Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ARHGEF16	27237	broad.mit.edu	37	1	3395016	3395016	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3395016G>A	uc001akg.3	+	12	1902	c.1654G>A	c.(1654-1656)GCC>ACC	p.A552T	ARHGEF16_uc001aki.2_Missense_Mutation_p.A264T|ARHGEF16_uc001akj.2_Missense_Mutation_p.A264T|ARHGEF16_uc010nzh.1_Missense_Mutation_p.A256T	NM_014448	NP_055263	Q5VV41	ARHGG_HUMAN	Rho guanine exchange factor 16	552	PH.				activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		CCAGGACTACGCCCAGATGAA	0.657																0.313725	170.119503	176.422824	64	140	KEEP	---	---	---	---	33	42	85	78	-1	capture	Missense_Mutation	SNP	3395016	3395016	ARHGEF16	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	892	139
HCRTR1	3061	broad.mit.edu	37	1	32084903	32084903	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32084903G>A	uc009vtx.2	+	3	495	c.110G>A	c.(109-111)CGC>CAC	p.R37H	HCRTR1_uc001btb.2_Intron|HCRTR1_uc001btc.3_Missense_Mutation_p.A11T|HCRTR1_uc001btd.2_Missense_Mutation_p.R37H|HCRTR1_uc010ogl.1_Missense_Mutation_p.R37H	NM_001525	NP_001516	O43613	OX1R_HUMAN	orexin receptor 1	37	Extracellular (Potential).				feeding behavior|neuropeptide signaling pathway|synaptic transmission	integral to plasma membrane				ovary(1)	1		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		TATCTGTGGCGCGATTATCTG	0.607																0.297143	424.068149	443.344084	156	369	KEEP	---	---	---	---	93	84	229	206	-1	capture	Missense_Mutation	SNP	32084903	32084903	HCRTR1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6928	139
KANK4	163782	broad.mit.edu	37	1	62740564	62740564	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:62740564C>T	uc001dah.3	-	3	589	c.212G>A	c.(211-213)CGA>CAA	p.R71Q	KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	71										ovary(3)|skin(2)|lung(1)	6						GCTGAAGTTTCGGGGCAGAGT	0.557																0.020576	-54.191397	8.321482	5	238	KEEP	---	---	---	---	2	4	163	130	-1	capture	Missense_Mutation	SNP	62740564	62740564	KANK4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7902	139
TGFBR3	7049	broad.mit.edu	37	1	92224221	92224221	+	Silent	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:92224221C>T	uc001doh.2	-	4	799	c.333G>A	c.(331-333)GTG>GTA	p.V111V	TGFBR3_uc009wde.2_Translation_Start_Site|TGFBR3_uc010osy.1_Silent_p.V69V|TGFBR3_uc001doi.2_Silent_p.V111V|TGFBR3_uc001doj.2_Silent_p.V111V	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	111	Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TCAGATGCCACACCAGGGGGT	0.507																0.477509	403.829125	403.956089	138	151	KEEP	---	---	---	---	90	57	83	77	-1	capture	Silent	SNP	92224221	92224221	TGFBR3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	210	17	2	2	15708	139
PSRC1	84722	broad.mit.edu	37	1	109823399	109823399	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:109823399C>T	uc001dxg.2	-	5	1116	c.994G>A	c.(994-996)GTT>ATT	p.V332I	PSRC1_uc001dxb.2_Missense_Mutation_p.V132I|PSRC1_uc001dxc.2_Missense_Mutation_p.V302I|PSRC1_uc001dxd.2_Missense_Mutation_p.V302I|PSRC1_uc001dxe.2_Missense_Mutation_p.V302I|PSRC1_uc001dxf.2_Missense_Mutation_p.G268D|PSRC1_uc001dxh.2_Missense_Mutation_p.V302I|PSRC1_uc001dxi.2_Missense_Mutation_p.V302I|PSRC1_uc001dxj.2_Missense_Mutation_p.V332I	NM_001032290	NP_001027461	Q6PGN9	PSRC1_HUMAN	proline/serine-rich coiled-coil 1 isoform c	332	Pro/Ser-rich.				cell division|microtubule bundle formation|mitotic metaphase plate congression|negative regulation of cell growth|positive regulation of microtubule polymerization|positive regulation of transcription, DNA-dependent|regulation of mitotic spindle organization	cytosol|midbody|spindle pole	microtubule binding				0		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0286)|Lung(183;0.0658)|COAD - Colon adenocarcinoma(174;0.112)|Epithelial(280;0.188)|all cancers(265;0.213)		GACCTCTTACCCTTGTGTCCA	0.552																0.392405	98.330079	99.123145	31	48	KEEP	---	---	---	---	18	14	26	23	-1	capture	Missense_Mutation	SNP	109823399	109823399	PSRC1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	12614	139
SYT6	148281	broad.mit.edu	37	1	114682285	114682285	+	Missense_Mutation	SNP	C	T	T	rs138691067		TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114682285C>T	uc001eev.2	-	2	459	c.209G>A	c.(208-210)CGT>CAT	p.R70H		NM_205848	NP_995320	Q5T7P8	SYT6_HUMAN	synaptotagmin VI	155	Cytoplasmic (Potential).				acrosomal vesicle exocytosis	cell junction|cytosol|integral to membrane|perinuclear endoplasmic reticulum|peripheral to membrane of membrane fraction|synaptic vesicle membrane	clathrin binding|metal ion binding|protein homodimerization activity|syntaxin binding|transporter activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCGGGTGTGACGCATGATGTG	0.622																0.429907	132.733923	133.191971	46	61	KEEP	---	---	---	---	33	16	40	25	-1	capture	Missense_Mutation	SNP	114682285	114682285	SYT6	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15366	139
FLG	2312	broad.mit.edu	37	1	152282266	152282266	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152282266C>T	uc001ezu.1	-	3	5132	c.5096G>A	c.(5095-5097)CGC>CAC	p.R1699H		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1699	Ser-rich.|Filaggrin 10.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCTTGTCTGCGCCCAGTGCC	0.572												Ichthyosis				0.409091	833.648697	838.735456	288	416	KEEP	---	---	---	---	181	148	250	206	-1	capture	Missense_Mutation	SNP	152282266	152282266	FLG	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5867	139
PKLR	5313	broad.mit.edu	37	1	155264433	155264433	+	Missense_Mutation	SNP	C	T	T	rs142395015	by1000genomes	TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155264433C>T	uc001fkb.3	-	6	844	c.805G>A	c.(805-807)GTC>ATC	p.V269I	RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Missense_Mutation_p.V238I	NM_000298	NP_000289	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC isoform 1	269					endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity			skin(4)|ovary(1)	5	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	AGGTCTCGGACGTCCTGCTCG	0.672																0.402299	98.901497	99.628821	35	52	KEEP	---	---	---	---	21	16	28	30	-1	capture	Missense_Mutation	SNP	155264433	155264433	PKLR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11879	139
KCNH1	3756	broad.mit.edu	37	1	210977475	210977475	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:210977475G>A	uc001hib.2	-	8	1666	c.1496C>T	c.(1495-1497)ACG>ATG	p.T499M	KCNH1_uc001hic.2_Missense_Mutation_p.T472M	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	499	Cytoplasmic (Potential).				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GAAAATAGTCGTCACATTCCC	0.478																0.142857	12.529225	20.278173	9	54	KEEP	---	---	---	---	2	7	33	24	-1	capture	Missense_Mutation	SNP	210977475	210977475	KCNH1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7953	139
FAM107B	83641	broad.mit.edu	37	10	14816316	14816316	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:14816316G>A	uc001ina.1	-	1	581	c.347C>T	c.(346-348)GCG>GTG	p.A116V	FAM107B_uc010qbu.1_RNA	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641	Error:Variant_position_missing_in_Q9H098_after_alignment										breast(4)	4						TTCACAGTCCGCCCCATCATC	0.572																0.028777	-26.808774	7.143707	4	135	KEEP	---	---	---	---	3	2	73	75	-1	capture	Missense_Mutation	SNP	14816316	14816316	FAM107B	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5344	139
AGAP5	729092	broad.mit.edu	37	10	75434500	75434500	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:75434500C>T	uc009xri.2	-	8	1959	c.1918G>A	c.(1918-1920)GCA>ACA	p.A640T	AGAP5_uc001juu.3_Missense_Mutation_p.A601T	NM_001144000	NP_001137472	A6NIR3	AGAP5_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	640	ANK 1.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						AGGAGCTGTGCCAGGACCACA	0.667																0.02	-45.372064	6.309541	4	196	KEEP	---	---	---	---	0	5	116	153	-1	capture	Missense_Mutation	SNP	75434500	75434500	AGAP5	10	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	371	139
C10orf12	26148	broad.mit.edu	37	10	98741767	98741767	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98741767G>A	uc001kmv.2	+	1	727	c.620G>A	c.(619-621)CGT>CAT	p.R207H	C10orf12_uc009xvg.1_Missense_Mutation_p.R517H	NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	207										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CCAACTGTTCGTACACTGGCC	0.433																0.669118	297.074154	300.529558	91	45	KEEP	---	---	---	---	46	59	28	25	-1	capture	Missense_Mutation	SNP	98741767	98741767	C10orf12	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1577	139
FANK1	92565	broad.mit.edu	37	10	127677132	127677132	+	Silent	SNP	G	A	A	rs146192515		TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:127677132G>A	uc001ljh.3	+	3	308	c.204G>A	c.(202-204)ACG>ACA	p.T68T	FANK1_uc010quk.1_Silent_p.T62T|FANK1_uc009yan.2_Silent_p.T68T|FANK1_uc001lji.2_Silent_p.T62T	NM_145235	NP_660278	Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains	68	Fibronectin type-III.					cytoplasm|nucleus				ovary(1)	1		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				GATATGCAACGAAGCATGTTG	0.512																0.054878	-15.562219	18.660221	9	155	KEEP	---	---	---	---	8	4	90	86	-1	capture	Silent	SNP	127677132	127677132	FANK1	10	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	5618	139
INS	3630	broad.mit.edu	37	11	2181082	2181082	+	Silent	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:2181082C>T	uc001lvn.1	-	3	388	c.333G>A	c.(331-333)TAG>TAA	p.*111*	INS-IGF2_uc001lvi.2_Intron|INS-IGF2_uc001lvm.2_Intron|INS_uc001lvo.1_Silent_p.*111*|INS_uc009ydg.1_Silent_p.*99*	NM_000207	NP_000198	P01308	INS_HUMAN	proinsulin precursor	111					activation of protein kinase B activity|acute-phase response|alpha-beta T cell activation|endocrine pancreas development|energy reserve metabolic process|fatty acid homeostasis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|glucose metabolic process|glucose transport|insulin receptor signaling pathway|MAPKKK cascade|negative regulation of acute inflammatory response|negative regulation of apoptosis|negative regulation of fatty acid metabolic process|negative regulation of feeding behavior|negative regulation of gluconeogenesis|negative regulation of glycogen catabolic process|negative regulation of lipid catabolic process|negative regulation of NAD(P)H oxidase activity|negative regulation of protein catabolic process|negative regulation of protein secretion|negative regulation of proteolysis|negative regulation of respiratory burst involved in inflammatory response|negative regulation of vasodilation|positive regulation of cell differentiation|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cytokine secretion|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin receptor signaling pathway|positive regulation of lipid biosynthetic process|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric oxide biosynthetic process|positive regulation of nitric-oxide synthase activity|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein autophosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of respiratory burst|positive regulation of vasodilation|regulation of cellular amino acid metabolic process|regulation of insulin secretion|regulation of transmembrane transporter activity|wound healing	endoplasmic reticulum lumen|endosome lumen|extracellular space	hormone activity|insulin receptor binding|insulin-like growth factor receptor binding				0		Lung NSC(207;8.94e-06)|all_epithelial(84;3.17e-05)|all_lung(207;3.67e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.14)		CGGGCTGCGTCTAGTTGCAGT	0.612																0.230769	7.717882	8.581667	3	10	KEEP	---	---	---	---	3	1	7	8	-1	capture	Silent	SNP	2181082	2181082	INS	11	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	7685	139
SLC5A12	159963	broad.mit.edu	37	11	26734241	26734241	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:26734241G>A	uc001mra.2	-	2	665	c.352C>T	c.(352-354)CGA>TGA	p.R118*	SLC5A12_uc001mrb.2_RNA|SLC5A12_uc001mrc.3_Nonsense_Mutation_p.R118*	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose	118	Cytoplasmic (Potential).				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						TTGTTGAATCGTAGTTGTAAG	0.418																0.2875	243.367332	256.328113	92	228	KEEP	---	---	---	---	54	48	130	110	-1	capture	Nonsense_Mutation	SNP	26734241	26734241	SLC5A12	11	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	14556	139
LRRC4C	57689	broad.mit.edu	37	11	40135944	40135944	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:40135944G>T	uc001mxa.1	-	2	3863	c.1899C>A	c.(1897-1899)GAC>GAA	p.D633E	LRRC4C_uc001mxc.1_Missense_Mutation_p.D629E|LRRC4C_uc001mxd.1_Missense_Mutation_p.D629E|LRRC4C_uc001mxb.1_Missense_Mutation_p.D629E	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	633					regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				CTTGTACATTGTCTTTAGAGT	0.274																0.543689	180.300536	180.470733	56	47	KEEP	---	---	---	---	33	26	26	24	0.559322033898	capture	Missense_Mutation	SNP	40135944	40135944	LRRC4C	11	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	8923	139
OR5AR1	219493	broad.mit.edu	37	11	56431699	56431699	+	Missense_Mutation	SNP	G	A	A	rs138342920		TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56431699G>A	uc010rjm.1	+	1	538	c.538G>A	c.(538-540)GAA>AAA	p.E180K		NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR,	180	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TTTCTTCTGCGAAATCCCACC	0.483																0.226316	105.452027	118.50045	43	147	KEEP	---	---	---	---	27	25	90	70	-1	capture	Missense_Mutation	SNP	56431699	56431699	OR5AR1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11049	139
OR9G4	283189	broad.mit.edu	37	11	56511283	56511283	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56511283A>T	uc010rjo.1	-	1	5	c.5T>A	c.(4-6)ATT>AAT	p.I2N		NM_001005284	NP_001005284	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G,	2	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						AGAAGGGAAAATCATCACTTA	0.383																0.165468	46.53594	61.297016	23	116	KEEP	---	---	---	---	16	12	74	63	-1	capture	Missense_Mutation	SNP	56511283	56511283	OR9G4	11	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	11155	139
OR4D6	219983	broad.mit.edu	37	11	59224665	59224665	+	Missense_Mutation	SNP	G	A	A	rs144983296	by1000genomes	TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59224665G>A	uc010rku.1	+	1	232	c.232G>A	c.(232-234)GTC>ATC	p.V78I		NM_001004708	NP_001004708	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D,	78	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						ATCTATCACCGTCCCCAAGTT	0.468																0.530201	253.035075	253.153663	79	70	KEEP	---	---	---	---	56	31	37	37	-1	capture	Missense_Mutation	SNP	59224665	59224665	OR4D6	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10962	139
ARHGEF17	9828	broad.mit.edu	37	11	73073628	73073628	+	Silent	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:73073628G>A	uc001otu.2	+	14	4866	c.4845G>A	c.(4843-4845)TCG>TCA	p.S1615S		NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1615					actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						TTGCAGGCTCGGGCTTGGAGA	0.706																0.428571	27.875525	27.968021	9	12	KEEP	---	---	---	---	6	5	8	9	-1	capture	Silent	SNP	73073628	73073628	ARHGEF17	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	893	139
ODZ4	26011	broad.mit.edu	37	11	78383335	78383335	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:78383335C>T	uc001ozl.3	-	31	5999	c.5536G>A	c.(5536-5538)GTA>ATA	p.V1846I	ODZ4_uc001ozk.3_Missense_Mutation_p.V71I|ODZ4_uc009yvb.1_Missense_Mutation_p.V430I	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1846	Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						GTGCGTGTTACGCGATCAAAG	0.512																0.058824	-6.795295	10.532629	5	80	KEEP	---	---	---	---	2	3	55	33	-1	capture	Missense_Mutation	SNP	78383335	78383335	ODZ4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10742	139
PZP	5858	broad.mit.edu	37	12	9346769	9346769	+	Silent	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:9346769G>A	uc001qvl.2	-	11	1187	c.1158C>T	c.(1156-1158)GAC>GAT	p.D386D	PZP_uc009zgl.2_Silent_p.D255D	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						AATAATTGGCGTCATTCACAG	0.408	Melanoma(125;1402 1695 4685 34487 38571)															0.349693	159.728886	162.976711	57	106	KEEP	---	---	---	---	31	28	60	52	-1	capture	Silent	SNP	9346769	9346769	PZP	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12764	139
NR1H4	9971	broad.mit.edu	37	12	100897268	100897268	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100897268G>A	uc001tht.1	+	1	131	c.103G>A	c.(103-105)GCG>ACG	p.A35T	NR1H4_uc001thp.1_Intron|NR1H4_uc001thq.1_Intron|NR1H4_uc010svj.1_Intron|NR1H4_uc001thr.1_Intron|NR1H4_uc010svk.1_Intron|NR1H4_uc001ths.1_Missense_Mutation_p.A35T	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	35					bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						TATGAAGCCCGCGAAAGGTAG	0.463																0.392857	31.317246	31.599182	11	17	KEEP	---	---	---	---	6	5	9	9	-1	capture	Missense_Mutation	SNP	100897268	100897268	NR1H4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	482	38	1	1	10526	139
RBM19	9904	broad.mit.edu	37	12	114377904	114377904	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:114377904G>A	uc009zwi.2	-	15	1943	c.1799C>T	c.(1798-1800)GCG>GTG	p.A600V	RBM19_uc001tvn.3_Missense_Mutation_p.A600V|RBM19_uc001tvm.2_Missense_Mutation_p.A600V	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	600	RRM 4.				multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CAGCTGGGCCGCCAGGGTGCC	0.627																0.238095	66.596111	74.486783	30	96	KEEP	---	---	---	---	27	30	67	61	-1	capture	Missense_Mutation	SNP	114377904	114377904	RBM19	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13016	139
CKAP2	26586	broad.mit.edu	37	13	53029668	53029668	+	Translation_Start_Site	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:53029668C>T	uc001vgv.2	+	1	174	c.-23C>T	c.(-25--21)GACGC>GATGC		CKAP2_uc001vgt.2_Translation_Start_Site|CKAP2_uc001vgu.2_Translation_Start_Site|CKAP2_uc010tha.1_5'Flank	NM_001098525	NP_001091995	Q8WWK9	CKAP2_HUMAN	cytoskeleton associated protein 2 isoform 2						apoptosis|cell cycle	centrosome|microtubule|spindle pole				ovary(1)|skin(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		AAAGCGGAGACGCATCCCCCG	0.662																0.71875	70.334012	71.710344	23	9	KEEP	---	---	---	---	11	16	3	6	-1	capture	Translation_Start_Site	SNP	53029668	53029668	CKAP2	13	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	3407	139
SLC7A8	23428	broad.mit.edu	37	14	23600746	23600746	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23600746C>T	uc001wiz.2	-	8	1763	c.1037G>A	c.(1036-1038)CGA>CAA	p.R346Q	SLC7A8_uc001wiw.2_5'Flank|SLC7A8_uc001wix.2_Missense_Mutation_p.R143Q|SLC7A8_uc010tnk.1_Missense_Mutation_p.R122Q|SLC7A8_uc010tnl.1_Missense_Mutation_p.R241Q|SLC7A8_uc001wiy.2_RNA|SLC7A8_uc010akj.2_Intron	NM_012244	NP_036376	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (cationic amino acid	346					blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity			ovary(1)	1	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	GTGGCCCTCTCGGGCTCCAGC	0.592																0.474576	83.699342	83.732107	28	31	KEEP	---	---	---	---	18	13	13	20	-1	capture	Missense_Mutation	SNP	23600746	23600746	SLC7A8	14	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14596	139
SPTB	6710	broad.mit.edu	37	14	65261276	65261276	+	Silent	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:65261276C>T	uc001xht.2	-	12	1758	c.1704G>A	c.(1702-1704)CAG>CAA	p.Q568Q	SPTB_uc001xhr.2_Silent_p.Q568Q|SPTB_uc001xhs.2_Silent_p.Q568Q|SPTB_uc001xhu.2_Silent_p.Q568Q	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	568	Spectrin 3.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		ACTTGTGCTTCTGTAGCAGGT	0.522																0.414729	335.970315	337.632671	107	151	KEEP	---	---	---	---	79	44	109	58	-1	capture	Silent	SNP	65261276	65261276	SPTB	14	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	15010	139
EXD2	55218	broad.mit.edu	37	14	69702870	69702870	+	Splice_Site	SNP	G	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:69702870G>T	uc001xkt.2	+	8	1440	c.781_splice	c.e8+1	p.E261_splice	EXD2_uc001xku.2_Splice_Site_p.E131_splice|EXD2_uc001xkv.2_Splice_Site_p.E386_splice|EXD2_uc001xkw.2_Splice_Site_p.E261_splice|EXD2_uc010aqt.2_Splice_Site_p.E386_splice|EXD2_uc010tte.1_Splice_Site_p.E386_splice|EXD2_uc001xky.2_Splice_Site_p.E261_splice	NM_018199	NP_060669	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						GGCATTGGTGGTATGAGATTC	0.478																0.478528	258.042576	258.107919	78	85	KEEP	---	---	---	---	52	29	45	44	0.641975308642	capture	Splice_Site	SNP	69702870	69702870	EXD2	14	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	5253	139
CAPN3	825	broad.mit.edu	37	15	42700426	42700426	+	Silent	SNP	G	A	A	rs28364528	byFrequency	TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42700426G>A	uc001zpn.1	+	16	2124	c.1818G>A	c.(1816-1818)TCG>TCA	p.S606S	CAPN3_uc001zpk.1_Silent_p.S373S|CAPN3_uc001zpl.1_Silent_p.S513S|CAPN3_uc010udf.1_Silent_p.S519S|CAPN3_uc010udg.1_Silent_p.S471S|CAPN3_uc001zpo.1_Silent_p.S600S|CAPN3_uc001zpp.1_Intron|CAPN3_uc001zpq.1_Silent_p.S94S|CAPN3_uc010bcv.1_Intron|CAPN3_uc001zpr.1_5'UTR|CAPN3_uc001zps.1_Intron|CAPN3_uc001zpt.1_Intron	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a	606	Linker.		S -> L (in LGMD2A).		muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		TCTTCGTTTCGGACAGAGCAA	0.532																0.21	49.652132	57.410467	21	79	KEEP	---	---	---	---	13	9	42	45	-1	capture	Silent	SNP	42700426	42700426	CAPN3	15	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2604	139
GOLGA6B	55889	broad.mit.edu	37	15	72954655	72954655	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:72954655G>A	uc010uks.1	+	11	951	c.910G>A	c.(910-912)GCC>ACC	p.A304T		NM_018652	NP_061122	A6NDN3	GOG6B_HUMAN	golgi autoantigen, golgin subfamily a, 6B	304	Potential.										0						ACAAGATGAGGCCAAACACCT	0.542																0.48227	211.592163	211.630776	68	73	KEEP	---	---	---	---	38	54	72	77	-1	capture	Missense_Mutation	SNP	72954655	72954655	GOLGA6B	15	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	6494	139
ACAN	176	broad.mit.edu	37	15	89391161	89391161	+	Missense_Mutation	SNP	C	T	T	rs143697605	by1000genomes	TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89391161C>T	uc010upo.1	+	9	1998	c.1624C>T	c.(1624-1626)CGG>TGG	p.R542W	ACAN_uc002bmx.2_Missense_Mutation_p.R542W|ACAN_uc010upp.1_Missense_Mutation_p.R542W|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	542					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TGTGAGCCCCCGGACCCCATG	0.607																0.292929	73.630638	77.434378	29	70	KEEP	---	---	---	---	13	17	38	33	-1	capture	Missense_Mutation	SNP	89391161	89391161	ACAN	15	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	117	139
ACAN	176	broad.mit.edu	37	15	89401858	89401858	+	Silent	SNP	A	G	G			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89401858A>G	uc010upo.1	+	12	6416	c.6042A>G	c.(6040-6042)GTA>GTG	p.V2014V	ACAN_uc010upp.1_Silent_p.V2014V|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	2014					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CCACCAATGTAAGTGGAGAAT	0.522																0.044118	-8.031531	7.09376	3	65	KEEP	---	---	---	---	3	0	44	35	-1	capture	Silent	SNP	89401858	89401858	ACAN	15	A	G	G	G	1	0	0	0	0	0	0	0	1	158	13	3	3	117	139
MYH2	4620	broad.mit.edu	37	17	10447064	10447064	+	Silent	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10447064G>A	uc010coi.2	-	8	833	c.705C>T	c.(703-705)AAC>AAT	p.N235N	uc002gml.1_Intron|MYH2_uc002gmp.3_Silent_p.N235N|MYH2_uc010coj.2_Silent_p.N235N	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	235	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						CGGTCTTGGCGTTGCCAAAGG	0.478																0.823171	458.622134	474.759672	135	29	KEEP	---	---	---	---	101	64	31	29	-1	capture	Silent	SNP	10447064	10447064	MYH2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9945	139
HOXB3	3213	broad.mit.edu	37	17	46628102	46628102	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:46628102G>A	uc002inn.2	-	2	1290	c.890C>T	c.(889-891)GCC>GTC	p.A297V	HOXB3_uc010wlm.1_Missense_Mutation_p.A224V|HOXB3_uc010dbf.2_Missense_Mutation_p.A297V|HOXB3_uc010dbg.2_Missense_Mutation_p.A297V|HOXB3_uc002ino.2_Missense_Mutation_p.A297V|HOXB3_uc010wlk.1_Missense_Mutation_p.A165V|HOXB3_uc010wll.1_Missense_Mutation_p.A224V	NM_002146	NP_002137	P14651	HXB3_HUMAN	homeobox B3	297					angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						ATTCTGGTGGGCTTTACCGAA	0.672														OREG0024516	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.027972	-28.2839	6.803763	4	139	KEEP	---	---	---	---	3	1	88	70	-1	capture	Missense_Mutation	SNP	46628102	46628102	HOXB3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7227	139
EPB41L3	23136	broad.mit.edu	37	18	5428401	5428401	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:5428401G>A	uc002kmt.1	-	9	1062	c.976C>T	c.(976-978)CGG>TGG	p.R326W	EPB41L3_uc010wzh.1_Missense_Mutation_p.R326W|EPB41L3_uc002kmu.1_Missense_Mutation_p.R326W|EPB41L3_uc010dkq.1_Missense_Mutation_p.R217W|EPB41L3_uc010dks.1_Missense_Mutation_p.R348W	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	326	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						ATTCGCAGCCGGTCGCGATAT	0.418																0.415686	335.120888	336.699237	106	149	KEEP	---	---	---	---	70	53	94	73	-1	capture	Missense_Mutation	SNP	5428401	5428401	EPB41L3	18	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	5109	139
DSG3	1830	broad.mit.edu	37	18	29038467	29038467	+	Silent	SNP	C	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29038467C>A	uc002kws.2	+	4	385	c.276C>A	c.(274-276)ATC>ATA	p.I92I		NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	92	Extracellular (Potential).|Cadherin 1.				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GAGTGGGAATCGATCAGCCGC	0.438																0.358491	112.030533	113.89535	38	68	KEEP	---	---	---	---	21	23	36	37	0.522727272727	capture	Silent	SNP	29038467	29038467	DSG3	18	C	A	A	A	1	0	0	0	0	0	0	0	1	395	31	4	4	4733	139
QTRT1	81890	broad.mit.edu	37	19	10823297	10823297	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10823297G>A	uc002mpr.2	+	7	879	c.854G>A	c.(853-855)CGG>CAG	p.R285Q	DNM2_uc010dxk.2_5'Flank	NM_031209	NP_112486	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	285					queuosine biosynthetic process	mitochondrion|nucleus|ribosome	metal ion binding|queuine tRNA-ribosyltransferase activity			skin(1)	1			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			TTCCCCACACGGACAGCGGTG	0.632																0.026946	-65.225529	17.331337	9	325	KEEP	---	---	---	---	7	3	193	163	-1	capture	Missense_Mutation	SNP	10823297	10823297	QTRT1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12780	139
AUP1	550	broad.mit.edu	37	2	74756731	74756731	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74756731G>A	uc010yry.1	-	1	244	c.26C>T	c.(25-27)CCG>CTG	p.P9L	AUP1_uc002sme.2_5'Flank|AUP1_uc002smf.2_Missense_Mutation_p.P9L|AUP1_uc002smg.2_RNA|AUP1_uc002smh.2_5'UTR|AUP1_uc010yrx.1_Missense_Mutation_p.R40W|HTRA2_uc002smi.1_5'UTR|HTRA2_uc002smj.1_5'UTR|HTRA2_uc002smk.1_5'UTR|HTRA2_uc002sml.1_5'UTR|HTRA2_uc002smm.1_5'Flank|HTRA2_uc002smn.1_5'Flank|HTRA2_uc010ffl.2_5'Flank			Q9Y679	AUP1_HUMAN	SubName: Full=cDNA FLJ58836, highly similar to Ancient ubiquitous protein 1;	9	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane|nucleus	protein binding				0						GAGCCGCTCCGGCCCCGGCCC	0.711																0.4	6.356658	6.397857	2	3	KEEP	---	---	---	---	1	1	1	3	-1	capture	Missense_Mutation	SNP	74756731	74756731	AUP1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1210	139
ASTL	431705	broad.mit.edu	37	2	96795617	96795617	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:96795617G>A	uc010yui.1	-	8	820	c.820C>T	c.(820-822)CGG>TGG	p.R274W		NM_001002036	NP_001002036	Q6HA08	ASTL_HUMAN	astacin-like metalloendopeptidase precursor	274					proteolysis		metalloendopeptidase activity|zinc ion binding				0						TTGAGGACCCGGGTGATGTCC	0.652																0.327586	52.503694	54.033497	19	39	KEEP	---	---	---	---	19	9	29	31	-1	capture	Missense_Mutation	SNP	96795617	96795617	ASTL	2	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	1054	139
ACMSD	130013	broad.mit.edu	37	2	135621053	135621053	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135621053G>T	uc002ttz.2	+	5	405	c.338G>T	c.(337-339)GGT>GTT	p.G113V	ACMSD_uc002tua.2_Missense_Mutation_p.G55V	NM_138326	NP_612199	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase	113					quinolinate metabolic process|tryptophan catabolic process	cytosol	aminocarboxymuconate-semialdehyde decarboxylase activity|metal ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.115)		AGGTTCGTGGGTCTGGGGACG	0.587																0.048485	-19.426823	16.329904	8	157	KEEP	---	---	---	---	6	5	81	86	0.545454545455	capture	Missense_Mutation	SNP	135621053	135621053	ACMSD	2	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	144	139
SCN7A	6332	broad.mit.edu	37	2	167263066	167263066	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167263066C>T	uc002udu.1	-	25	4200	c.4073G>A	c.(4072-4074)CGT>CAT	p.R1358H		NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	1358	Helical; Voltage-sensor; Name=S4 of repeat IV; (By similarity).				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						TTTTCCAAGACGCAGCATGTG	0.468																0.284091	132.171647	139.541374	50	126	KEEP	---	---	---	---	29	25	81	55	-1	capture	Missense_Mutation	SNP	167263066	167263066	SCN7A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13816	139
TTN	7273	broad.mit.edu	37	2	179575562	179575562	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179575562G>A	uc010zfg.1	-	95	24754	c.24530C>T	c.(24529-24531)ACG>ATG	p.T8177M	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.T4838M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9104							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGTGTGCCCGTGACGTGGCA	0.522					8722											0.430233	217.520307	218.250531	74	98	KEEP	---	---	---	---	41	39	52	55	-1	capture	Missense_Mutation	SNP	179575562	179575562	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16617	139
PLCL1	5334	broad.mit.edu	37	2	198968641	198968641	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198968641G>A	uc010fsp.2	+	5	3377	c.3086G>A	c.(3085-3087)TGG>TAG	p.W1029*	PLCL1_uc002uuv.3_Nonsense_Mutation_p.W950*	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	1029					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	AGCTTTGCTTGGAACATTACA	0.403																0.272727	43.701072	46.261268	15	40	KEEP	---	---	---	---	13	5	21	21	-1	capture	Nonsense_Mutation	SNP	198968641	198968641	PLCL1	2	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	11942	139
ESPNL	339768	broad.mit.edu	37	2	239039147	239039147	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:239039147C>T	uc002vxq.3	+	9	1902	c.1792C>T	c.(1792-1794)CGC>TGC	p.R598C	ESPNL_uc010fyw.2_Missense_Mutation_p.R294C	NM_194312	NP_919288	Q6ZVH7	ESPNL_HUMAN	espin-like	598										pancreas(1)	1		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CCACATCTCCCGCCTGGTACG	0.692																0.5	21.624344	21.624344	7	7	KEEP	---	---	---	---	7	3	4	9	-1	capture	Missense_Mutation	SNP	239039147	239039147	ESPNL	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5210	139
PLCB4	5332	broad.mit.edu	37	20	9370528	9370528	+	Silent	SNP	T	C	C			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:9370528T>C	uc002wnf.2	+	15	1297	c.1161T>C	c.(1159-1161)GAT>GAC	p.D387D	PLCB4_uc010gbw.1_Silent_p.D387D|PLCB4_uc010gbx.2_Silent_p.D387D|PLCB4_uc002wne.2_Silent_p.D387D|PLCB4_uc002wnh.2_Silent_p.D234D	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b	387	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						TTTTAAAGGATGTAATTCAAG	0.333																0.020619	-42.668696	7.258776	4	190	KEEP	---	---	---	---	1	3	117	89	-1	capture	Silent	SNP	9370528	9370528	PLCB4	20	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	11933	139
WFDC3	140686	broad.mit.edu	37	20	44417585	44417585	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44417585G>A	uc002xpf.1	-	3	280	c.196C>T	c.(196-198)CGA>TGA	p.R66*	DNTTIP1_uc002xpk.2_5'Flank|WFDC3_uc002xpj.1_RNA|WFDC3_uc002xph.1_RNA|WFDC3_uc010ghh.1_Intron	NM_080614	NP_542181	Q8IUB2	WFDC3_HUMAN	WAP four-disulfide core domain 3 precursor	66	WAP 1.					extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				GGAATGTCTCGGCAGATCCGA	0.527																0.060976	-16.352726	33.137971	15	231	KEEP	---	---	---	---	11	5	131	140	-1	capture	Nonsense_Mutation	SNP	44417585	44417585	WFDC3	20	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	17234	139
ZBP1	81030	broad.mit.edu	37	20	56191402	56191402	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:56191402T>G	uc002xyo.2	-	2	438	c.157A>C	c.(157-159)AAA>CAA	p.K53Q	ZBP1_uc010gjm.2_Missense_Mutation_p.K53Q|ZBP1_uc002xyp.2_Intron|ZBP1_uc010zzn.1_Missense_Mutation_p.K53Q	NM_030776	NP_110403	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1 isoform a	53	DRADA 1.					cytoplasm|nucleus	double-stranded RNA adenosine deaminase activity|left-handed Z-DNA binding|RNA binding			ovary(2)	2	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			AACTCCTTTTTCATTCGGTAG	0.597																0.355556	384.223102	390.009017	112	203	KEEP	---	---	---	---	69	54	139	89	-1	capture	Missense_Mutation	SNP	56191402	56191402	ZBP1	20	T	G	G	G	1	0	0	0	0	1	0	0	0	806	62	4	4	17401	139
RIPK4	54101	broad.mit.edu	37	21	43161460	43161460	+	Silent	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43161460G>A	uc002yzn.1	-	8	1941	c.1893C>T	c.(1891-1893)AAC>AAT	p.N631N		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	631						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						GGCTGCAGACGTTGACGTCGG	0.697					268											0.372727	117.549279	119.113348	41	69	KEEP	---	---	---	---	29	19	48	42	-1	capture	Silent	SNP	43161460	43161460	RIPK4	21	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13275	139
MCM5	4174	broad.mit.edu	37	22	35796511	35796511	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:35796511G>A	uc003anu.3	+	2	174	c.80G>A	c.(79-81)CGC>CAC	p.R27H	MCM5_uc010gwr.2_5'UTR|MCM5_uc003anv.3_Missense_Mutation_p.R27H	NM_006739	NP_006730	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	27					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)	1						GGGCAGGCCCGCAAATCGCAG	0.647																0.051282	-10.10689	6.480668	4	74	KEEP	---	---	---	---	2	3	43	43	-1	capture	Missense_Mutation	SNP	35796511	35796511	MCM5	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9303	139
APOBEC3H	164668	broad.mit.edu	37	22	39497965	39497965	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:39497965C>T	uc011aoh.1	+	4	527	c.461C>T	c.(460-462)CCG>CTG	p.P154L	APOBEC3H_uc011aoi.1_RNA|APOBEC3H_uc003axa.3_RNA	NM_181773	NP_861438	Q6NTF7	ABC3H_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	154					DNA cytosine deamination|negative regulation of retroviral genome replication|negative regulation of transposition	cytoplasm|nucleus	cytidine deaminase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Melanoma(58;0.04)					CACGAGAAACCGCTTTCCTTC	0.537																0.407143	181.757503	182.809766	57	83	KEEP	---	---	---	---	30	34	52	40	-1	capture	Missense_Mutation	SNP	39497965	39497965	APOBEC3H	22	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	788	139
CENPM	79019	broad.mit.edu	37	22	42342475	42342475	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42342475A>G	uc003bbn.2	-	2	151	c.83T>C	c.(82-84)CTG>CCG	p.L28P	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|CENPM_uc003bbm.2_5'UTR|CENPM_uc003bbo.2_Missense_Mutation_p.L28P|CENPM_uc003bbp.1_Missense_Mutation_p.L28P	NM_024053	NP_076958	Q9NSP4	CENPM_HUMAN	centromere protein M isoform a	28					mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleus					0						CAGCTGCTGCAGAAGAGCATC	0.662														OREG0026600	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.185185	10.152738	12.671919	5	22	KEEP	---	---	---	---	5	6	17	16	-1	capture	Missense_Mutation	SNP	42342475	42342475	CENPM	22	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	3205	139
CSPG5	10675	broad.mit.edu	37	3	47619104	47619104	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47619104T>C	uc003crp.3	-	2	588	c.412A>G	c.(412-414)ATC>GTC	p.I138V	CSPG5_uc003crn.2_5'UTR|CSPG5_uc003cro.3_Missense_Mutation_p.I138V|CSPG5_uc011bbb.1_5'UTR	NM_006574	NP_006565	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan	138	Extracellular (Potential).				cell differentiation|intracellular transport|nervous system development|regulation of growth	endoplasmic reticulum membrane|Golgi-associated vesicle membrane|integral to plasma membrane|membrane fraction	growth factor activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GGGGGCATGATTGACTGCCCG	0.692																0.409091	118.796571	119.427958	36	52	KEEP	---	---	---	---	23	23	47	29	-1	capture	Missense_Mutation	SNP	47619104	47619104	CSPG5	3	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	3926	139
KBTBD12	166348	broad.mit.edu	37	3	127682174	127682174	+	Silent	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:127682174C>T	uc010hsr.2	+	4	1638	c.1635C>T	c.(1633-1635)ACC>ACT	p.T545T	KBTBD12_uc003ejy.3_Silent_p.T152T|KBTBD12_uc010hsq.2_RNA|KBTBD12_uc003eka.3_Silent_p.T120T	NM_207335	NP_997218	Q3ZCT8	KBTBC_HUMAN	kelch domain containing 6	545	Kelch 3.									ovary(1)	1						CCAATTCCACCAATGCAGGGG	0.532																0.266667	22.185338	23.661387	8	22	KEEP	---	---	---	---	3	7	13	12	-1	capture	Silent	SNP	127682174	127682174	KBTBD12	3	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	7914	139
CNGA1	1259	broad.mit.edu	37	4	47938532	47938532	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:47938532G>T	uc003gxt.3	-	11	2245	c.1979C>A	c.(1978-1980)ACC>AAC	p.T660N	uc003gxr.1_Intron|CNGA1_uc003gxu.2_Missense_Mutation_p.T729N	NM_000087	NP_000078	P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1 isoform	660	Cytoplasmic (Potential).				response to stimulus|visual perception	integral to plasma membrane	cGMP binding|ion channel activity			ovary(2)	2						CTCAACCTTGGTTAATCTTTG	0.463																0.375	231.193196	234.048574	78	130	KEEP	---	---	---	---	38	42	83	53	0.475	capture	Missense_Mutation	SNP	47938532	47938532	CNGA1	4	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	3561	139
CENPE	1062	broad.mit.edu	37	4	104068560	104068560	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:104068560C>A	uc003hxb.1	-	29	4177	c.4087G>T	c.(4087-4089)GTT>TTT	p.V1363F	CENPE_uc003hxc.1_Missense_Mutation_p.V1338F	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	1363	Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TCATGTTTAACTTCAAGGGCT	0.343																0.341584	205.509052	209.990875	69	133	KEEP	---	---	---	---	41	35	96	52	0.460526315789	capture	Missense_Mutation	SNP	104068560	104068560	CENPE	4	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	3198	139
FBXW7	55294	broad.mit.edu	37	4	153244185	153244185	+	Nonsense_Mutation	SNP	G	A	A	rs144247898		TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:153244185G>A	uc003ims.2	-	12	2121	c.1972C>T	c.(1972-1974)CGA>TGA	p.R658*	FBXW7_uc011cii.1_Nonsense_Mutation_p.R658*|FBXW7_uc003imt.2_Nonsense_Mutation_p.R658*|FBXW7_uc011cih.1_Nonsense_Mutation_p.R482*|FBXW7_uc003imq.2_Nonsense_Mutation_p.R578*|FBXW7_uc003imr.2_Nonsense_Mutation_p.R540*	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	658	WD 7.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.R658*(1)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ACTAGGTTTCGAATAAATTCA	0.473					266	Mis|N|D|F		colorectal|endometrial|T-ALL								0.383562	245.044643	247.649227	84	135	KEEP	---	---	---	---	43	50	85	72	-1	capture	Nonsense_Mutation	SNP	153244185	153244185	FBXW7	4	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	5715	139
NPY5R	4889	broad.mit.edu	37	4	164271738	164271738	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:164271738G>C	uc003iqn.2	+	4	495	c.313G>C	c.(313-315)GAT>CAT	p.D105H		NM_006174	NP_006165	Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	105	Extracellular (Potential).				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane				lung(6)|skin(1)	7	all_hematologic(180;0.166)	Prostate(90;0.109)				TGTCTTGCTGGATCAGTGGAT	0.393	Melanoma(139;1287 1774 9781 19750 25599)															0.074803	8.522531	102.791734	38	470	KEEP	---	---	---	---	27	15	315	205	-1	capture	Missense_Mutation	SNP	164271738	164271738	NPY5R	4	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	10517	139
SLC9A3	6550	broad.mit.edu	37	5	482707	482707	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:482707C>T	uc003jbe.2	-	7	1424	c.1312G>A	c.(1312-1314)GTC>ATC	p.V438I	SLC9A3_uc011clx.1_Missense_Mutation_p.V438I	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen	438	Helical; Name=M/M10; (Potential).					cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GTGGTGCTGACGAACAGGTTC	0.652																0.446809	128.847398	129.077227	42	52	KEEP	---	---	---	---	23	20	30	28	-1	capture	Missense_Mutation	SNP	482707	482707	SLC9A3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14605	139
GPR98	84059	broad.mit.edu	37	5	89954051	89954051	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89954051A>G	uc003kju.2	+	21	4804	c.4708A>G	c.(4708-4710)AAT>GAT	p.N1570D	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1570	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AAAAAGTGACAATGCAAATGG	0.343																0.289157	71.566958	74.8738	24	59	KEEP	---	---	---	---	20	18	37	48	-1	capture	Missense_Mutation	SNP	89954051	89954051	GPR98	5	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	6654	139
NUP153	9972	broad.mit.edu	37	6	17616339	17616339	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17616339G>A	uc003ncd.1	-	22	4617	c.4417C>T	c.(4417-4419)CGC>TGC	p.R1473C	NUP153_uc011dje.1_Missense_Mutation_p.R1504C|NUP153_uc010jpl.1_Missense_Mutation_p.R1431C	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	1473					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TATTTCCTGCGTCTAACAGCA	0.388					1004											0.419355	196.549243	197.428848	65	90	KEEP	---	---	---	---	38	40	49	60	-1	capture	Missense_Mutation	SNP	17616339	17616339	NUP153	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10662	139
SUPT3H	8464	broad.mit.edu	37	6	44922308	44922308	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44922308C>T	uc003oxo.2	-	10	968	c.650G>A	c.(649-651)TGC>TAC	p.C217Y	SUPT3H_uc003oxn.1_Missense_Mutation_p.C206Y|SUPT3H_uc011dvv.1_Missense_Mutation_p.C54Y|SUPT3H_uc003oxp.2_Missense_Mutation_p.C206Y|SUPT3H_uc011dvw.1_Missense_Mutation_p.C120Y	NM_181356	NP_852001	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog isoform 2	288					histone deubiquitination|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	STAGA complex|transcription factor TFTC complex	DNA binding|transcription coactivator activity			ovary(2)|breast(1)	3						CATACTGCTGCAGTCCAACCA	0.348					2											0.38255	152.074695	153.897884	57	92	KEEP	---	---	---	---	42	30	56	49	-1	capture	Missense_Mutation	SNP	44922308	44922308	SUPT3H	6	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	15285	139
MEP1A	4224	broad.mit.edu	37	6	46761453	46761453	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46761453G>A	uc010jzh.1	+	3	187	c.145G>A	c.(145-147)GCT>ACT	p.A49T	MEP1A_uc011dwg.1_5'UTR|MEP1A_uc011dwh.1_Missense_Mutation_p.A77T|MEP1A_uc011dwi.1_5'UTR	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor	49					digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			AATCAATTTAGGTGAGTTCAA	0.313																0.403509	75.813489	76.277658	23	34	KEEP	---	---	---	---	18	8	24	19	-1	capture	Missense_Mutation	SNP	46761453	46761453	MEP1A	6	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	9388	139
HTR1E	3354	broad.mit.edu	37	6	87725079	87725079	+	Silent	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:87725079G>A	uc003pli.2	+	2	730	c.27G>A	c.(25-27)GAG>GAA	p.E9E		NM_000865	NP_000856	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E	9	Extracellular (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity			ovary(2)|skin(1)	3		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Eletriptan(DB00216)	GTACCACAGAGGCCAGCATGG	0.473																0.403509	74.513432	74.977628	23	34	KEEP	---	---	---	---	8	16	19	17	-1	capture	Silent	SNP	87725079	87725079	HTR1E	6	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	7364	139
GRM1	2911	broad.mit.edu	37	6	146720758	146720758	+	Silent	SNP	C	T	T	rs148042148		TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:146720758C>T	uc010khw.1	+	8	3053	c.2583C>T	c.(2581-2583)GGC>GGT	p.G861G	GRM1_uc010khv.1_Silent_p.G861G|GRM1_uc003qll.2_Silent_p.G861G|GRM1_uc011edz.1_Silent_p.G861G|GRM1_uc011eea.1_Silent_p.G861G	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	861	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	TGCATGTTGGCGATGGCAAGC	0.517																0.194444	14.503931	17.639701	7	29	KEEP	---	---	---	---	4	4	15	15	-1	capture	Silent	SNP	146720758	146720758	GRM1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6729	139
SYNE1	23345	broad.mit.edu	37	6	152763368	152763368	+	Missense_Mutation	SNP	G	A	A	rs140780725		TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152763368G>A	uc010kiw.2	-	31	4452	c.3850C>T	c.(3850-3852)CGG>TGG	p.R1284W	SYNE1_uc003qot.3_Missense_Mutation_p.R1291W|SYNE1_uc003qou.3_Missense_Mutation_p.R1284W|SYNE1_uc010kjb.1_Missense_Mutation_p.R1267W|SYNE1_uc003qow.2_Missense_Mutation_p.R579W|SYNE1_uc003qox.1_Missense_Mutation_p.R800W	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1284	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCTGAGATCCGCTTTGTCTTT	0.512													HNSCC(10;0.0054)			0.401869	123.800333	124.70213	43	64	KEEP	---	---	---	---	26	24	47	33	-1	capture	Missense_Mutation	SNP	152763368	152763368	SYNE1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	15333	139
SLC22A2	6582	broad.mit.edu	37	6	160662608	160662608	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160662608C>T	uc003qtf.2	-	9	1569	c.1399G>A	c.(1399-1401)GTC>ATC	p.V467I	SLC22A2_uc003qte.1_Missense_Mutation_p.V467I	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2	467	Helical; (Potential).				body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		CAGATGTGGACGCCAAGATTC	0.453																0.471429	104.421802	104.466177	33	37	KEEP	---	---	---	---	23	17	19	20	-1	capture	Missense_Mutation	SNP	160662608	160662608	SLC22A2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14343	139
UNC93A	54346	broad.mit.edu	37	6	167728686	167728686	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:167728686G>A	uc003qvq.2	+	8	1295	c.1120G>A	c.(1120-1122)GTT>ATT	p.V374I	UNC93A_uc003qvr.2_Missense_Mutation_p.V332I	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1	374						integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TCTCTACGGCGTTCTGTTTGA	0.567																0.029197	-26.797504	6.591052	4	133	KEEP	---	---	---	---	3	3	81	70	-1	capture	Missense_Mutation	SNP	167728686	167728686	UNC93A	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16878	139
CALN1	83698	broad.mit.edu	37	7	71488740	71488740	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71488740C>A	uc003twa.3	-	4	804	c.277G>T	c.(277-279)GAT>TAT	p.D93Y	CALN1_uc003twb.3_Missense_Mutation_p.D135Y|CALN1_uc003twc.3_Missense_Mutation_p.D93Y	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	93	2 (Potential).|EF-hand 2.|Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				TCATCAAAATCCACCTGGCCA	0.458																0.31	75.795735	79.00805	31	69	KEEP	---	---	---	---	12	21	44	32	0.636363636364	capture	Missense_Mutation	SNP	71488740	71488740	CALN1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	2567	139
ABCB1	5243	broad.mit.edu	37	7	87148697	87148697	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87148697G>A	uc003uiz.1	-	24	3290	c.2872C>T	c.(2872-2874)CGG>TGG	p.R958W	ABCB1_uc011khc.1_Missense_Mutation_p.R894W	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	958	ABC transmembrane type-1 2.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	GCTCCAAACCGGAAACATCCA	0.323																0.306818	157.878469	163.738644	54	122	KEEP	---	---	---	---	29	29	69	55	-1	capture	Missense_Mutation	SNP	87148697	87148697	ABCB1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	40	139
PEX1	5189	broad.mit.edu	37	7	92120719	92120719	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92120719C>A	uc003uly.2	-	21	3401	c.3305G>T	c.(3304-3306)TGT>TTT	p.C1102F	PEX1_uc011khr.1_Missense_Mutation_p.C894F|PEX1_uc010ley.2_Missense_Mutation_p.C1045F|PEX1_uc011khs.1_Missense_Mutation_p.C780F	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1	1102					microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			ATCTAAGCCACATTCTCCATC	0.428																0.311111	329.264561	340.704947	112	248	KEEP	---	---	---	---	56	66	136	144	0.540983606557	capture	Missense_Mutation	SNP	92120719	92120719	PEX1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	11638	139
NPTX2	4885	broad.mit.edu	37	7	98254301	98254301	+	Silent	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98254301C>T	uc003upl.2	+	3	888	c.711C>T	c.(709-711)TAC>TAT	p.Y237Y		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor	237	Pentaxin.				synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			ACTACCTATACGGCAAGATCA	0.587																0.24622	278.621138	305.774616	114	349	KEEP	---	---	---	---	58	65	220	169	-1	capture	Silent	SNP	98254301	98254301	NPTX2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10510	139
LMOD2	442721	broad.mit.edu	37	7	123302696	123302696	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:123302696G>A	uc003vky.2	+	2	1213	c.1056G>A	c.(1054-1056)ATG>ATA	p.M352I		NM_207163	NP_997046	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	352						cytoskeleton	actin binding|tropomyosin binding				0						CAAGAAATATGGATAAACAGA	0.473																0.275862	194.477895	206.28893	72	189	KEEP	---	---	---	---	36	39	102	95	-1	capture	Missense_Mutation	SNP	123302696	123302696	LMOD2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	8777	139
TRPV5	56302	broad.mit.edu	37	7	142622682	142622682	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142622682C>T	uc003wby.1	-	8	1328	c.1064G>A	c.(1063-1065)CGT>CAT	p.R355H	TRPV5_uc003wbz.2_Missense_Mutation_p.R355H	NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	355	Extracellular (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity	p.R355L(1)|p.R355H(1)		ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					GTTGCCACCACGAAACTTAAG	0.517																0.209677	57.182599	66.855504	26	98	KEEP	---	---	---	---	18	11	64	59	-1	capture	Missense_Mutation	SNP	142622682	142622682	TRPV5	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16482	139
OR2A12	346525	broad.mit.edu	37	7	143792808	143792808	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143792808C>T	uc011kty.1	+	1	608	c.608C>T	c.(607-609)GCG>GTG	p.A203V		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	203	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)					GCGGGTTCTGCGTTCATCTTA	0.537																0.244552	245.983251	270.529651	101	312	KEEP	---	---	---	---	64	50	222	135	-1	capture	Missense_Mutation	SNP	143792808	143792808	OR2A12	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10879	139
NOS3	4846	broad.mit.edu	37	7	150703567	150703567	+	Missense_Mutation	SNP	G	A	A	rs145168353	byFrequency	TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150703567G>A	uc003wif.2	+	15	2101	c.1805G>A	c.(1804-1806)CGG>CAG	p.R602Q	NOS3_uc011kuy.1_Missense_Mutation_p.R396Q	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	602	Flavodoxin-like.		R -> Q (in a colorectal cancer sample; somatic mutation).		anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding	p.R602Q(1)		central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	AGCTCCCCTCGGCCGGAACAG	0.542				p.R602Q(TCCPAN2-Tumor)	755											0.025575	-77.148476	20.278861	10	381	KEEP	---	---	---	---	6	5	200	220	-1	capture	Missense_Mutation	SNP	150703567	150703567	NOS3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10451	139
PRSS55	203074	broad.mit.edu	37	8	10390524	10390524	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:10390524C>T	uc003wta.2	+	4	722	c.707C>T	c.(706-708)GCC>GTC	p.A236V	uc010lru.2_Intron|PRSS55_uc003wtb.2_RNA	NM_198464	NP_940866	Q6UWB4	PRS55_HUMAN	hypothetical protein LOC203074 precursor	236	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane	serine-type endopeptidase activity			ovary(1)	1						ATGCTGTGTGCCGGATACAAG	0.483																0.041667	-17.431154	9.668764	5	115	KEEP	---	---	---	---	1	4	64	64	-1	capture	Missense_Mutation	SNP	10390524	10390524	PRSS55	8	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12529	139
PHYHIP	9796	broad.mit.edu	37	8	22079191	22079191	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22079191G>A	uc003xbk.3	-	6	1362	c.668C>T	c.(667-669)GCG>GTG	p.A223V	PHYHIP_uc003xbj.3_Missense_Mutation_p.A223V	NM_001099335	NP_001092805	Q92561	PHYIP_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein	223											0				Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0629)		GTAGAAGTCCGCAAAGTAGAG	0.657																0.333333	23.665443	24.329938	9	18	KEEP	---	---	---	---	9	2	11	9	-1	capture	Missense_Mutation	SNP	22079191	22079191	PHYHIP	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11769	139
SULF1	23213	broad.mit.edu	37	8	70536309	70536309	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70536309G>A	uc010lza.1	+	15	2444	c.1727G>A	c.(1726-1728)CGT>CAT	p.R576H	SULF1_uc003xyd.2_Missense_Mutation_p.R576H|SULF1_uc003xye.2_Missense_Mutation_p.R576H|SULF1_uc003xyf.2_Missense_Mutation_p.R576H|SULF1_uc003xyg.2_Missense_Mutation_p.R576H|SULF1_uc003xyh.1_RNA	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	576					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			ATTGCTAAGCGTCATGATGAA	0.498					473											0.043956	-12.377059	7.888395	4	87	KEEP	---	---	---	---	2	2	44	50	-1	capture	Missense_Mutation	SNP	70536309	70536309	SULF1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15260	139
SLCO5A1	81796	broad.mit.edu	37	8	70744225	70744225	+	Silent	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70744225G>A	uc003xyl.2	-	2	1391	c.684C>T	c.(682-684)AAC>AAT	p.N228N	SLCO5A1_uc010lzb.2_Silent_p.N228N|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_Silent_p.N228N|SLCO5A1_uc010lzc.2_Silent_p.N228N	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	228	Extracellular (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GGGCCGAGGCGTTCAACTCTT	0.637																0.492537	98.870589	98.873882	33	34	KEEP	---	---	---	---	18	15	17	22	-1	capture	Silent	SNP	70744225	70744225	SLCO5A1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14623	139
KIAA1161	57462	broad.mit.edu	37	9	34372688	34372688	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34372688G>A	uc003zue.3	-	3	421	c.254C>T	c.(253-255)GCG>GTG	p.A85V		NM_020702	NP_065753	Q6NSJ0	K1161_HUMAN	hypothetical protein LOC57462	85	Extracellular (Potential).				carbohydrate metabolic process	integral to membrane	hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|breast(1)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		AAGTCGCTCCGCCTTGCGTAG	0.662																0.4	23.198819	23.372756	8	12	KEEP	---	---	---	---	6	4	6	8	-1	capture	Missense_Mutation	SNP	34372688	34372688	KIAA1161	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8133	139
KIAA1539	80256	broad.mit.edu	37	9	35108015	35108015	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35108015C>T	uc003zwl.2	-	3	582	c.257G>A	c.(256-258)GGG>GAG	p.G86E	KIAA1539_uc003zwm.2_Missense_Mutation_p.G86E|KIAA1539_uc003zwn.2_Intron|KIAA1539_uc003zwo.2_Missense_Mutation_p.G86E|KIAA1539_uc003zwp.1_Missense_Mutation_p.G86E|KIAA1539_uc010mkk.1_Intron	NM_025182	NP_079458	Q7L5A3	K1539_HUMAN	hypothetical protein LOC80256	86						nucleus				ovary(2)	2	all_epithelial(49;0.217)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CTCTCTGGCCCCCAGCCCAGG	0.637																0.429825	154.964857	155.452738	49	65	KEEP	---	---	---	---	28	29	44	29	-1	capture	Missense_Mutation	SNP	35108015	35108015	KIAA1539	9	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	8164	139
ZNF462	58499	broad.mit.edu	37	9	109746495	109746495	+	Silent	SNP	C	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:109746495C>T	uc004bcz.2	+	10	7150	c.6861C>T	c.(6859-6861)TGC>TGT	p.C2287C	ZNF462_uc010mto.2_Silent_p.C2196C|ZNF462_uc004bda.2_Silent_p.C2195C|ZNF462_uc011lvz.1_Silent_p.C244C|uc004bdc.1_Intron	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	2287					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						TTGAAGTTTGCCGGTCCAAAC	0.423																0.030303	-25.089764	6.836898	4	128	KEEP	---	---	---	---	3	3	82	67	-1	capture	Silent	SNP	109746495	109746495	ZNF462	9	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	17805	139
PHEX	5251	broad.mit.edu	37	X	22151701	22151701	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:22151701A>T	uc004dah.2	+	12	1567	c.1364A>T	c.(1363-1365)GAG>GTG	p.E455V	PHEX_uc011mjr.1_Missense_Mutation_p.E455V|PHEX_uc011mjs.1_Missense_Mutation_p.E358V	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase	455	Extracellular (Potential).				biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						AAAGAAAATGAGTGGATGGAT	0.403																0.370861	164.65757	166.87157	56	95	KEEP	---	---	---	---	31	33	56	51	-1	capture	Missense_Mutation	SNP	22151701	22151701	PHEX	23	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	11722	139
GLUD2	2747	broad.mit.edu	37	X	120183085	120183085	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:120183085G>A	uc004eto.2	+	1	1624	c.1547G>A	c.(1546-1548)CGT>CAT	p.R516H		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2 precursor	516					glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)	ACAATGGAGCGTTCTGCCAGG	0.468																0.459716	291.878127	292.172153	97	114	KEEP	---	---	---	---	45	60	47	71	-1	capture	Missense_Mutation	SNP	120183085	120183085	GLUD2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6413	139
ENOX2	10495	broad.mit.edu	37	X	129759413	129759413	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129759413T>G	uc004evw.2	-	16	2126	c.1708A>C	c.(1708-1710)ACC>CCC	p.T570P	ENOX2_uc004evx.2_Missense_Mutation_p.T541P|ENOX2_uc004evy.2_Missense_Mutation_p.T541P|ENOX2_uc004evv.2_Missense_Mutation_p.T395P	NM_182314	NP_872114	Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2 isoform b	570					cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1						ACATCGCTGGTGCAGATCTGT	0.463	Ovarian(101;828 1506 2951 9500 35258)															0.378049	103.170027	104.251834	31	51	KEEP	---	---	---	---	20	14	30	26	-1	capture	Missense_Mutation	SNP	129759413	129759413	ENOX2	23	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	5082	139
L1CAM	3897	broad.mit.edu	37	X	153137805	153137805	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153137805G>A	uc004fjb.2	-	4	310	c.202C>T	c.(202-204)CGC>TGC	p.R68C	L1CAM_uc004fjc.2_Missense_Mutation_p.R68C|L1CAM_uc010nuo.2_Missense_Mutation_p.R63C|L1CAM_uc004fjd.1_5'Flank|L1CAM_uc004fje.1_Missense_Mutation_p.R63C	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	68	Extracellular (Potential).|Ig-like C2-type 1.				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTCGTCCAGCGGAACCTGTGG	0.637																0.369863	85.309698	86.394734	27	46	KEEP	---	---	---	---	14	16	25	28	-1	capture	Missense_Mutation	SNP	153137805	153137805	L1CAM	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8508	139
TP53	7157	broad.mit.edu	37	17	7578264	7578268	+	Frame_Shift_Del	DEL	GATAA	-	-			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578264_7578268delGATAA	uc002gim.2	-	6	775_779	c.581_585delTTATC	c.(580-585)CTTATCfs	p.L194fs	TP53_uc002gig.1_Frame_Shift_Del_p.L194fs|TP53_uc002gih.2_Frame_Shift_Del_p.L194fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.L62fs|TP53_uc010cng.1_Frame_Shift_Del_p.L62fs|TP53_uc002gii.1_Frame_Shift_Del_p.L62fs|TP53_uc010cnh.1_Frame_Shift_Del_p.L194fs|TP53_uc010cni.1_Frame_Shift_Del_p.L194fs|TP53_uc002gij.2_Frame_Shift_Del_p.L194fs|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Frame_Shift_Del_p.L101fs|TP53_uc002gio.2_Frame_Shift_Del_p.L62fs|TP53_uc010vug.1_Frame_Shift_Del_p.L155fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	194_195	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|I -> N (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.I195T(61)|p.L194R(31)|p.L194F(16)|p.I195F(16)|p.I195N(12)|p.L194P(8)|p.R196*(7)|p.0?(7)|p.L194H(5)|p.L194L(4)|p.I195S(4)|p.A189_V197delAPPQHLIRV(4)|p.I195fs*14(3)|p.P191fs*53(2)|p.L194fs*15(2)|p.I195fs*52(2)|p.K164_P219del(1)|p.L194V(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.I195fs*12(1)|p.I195L(1)|p.I195fs*50(1)|p.L194fs*14(1)|p.L194fs*52(1)|p.?(1)|p.I195_G199delIRVEG(1)|p.A189fs*53(1)|p.L194I(1)|p.H193_I195>AP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CTTCCACTCGGATAAGATGCTGAGG	0.551	Pancreas(47;798 1329 9957 10801)		111	p.L194R(GSS-Tumor)|p.I195S(SNU1077-Tumor)|p.I195T(KYSE180-Tumor)|p.I195F(COV318-Tumor)|p.H193fs(59M-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.69			60	27		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	7578264	7578268	TP53	17	GATAA	-	-	-	1	0	1	0	1	0	0	0	0	525	41	5	5	16264	139
SSPO	23145	broad.mit.edu	37	7	149502623	149502623	+	Frame_Shift_Del	DEL	C	-	-			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:149502623delC	uc010lpk.2	+	58	8436	c.8436delC	c.(8434-8436)TGCfs	p.C2812fs		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	2812	TSP type-1 7.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ATTCATCCTGCCCAGGAGATG	0.682																0.21			28	107		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	149502623	149502623	SSPO	7	C	-	-	-	1	0	1	0	1	0	0	0	0	337	26	5	5	15081	139
USP20	10868	broad.mit.edu	37	9	132625554	132625555	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:132625554_132625555delTC	uc004bys.2	+	9	798_799	c.587_588delTC	c.(586-588)GTCfs	p.V196fs	USP20_uc004byr.2_Frame_Shift_Del_p.V196fs|USP20_uc004byt.1_Frame_Shift_Del_p.V196fs	NM_001110303	NP_001103773	Q9Y2K6	UBP20_HUMAN	ubiquitin specific protease 20	196					endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|ubiquitin thiolesterase activity|zinc ion binding			lung(1)|breast(1)	2		Ovarian(14;0.00556)				CAGAAGCTGGTCTCTGAGGTCT	0.569																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	132625554	132625555	USP20	9	TC	-	-	-	1	0	1	0	1	0	0	0	0	754	58	5	5	16934	139
SLITRK2	84631	broad.mit.edu	37	X	144903994	144903997	+	Frame_Shift_Del	DEL	ACAG	-	-			TCGA-14-0817-01	TCGA-14-0817-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:144903994_144903997delACAG	uc004fcd.2	+	5	1041_1044	c.51_54delACAG	c.(49-54)TTACAGfs	p.L17fs	SLITRK2_uc010nsp.2_Frame_Shift_Del_p.L17fs|SLITRK2_uc010nso.2_Frame_Shift_Del_p.L17fs|SLITRK2_uc011mwq.1_Frame_Shift_Del_p.L17fs|SLITRK2_uc011mwr.1_Frame_Shift_Del_p.L17fs|SLITRK2_uc011mws.1_Frame_Shift_Del_p.L17fs|SLITRK2_uc004fcg.2_Frame_Shift_Del_p.L17fs|SLITRK2_uc011mwt.1_Frame_Shift_Del_p.L17fs	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	17_18						integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					CCGGGATCTTACAGACAGAGAGTC	0.471																0.41			39	57		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	144903994	144903997	SLITRK2	23	ACAG	-	-	-	1	0	1	0	1	0	0	0	0	180	14	5	5	14635	139
