Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
HSPG2	3339	broad.mit.edu	37	1	22211272	22211272	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22211272C>T	uc001bfj.2	-	12	1535	c.1495G>A	c.(1495-1497)GTC>ATC	p.V499I	HSPG2_uc009vqd.2_Missense_Mutation_p.V499I	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	499	Ig-like C2-type 1.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	CGTTGTGGGACGAGCTCAAGG	0.667																0.433333	36.568459	36.684957	13	17	KEEP	---	---	---	---	8	8	9	12	-1	capture	Missense_Mutation	SNP	22211272	22211272	HSPG2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7355	152
DAB1	1600	broad.mit.edu	37	1	57535043	57535043	+	Missense_Mutation	SNP	T	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:57535043T>A	uc001cys.1	-	10	1327	c.653A>T	c.(652-654)AAC>ATC	p.N218I	DAB1_uc001cyt.1_Missense_Mutation_p.N218I|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Missense_Mutation_p.N218I	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1	218					cell differentiation|nervous system development					skin(2)|ovary(1)	3						CTGATAAATGTTTTCTTCCGT	0.423					395											0.399083	249.236747	251.189803	87	131	KEEP	---	---	---	---	77	37	84	87	-1	capture	Missense_Mutation	SNP	57535043	57535043	DAB1	1	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	4177	152
DCLRE1B	64858	broad.mit.edu	37	1	114448263	114448263	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114448263C>T	uc001eeg.2	+	1	226	c.55C>T	c.(55-57)CGC>TGC	p.R19C	AP4B1_uc001eeb.2_5'Flank|AP4B1_uc001eec.2_5'Flank|AP4B1_uc001eed.2_5'Flank|AP4B1_uc010owp.1_5'Flank|AP4B1_uc010owq.1_5'Flank|DCLRE1B_uc001eeh.2_5'UTR|DCLRE1B_uc001eei.2_5'UTR	NM_022836	NP_073747	Q9H816	DCR1B_HUMAN	DNA cross-link repair 1B (PSO2 homolog, S.	19					cell cycle checkpoint|DNA repair|protection from non-homologous end joining at telomere|telomeric 3' overhang formation|telomeric loop formation	centrosome|chromosome, telomeric region|nucleus	5'-3' exonuclease activity|protein binding				0	Lung SC(450;0.184)	all_cancers(81;1.46e-05)|all_epithelial(167;2.42e-05)|all_lung(203;0.000353)|Lung NSC(69;0.000518)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGGAGCCTGCGCCGGGCTGG	0.642											Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					0.026738	-38.082061	8.197274	5	182	KEEP	---	---	---	---	2	3	91	115	-1	capture	Missense_Mutation	SNP	114448263	114448263	DCLRE1B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4254	152
CASQ2	845	broad.mit.edu	37	1	116247851	116247851	+	Missense_Mutation	SNP	G	C	C			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:116247851G>C	uc001efx.3	-	9	1165	c.901C>G	c.(901-903)CTG>GTG	p.L301V	CASQ2_uc010owu.1_Missense_Mutation_p.L230V	NM_001232	NP_001223	O14958	CASQ2_HUMAN	cardiac calsequestrin 2 precursor	301					heart development|striated muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		AGGATGCTCAGATCGGGGTTG	0.547																0.030769	-20.320981	11.051933	4	126	KEEP	---	---	---	---	2	3	61	77	-1	capture	Missense_Mutation	SNP	116247851	116247851	CASQ2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	2657	152
PRSS38	339501	broad.mit.edu	37	1	228004940	228004940	+	Silent	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228004940C>T	uc001hrh.2	+	3	342	c.342C>T	c.(340-342)TAC>TAT	p.Y114Y		NM_183062	NP_898885	A1L453	PRS38_HUMAN	marapsin 2 precursor	114	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)|pancreas(1)	2						ATGACATGTACGTAGGCCTCG	0.562																0.02439	-24.28132	6.611965	3	120	KEEP	---	---	---	---	1	4	52	79	-1	capture	Silent	SNP	228004940	228004940	PRSS38	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12522	152
LYST	1130	broad.mit.edu	37	1	235866238	235866238	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235866238C>T	uc001hxj.2	-	45	10358	c.10183G>A	c.(10183-10185)GTT>ATT	p.V3395I	LYST_uc001hxi.2_Missense_Mutation_p.V619I	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	3395	BEACH.				defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CGTCTCTGAACTGGATCTTCA	0.448												Chediak-Higashi_syndrome				0.013986	-105.958666	9.475408	6	423	KEEP	---	---	---	---	3	3	223	259	-1	capture	Missense_Mutation	SNP	235866238	235866238	LYST	1	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	9043	152
HEATR1	55127	broad.mit.edu	37	1	236749663	236749663	+	Missense_Mutation	SNP	C	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:236749663C>A	uc001hyd.1	-	15	1930	c.1805G>T	c.(1804-1806)TGT>TTT	p.C602F		NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	602					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TGGCAGCAAACATACAACCAC	0.358																0.02	-32.413701	6.350144	3	147	KEEP	---	---	---	---	5	0	88	76	-1	capture	Missense_Mutation	SNP	236749663	236749663	HEATR1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	6954	152
NMT2	9397	broad.mit.edu	37	10	15183429	15183429	+	Missense_Mutation	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:15183429G>A	uc001inz.1	-	2	322	c.238C>T	c.(238-240)CCT>TCT	p.P80S	NMT2_uc001ioa.1_Silent_p.S52S|NMT2_uc009xjo.1_Missense_Mutation_p.P80S|NMT2_uc010qbz.1_5'UTR	NM_004808	NP_004799	O60551	NMT2_HUMAN	N-myristoyltransferase 2	80					N-terminal protein myristoylation|protein lipoylation	Golgi apparatus|plasma membrane	glycylpeptide N-tetradecanoyltransferase activity			ovary(1)	1						ACTTTCGAAGGCTGCTGAATT	0.393	Melanoma(117;1345 1645 4130 12688 30625)															0.025641	-31.93832	6.941521	4	152	KEEP	---	---	---	---	3	2	79	97	-1	capture	Missense_Mutation	SNP	15183429	15183429	NMT2	10	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10411	152
MYOZ1	58529	broad.mit.edu	37	10	75399754	75399754	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:75399754C>T	uc001jur.2	-	2	387	c.22G>A	c.(22-24)GCC>ACC	p.A8T		NM_021245	NP_067068	Q9NP98	MYOZ1_HUMAN	myozenin 1	8					myofibril assembly	nucleus|pseudopodium	FATZ binding			ovary(2)	2	Prostate(51;0.0112)					TTATTAGGGGCCGGGGTTCCT	0.542																0.020161	-55.688	8.277603	5	243	KEEP	---	---	---	---	0	8	126	160	-1	capture	Missense_Mutation	SNP	75399754	75399754	MYOZ1	10	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10005	152
DLG5	9231	broad.mit.edu	37	10	79571808	79571808	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:79571808C>T	uc001jzk.2	-	22	4266	c.4196G>A	c.(4195-4197)GGC>GAC	p.G1399D	DLG5_uc001jzi.2_Missense_Mutation_p.G154D|DLG5_uc001jzj.2_Missense_Mutation_p.G814D|DLG5_uc009xru.1_RNA	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5	1399	PDZ 3.				cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			CAGGTTTATGCCGTTGAACTG	0.642																0.035461	-25.024862	8.052878	5	136	KEEP	---	---	---	---	1	5	59	110	-1	capture	Missense_Mutation	SNP	79571808	79571808	DLG5	10	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4516	152
EBF3	253738	broad.mit.edu	37	10	131676050	131676050	+	Silent	SNP	T	C	C			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:131676050T>C	uc001lki.1	-	7	677	c.618A>G	c.(616-618)CGA>CGG	p.R206R		NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3	206					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		TCCGCATATCTCGAGGGTTGC	0.368																0.051282	-1.680907	6.628721	2	37	KEEP	---	---	---	---	4	0	27	23	-1	capture	Silent	SNP	131676050	131676050	EBF3	10	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	4837	152
TEAD1	7003	broad.mit.edu	37	11	12902599	12902599	+	Splice_Site	SNP	G	C	C			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:12902599G>C	uc001mkj.3	+	7	1132	c.467_splice	c.e7+1	p.D156_splice	TEAD1_uc001mkk.3_Splice_Site_p.D75_splice|TEAD1_uc009ygl.2_Splice_Site_p.D50_splice	NM_021961	NP_068780	P28347	TEAD1_HUMAN	TEA domain family member 1						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CCTCACAAGAGTAAGTCTGAG	0.547																0.026906	-41.45664	13.677745	6	217	KEEP	---	---	---	---	2	5	120	127	-1	capture	Splice_Site	SNP	12902599	12902599	TEAD1	11	G	C	C	C	1	0	0	0	0	0	0	1	0	468	36	5	4	15623	152
OR4C15	81309	broad.mit.edu	37	11	55322827	55322827	+	Missense_Mutation	SNP	C	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55322827C>G	uc010rig.1	+	1	1045	c.1045C>G	c.(1045-1047)CAG>GAG	p.Q349E		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	295	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GGAAGTAAAACAGGCCATGAG	0.328													HNSCC(20;0.049)			0.38342	261.807814	264.107124	74	119	KEEP	---	---	---	---	39	38	61	61	-1	capture	Missense_Mutation	SNP	55322827	55322827	OR4C15	11	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	10952	152
KRT80	144501	broad.mit.edu	37	12	52565281	52565281	+	Silent	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52565281C>T	uc001rzx.2	-	9	1358	c.1260G>A	c.(1258-1260)AAG>AAA	p.K420K	KRT80_uc001rzw.2_Silent_p.K455K|KRT80_uc001rzy.2_3'UTR	NM_182507	NP_872313	Q6KB66	K2C80_HUMAN	keratin 80 isoform a	420	Tail.					keratin filament	structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.108)		GGGAGGGGGCCTTGGAGAGGC	0.542	GBM(178;2309 2916 15678 35873)															0.483333	193.647928	193.676784	58	62	KEEP	---	---	---	---	30	38	27	41	-1	capture	Silent	SNP	52565281	52565281	KRT80	12	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	8414	152
LRIG3	121227	broad.mit.edu	37	12	59271381	59271381	+	Silent	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:59271381G>A	uc001sqr.2	-	15	2583	c.2337C>T	c.(2335-2337)AAC>AAT	p.N779N	LRIG3_uc009zqh.2_Silent_p.N719N|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	779	Ig-like C2-type 3.					integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			TGAGGCGCACGTTTCCTCTCT	0.532																0.47619	203.615743	203.689439	70	77	KEEP	---	---	---	---	29	42	38	40	-1	capture	Silent	SNP	59271381	59271381	LRIG3	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8862	152
C14orf21	161424	broad.mit.edu	37	14	24769334	24769334	+	Missense_Mutation	SNP	C	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24769334C>A	uc001wol.1	+	1	237	c.174C>A	c.(172-174)AGC>AGA	p.S58R	C14orf21_uc001wom.1_5'Flank|DHRS1_uc001woj.1_5'Flank|DHRS1_uc001wok.2_5'Flank	NM_174913	NP_777573	Q86U38	CN021_HUMAN	hypothetical protein LOC161424	58							RNA binding			breast(2)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(265;0.0185)		CGCACCTGAGCCCGGAAGCTC	0.662																0.036842	-37.649605	6.708134	7	183	KEEP	---	---	---	---	6	3	97	118	0.333333333333	capture	Missense_Mutation	SNP	24769334	24769334	C14orf21	14	C	A	A	A	1	0	0	0	0	1	0	0	0	337	26	4	4	1755	152
C14orf101	54916	broad.mit.edu	37	14	57075891	57075891	+	Missense_Mutation	SNP	A	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:57075891A>G	uc001xcm.2	+	6	826	c.704A>G	c.(703-705)CAC>CGC	p.H235R	C14orf101_uc001xcj.2_RNA|C14orf101_uc001xck.2_Missense_Mutation_p.H235R|C14orf101_uc010aot.1_Missense_Mutation_p.H235R|C14orf101_uc001xcl.1_RNA|C14orf101_uc001xcn.2_RNA|C14orf101_uc010trf.1_5'UTR	NM_017799	NP_060269	Q9NX78	CN101_HUMAN	hypothetical protein LOC54916	235	Helical; (Potential).					integral to membrane				breast(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(311;0.226)		CCCTATGTCCACCTTCCCATC	0.488																0.44	942.193045	944.143424	275	350	KEEP	---	---	---	---	139	170	182	213	-1	capture	Missense_Mutation	SNP	57075891	57075891	C14orf101	14	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	1720	152
PAPOLA	10914	broad.mit.edu	37	14	96986512	96986512	+	Missense_Mutation	SNP	T	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96986512T>G	uc001yfq.2	+	2	339	c.129T>G	c.(127-129)ATT>ATG	p.I43M	PAPOLA_uc001yfo.2_Missense_Mutation_p.I43M|PAPOLA_uc001yfp.2_Missense_Mutation_p.I43M|PAPOLA_uc001yfr.2_Missense_Mutation_p.I43M|PAPOLA_uc010twv.1_Missense_Mutation_p.I43M|PAPOLA_uc010avp.2_Translation_Start_Site	NM_032632	NP_116021	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	43					mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding				0		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		AGAAACTAATTGAGACATTGA	0.408	NSCLC(19;254 734 11908 35501 39234)															0.022901	-26.091559	7.125287	3	128	KEEP	---	---	---	---	1	2	72	75	-1	capture	Missense_Mutation	SNP	96986512	96986512	PAPOLA	14	T	G	G	G	1	0	0	0	0	1	0	0	0	809	63	4	4	11333	152
WARS	7453	broad.mit.edu	37	14	100808747	100808747	+	Missense_Mutation	SNP	C	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:100808747C>A	uc001yhf.1	-	8	1185	c.1101G>T	c.(1099-1101)CAG>CAT	p.Q367H	WARS_uc001yhe.1_Missense_Mutation_p.Q173H|WARS_uc001yhg.1_Missense_Mutation_p.Q367H|WARS_uc001yhh.1_Missense_Mutation_p.Q367H|WARS_uc001yhi.1_Missense_Mutation_p.Q326H|WARS_uc001yhj.1_Missense_Mutation_p.Q326H|WARS_uc001yhk.1_Missense_Mutation_p.Q326H|WARS_uc001yhl.1_Missense_Mutation_p.Q367H	NM_173701	NP_776049	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase isoform a	367					angiogenesis|negative regulation of cell proliferation|regulation of angiogenesis|tryptophanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|protein binding|tryptophan-tRNA ligase activity			breast(1)	1		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	TGGTTTTGATCTGCTTGGCCG	0.622																0.059701	-5.159768	8.43618	4	63	KEEP	---	---	---	---	2	2	31	51	0.5	capture	Missense_Mutation	SNP	100808747	100808747	WARS	14	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	17131	152
SPTBN5	51332	broad.mit.edu	37	15	42185109	42185109	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42185109C>T	uc001zos.2	-	3	595	c.262G>A	c.(262-264)GCC>ACC	p.A88T	uc010bcp.1_RNA	NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	123	Actin-binding.|CH 1.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CTGAGGAAGGCCAGAGCTCGG	0.687																0.327869	54.083936	55.684229	20	41	KEEP	---	---	---	---	21	8	19	33	-1	capture	Missense_Mutation	SNP	42185109	42185109	SPTBN5	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15014	152
PDIA3	2923	broad.mit.edu	37	15	44055362	44055362	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:44055362C>T	uc001zsu.2	+	5	708	c.560C>T	c.(559-561)ACG>ATG	p.T187M	PDIA3_uc010bdp.2_Missense_Mutation_p.T167M|PDIA3_uc010ued.1_Translation_Start_Site	NM_005313	NP_005304	P30101	PDIA3_HUMAN	protein disulfide-isomerase A3 precursor	187					cell redox homeostasis|glycerol ether metabolic process|post-translational protein modification|protein folding|protein import into nucleus|protein N-linked glycosylation via asparagine|protein retention in ER lumen|signal transduction	endoplasmic reticulum lumen|melanosome	cysteine-type endopeptidase activity|electron carrier activity|phospholipase C activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)|skin(1)	2		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		TTTGCACATACGAATGTTGAG	0.408																0.471761	432.922068	433.13129	142	159	KEEP	---	---	---	---	68	90	84	102	-1	capture	Missense_Mutation	SNP	44055362	44055362	PDIA3	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11572	152
ADAMTSL3	57188	broad.mit.edu	37	15	84442304	84442304	+	Silent	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:84442304C>T	uc002bjz.3	+	4	443	c.219C>T	c.(217-219)GAC>GAT	p.D73D	ADAMTSL3_uc002bjy.1_Silent_p.D73D|ADAMTSL3_uc010bmt.1_Silent_p.D73D|ADAMTSL3_uc010bmu.1_Silent_p.D73D	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	73						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			CAGATGAAGACAAAGATGGCA	0.438					580											0.419847	152.891374	153.628201	55	76	KEEP	---	---	---	---	33	30	45	52	-1	capture	Silent	SNP	84442304	84442304	ADAMTSL3	15	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	276	152
ZFHX3	463	broad.mit.edu	37	16	72831003	72831003	+	Missense_Mutation	SNP	T	C	C			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:72831003T>C	uc002fck.2	-	9	6251	c.5578A>G	c.(5578-5580)ATA>GTA	p.I1860V	ZFHX3_uc002fcl.2_Missense_Mutation_p.I946V	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	1860					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				CTCTGGGCTATAGAGAGTTGG	0.532																0.019934	-65.772116	12.001096	6	295	KEEP	---	---	---	---	4	4	140	213	-1	capture	Missense_Mutation	SNP	72831003	72831003	ZFHX3	16	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	17514	152
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	T	T	rs28934578		TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578406C>T	uc002gim.2	-	5	718	c.524G>A	c.(523-525)CGC>CAC	p.R175H	TP53_uc002gig.1_Missense_Mutation_p.R175H|TP53_uc002gih.2_Missense_Mutation_p.R175H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R43H|TP53_uc010cng.1_Missense_Mutation_p.R43H|TP53_uc002gii.1_Missense_Mutation_p.R43H|TP53_uc010cnh.1_Missense_Mutation_p.R175H|TP53_uc010cni.1_Missense_Mutation_p.R175H|TP53_uc002gij.2_Missense_Mutation_p.R175H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R82H|TP53_uc002gio.2_Missense_Mutation_p.R43H|TP53_uc010vug.1_Missense_Mutation_p.R136H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	175	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R175H(729)|p.R175L(19)|p.R175C(12)|p.R175G(11)|p.0?(7)|p.R175P(5)|p.R175S(5)|p.R43H(5)|p.R82H(5)|p.R175R(4)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.R175fs*5(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTGGGGGCAGCGCCTCACAAC	0.652	Pancreas(47;798 1329 9957 10801)	R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(HCC1395_BREAST)|R175H(KLE_ENDOMETRIUM)|R175H(NCIH196_LUNG)|R175H(AU565_BREAST)|R175H(TYKNU_OVARY)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(SKUT1_SOFT_TISSUE)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(LS123_LARGE_INTESTINE)|R175H(SKBR3_BREAST)|R175H(RKN_OVARY)|R175H(HUCCT1_BILIARY_TRACT)	111	p.R175L(LS123-Tumor)|p.R175L(VMRCLCD-Tumor)|p.R175L(DETROIT562-Tumor)|p.R175L(KMS26-Tumor)|p.R175L(KLE-Tumor)|p.R175L(SNU245-Tumor)|p.R175L(SKBR3-Tumor)|p.R175L(RKN-Tumor)|p.R174fs(THP1-Tumor)|p.R175L(HCC1395-Tumor)|p.R175L(VMCUB1-Tumor)|p.R175L(RT11284-Tumor)|p.R175L(AU565-Tumor)|p.R175L(SKUT1-Tumor)|p.R175L(HS571.T-Tumor)|p.R175L(HUCCT1-Tumor)|p.R175L(TYKNU-Tumor)|p.R175L(LMSU-Tumor)|p.R175L(CAL33-Tumor)|p.R175L(SNU1197-Tumor)|p.R175L(NCIH196-Tumor)|p.R175H(HCC44-Tumor)|p.R175L(OPM2-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.540984	93.970235	94.058944	33	28	KEEP	---	---	---	---	17	19	18	15	-1	capture	Missense_Mutation	SNP	7578406	7578406	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16264	152
TP53	7157	broad.mit.edu	37	17	7578460	7578460	+	Missense_Mutation	SNP	A	C	C			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578460A>C	uc002gim.2	-	5	664	c.470T>G	c.(469-471)GTC>GGC	p.V157G	TP53_uc002gig.1_Missense_Mutation_p.V157G|TP53_uc002gih.2_Missense_Mutation_p.V157G|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.V25G|TP53_uc010cng.1_Missense_Mutation_p.V25G|TP53_uc002gii.1_Missense_Mutation_p.V25G|TP53_uc010cnh.1_Missense_Mutation_p.V157G|TP53_uc010cni.1_Missense_Mutation_p.V157G|TP53_uc002gij.2_Missense_Mutation_p.V157G|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.V64G|TP53_uc002gio.2_Missense_Mutation_p.V25G|TP53_uc010vug.1_Missense_Mutation_p.V118G	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	157	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		V -> I (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> A (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.V157F(139)|p.V157I(10)|p.V157D(8)|p.V157G(7)|p.0?(7)|p.V157L(6)|p.V157V(5)|p.V157fs*13(3)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.V157A(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CATGGCGCGGACGCGGGTGCC	0.617	Pancreas(47;798 1329 9957 10801)		111		690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.436782	125.081509	125.392654	38	49	KEEP	---	---	---	---	30	24	32	26	-1	capture	Missense_Mutation	SNP	7578460	7578460	TP53	17	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	16264	152
ZNF207	7756	broad.mit.edu	37	17	30696410	30696410	+	Missense_Mutation	SNP	A	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:30696410A>G	uc002hhh.3	+	10	1361	c.1213A>G	c.(1213-1215)ATG>GTG	p.M405V	ZNF207_uc002hhj.3_Missense_Mutation_p.M421V|ZNF207_uc002hhi.3_Missense_Mutation_p.M390V|ZNF207_uc010csz.2_Missense_Mutation_p.M424V|ZNF207_uc002hhk.1_Missense_Mutation_p.M421V|ZNF207_uc002hhl.1_RNA	NM_003457	NP_003448	O43670	ZN207_HUMAN	zinc finger protein 207 isoform a	405						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			AATTGGAGGTATGATGCCACC	0.488																0.396694	154.551514	155.686904	48	73	KEEP	---	---	---	---	27	29	41	45	-1	capture	Missense_Mutation	SNP	30696410	30696410	ZNF207	17	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	17645	152
TAF15	8148	broad.mit.edu	37	17	34171636	34171636	+	Missense_Mutation	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34171636G>A	uc002hkd.2	+	15	1419	c.1333G>A	c.(1333-1335)GGC>AGC	p.G445S	TAF15_uc002hkc.2_Missense_Mutation_p.G442S	NM_139215	NP_631961	Q92804	RBP56_HUMAN	TBP-associated factor 15 isoform 1	445	Arg/Gly-rich.|5.|21 X approximate tandem repeats of D-R- [S,G](0,3)-G-G-Y-G-G.				positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		TAF15/NR4A3(33)	bone(33)|lung(1)|skin(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		aagtgggggcggctatggtgg	0.000				p.RSGGGYGGD450del(NCIH226-Tumor)|p.GYGGDRSGG445del(SNU81-Tumor)	696	T	TEC|CHN1|ZNF384	extraskeletal myxoid chondrosarcomas|ALL								0.647059	33.827568	34.151107	11	6	KEEP	---	---	---	---	10	6	6	7	-1	capture	Missense_Mutation	SNP	34171636	34171636	TAF15	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15406	152
NR1D1	9572	broad.mit.edu	37	17	38253028	38253028	+	Silent	SNP	C	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38253028C>G	uc002htz.1	-	3	1001	c.375G>C	c.(373-375)CTG>CTC	p.L125L	NR1D1_uc010cwq.1_RNA|NR1D1_uc010cwr.1_5'UTR	NM_021724	NP_068370	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	125					cellular response to lipopolysaccharide|negative regulation of receptor biosynthetic process|negative regulation of toll-like receptor 4 signaling pathway|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nuclear chromatin|nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding			skin(1)	1	Colorectal(19;0.000442)					CCATGCCATTCAGCTCTGTGG	0.622																0.037975	-11.548132	6.74107	3	76	KEEP	---	---	---	---	1	2	33	48	-1	capture	Silent	SNP	38253028	38253028	NR1D1	17	C	G	G	G	1	0	0	0	0	0	0	0	1	366	29	4	4	10522	152
FBF1	85302	broad.mit.edu	37	17	73922854	73922854	+	Missense_Mutation	SNP	T	C	C			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73922854T>C	uc002jqc.2	-	9	812	c.538A>G	c.(538-540)ACA>GCA	p.T180A	FBF1_uc002jqa.1_RNA|FBF1_uc010wsp.1_Missense_Mutation_p.T170A|FBF1_uc002jqd.1_Missense_Mutation_p.T180A	NM_001080542	NP_001074011	Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	180											0						TCTCTCACTGTGCTGGGGCTC	0.512																0.044444	-3.685979	6.301534	2	43	KEEP	---	---	---	---	2	0	28	22	-1	capture	Missense_Mutation	SNP	73922854	73922854	FBF1	17	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	5641	152
OR10H2	26538	broad.mit.edu	37	19	15839024	15839024	+	Silent	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15839024G>A	uc002nbm.2	+	1	191	c.171G>A	c.(169-171)ACG>ACA	p.T57T		NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,	57	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					GCCTCCACACGCCCATGTACC	0.612																0.022801	-67.716244	10.18292	7	300	KEEP	---	---	---	---	3	6	141	259	-1	capture	Silent	SNP	15839024	15839024	OR10H2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10810	152
LRP3	4037	broad.mit.edu	37	19	33697915	33697915	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33697915C>T	uc010edh.2	+	7	1840	c.1747C>T	c.(1747-1749)CGC>TGC	p.R583C	LRP3_uc002nuk.3_Missense_Mutation_p.R457C	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	583	Cytoplasmic (Potential).				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					GCAGAATCTTCGCACAGCCAT	0.552																0.466667	21.224679	21.239056	7	8	KEEP	---	---	---	---	5	5	7	2	-1	capture	Missense_Mutation	SNP	33697915	33697915	LRP3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8874	152
FFAR2	2867	broad.mit.edu	37	19	35940825	35940825	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35940825C>T	uc002nzg.2	+	2	289	c.209C>T	c.(208-210)GCG>GTG	p.A70V	FFAR2_uc010eea.2_Missense_Mutation_p.A70V	NM_005306	NP_005297	O15552	FFAR2_HUMAN	free fatty acid receptor 2	70	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity|lipid binding			central_nervous_system(1)	1	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			ATCGAGGCTGCGTCGAACTTC	0.637	GBM(40;139 809 9833 23358 48736)				34											0.529412	81.32649	81.364921	27	24	KEEP	---	---	---	---	22	11	18	10	-1	capture	Missense_Mutation	SNP	35940825	35940825	FFAR2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5774	152
ZNF283	284349	broad.mit.edu	37	19	44351487	44351487	+	Nonsense_Mutation	SNP	T	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44351487T>A	uc002oxr.3	+	7	1002	c.734T>A	c.(733-735)TTA>TAA	p.L245*	ZNF283_uc002oxp.3_Nonsense_Mutation_p.L106*	NM_181845	NP_862828	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	245	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)				AAGAATTATTTAAGTGCCTAT	0.408																0.626506	162.61553	163.78178	52	31	KEEP	---	---	---	---	31	25	22	19	-1	capture	Nonsense_Mutation	SNP	44351487	44351487	ZNF283	19	T	A	A	A	1	0	0	0	0	0	1	0	0	793	61	5	4	17700	152
SAE1	10055	broad.mit.edu	37	19	47700626	47700626	+	Missense_Mutation	SNP	C	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47700626C>A	uc002pgc.2	+	7	926	c.870C>A	c.(868-870)GAC>GAA	p.D290E	SAE1_uc002pgd.2_Intron|SAE1_uc010ekx.2_Intron|SAE1_uc010ekw.2_RNA|SAE1_uc010xyk.1_Missense_Mutation_p.D116E|SAE1_uc002pge.2_Missense_Mutation_p.D226E	NM_016402	NP_057486	Q9UBE0	SAE1_HUMAN	SubName: Full=SUMO-1 activating enzyme subunit 1, isoform CRA_b; SubName: Full=cDNA, FLJ96708, Homo sapiens SUMO-1 activating enzyme subunit 1 (SAE1), mRNA;	290					protein sumoylation|protein ubiquitination	nucleus	ATP-dependent protein binding|enzyme activator activity|ligase activity|protein C-terminus binding|protein heterodimerization activity|ubiquitin activating enzyme activity			ovary(1)	1		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)		TTCCTGAGGACTTTGTCAGGT	0.398																0.018868	-34.8293	6.572738	3	156	KEEP	---	---	---	---	4	1	71	110	0.2	capture	Missense_Mutation	SNP	47700626	47700626	SAE1	19	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	13697	152
FOSL2	2355	broad.mit.edu	37	2	28635026	28635026	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:28635026C>T	uc002rma.2	+	4	1501	c.692C>T	c.(691-693)CCC>CTC	p.P231L	FOSL2_uc010ymi.1_Missense_Mutation_p.P192L	NM_005253	NP_005244	P15408	FOSL2_HUMAN	FOS-like antigen 2	231					cell death|regulation of transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(172;0.155)					GAGGACAGCCCCTCGTCCTCG	0.692																0.345679	79.888729	81.585814	28	53	KEEP	---	---	---	---	29	36	37	47	-1	capture	Missense_Mutation	SNP	28635026	28635026	FOSL2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	5932	152
THADA	63892	broad.mit.edu	37	2	43520122	43520122	+	Missense_Mutation	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:43520122G>A	uc002rsw.3	-	32	5021	c.4669C>T	c.(4669-4671)CGC>TGC	p.R1557C	THADA_uc010far.2_Missense_Mutation_p.R752C|THADA_uc002rsx.3_Missense_Mutation_p.R1557C|THADA_uc002rsy.3_RNA	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1557							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GTTAGTGAGCGCACTTCAGGG	0.557																0.090909	1.365164	8.79024	4	40	KEEP	---	---	---	---	2	4	19	27	-1	capture	Missense_Mutation	SNP	43520122	43520122	THADA	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15725	152
FSHR	2492	broad.mit.edu	37	2	49190747	49190747	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:49190747C>T	uc002rww.2	-	10	1287	c.1213G>A	c.(1213-1215)GCC>ACC	p.A405T	FSHR_uc002rwx.2_Missense_Mutation_p.A343T|FSHR_uc010fbn.2_Missense_Mutation_p.A379T	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	405	Helical; Name=2; (Potential).				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	TCAGCAAAGGCCAGGTTGCAC	0.458												Gonadal_Dysgenesis_46_XX				0.051471	-14.495922	14.46882	7	129	KEEP	---	---	---	---	6	3	82	69	-1	capture	Missense_Mutation	SNP	49190747	49190747	FSHR	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	6016	152
CTNNA2	1496	broad.mit.edu	37	2	80085194	80085194	+	Silent	SNP	A	C	C			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:80085194A>C	uc010ysh.1	+	3	359	c.354A>C	c.(352-354)GTA>GTC	p.V118V	CTNNA2_uc010yse.1_Silent_p.V118V|CTNNA2_uc010ysf.1_Silent_p.V118V|CTNNA2_uc010ysg.1_Silent_p.V118V	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	118					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GCTCGTCGGTAAAGCGCGGCA	0.582					489											0.348148	163.222472	165.952506	47	88	KEEP	---	---	---	---	25	28	42	52	-1	capture	Silent	SNP	80085194	80085194	CTNNA2	2	A	C	C	C	1	0	0	0	0	0	0	0	1	158	13	4	4	3976	152
SLC9A2	6549	broad.mit.edu	37	2	103274233	103274233	+	Missense_Mutation	SNP	G	C	C			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103274233G>C	uc002tca.2	+	2	642	c.500G>C	c.(499-501)GGC>GCC	p.G167A		NM_003048	NP_003039	Q9UBY0	SL9A2_HUMAN	solute carrier family 9 (sodium/hydrogen	167	Cytoplasmic (Potential).					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			central_nervous_system(3)|skin(3)|breast(2)	8						GAGAACATTGGCACGATTTTC	0.493																0.075838	13.654448	118.127655	43	524	KEEP	---	---	---	---	21	27	240	339	-1	capture	Missense_Mutation	SNP	103274233	103274233	SLC9A2	2	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	14604	152
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393	Pancreas(158;264 1958 3300 35450 36047)				134	Mis		gliobastoma 								0.360656	119.060906	121.148256	44	78	KEEP	---	---	---	---	20	28	47	41	-1	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	152
GIGYF2	26058	broad.mit.edu	37	2	233613794	233613794	+	Splice_Site	SNP	T	C	C			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233613794T>C	uc002vti.3	+	7	604	c.267_splice	c.e7+2	p.Q89_splice	GIGYF2_uc010zmj.1_Splice_Site_p.Q89_splice|GIGYF2_uc002vtg.2_Splice_Site_p.Q89_splice|GIGYF2_uc002vtj.3_Splice_Site_p.Q89_splice|GIGYF2_uc002vtk.3_Splice_Site_p.Q89_splice|GIGYF2_uc002vth.3_Splice_Site_p.Q89_splice|GIGYF2_uc010zmk.1_Splice_Site	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b						cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		GAAGAACAGGTTTGTGATTAG	0.433																0.020243	-51.649085	12.070979	5	242	KEEP	---	---	---	---	2	3	103	161	-1	capture	Splice_Site	SNP	233613794	233613794	GIGYF2	2	T	C	C	C	1	0	0	0	0	0	0	1	0	780	60	5	3	6317	152
PRIC285	85441	broad.mit.edu	37	20	62200951	62200951	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62200951C>T	uc002yfm.2	-	5	1530	c.638G>A	c.(637-639)GGC>GAC	p.G213D	PRIC285_uc002yfl.1_5'Flank	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	213					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			TGGCGGGAGGCCGGGAGCCAC	0.697																0.25	5.945834	6.400629	2	6	KEEP	---	---	---	---	0	2	4	4	-1	capture	Missense_Mutation	SNP	62200951	62200951	PRIC285	20	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12381	152
UCKL1	54963	broad.mit.edu	37	20	62577191	62577191	+	Nonsense_Mutation	SNP	A	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62577191A>T	uc010gkn.2	-	4	592	c.549T>A	c.(547-549)TAT>TAA	p.Y183*	UCKL1_uc011abm.1_Nonsense_Mutation_p.Y168*|UCKL1_uc011abn.1_RNA|UCKL1_uc011abo.1_RNA	NM_017859	NP_060329	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	183					interspecies interaction between organisms	endoplasmic reticulum|nucleus	ATP binding|phosphotransferase activity, alcohol group as acceptor|protein binding|uridine kinase activity				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGGTGAAGTCATAAATGGGCA	0.587																0.419811	567.353495	569.737084	178	246	KEEP	---	---	---	---	89	114	128	152	-1	capture	Nonsense_Mutation	SNP	62577191	62577191	UCKL1	20	A	T	T	T	1	0	0	0	0	0	1	0	0	102	8	5	4	16807	152
PRPF6	24148	broad.mit.edu	37	20	62648082	62648082	+	Missense_Mutation	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62648082G>A	uc002yho.2	+	12	1699	c.1531G>A	c.(1531-1533)GAG>AAG	p.E511K	PRPF6_uc002yhp.2_Missense_Mutation_p.E511K	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog	511					assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)					TCAGGATGCCGAGGAATGTGA	0.512																0.37931	93.752527	94.864741	33	54	KEEP	---	---	---	---	24	16	30	30	-1	capture	Missense_Mutation	SNP	62648082	62648082	PRPF6	20	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12470	152
RAP2B	5912	broad.mit.edu	37	3	152880606	152880606	+	Missense_Mutation	SNP	A	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:152880606A>G	uc003ezr.2	+	1	578	c.124A>G	c.(124-126)AAG>GAG	p.K42E		NM_002886	NP_002877	P61225	RAP2B_HUMAN	RAP2B, member of RAS oncogene family precursor	42					Rap protein signal transduction|regulation of protein tyrosine kinase activity	recycling endosome membrane	GTP binding|GTPase activity			lung(2)	2			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			CTTTTACCGCAAGGAGATTGA	0.627																0.039474	-33.914118	18.249393	9	219	KEEP	---	---	---	---	6	4	161	104	-1	capture	Missense_Mutation	SNP	152880606	152880606	RAP2B	3	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	12936	152
MCCC1	56922	broad.mit.edu	37	3	182775185	182775185	+	Missense_Mutation	SNP	C	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:182775185C>G	uc003fle.2	-	8	924	c.787G>C	c.(787-789)GAT>CAT	p.D263H	MCCC1_uc010hxi.2_RNA|MCCC1_uc011bqo.1_RNA|MCCC1_uc003flf.2_Missense_Mutation_p.D146H|MCCC1_uc003flg.2_Missense_Mutation_p.D154H|MCCC1_uc011bqp.1_Missense_Mutation_p.D216H|MCCC1_uc011bqq.1_Missense_Mutation_p.D154H	NM_020166	NP_064551	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)	263	Biotin carboxylation.|ATP-grasp.				biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	CCATGGTGATCACCAAACACC	0.413																0.064516	0.322679	6.433945	2	29	KEEP	---	---	---	---	0	2	20	16	-1	capture	Missense_Mutation	SNP	182775185	182775185	MCCC1	3	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	9287	152
ZNF595	152687	broad.mit.edu	37	4	59387	59387	+	Missense_Mutation	SNP	C	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:59387C>A	uc003fzv.1	+	2	224	c.68C>A	c.(67-69)CCT>CAT	p.P23H	ZNF595_uc003fzu.1_RNA|ZNF718_uc003fzt.3_Missense_Mutation_p.T23N|ZNF595_uc010iay.1_RNA|ZNF595_uc011bus.1_Translation_Start_Site|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595	23					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		TGTCTGGACCCTGCCCAGCAG	0.423																0.014388	-173.497106	13.033495	10	685	KEEP	---	---	---	---	5	7	386	359	0.583333333333	capture	Missense_Mutation	SNP	59387	59387	ZNF595	4	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	17903	152
MTHFD2L	441024	broad.mit.edu	37	4	75065528	75065528	+	Missense_Mutation	SNP	A	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:75065528A>G	uc003hhn.1	+	7	813	c.295A>G	c.(295-297)ACA>GCA	p.T99A	MTHFD2L_uc011cbj.1_Missense_Mutation_p.T99A|MTHFD2L_uc011cbk.1_Missense_Mutation_p.T157A	NM_001144978	NP_001138450	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase 2-like	99					folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process		binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity			ovary(1)|central_nervous_system(1)	2			all cancers(17;0.0101)|Lung(101;0.196)			TGATGAGCGAACAATATGCAA	0.313																0.027273	-20.260726	6.85795	3	107	KEEP	---	---	---	---	2	1	65	53	-1	capture	Missense_Mutation	SNP	75065528	75065528	MTHFD2L	4	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	9840	152
CDKN2AIP	55602	broad.mit.edu	37	4	184367366	184367366	+	Missense_Mutation	SNP	A	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:184367366A>G	uc003ivp.1	+	3	691	c.529A>G	c.(529-531)ACG>GCG	p.T177A	CDKN2AIP_uc003ivq.1_5'UTR	NM_017632	NP_060102	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	177	Ser-rich.				negative regulation of cell growth|positive regulation of signal transduction|regulation of protein stability	granular component|nucleoplasm	double-stranded RNA binding|p53 binding				0		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		AAACAGTTCAACGTGTATAGG	0.473																0.443662	230.813825	231.205407	63	79	KEEP	---	---	---	---	36	32	39	46	-1	capture	Missense_Mutation	SNP	184367366	184367366	CDKN2AIP	4	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	3131	152
TAF7	6879	broad.mit.edu	37	5	140698719	140698719	+	Missense_Mutation	SNP	C	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140698719C>A	uc003ljg.2	-	1	1633	c.893G>T	c.(892-894)AGG>ATG	p.R298M		NM_005642	NP_005633	Q15545	TAF7_HUMAN	TATA box-binding protein-associated factor 2F	298	Potential.				negative regulation of histone acetylation|negative regulation of protein kinase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|spermine transport|transcription initiation from RNA polymerase II promoter	Golgi apparatus|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	histone acetyltransferase binding|thyroid hormone receptor binding|transcription coactivator activity|transcription regulatory region DNA binding|vitamin D receptor binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGTTTTGCCCTGTCCTGGGT	0.453																0.02459	-24.243484	6.32474	3	119	KEEP	---	---	---	---	2	1	47	73	0.333333333333	capture	Missense_Mutation	SNP	140698719	140698719	TAF7	5	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	15420	152
CCNG1	900	broad.mit.edu	37	5	162868235	162868235	+	Missense_Mutation	SNP	A	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:162868235A>G	uc003lzb.2	+	4	550	c.416A>G	c.(415-417)AAG>AGG	p.K139R	CCNG1_uc011dek.1_Missense_Mutation_p.K3R|CCNG1_uc011del.1_Missense_Mutation_p.K3R|CCNG1_uc003lzc.2_RNA	NM_199246	NP_954854	P51959	CCNG1_HUMAN	cyclin G1	139					cell division|mitosis|regulation of cyclin-dependent protein kinase activity	nucleus				lung(1)|kidney(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		AGAATGGAAAAGATTGTATTG	0.378					99											0.021164	-38.776659	9.694802	4	185	KEEP	---	---	---	---	3	3	90	120	-1	capture	Missense_Mutation	SNP	162868235	162868235	CCNG1	5	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	2894	152
OR2J3	442186	broad.mit.edu	37	6	29080438	29080438	+	Silent	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29080438G>A	uc011dll.1	+	1	771	c.771G>A	c.(769-771)CCG>CCA	p.P257P		NM_001005216	NP_001005216	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J,	257	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TTTTCATTCCGGCCATGTGCA	0.458																0.452941	235.896291	236.216755	77	93	KEEP	---	---	---	---	40	58	50	63	-1	capture	Silent	SNP	29080438	29080438	OR2J3	6	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10908	152
DNAH8	1769	broad.mit.edu	37	6	38783392	38783392	+	Missense_Mutation	SNP	T	C	C			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38783392T>C	uc003ooe.1	+	24	3431	c.2831T>C	c.(2830-2832)GTG>GCG	p.V944A		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						ACTACTGACGTGACCCATCAA	0.448					2979											0.544304	144.331279	144.466307	43	36	KEEP	---	---	---	---	21	39	23	32	-1	capture	Missense_Mutation	SNP	38783392	38783392	DNAH8	6	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	4563	152
CD2AP	23607	broad.mit.edu	37	6	47512403	47512403	+	Silent	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:47512403G>A	uc003oyw.2	+	4	837	c.381G>A	c.(379-381)CTG>CTA	p.L127L		NM_012120	NP_036252	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	127	SH3 2.|Interaction with ANLN and localization to the midbody.				cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			AGGATGAACTGGAGCTGAAAG	0.313																0.021429	-29.296939	6.54243	3	137	KEEP	---	---	---	---	0	3	58	113	-1	capture	Silent	SNP	47512403	47512403	CD2AP	6	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	2965	152
C6orf150	115004	broad.mit.edu	37	6	74149963	74149963	+	Silent	SNP	G	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:74149963G>T	uc003pgx.1	-	3	1222	c.1083C>A	c.(1081-1083)CCC>CCA	p.P361P		NM_138441	NP_612450	Q8N884	M21D1_HUMAN	hypothetical protein LOC115004	361											0						TTGCATGCTTGGGTACAAGGT	0.383																0.030769	-24.12163	7.259948	4	126	KEEP	---	---	---	---	2	2	64	69	0.5	capture	Silent	SNP	74149963	74149963	C6orf150	6	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	2314	152
LPA	4018	broad.mit.edu	37	6	160977190	160977190	+	Missense_Mutation	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160977190G>A	uc003qtl.2	-	31	4960	c.4840C>T	c.(4840-4842)CGG>TGG	p.R1614W		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	4122	Kringle 37.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity	p.R1614Q(1)		ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TAGCACTGCCGGACCACAGGG	0.463																0.042857	-9.337523	6.356251	3	67	KEEP	---	---	---	---	1	2	35	37	-1	capture	Missense_Mutation	SNP	160977190	160977190	LPA	6	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	8819	152
ZNF12	7559	broad.mit.edu	37	7	6737438	6737438	+	Missense_Mutation	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6737438G>A	uc003sqt.1	-	3	574	c.20C>T	c.(19-21)CCA>CTA	p.P7L	ZNF12_uc011jxa.1_5'UTR|ZNF12_uc003sqs.1_Missense_Mutation_p.P7L	NM_016265	NP_057349	P17014	ZNF12_HUMAN	zinc finger protein 12 isoform a	7					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		GAATGACACTGGCCCCTGAAA	0.493																0.019737	-68.840896	9.878881	6	298	KEEP	---	---	---	---	5	5	160	195	-1	capture	Missense_Mutation	SNP	6737438	6737438	ZNF12	7	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	17598	152
POM121C	100101267	broad.mit.edu	37	7	75070792	75070792	+	Missense_Mutation	SNP	A	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:75070792A>T	uc010lde.1	-	2	709	c.709T>A	c.(709-711)TCC>ACC	p.S237T	POM121C_uc003udk.3_5'UTR|POM121C_uc003udl.1_RNA			A8CG34	P121C_HUMAN	Homo sapiens POM121-2 mRNA for nuclear pore membrane protein 121-2, partial cds.	237	Required for targeting to the nucleus and nuclear pore complex.|Pore side (Potential).				mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding				0						TTGCGAGGGGACAGCACAGCC	0.527																0.276923	44.418454	47.332936	18	47	KEEP	---	---	---	---	15	8	35	36	-1	capture	Missense_Mutation	SNP	75070792	75070792	POM121C	7	A	T	T	T	1	0	0	0	0	1	0	0	0	118	10	4	4	12142	152
TRRAP	8295	broad.mit.edu	37	7	98588209	98588209	+	Silent	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98588209G>A	uc003upp.2	+	63	9944	c.9735G>A	c.(9733-9735)TCG>TCA	p.S3245S	TRRAP_uc011kis.1_Silent_p.S3216S|TRRAP_uc003upr.2_Silent_p.S2933S	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	3245	FAT.				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TGGTTGGCTCGGAGGGAAAGC	0.527					1847											0.290909	92.472447	96.770713	32	78	KEEP	---	---	---	---	17	17	38	45	-1	capture	Silent	SNP	98588209	98588209	TRRAP	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	16484	152
RP1	6101	broad.mit.edu	37	8	55537403	55537403	+	Missense_Mutation	SNP	A	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:55537403A>G	uc003xsd.1	+	4	1109	c.961A>G	c.(961-963)AAA>GAA	p.K321E	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	321					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TGATATTGAGAAATCAATTAT	0.323	Colon(91;1014 1389 7634 14542 40420)															0.414634	122.738822	123.259817	34	48	KEEP	---	---	---	---	11	24	23	29	-1	capture	Missense_Mutation	SNP	55537403	55537403	RP1	8	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	13424	152
ARHGAP39	80728	broad.mit.edu	37	8	145758601	145758601	+	Missense_Mutation	SNP	G	A	A			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145758601G>A	uc003zdt.1	-	9	3259	c.2704C>T	c.(2704-2706)CGC>TGC	p.R902C	ARHGAP39_uc011llk.1_Missense_Mutation_p.R902C|ARHGAP39_uc003zds.1_Missense_Mutation_p.R933C	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	902	Rho-GAP.				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0						TCGGGGTAGCGCTCTCTCTGC	0.647																0.045455	-15.489953	8.766344	5	105	KEEP	---	---	---	---	2	3	42	77	-1	capture	Missense_Mutation	SNP	145758601	145758601	ARHGAP39	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	877	152
C9orf21	195827	broad.mit.edu	37	9	99413984	99413984	+	Missense_Mutation	SNP	A	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:99413984A>G	uc004awm.2	-	3	308	c.272T>C	c.(271-273)GTC>GCC	p.V91A		NM_153698	NP_714542	Q7RTV5	CI021_HUMAN	hypothetical protein LOC195827	91							antioxidant activity|oxidoreductase activity			large_intestine(1)	1		Acute lymphoblastic leukemia(62;0.0559)				TATAAGGGTGACATTTGCTTC	0.313																0.40708	154.728681	155.580937	46	67	KEEP	---	---	---	---	22	31	39	36	-1	capture	Missense_Mutation	SNP	99413984	99413984	C9orf21	9	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	2449	152
OBP2A	29991	broad.mit.edu	37	9	138438640	138438640	+	Missense_Mutation	SNP	A	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138438640A>G	uc004cgb.2	+	2	131	c.89A>G	c.(88-90)TAC>TGC	p.Y30C	OBP2A_uc004cgc.2_Missense_Mutation_p.Y30C|OBP2A_uc010nau.2_RNA|OBP2A_uc010nav.2_Intron	NM_014582	NP_055397	Q9NY56	OBP2A_HUMAN	odorant binding protein 2A precursor	30					response to stimulus|sensory perception of smell	extracellular region	odorant binding|transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		GGGACCTGGTACGTGAAGGCC	0.607																0.057143	-0.676408	6.525476	2	33	KEEP	---	---	---	---	2	0	45	37	-1	capture	Missense_Mutation	SNP	138438640	138438640	OBP2A	9	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	10715	152
KIAA2022	340533	broad.mit.edu	37	X	73959989	73959989	+	Missense_Mutation	SNP	T	C	C			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:73959989T>C	uc004eby.2	-	3	5020	c.4403A>G	c.(4402-4404)GAG>GGG	p.E1468G		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	1468					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity	p.E1468G(1)		ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						CTGTTCTCGCTCCATGTGCTT	0.473					126											0.024793	-22.983786	7.329686	3	118	KEEP	---	---	---	---	2	1	58	70	-1	capture	Missense_Mutation	SNP	73959989	73959989	KIAA2022	23	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	8191	152
DIAPH2	1730	broad.mit.edu	37	X	96638984	96638984	+	Missense_Mutation	SNP	C	T	T			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:96638984C>T	uc004efu.3	+	25	3482	c.3086C>T	c.(3085-3087)GCT>GTT	p.A1029V	DIAPH2_uc004eft.3_Missense_Mutation_p.A1029V	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156	1029	Potential.				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						AAAGAGAAAGCTGAACAAGAA	0.313																0.115385	3.504933	7.294456	3	23	KEEP	---	---	---	---	3	0	18	11	-1	capture	Missense_Mutation	SNP	96638984	96638984	DIAPH2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	4477	152
VAMP7	6845	broad.mit.edu	37	X	155149532	155149532	+	Missense_Mutation	SNP	T	G	G			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:155149532T>G	uc004fnr.2	+	6	663	c.489T>G	c.(487-489)AAT>AAG	p.N163K	VAMP7_uc004fnt.2_Missense_Mutation_p.N122K|VAMP7_uc011naa.1_Missense_Mutation_p.N124K|VAMP7_uc011nab.1_Missense_Mutation_p.N62K|VAMP7_uc004fns.2_Intron|VAMP7_uc011nac.1_Missense_Mutation_p.N96K	NM_005638	NP_005629	P51809	VAMP7_HUMAN	vesicle-associated membrane protein 7 isoform 1	163	v-SNARE coiled-coil homology.|Cytoplasmic (Potential).				calcium ion-dependent exocytosis|endosome to lysosome transport|eosinophil degranulation|ER to Golgi vesicle-mediated transport|neutrophil degranulation|phagocytosis, engulfment|post-Golgi vesicle-mediated transport|protein transport|vesicle fusion	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|phagocytic vesicle membrane|plasma membrane|SNARE complex|transport vesicle membrane	protein binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AAACAGAAAATCTTGTGGATT	0.338																0.446809	153.206534	153.426124	42	52	KEEP	---	---	---	---	24	25	31	35	-1	capture	Missense_Mutation	SNP	155149532	155149532	VAMP7	23	T	G	G	G	1	0	0	0	0	1	0	0	0	647	50	4	4	16999	152
GBP2	2634	broad.mit.edu	37	1	89575480	89575482	+	In_Frame_Del	DEL	CTC	-	-			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89575480_89575482delCTC	uc001dmz.1	-	10	1808_1810	c.1537_1539delGAG	c.(1537-1539)GAGdel	p.E513del	GBP2_uc001dmy.1_RNA	NM_004120	NP_004111	P32456	GBP2_HUMAN	guanylate binding protein 2,	513					interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	plasma membrane	GTP binding|GTPase activity			ovary(1)	1		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		GTTCCATCATCTCCTCATTCTTC	0.404																0.43			63	83		---	---	---	---						capture_indel	In_Frame_Del	DEL	89575480	89575482	GBP2	1	CTC	-	-	-	1	0	1	0	1	0	0	0	0	415	32	5	5	6214	152
LRFN4	78999	broad.mit.edu	37	11	66626230	66626230	+	Frame_Shift_Del	DEL	G	-	-			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66626230delG	uc001ojr.2	+	1	1355	c.1015delG	c.(1015-1017)GGGfs	p.G339fs	PC_uc001ojo.1_Intron|PC_uc001ojp.1_Intron|PC_uc001ojn.1_Intron|LRFN4_uc001ojq.1_Frame_Shift_Del_p.G339fs|LRFN4_uc001ojs.2_Frame_Shift_Del_p.G339fs	NM_024036	NP_076941	Q6PJG9	LRFN4_HUMAN	leucine rich repeat and fibronectin type III	339	Extracellular (Potential).|Ig-like.					integral to membrane					0						CTTAGAGATTGGGGTGACCGG	0.677																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	66626230	66626230	LRFN4	11	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	8856	152
ANKLE2	23141	broad.mit.edu	37	12	133327271	133327272	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133327271_133327272delGA	uc001ukx.2	-	3	871_872	c.804_805delTC	c.(802-807)TCTCCTfs	p.S268fs	ANKLE2_uc001uky.3_Frame_Shift_Del_p.S206fs	NM_015114	NP_055929	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	268_269						cytoplasm|integral to membrane|nuclear envelope					0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		GTTTTCACAGGAGACAGTGGTA	0.426																0.39			80	123		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	133327271	133327272	ANKLE2	12	GA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	630	152
MKL1	57591	broad.mit.edu	37	22	40814732	40814737	+	In_Frame_Del	DEL	GGGGGC	-	-	rs144888766	by1000genomes	TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:40814732_40814737delGGGGGC	uc003ayv.1	-	9	1912_1917	c.1705_1710delGCCCCC	c.(1705-1710)GCCCCCdel	p.AP569del	MKL1_uc003ayw.1_In_Frame_Del_p.AP569del|MKL1_uc010gye.1_In_Frame_Del_p.AP569del|MKL1_uc010gyf.1_In_Frame_Del_p.AP519del	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein	569_570	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						GGGTGCCGAGgggggcgggggcgggg	0.621					210	T	RBM15	acute megakaryocytic leukemia								0.50			4	4		---	---	---	---						capture_indel	In_Frame_Del	DEL	40814732	40814737	MKL1	22	GGGGGC	-	-	-	1	0	1	0	1	0	0	0	0	548	43	5	5	9513	152
PRKCD	5580	broad.mit.edu	37	3	53220653	53220653	+	Frame_Shift_Del	DEL	G	-	-			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53220653delG	uc003dgl.2	+	14	1647	c.1294delG	c.(1294-1296)GGGfs	p.G432fs	PRKCD_uc003dgm.2_Frame_Shift_Del_p.G432fs	NM_006254	NP_006245	Q05655	KPCD_HUMAN	protein kinase C, delta	432	Protein kinase.				activation of phospholipase C activity|cellular component disassembly involved in apoptosis|cellular senescence|interferon-gamma-mediated signaling pathway|intracellular signal transduction|mRNA metabolic process|negative regulation of insulin receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein binding|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of ceramide biosynthetic process|positive regulation of glucosylceramide catabolic process|positive regulation of protein dephosphorylation|positive regulation of sphingomyelin catabolic process|protein stabilization|regulation of receptor activity|termination of signal transduction	cytosol|endoplasmic reticulum|nucleoplasm	ATP binding|calcium-independent protein kinase C activity|enzyme activator activity|enzyme binding|insulin receptor substrate binding|metal ion binding|protein C-terminus binding			central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)		GTTCCTCAACGGGGGGGACCT	0.602				p.G432W(QGP1-Tumor)	215											0.01			7	819		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	53220653	53220653	PRKCD	3	G	-	-	-	1	0	1	0	1	0	0	0	0	507	39	5	5	12405	152
ATRX	546	broad.mit.edu	37	X	76937111	76937111	+	Frame_Shift_Del	DEL	G	-	-			TCGA-14-4157-01	TCGA-14-4157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76937111delG	uc004ecp.3	-	9	3869	c.3637delC	c.(3637-3639)CAGfs	p.Q1213fs	ATRX_uc004ecq.3_Frame_Shift_Del_p.Q1175fs|ATRX_uc004eco.3_Frame_Shift_Del_p.Q998fs|ATRX_uc004ecr.2_Frame_Shift_Del_p.Q1145fs|ATRX_uc010nlx.1_Frame_Shift_Del_p.Q1184fs|ATRX_uc010nly.1_Frame_Shift_Del_p.Q1158fs	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1213					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	ATAGAATTCTGATCATCATCT	0.388					2	Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						0.93			127	9		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	76937111	76937111	ATRX	23	G	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	1199	152
