; (Potential).				cellular phosphate ion homeostasis	apical plasma membrane|integral to membrane	sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		TGGTCATTGGCGTGCTGGTCA	0.617																0.564103	59.881702	60.030244	22	17	KEEP	---	---	---	---	14	8	8	9	-1	capture	Silent	SNP	140127306	140127306	SLC34A3	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14461	131
F9	2158	broad.mit.edu	37	X	138643736	138643736	+	Nonsense_Mutation	SNP	C	T	T	rs137852250		TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138643736C>T	uc004fas.1	+	8	921	c.892C>T	c.(892-894)CGA>TGA	p.R298*	F9_uc004fat.1_Nonsense_Mutation_p.R260*	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein	298	Peptidase S1.				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)	AAATGTGATTCGAATTATTCC	0.353																0.875	373.197456	391.872856	119	17	KEEP	---	---	---	---	64	62	11	8	-1	capture	Nonsense_Mutation	SNP	138643736	138643736	F9	23	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	5305	131
CAMTA1	23261	broad.mit.edu	37	1	7811328	7811329	+	Frame_Shift_Ins	INS	-	A	A			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:7811328_7811329insA	uc001aoi.2	+	20	4966_4967	c.4759_4760insA	c.(4759-4761)CAAfs	p.Q1587fs	CAMTA1_uc001aok.3_Frame_Shift_Ins_p.Q630fs|CAMTA1_uc001aoj.2_Frame_Shift_Ins_p.Q550fs|CAMTA1_uc009vmf.2_Frame_Shift_Ins_p.Q177fs	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	1587	IQ 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		TTACTATGAACAAAAAAAATTC	0.470																0.01			8	531		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	7811328	7811329	CAMTA1	1	-	A	A	A	1	0	1	1	0	0	0	0	0	221	17	5	5	2589	131
TMTC3	160418	broad.mit.edu	37	12	88566417	88566417	+	Frame_Shift_Del	DEL	T	-	-			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:88566417delT	uc001tau.2	+	8	1314	c.1094delT	c.(1093-1095)CTTfs	p.L365fs	TMTC3_uc009zsm.2_RNA	NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat	365	Helical; (Potential).					integral to membrane	binding			skin(1)	1						GCATCGAACCTTTTTTTTCCA	0.303																0.02			7	360		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	88566417	88566417	TMTC3	12	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	16145	131
RFX1	5989	broad.mit.edu	37	19	14104590	14104591	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14104590_14104591insG	uc002mxv.2	-	2	337_338	c.65_66insC	c.(64-66)CCGfs	p.P22fs	RFX1_uc010dzi.2_Frame_Shift_Ins_p.P22fs	NM_002918	NP_002909	P22670	RFX1_HUMAN	regulatory factor X1	22					immune response	nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			lung(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			gggcttgtggcggggcctgtgg	0.149																0.12			7	52		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	14104590	14104591	RFX1	19	-	G	G	G	1	0	1	1	0	0	0	0	0	340	27	5	5	13157	131
FBLN1	2192	broad.mit.edu	37	22	45944523	45944524	+	Frame_Shift_Ins	INS	-	CCAC	CCAC			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:45944523_45944524insCCAC	uc003bgj.1	+	13	1619_1620	c.1472_1473insCCAC	c.(1471-1473)GGCfs	p.G491fs	FBLN1_uc003bgg.1_Frame_Shift_Ins_p.G491fs|FBLN1_uc003bgh.2_Frame_Shift_Ins_p.G491fs|FBLN1_uc010gzz.2_Frame_Shift_Ins_p.G529fs|FBLN1_uc003bgi.1_Frame_Shift_Ins_p.G491fs	NM_006486	NP_006477	P23142	FBLN1_HUMAN	fibulin 1 isoform D	491	EGF-like 8; calcium-binding.				interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CCCACCGGGGGCCACATCTGCT	0.644																0.34			31	60		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	45944523	45944524	FBLN1	22	-	CCAC	CCAC	CCAC	1	0	1	1	0	0	0	0	0	546	42	5	5	5644	131
NOP16	51491	broad.mit.edu	37	5	175811029	175811030	+	Frame_Shift_Ins	INS	-	C	C			TCGA-12-5301-01	TCGA-12-5301-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:175811029_175811030insC	uc003mee.2	-	5	651_652	c.651_652insG	c.(649-654)GGGTTCfs	p.G217fs	NOP16_uc003med.2_Frame_Shift_Ins_p.G216fs			Q9Y3C1	NOP16_HUMAN	SubName: Full=NOP16 protein; SubName: Full=Putative uncharacterized protein HSPC111;	Error:Variant_position_missing_in_Q9Y3C1_after_alignment						nucleolus				ovary(1)|central_nervous_system(1)	2						TTTTCCGTGAACCCCCAGATGA	0.436																0.28			7	18		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	175811029	175811030	NOP16	5	-	C	C	C	1	0	1	1	0	0	0	0	0	14	2	5	5	10444	131
