Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
EXOSC10	5394	broad.mit.edu	37	1	11151619	11151619	+	Missense_Mutation	SNP	C	G	G	rs146190133		TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11151619C>G	uc001asa.2	-	4	458	c.408G>C	c.(406-408)AAG>AAC	p.K136N	EXOSC10_uc001asb.2_Missense_Mutation_p.K136N|EXOSC10_uc009vmy.1_Missense_Mutation_p.K136N	NM_001001998	NP_001001998	Q01780	EXOSX_HUMAN	exosome component 10 isoform 1	136					CUT catabolic process|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear polyadenylation-dependent rRNA catabolic process|nuclear retention of unspliced pre-mRNA at the site of transcription|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasm|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5' exonuclease activity|exoribonuclease activity|identical protein binding|nucleotide binding|protein serine/threonine kinase activity|RNA binding			upper_aerodigestive_tract(1)	1	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		GCTGTTGATTCTTGTTTACAC	0.458	Colon(179;105 1987 14326 27364 29542)															0.322917	95.591075	98.264045	31	65	KEEP	---	---	---	---	21	12	33	37	-1	capture	Missense_Mutation	SNP	11151619	11151619	EXOSC10	1	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	5269	149
UBIAD1	29914	broad.mit.edu	37	1	11334002	11334002	+	Silent	SNP	C	G	G			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11334002C>G	uc001asg.2	+	1	748	c.414C>G	c.(412-414)CTC>CTG	p.L138L		NM_013319	NP_037451	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	138	Helical; (Potential).				menaquinone biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrion|nucleus	prenyltransferase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		GAGTCTTCCTCTACACGTTGG	0.537																0.300885	107.905877	111.90744	34	79	KEEP	---	---	---	---	23	14	43	50	-1	capture	Silent	SNP	11334002	11334002	UBIAD1	1	C	G	G	G	1	0	0	0	0	0	0	0	1	405	32	4	4	16767	149
TRIM62	55223	broad.mit.edu	37	1	33646782	33646782	+	Silent	SNP	G	C	C			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:33646782G>C	uc001bxb.2	-	1	890	c.252C>G	c.(250-252)CTC>CTG	p.L84L		NM_018207	NP_060677	Q9BVG3	TRI62_HUMAN	tripartite motif-containing 62	84						intracellular	zinc ion binding				0		Myeloproliferative disorder(586;0.0393)				GGCGCGCGTTGAGGATGGCGT	0.701																0.277778	16.167485	16.967022	5	13	KEEP	---	---	---	---	3	3	5	9	-1	capture	Silent	SNP	33646782	33646782	TRIM62	1	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	16420	149
TCHH	7062	broad.mit.edu	37	1	152080828	152080828	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152080828C>T	uc001ezp.2	-	2	4865	c.4865G>A	c.(4864-4866)CGC>CAC	p.R1622H	TCHH_uc009wne.1_Missense_Mutation_p.R1622H	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1622	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCGTCTTCGCGGAATTTTCT	0.602																0.337278	159.423785	163.381214	57	112	KEEP	---	---	---	---	35	27	65	56	-1	capture	Missense_Mutation	SNP	152080828	152080828	TCHH	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15585	149
OR10J3	441911	broad.mit.edu	37	1	159283794	159283794	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159283794T>A	uc010piu.1	-	1	656	c.656A>T	c.(655-657)TAT>TTT	p.Y219F		NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J,	219	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_hematologic(112;0.0429)					GATGAGGACATAGGAGATAAA	0.502																0.043716	-25.053913	15.793765	8	175	KEEP	---	---	---	---	7	3	82	110	-1	capture	Missense_Mutation	SNP	159283794	159283794	OR10J3	1	T	A	A	A	1	0	0	0	0	1	0	0	0	637	49	4	4	10815	149
SLAMF6	114836	broad.mit.edu	37	1	160456502	160456502	+	Missense_Mutation	SNP	C	T	T	rs151001421		TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160456502C>T	uc001fwe.1	-	8	1054	c.994G>A	c.(994-996)GTG>ATG	p.V332M	SLAMF6_uc001fwd.1_Missense_Mutation_p.V331M|SLAMF6_uc010pjh.1_Missense_Mutation_p.V282M|SLAMF6_uc010pji.1_Missense_Mutation_p.V221M	NM_052931	NP_443163	Q96DU3	SLAF6_HUMAN	activating NK receptor precursor	332						integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			GCAACTTACACGACATTGTCA	0.483																0.292929	79.335456	83.135989	29	70	KEEP	---	---	---	---	13	20	48	40	-1	capture	Missense_Mutation	SNP	160456502	160456502	SLAMF6	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14261	149
KLHDC8A	55220	broad.mit.edu	37	1	205312607	205312607	+	Silent	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205312607G>A	uc001hcf.1	-	2	694	c.126C>T	c.(124-126)AAC>AAT	p.N42N	KLHDC8A_uc010prg.1_Intron|KLHDC8A_uc001hcg.1_Silent_p.N42N	NM_018203	NP_060673	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	42	Kelch 2.									ovary(1)	1	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TGGGGACGCCGTTGTCGTCAC	0.716																0.253968	37.470593	40.932165	16	47	KEEP	---	---	---	---	8	9	26	25	-1	capture	Silent	SNP	205312607	205312607	KLHDC8A	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8282	149
RAB3GAP2	25782	broad.mit.edu	37	1	220340949	220340949	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:220340949C>A	uc010puk.1	-	25	3039	c.2875G>T	c.(2875-2877)GCT>TCT	p.A959S	RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_Missense_Mutation_p.A539S|RAB3GAP2_uc001hmh.2_5'Flank	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic	959					intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		TCTTCATTAGCCAGTTTTAAT	0.398																0.344519	439.993559	449.546843	154	293	KEEP	---	---	---	---	81	91	162	170	0.529069767442	capture	Missense_Mutation	SNP	220340949	220340949	RAB3GAP2	1	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	12831	149
HHIPL2	79802	broad.mit.edu	37	1	222717502	222717502	+	Silent	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:222717502G>A	uc001hnh.1	-	2	409	c.351C>T	c.(349-351)TAC>TAT	p.Y117Y		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	117					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		TTTCGGCGTCGTAGAGGTGGG	0.567																0.390805	298.177306	300.907181	102	159	KEEP	---	---	---	---	65	48	80	91	-1	capture	Silent	SNP	222717502	222717502	HHIPL2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7019	149
NUP133	55746	broad.mit.edu	37	1	229606471	229606471	+	Silent	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:229606471G>A	uc001htn.2	-	15	2024	c.1932C>T	c.(1930-1932)GCC>GCT	p.A644A		NM_018230	NP_060700	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	644					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				ACAGCTTTTCGGCATGCTCAC	0.493					578											0.317647	83.097259	85.608586	27	58	KEEP	---	---	---	---	13	15	23	43	-1	capture	Silent	SNP	229606471	229606471	NUP133	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10661	149
ARHGAP22	58504	broad.mit.edu	37	10	49667897	49667897	+	Silent	SNP	G	A	A	rs78086414		TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:49667897G>A	uc001jgt.2	-	5	786	c.489C>T	c.(487-489)CAC>CAT	p.H163H	ARHGAP22_uc001jgs.2_Silent_p.H73H|ARHGAP22_uc001jgu.2_Silent_p.H179H|ARHGAP22_uc010qgl.1_Silent_p.H120H|ARHGAP22_uc010qgm.1_Silent_p.H169H|ARHGAP22_uc001jgv.2_Translation_Start_Site	NM_021226	NP_067049	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 2	163	Rho-GAP.				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1						ACTTCCGCTCGTGGTGGACTG	0.642																0.542373	100.614274	100.708377	32	27	KEEP	---	---	---	---	14	24	15	16	-1	capture	Silent	SNP	49667897	49667897	ARHGAP22	10	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	865	149
TLL2	7093	broad.mit.edu	37	10	98156950	98156950	+	Silent	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98156950C>T	uc001kml.1	-	11	1603	c.1377G>A	c.(1375-1377)GCG>GCA	p.A459A	TLL2_uc009xvf.1_Silent_p.A437A	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor	459	CUB 1.				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		AACCTTCGTACGCTGCAAAGA	0.622																0.432836	85.960789	86.224652	29	38	KEEP	---	---	---	---	17	13	25	21	-1	capture	Silent	SNP	98156950	98156950	TLL2	10	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	15831	149
OR4D10	390197	broad.mit.edu	37	11	59244963	59244963	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59244963C>T	uc001nnz.1	+	1	61	c.61C>T	c.(61-63)CGG>TGG	p.R21W		NM_001004705	NP_001004705	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D,	21	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						GACCCAGAATCGGGAAGTGAG	0.413																0.268293	116.72239	124.673709	44	120	KEEP	---	---	---	---	27	20	60	64	-1	capture	Missense_Mutation	SNP	59244963	59244963	OR4D10	11	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	10958	149
PKNOX2	63876	broad.mit.edu	37	11	125255470	125255470	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:125255470C>T	uc001qbu.2	+	6	565	c.251C>T	c.(250-252)ACG>ATG	p.T84M	PKNOX2_uc010saz.1_Missense_Mutation_p.T55M|PKNOX2_uc010sba.1_Missense_Mutation_p.T55M|PKNOX2_uc010sbb.1_Missense_Mutation_p.T20M	NM_022062	NP_071345	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	84						nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CCGCTCCTGACGCTGCTGTTT	0.567																0.039326	-27.126839	13.635682	7	171	KEEP	---	---	---	---	5	4	99	106	-1	capture	Missense_Mutation	SNP	125255470	125255470	PKNOX2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11886	149
LTBR	4055	broad.mit.edu	37	12	6497971	6497971	+	Silent	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6497971C>T	uc001qny.1	+	8	949	c.781C>T	c.(781-783)CTG>TTG	p.L261L	LTBR_uc010sfc.1_Silent_p.L242L|LTBR_uc001qnz.1_Silent_p.L256L	NM_002342	NP_002333	P36941	TNR3_HUMAN	lymphotoxin beta receptor precursor	261	Cytoplasmic (Potential).				apoptosis|cellular response to mechanical stimulus|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	protein binding|receptor activity			lung(2)	2						TGCAGGATCGCTGCTCAAGAG	0.562					109											0.457627	171.943959	172.127554	54	64	KEEP	---	---	---	---	37	34	39	42	-1	capture	Silent	SNP	6497971	6497971	LTBR	12	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	8992	149
NAB2	4665	broad.mit.edu	37	12	57485446	57485446	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57485446T>C	uc001smz.2	+	2	1000	c.622T>C	c.(622-624)TTC>CTC	p.F208L		NM_005967	NP_005958	Q15742	NAB2_HUMAN	NGFI-A binding protein 2	208					cell proliferation|negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	transcription corepressor activity			upper_aerodigestive_tract(1)|ovary(1)	2						CTCGCCCCCCTTCTCCCCCCC	0.716																0.129032	2.771303	6.95123	4	27	KEEP	---	---	---	---	5	6	15	15	-1	capture	Missense_Mutation	SNP	57485446	57485446	NAB2	12	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	10042	149
SLC17A8	246213	broad.mit.edu	37	12	100811900	100811900	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100811900G>A	uc010svi.1	+	11	1704	c.1391G>A	c.(1390-1392)TGT>TAT	p.C464Y	SLC17A8_uc009ztx.2_Missense_Mutation_p.C414Y	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent	464	Helical; (Potential).				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						GGAATGGTCTGTCCCCTCATT	0.498																0.359551	175.941602	179.036752	64	114	KEEP	---	---	---	---	44	23	61	67	-1	capture	Missense_Mutation	SNP	100811900	100811900	SLC17A8	12	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	14316	149
SIAH3	283514	broad.mit.edu	37	13	46358034	46358034	+	Silent	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:46358034G>A	uc001vap.2	-	2	376	c.294C>T	c.(292-294)CAC>CAT	p.H98H		NM_198849	NP_942146	Q8IW03	SIAH3_HUMAN	seven in absentia homolog 3	98	SIAH-type; degenerate.|His-rich.				multicellular organismal development|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding			ovary(1)|skin(1)	2						CCGGGTTGGCGTGCAGCCCCG	0.428																0.280488	56.336786	59.861311	23	59	KEEP	---	---	---	---	13	13	31	33	-1	capture	Silent	SNP	46358034	46358034	SIAH3	13	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14194	149
NRXN3	9369	broad.mit.edu	37	14	80328137	80328137	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:80328137G>A	uc001xun.2	+	17	3507	c.3016G>A	c.(3016-3018)GCC>ACC	p.A1006T	NRXN3_uc001xum.1_RNA|NRXN3_uc001xup.2_RNA|NRXN3_uc001xuq.2_Missense_Mutation_p.A582T|NRXN3_uc010asw.2_Missense_Mutation_p.A404T|NRXN3_uc001xur.3_Missense_Mutation_p.A377T	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	1588	Helical; (Potential).				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CCTCCTGTACGCCATGTACAA	0.597																0.173077	15.239918	20.493305	9	43	KEEP	---	---	---	---	6	4	20	26	-1	capture	Missense_Mutation	SNP	80328137	80328137	NRXN3	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10574	149
DIO3	1735	broad.mit.edu	37	14	102028607	102028607	+	Silent	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:102028607C>T	uc010txq.1	+	2	920	c.696C>T	c.(694-696)TTC>TTT	p.F232F	DIO3OS_uc001ykd.1_5'Flank|uc001yke.2_5'Flank|uc001ykf.2_5'Flank|uc001ykg.2_5'Flank|uc001ykh.3_5'Flank|MIR1247_hsa-mir-1247|MI0006382_5'Flank	NM_001362	NP_001353	P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	232	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process	endosome membrane|integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|thyroxine 5-deiodinase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(303;0.185)				GCGCCTACTTCGAGCGTCTCT	0.632																0.17	34.01453	44.316522	17	83	KEEP	---	---	---	---	11	9	39	51	-1	capture	Silent	SNP	102028607	102028607	DIO3	14	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	4484	149
CEP152	22995	broad.mit.edu	37	15	49076318	49076318	+	Splice_Site	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:49076318C>T	uc001zwy.2	-	10	1208	c.1174_splice	c.e10-1	p.E392_splice	CEP152_uc001zwz.2_Splice_Site_p.E392_splice|CEP152_uc001zxa.1_Splice_Site_p.E299_splice	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa						centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		AAATGTCTTCCTAAATAGAAA	0.294																0.391892	95.458288	96.215941	29	45	KEEP	---	---	---	---	20	12	24	28	-1	capture	Splice_Site	SNP	49076318	49076318	CEP152	15	C	T	T	T	1	0	0	0	0	0	0	1	0	312	24	5	2	3216	149
SMG1	23049	broad.mit.edu	37	16	18853724	18853724	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:18853724C>T	uc002dfm.2	-	40	6635	c.6272G>A	c.(6271-6273)CGT>CAT	p.R2091H	SMG1_uc010bwb.2_Missense_Mutation_p.R1951H|SMG1_uc010bwa.2_Missense_Mutation_p.R822H|SMG1_uc002dfo.3_Missense_Mutation_p.R389H	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	2091					DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						TTCTTCAAGACGCAAGATGTA	0.408					1101											0.05814	-6.773812	10.807228	5	81	KEEP	---	---	---	---	3	2	44	41	-1	capture	Missense_Mutation	SNP	18853724	18853724	SMG1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14687	149
FAM83G	644815	broad.mit.edu	37	17	18875008	18875008	+	Silent	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18875008G>A	uc002guw.2	-	6	2303	c.2136C>T	c.(2134-2136)GAC>GAT	p.D712D	SLC5A10_uc002gur.1_Intron|SLC5A10_uc002guu.1_Intron|SLC5A10_uc002gut.1_Intron|SLC5A10_uc002guv.1_Intron|SLC5A10_uc010vyl.1_Intron	NM_001039999	NP_001035088	A6ND36	FA83G_HUMAN	hypothetical protein LOC644815	712										ovary(1)|central_nervous_system(1)	2						CTGGGAAGCCGTCTTTATCCC	0.622																0.312977	112.428081	116.506549	41	90	KEEP	---	---	---	---	20	26	44	62	-1	capture	Silent	SNP	18875008	18875008	FAM83G	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5585	149
KCNJ12	3768	broad.mit.edu	37	17	21319359	21319359	+	Silent	SNP	G	A	A	rs147653221	byFrequency	TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21319359G>A	uc002gyv.1	+	3	1410	c.705G>A	c.(703-705)CCG>CCA	p.P235P		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	235	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	TCATCAAGCCGCGGGTCACCG	0.632													Prostate(3;0.18)			0.118812	14.655692	29.044439	12	89	KEEP	---	---	---	---	11	3	55	52	-1	capture	Silent	SNP	21319359	21319359	KCNJ12	17	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7968	149
CNTNAP1	8506	broad.mit.edu	37	17	40843451	40843451	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40843451C>A	uc002iay.2	+	15	2482	c.2266C>A	c.(2266-2268)CAG>AAG	p.Q756K	CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor	756	Extracellular (Potential).|Fibrinogen C-terminal.				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		GCCTGTCACTCAGGTAGTGAT	0.587																0.03937	-19.841619	9.244124	5	122	KEEP	---	---	---	---	3	2	71	64	0.4	capture	Missense_Mutation	SNP	40843451	40843451	CNTNAP1	17	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	3611	149
METRNL	284207	broad.mit.edu	37	17	81042908	81042908	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:81042908C>A	uc002kgh.2	+	2	390	c.265C>A	c.(265-267)CTC>ATC	p.L89I	METRNL_uc002kgi.2_Missense_Mutation_p.L7I	NM_001004431	NP_001004431	Q641Q3	METRL_HUMAN	meteorin, glial cell differentiation	89						extracellular region					0	Breast(20;0.000443)|all_neural(118;0.0779)		BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			AACAGGTGCTCTCATCGTTAA	0.617																0.430464	185.443019	186.08082	65	86	KEEP	---	---	---	---	30	39	38	58	0.565217391304	capture	Missense_Mutation	SNP	81042908	81042908	METRNL	17	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	9401	149
METRNL	284207	broad.mit.edu	37	17	81042984	81042984	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:81042984C>T	uc002kgh.2	+	2	466	c.341C>T	c.(340-342)TCC>TTC	p.S114F	METRNL_uc002kgi.2_Missense_Mutation_p.S32F	NM_001004431	NP_001004431	Q641Q3	METRL_HUMAN	meteorin, glial cell differentiation	114						extracellular region					0	Breast(20;0.000443)|all_neural(118;0.0779)		BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			TTCACGGACTCCTCGGGGGCC	0.592																0.401235	193.561146	194.93672	65	97	KEEP	---	---	---	---	28	43	40	63	-1	capture	Missense_Mutation	SNP	81042984	81042984	METRNL	17	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	9401	149
MUC16	94025	broad.mit.edu	37	19	9026244	9026244	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9026244G>A	uc002mkp.2	-	14	36946	c.36742C>T	c.(36742-36744)CGT>TGT	p.R12248C		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12250	SEA 2.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCAGTGCGACGCATGTCCTCC	0.542																0.261628	231.08648	248.778995	90	254	KEEP	---	---	---	---	48	52	151	137	-1	capture	Missense_Mutation	SNP	9026244	9026244	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9883	149
MUC16	94025	broad.mit.edu	37	19	9085463	9085463	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9085463C>T	uc002mkp.2	-	1	6556	c.6352G>A	c.(6352-6354)GCG>ACG	p.A2118T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2118	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AAAGTACTCGCGGCTGTATTC	0.488																0.20765	172.790085	201.775107	76	290	KEEP	---	---	---	---	43	45	158	178	-1	capture	Missense_Mutation	SNP	9085463	9085463	MUC16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9883	149
MAN2B1	4125	broad.mit.edu	37	19	12768940	12768940	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12768940C>G	uc002mub.2	-	10	1322	c.1246G>C	c.(1246-1248)GAG>CAG	p.E416Q	MAN2B1_uc010dyv.1_Missense_Mutation_p.E415Q	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	416					protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						ACCAGCGCCTCCAGCTGGTTG	0.687																0.290698	80.341813	83.715969	25	61	KEEP	---	---	---	---	18	21	28	58	-1	capture	Missense_Mutation	SNP	12768940	12768940	MAN2B1	19	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	9130	149
IL12RB1	3594	broad.mit.edu	37	19	18171938	18171938	+	Silent	SNP	C	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18171938C>A	uc002nhw.1	-	15	1849	c.1785G>T	c.(1783-1785)GGG>GGT	p.G595G	IL12RB1_uc010xqb.1_Silent_p.G595G|IL12RB1_uc002nhx.1_Silent_p.G635G	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1	595	Cytoplasmic (Potential).				cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						TTACCTCCTTCCCTCCAGGGA	0.552																0.190476	7.986937	9.868707	4	17	KEEP	---	---	---	---	4	0	14	10	-1	capture	Silent	SNP	18171938	18171938	IL12RB1	19	C	A	A	A	1	0	0	0	0	0	0	0	1	379	30	4	4	7549	149
MLL4	9757	broad.mit.edu	37	19	36212329	36212329	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36212329C>T	uc010eei.2	+	3	2080	c.2080C>T	c.(2080-2082)CGG>TGG	p.R694W		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	694	Pro-rich.				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCCTGAGCCTCGGGCAGTGGG	0.642																0.354839	28.183623	28.772872	11	20	KEEP	---	---	---	---	6	5	11	13	-1	capture	Missense_Mutation	SNP	36212329	36212329	MLL4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	9535	149
NLRP12	91662	broad.mit.edu	37	19	54327194	54327194	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54327194G>A	uc002qch.3	-	1	455	c.235C>T	c.(235-237)CGG>TGG	p.R79W	NLRP12_uc002qci.3_Missense_Mutation_p.R79W|NLRP12_uc002qcj.3_Missense_Mutation_p.R79W|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.R79W	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	79	DAPIN.				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CTGTTTATCCGCTCAAAGGTG	0.582																0.264331	213.508964	229.258805	83	231	KEEP	---	---	---	---	55	46	144	130	-1	capture	Missense_Mutation	SNP	54327194	54327194	NLRP12	19	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	10381	149
LILRB2	10288	broad.mit.edu	37	19	54782762	54782762	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54782762C>G	uc002qfb.2	-	6	1126	c.860G>C	c.(859-861)AGC>ACC	p.S287T	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Missense_Mutation_p.S287T|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Missense_Mutation_p.S287T|LILRB2_uc010yet.1_Missense_Mutation_p.S171T|LILRB2_uc010yeu.1_RNA	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	287	Extracellular (Potential).|Ig-like C2-type 3.				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTAGGAGCGGCTCACAGGGCC	0.647																0.101695	7.295977	26.012044	12	106	KEEP	---	---	---	---	10	2	62	61	-1	capture	Missense_Mutation	SNP	54782762	54782762	LILRB2	19	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	8711	149
SPEG	10290	broad.mit.edu	37	2	220353375	220353375	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220353375G>A	uc010fwg.2	+	33	8014	c.8014G>A	c.(8014-8016)GTG>ATG	p.V2672M		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	2672	Ig-like 9.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CTCCTGTACCGTGGCTGTGGC	0.672					482											0.111111	6.173787	18.248539	9	72	KEEP	---	---	---	---	7	4	40	45	-1	capture	Missense_Mutation	SNP	220353375	220353375	SPEG	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14928	149
C2orf85	285093	broad.mit.edu	37	2	242814085	242814085	+	Silent	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242814085C>T	uc010fzu.1	+	2	401	c.378C>T	c.(376-378)TAC>TAT	p.Y126Y		NM_173821	NP_776182	Q14D33	CB085_HUMAN	hypothetical protein LOC285093	126						integral to membrane				ovary(1)	1						AGGACTGCTACGGGGATGGCC	0.711																0.363636	11.597485	11.777244	4	7	KEEP	---	---	---	---	2	2	6	2	-1	capture	Silent	SNP	242814085	242814085	C2orf85	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2180	149
DPPA4	55211	broad.mit.edu	37	3	109046838	109046838	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:109046838T>G	uc003dxq.3	-	7	967	c.912A>C	c.(910-912)GAA>GAC	p.E304D	DPPA4_uc011bho.1_3'UTR	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	304						nucleus	protein binding			upper_aerodigestive_tract(1)	1						TGATATTCTATTCCCATTGGA	0.368																0.236443	324.946451	354.211095	109	352	KEEP	---	---	---	---	75	60	184	214	-1	capture	Missense_Mutation	SNP	109046838	109046838	DPPA4	3	T	G	G	G	1	0	0	0	0	1	0	0	0	673	52	4	4	4691	149
HCLS1	3059	broad.mit.edu	37	3	121356079	121356079	+	Missense_Mutation	SNP	C	T	T	rs142478875	by1000genomes	TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121356079C>T	uc003eeh.3	-	7	604	c.479G>A	c.(478-480)CGG>CAG	p.R160Q	HCLS1_uc011bjj.1_Intron|HCLS1_uc011bjk.1_RNA	NM_005335	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	160	Cortactin 3.				erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(114;0.0912)		CACCCCGTACCGGCCACCAAA	0.557																0.439394	188.238884	188.660076	58	74	KEEP	---	---	---	---	30	37	42	48	-1	capture	Missense_Mutation	SNP	121356079	121356079	HCLS1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6921	149
SR140	23350	broad.mit.edu	37	3	142741859	142741859	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142741859A>G	uc003evh.1	+	12	1282	c.1183A>G	c.(1183-1185)AAT>GAT	p.N395D	SR140_uc003evi.1_5'UTR|SR140_uc011bnj.1_Missense_Mutation_p.N395D|SR140_uc003evj.1_RNA|SR140_uc003evk.1_Missense_Mutation_p.N394D|SR140_uc003evl.1_5'Flank	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein	395	Pro-rich.				RNA processing	nucleus	nucleotide binding|RNA binding				0						AAAAAACCCTAATGCTCCTAT	0.418	Colon(87;897 1320 15089 19747 35974)															0.317073	42.761673	43.980776	13	28	KEEP	---	---	---	---	10	5	13	17	-1	capture	Missense_Mutation	SNP	142741859	142741859	SR140	3	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	15023	149
SLIT2	9353	broad.mit.edu	37	4	20544133	20544133	+	Silent	SNP	T	C	C			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:20544133T>C	uc003gpr.1	+	21	2364	c.2160T>C	c.(2158-2160)AGT>AGC	p.S720S	SLIT2_uc003gps.1_Silent_p.S712S	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	720	LRRNT 4.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						ATGACAATAGTTGCTCCCCAC	0.413																0.341991	539.90563	550.099643	158	304	KEEP	---	---	---	---	88	87	167	182	-1	capture	Silent	SNP	20544133	20544133	SLIT2	4	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	14632	149
PKD2	5311	broad.mit.edu	37	4	88973158	88973158	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88973158A>G	uc003hre.2	+	7	1630	c.1564A>G	c.(1564-1566)ATA>GTA	p.I522V	PKD2_uc011cdf.1_5'UTR|PKD2_uc011cdg.1_5'UTR|PKD2_uc011cdh.1_5'UTR	NM_000297	NP_000288	Q13563	PKD2_HUMAN	polycystin 2	522	Helical; (Potential).					basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity			skin(1)	1		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		AGTGGTAGCTATAGGAATTAA	0.323																0.092308	3.508775	14.385556	6	59	KEEP	---	---	---	---	6	3	49	27	-1	capture	Missense_Mutation	SNP	88973158	88973158	PKD2	4	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	11869	149
GPR98	84059	broad.mit.edu	37	5	90055389	90055389	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:90055389G>T	uc003kju.2	+	58	12200	c.12104G>T	c.(12103-12105)GGA>GTA	p.G4035V	GPR98_uc003kjt.2_Missense_Mutation_p.G1741V|GPR98_uc003kjv.2_Missense_Mutation_p.G1635V	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	4035	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGAGTATTTGGATTTGAAGAA	0.368																0.369565	48.561425	49.249856	17	29	KEEP	---	---	---	---	8	10	16	14	0.444444444444	capture	Missense_Mutation	SNP	90055389	90055389	GPR98	5	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	6654	149
ETF1	2107	broad.mit.edu	37	5	137846888	137846888	+	Silent	SNP	T	C	C			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137846888T>C	uc003ldc.3	-	8	1029	c.864A>G	c.(862-864)GGA>GGG	p.G288G	ETF1_uc011cyv.1_Silent_p.G274G|ETF1_uc010jex.2_RNA|ETF1_uc003ldd.3_Silent_p.G255G	NM_004730	NP_004721	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	288					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|protein methylation|regulation of translational termination	cytoplasm	protein binding|ribosome binding|translation release factor activity, codon specific			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CAAAGTATCGTCCTACGATTA	0.368																0.42953	224.468756	225.115269	64	85	KEEP	---	---	---	---	38	37	40	53	-1	capture	Silent	SNP	137846888	137846888	ETF1	5	T	C	C	C	1	0	0	0	0	0	0	0	1	743	58	3	3	5223	149
PCDHB6	56130	broad.mit.edu	37	5	140530986	140530986	+	Missense_Mutation	SNP	T	C	C	rs142117819	by1000genomes	TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140530986T>C	uc003lir.2	+	1	1148	c.1148T>C	c.(1147-1149)ATA>ACA	p.I383T	PCDHB6_uc011dah.1_Missense_Mutation_p.I247T	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	383	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATTTGTTCAATAGAGAACAAT	0.463																0.337778	258.143825	263.374003	76	149	KEEP	---	---	---	---	48	37	81	91	-1	capture	Missense_Mutation	SNP	140530986	140530986	PCDHB6	5	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	11449	149
PCDHB7	56129	broad.mit.edu	37	5	140554290	140554290	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140554290G>A	uc003lit.2	+	1	2048	c.1874G>A	c.(1873-1875)CGT>CAT	p.R625H		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	625	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCGAGGTGCGTACCGCCAGG	0.697																0.37931	124.883514	126.361254	44	72	KEEP	---	---	---	---	19	30	34	56	-1	capture	Missense_Mutation	SNP	140554290	140554290	PCDHB7	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11450	149
TREML1	340205	broad.mit.edu	37	6	41121804	41121804	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41121804G>A	uc011duc.1	-	2	112	c.68C>T	c.(67-69)CCT>CTT	p.P23L	TREML1_uc003opx.2_Missense_Mutation_p.P23L|TREML1_uc011dud.1_Intron	NM_178174	NP_835468	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid	23	Ig-like V-type.|Extracellular (Potential).				calcium-mediated signaling|innate immune response|platelet activation	cell surface|integral to membrane|plasma membrane|platelet alpha granule	protein binding|receptor activity			breast(1)	1	Ovarian(28;0.0418)|Colorectal(47;0.196)					CAGCACCTCAGGGAGGCTGCC	0.607																0.241071	74.472085	81.320041	27	85	KEEP	---	---	---	---	12	18	41	53	-1	capture	Missense_Mutation	SNP	41121804	41121804	TREML1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	16355	149
GFRAL	389400	broad.mit.edu	37	6	55196594	55196594	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55196594C>T	uc003pcm.1	+	2	190	c.104C>T	c.(103-105)GCA>GTA	p.A35V		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	35	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTACGTGATGCAAATGGATGT	0.338																0.3	48.624506	50.769979	18	42	KEEP	---	---	---	---	10	9	21	27	-1	capture	Missense_Mutation	SNP	55196594	55196594	GFRAL	6	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	6290	149
BCLAF1	9774	broad.mit.edu	37	6	136599627	136599627	+	Missense_Mutation	SNP	C	T	T	rs149799182		TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:136599627C>T	uc003qgx.1	-	4	645	c.392G>A	c.(391-393)CGG>CAG	p.R131Q	BCLAF1_uc003qgw.1_Missense_Mutation_p.R131Q|BCLAF1_uc003qgy.1_Missense_Mutation_p.R129Q|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R129Q	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	131					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TCTATATGACCGGCGAGATCT	0.448	Colon(142;1534 1789 5427 7063 28491)															0.107769	51.545558	112.399436	43	356	KEEP	---	---	---	---	28	17	177	206	-1	capture	Missense_Mutation	SNP	136599627	136599627	BCLAF1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1372	149
USP42	84132	broad.mit.edu	37	7	6183728	6183728	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6183728G>A	uc011jwo.1	+	9	1014	c.891G>A	c.(889-891)ATG>ATA	p.M297I	USP42_uc011jwn.1_Missense_Mutation_p.M142I|USP42_uc010kth.1_Missense_Mutation_p.M230I|USP42_uc011jwp.1_Missense_Mutation_p.M297I|USP42_uc011jwq.1_Missense_Mutation_p.M104I|USP42_uc011jwr.1_Missense_Mutation_p.M142I	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	297					cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		GTAAAAAGATGGTTCCAGCTT	0.333																0.245283	32.04673	35.180162	13	40	KEEP	---	---	---	---	11	2	21	22	-1	capture	Missense_Mutation	SNP	6183728	6183728	USP42	7	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	16955	149
URGCP	55665	broad.mit.edu	37	7	43917037	43917037	+	Silent	SNP	G	C	C			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43917037G>C	uc003tiw.2	-	6	2082	c.2025C>G	c.(2023-2025)GTC>GTG	p.V675V	URGCP_uc003tiu.2_Silent_p.V632V|URGCP_uc003tiv.2_Silent_p.V600V|URGCP_uc003tix.2_Silent_p.V666V|URGCP_uc003tiy.2_Silent_p.V632V|URGCP_uc003tiz.2_Silent_p.V632V|URGCP_uc011kbj.1_Silent_p.V632V	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	675					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						GGAGCCCTGTGACCCAGCGGA	0.642																0.245763	87.664081	94.576875	29	89	KEEP	---	---	---	---	11	19	47	49	-1	capture	Silent	SNP	43917037	43917037	URGCP	7	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	16908	149
URGCP	55665	broad.mit.edu	37	7	43917123	43917123	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43917123G>T	uc003tiw.2	-	6	1996	c.1939C>A	c.(1939-1941)CCA>ACA	p.P647T	URGCP_uc003tiu.2_Missense_Mutation_p.P604T|URGCP_uc003tiv.2_Missense_Mutation_p.P572T|URGCP_uc003tix.2_Missense_Mutation_p.P638T|URGCP_uc003tiy.2_Missense_Mutation_p.P604T|URGCP_uc003tiz.2_Missense_Mutation_p.P604T|URGCP_uc011kbj.1_Missense_Mutation_p.P604T	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	647					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						GCCAAGCCTGGGAAGTGGGCA	0.622																0.343284	59.000657	60.456069	23	44	KEEP	---	---	---	---	14	17	32	26	0.451612903226	capture	Missense_Mutation	SNP	43917123	43917123	URGCP	7	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	16908	149
URGCP	55665	broad.mit.edu	37	7	43918034	43918034	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43918034G>C	uc003tiw.2	-	6	1085	c.1028C>G	c.(1027-1029)TCT>TGT	p.S343C	URGCP_uc003tiu.2_Missense_Mutation_p.S300C|URGCP_uc003tiv.2_Missense_Mutation_p.S268C|URGCP_uc003tix.2_Missense_Mutation_p.S334C|URGCP_uc003tiy.2_Missense_Mutation_p.S300C|URGCP_uc003tiz.2_Missense_Mutation_p.S300C|URGCP_uc011kbj.1_Missense_Mutation_p.S300C	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	343					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						CAGCCAGTGAGACCCGATGTC	0.458																0.211055	119.935695	135.302429	42	157	KEEP	---	---	---	---	26	30	103	91	-1	capture	Missense_Mutation	SNP	43918034	43918034	URGCP	7	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	16908	149
URGCP	55665	broad.mit.edu	37	7	43918768	43918768	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43918768G>C	uc003tiw.2	-	6	351	c.294C>G	c.(292-294)ATC>ATG	p.I98M	URGCP_uc003tiu.2_Missense_Mutation_p.I55M|URGCP_uc003tiv.2_Missense_Mutation_p.I23M|URGCP_uc003tix.2_Missense_Mutation_p.I89M|URGCP_uc003tiy.2_Missense_Mutation_p.I55M|URGCP_uc003tiz.2_Missense_Mutation_p.I55M|URGCP_uc011kbj.1_Missense_Mutation_p.I55M	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	98					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						TGTCAAAACTGATCTGCAGAG	0.507																0.213592	124.685889	140.293545	44	162	KEEP	---	---	---	---	26	20	84	81	-1	capture	Missense_Mutation	SNP	43918768	43918768	URGCP	7	G	C	C	C	1	0	0	0	0	1	0	0	0	577	45	4	4	16908	149
EGFR	1956	broad.mit.edu	37	7	55224307	55224307	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55224307C>T	uc003tqk.2	+	9	1334	c.1088C>T	c.(1087-1089)ACC>ATC	p.T363I	EGFR_uc003tqh.2_Missense_Mutation_p.T363I|EGFR_uc003tqi.2_Missense_Mutation_p.T363I|EGFR_uc003tqj.2_Missense_Mutation_p.T363I|EGFR_uc010kzg.1_Missense_Mutation_p.T318I|EGFR_uc011kco.1_Missense_Mutation_p.T310I|EGFR_uc011kcp.1_RNA|EGFR_uc011kcq.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	363	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AAAAACTGCACCTCCATCAGT	0.413			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.966268	2899.197867	2960.11343	888	31	KEEP	---	---	---	---	449	512	19	20	-1	capture	Missense_Mutation	SNP	55224307	55224307	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	4922	149
NCF1	653361	broad.mit.edu	37	7	74193497	74193497	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:74193497C>T	uc003ubb.2	+	3	293	c.223C>T	c.(223-225)CTC>TTC	p.L75F	NCF1_uc010lbs.1_Missense_Mutation_p.L75F|NCF1_uc011kfh.1_Intron	NM_000265	NP_000256	P14598	NCF1_HUMAN	neutrophil cytosolic factor 1	75	PX.				cell communication|cellular defense response|innate immune response|protein targeting to membrane|respiratory burst|superoxide anion generation	cytosol|NADPH oxidase complex|soluble fraction	electron carrier activity|GTP binding|GTPase activity|phosphatidylinositol binding|SH3 domain binding|superoxide-generating NADPH oxidase activity			skin(1)	1						CATCCCCCACCTCCCAGGTGA	0.552																0.157895	4.715281	6.836467	3	16	KEEP	---	---	---	---	1	3	21	14	-1	capture	Missense_Mutation	SNP	74193497	74193497	NCF1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	10123	149
TRIM4	89122	broad.mit.edu	37	7	99516656	99516656	+	Silent	SNP	G	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99516656G>A	uc003usd.2	-	1	499	c.369C>T	c.(367-369)ATC>ATT	p.I123I	TRIM4_uc003use.2_Silent_p.I123I|TRIM4_uc011kjc.1_5'UTR|TRIM4_uc003usf.2_Silent_p.I123I	NM_033017	NP_148977	Q9C037	TRIM4_HUMAN	tripartite motif protein TRIM4 isoform alpha	123	B box-type.				protein trimerization	cytoplasm|plasma membrane	zinc ion binding			ovary(1)|kidney(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				AGGCCTCGTCGATGGGTGCCA	0.612																0.315789	13.733241	14.312532	6	13	KEEP	---	---	---	---	4	2	9	5	-1	capture	Silent	SNP	99516656	99516656	TRIM4	7	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	16397	149
PIK3CG	5294	broad.mit.edu	37	7	106508126	106508126	+	Silent	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106508126C>T	uc003vdv.3	+	2	205	c.120C>T	c.(118-120)ATC>ATT	p.I40I	PIK3CG_uc003vdu.2_Silent_p.I40I|PIK3CG_uc003vdw.2_Silent_p.I40I	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	40					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						TCATCCCCATCGAGTTCGTGC	0.662					292											0.173228	40.6776	53.487284	22	105	KEEP	---	---	---	---	13	13	47	83	-1	capture	Silent	SNP	106508126	106508126	PIK3CG	7	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	11819	149
C7orf66	154907	broad.mit.edu	37	7	108524126	108524126	+	Missense_Mutation	SNP	G	A	A	rs143724624		TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:108524126G>A	uc003vfo.2	-	2	334	c.286C>T	c.(286-288)CGG>TGG	p.R96W		NM_001024607	NP_001019778	A4D0T2	CG066_HUMAN	hypothetical protein LOC154907	96						integral to membrane				ovary(2)	2						TGGACAATCCGTAGATATGCA	0.348																0.268608	220.892386	235.822767	83	226	KEEP	---	---	---	---	52	37	112	125	-1	capture	Missense_Mutation	SNP	108524126	108524126	C7orf66	7	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	2389	149
GPR37	2861	broad.mit.edu	37	7	124387325	124387325	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:124387325C>T	uc003vli.2	-	2	1747	c.1096G>A	c.(1096-1098)GTA>ATA	p.V366I		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	366	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						TACATCTGTACGTTGGTGGCA	0.463																0.298246	139.663227	145.882272	51	120	KEEP	---	---	---	---	32	25	57	75	-1	capture	Missense_Mutation	SNP	124387325	124387325	GPR37	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6625	149
AKR1B10	57016	broad.mit.edu	37	7	134212671	134212671	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134212671C>T	uc003vrr.2	+	1	328	c.8C>T	c.(7-9)ACG>ATG	p.T3M		NM_020299	NP_064695	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10	3					cellular aldehyde metabolic process|digestion|steroid metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|protein binding			skin(5)	5						ACCATGGCCACGTTTGTGGAG	0.438																0.275591	95.669472	101.428365	35	92	KEEP	---	---	---	---	17	28	49	63	-1	capture	Missense_Mutation	SNP	134212671	134212671	AKR1B10	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	467	149
EBF2	64641	broad.mit.edu	37	8	25718712	25718712	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25718712C>A	uc003xes.1	-	13	1212	c.1195G>T	c.(1195-1197)GCT>TCT	p.A399S	PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_RNA	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	399					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		AGAGCTTCAGCAATGTCTGCG	0.493	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)															0.385135	172.137551	173.850394	57	91	KEEP	---	---	---	---	37	30	59	60	0.44776119403	capture	Missense_Mutation	SNP	25718712	25718712	EBF2	8	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	4836	149
LY96	23643	broad.mit.edu	37	8	74922304	74922304	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:74922304A>G	uc003yad.2	+	3	362	c.271A>G	c.(271-273)AAA>GAA	p.K91E		NM_015364	NP_056179	Q9Y6Y9	LY96_HUMAN	MD-2 protein precursor	91					cellular defense response|detection of lipopolysaccharide|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	extracellular space|lipopolysaccharide receptor complex|plasma membrane	coreceptor activity|lipopolysaccharide receptor activity|protein binding				0	Breast(64;0.0311)		Epithelial(68;0.0208)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0619)			TCCAAAGCGCAAAGAAGTTAT	0.343	GBM(131;1357 1748 34893 50149 52212)															0.338983	121.826433	124.501968	40	78	KEEP	---	---	---	---	26	20	47	41	-1	capture	Missense_Mutation	SNP	74922304	74922304	LY96	8	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	9017	149
TAF2	6873	broad.mit.edu	37	8	120831592	120831592	+	Nonsense_Mutation	SNP	G	C	C			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120831592G>C	uc003you.2	-	3	563	c.293C>G	c.(292-294)TCA>TGA	p.S98*		NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2	98					G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TTACTGTTTTGATTCACTGTG	0.289																0.101307	41.309214	89.817621	31	275	KEEP	---	---	---	---	19	17	148	155	-1	capture	Nonsense_Mutation	SNP	120831592	120831592	TAF2	8	G	C	C	C	1	0	0	0	0	0	1	0	0	585	45	5	4	15412	149
C9orf131	138724	broad.mit.edu	37	9	35045372	35045372	+	Missense_Mutation	SNP	C	G	G	rs3739871	byFrequency;by1000genomes	TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35045372C>G	uc003zvw.2	+	2	2775	c.2746C>G	c.(2746-2748)CCA>GCA	p.P916A	C9orf131_uc003zvu.2_Missense_Mutation_p.P868A|C9orf131_uc003zvv.2_Missense_Mutation_p.P843A|C9orf131_uc003zvx.2_Missense_Mutation_p.P881A	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	916											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			CTATCTATCTCCAGGCCCAGG	0.537																0.341108	388.350394	395.966185	117	226	KEEP	---	---	---	---	53	72	117	120	-1	capture	Missense_Mutation	SNP	35045372	35045372	C9orf131	9	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	2434	149
LHFPL3	375612	broad.mit.edu	37	7	103969236	103969237	+	In_Frame_Ins	INS	-	GCC	GCC			TCGA-14-1829-01	TCGA-14-1829-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103969236_103969237insGCC	uc003vce.2	+	1	133_134	c.9_10insGCC	c.(7-12)insGCC	p.14_15insA	LHFPL3_uc003vcf.2_In_Frame_Ins_p.14_15insA	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	Error:Variant_position_missing_in_Q86UP9_after_alignment_1						integral to membrane					0						gAATGCCCGGAgccgccgccgc	0.396																0.31			4	9		---	---	---	---						capture_indel	In_Frame_Ins	INS	103969236	103969237	LHFPL3	7	-	GCC	GCC	GCC	1	0	1	1	0	0	0	0	0	132	11	5	5	8686	149
