Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
DNAJB4	11080	broad.mit.edu	37	1	78470832	78470832	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:78470832A>G	uc001dij.2	+	1	197	c.38A>G	c.(37-39)AAA>AGA	p.K13R	DNAJB4_uc010orn.1_Intron	NM_007034	NP_008965	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	13	J.				protein folding|response to heat|response to unfolded protein	cytoplasm|plasma membrane	heat shock protein binding|unfolded protein binding				0						GGAATTGAGAAAGGAGCTTCA	0.368																0.192488	112.952617	131.756936	41	172	KEEP	---	---	---	---	21	23	85	100	-1	capture	Missense_Mutation	SNP	78470832	78470832	DNAJB4	1	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	4578	166
ODF2L	57489	broad.mit.edu	37	1	86822223	86822223	+	Silent	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86822223C>T	uc001dll.1	-	14	1762	c.1422G>A	c.(1420-1422)GCG>GCA	p.A474A	ODF2L_uc001dlm.1_Silent_p.A445A|ODF2L_uc001dln.2_Silent_p.A445A|ODF2L_uc001dlo.2_Silent_p.A314A|ODF2L_uc001dlp.2_Intron|ODF2L_uc010osg.1_Intron	NM_020729	NP_065780	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like isoform	474	Potential.					centrosome				ovary(1)	1				all cancers(265;0.0313)|Epithelial(280;0.0611)		TCCGTTCCGCCGCCGTCAAGG	0.547																0.425532	62.489302	62.717176	20	27	KEEP	---	---	---	---	15	17	18	28	-1	capture	Silent	SNP	86822223	86822223	ODF2L	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10733	166
SSR2	6746	broad.mit.edu	37	1	155989853	155989853	+	Nonsense_Mutation	SNP	C	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155989853C>A	uc001fmx.2	-	2	186	c.106G>T	c.(106-108)GAG>TAG	p.E36*	SSR2_uc001fmw.2_RNA|SSR2_uc001fmy.2_RNA|SSR2_uc010pgv.1_Nonsense_Mutation_p.E55*|SSR2_uc010pgw.1_Nonsense_Mutation_p.E55*	NM_003145	NP_003136	P43308	SSRB_HUMAN	signal sequence receptor, beta precursor	36	Lumenal (Potential).				cotranslational protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	signal sequence binding				0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCTCGTCCCTCCACGGCGTAT	0.483																0.430233	103.149746	103.516861	37	49	KEEP	---	---	---	---	23	19	26	29	0.452380952381	capture	Nonsense_Mutation	SNP	155989853	155989853	SSR2	1	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	15083	166
OR6K2	81448	broad.mit.edu	37	1	158670186	158670186	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158670186A>G	uc001fsu.1	-	1	257	c.257T>C	c.(256-258)CTT>CCT	p.L86P		NM_001005279	NP_001005279	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K,	86	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					CCTCTCACTAAGCAGGCTAGA	0.458																0.426966	134.739585	135.152962	38	51	KEEP	---	---	---	---	17	33	29	34	-1	capture	Missense_Mutation	SNP	158670186	158670186	OR6K2	1	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	11106	166
NDUFS2	4720	broad.mit.edu	37	1	161182256	161182256	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161182256C>T	uc001fyv.2	+	11	1550	c.1102C>T	c.(1102-1104)CGA>TGA	p.R368*	NDUFS2_uc001fyw.2_Nonsense_Mutation_p.R368*|NDUFS2_uc010pkj.1_Nonsense_Mutation_p.R317*|NDUFS2_uc001fyx.2_Nonsense_Mutation_p.R342*|FCER1G_uc001fyz.1_5'Flank|FCER1G_uc001fza.1_5'Flank	NM_004550	NP_004541	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2	368					mitochondrial electron transport, NADH to ubiquinone|response to oxidative stress|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity|protein binding|quinone binding			skin(1)	1	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		NADH(DB00157)	TCCACCTAAGCGAGCAGAGAT	0.527																0.204545	18.249508	21.814843	9	35	KEEP	---	---	---	---	2	7	21	18	-1	capture	Nonsense_Mutation	SNP	161182256	161182256	NDUFS2	1	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	10199	166
CYP2E1	1571	broad.mit.edu	37	10	135351261	135351261	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135351261G>C	uc001lnj.1	+	8	1195	c.1162G>C	c.(1162-1164)GTC>CTC	p.V388L	CYP2E1_uc001lnk.1_Missense_Mutation_p.V251L|CYP2E1_uc009ybl.1_Missense_Mutation_p.V189L|CYP2E1_uc009ybm.1_Missense_Mutation_p.V42L|CYP2E1_uc001lnl.1_Missense_Mutation_p.V189L	NM_000773	NP_000764	P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E,	388					drug metabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding			central_nervous_system(3)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Dacarbazine(DB00851)|Dapsone(DB00250)|Enflurane(DB00228)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethosuximide(DB00593)|Fomepizole(DB01213)|Glutathione(DB00143)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Isoniazid(DB00951)|Menadione(DB00170)|Mephenytoin(DB00532)|Methoxyflurane(DB01028)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitrofurantoin(DB00698)|Orphenadrine(DB01173)|Phenelzine(DB00780)|Quinidine(DB00908)|S-Adenosylmethionine(DB00118)|Sevoflurane(DB01236)|Theophylline(DB00277)|Tolbutamide(DB01124)	CTAGGGCACAGTCGTAGTGCC	0.398												Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				0.333333	54.81938	56.09374	17	34	KEEP	---	---	---	---	10	8	17	22	-1	capture	Missense_Mutation	SNP	135351261	135351261	CYP2E1	10	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	4130	166
MUC5B	727897	broad.mit.edu	37	11	1257593	1257593	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1257593G>A	uc009ycr.1	+	40	5063	c.4937G>A	c.(4936-4938)CGG>CAG	p.R1646Q	MUC5B_uc009yct.1_Intron|MUC5B_uc001ltb.2_Intron|MUC5B_uc001lta.2_Intron	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTCGGCTTCCGGCAGCGTCTG	0.677																0.372093	45.796066	46.411128	16	27	KEEP	---	---	---	---	7	11	20	12	-1	capture	Missense_Mutation	SNP	1257593	1257593	MUC5B	11	G	A	A	A	1	0	0	0	0	1	0	0	0	495	39	1	1	9889	166
CHRNA10	57053	broad.mit.edu	37	11	3687783	3687783	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3687783T>C	uc001lyf.2	-	5	979	c.907A>G	c.(907-909)ATG>GTG	p.M303V	CHRNA10_uc010qxt.1_Missense_Mutation_p.M97V|CHRNA10_uc010qxu.1_Missense_Mutation_p.M97V	NM_020402	NP_065135	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10	303	Helical; (Potential).				elevation of cytosolic calcium ion concentration|regulation of cell proliferation|synaptic transmission, cholinergic	cell junction|postsynaptic membrane	calcium channel activity|receptor activity|receptor binding			ovary(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Procaine(DB00721)|Trimethaphan(DB01116)	ATAGTGGCCATGTAGTACTTC	0.507	Melanoma(153;17 1869 2949 7120 36888)															0.162162	19.250231	27.298606	12	62	KEEP	---	---	---	---	7	5	34	34	-1	capture	Missense_Mutation	SNP	3687783	3687783	CHRNA10	11	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	3347	166
CNGA4	1262	broad.mit.edu	37	11	6261617	6261617	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6261617G>A	uc001mco.2	+	4	700	c.593G>A	c.(592-594)CGT>CAT	p.R198H	CNGA4_uc010raa.1_Intron|CNGA4_uc001mcn.2_Missense_Mutation_p.R158H	NM_001037329	NP_001032406	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	198	Cytoplasmic (Potential).				response to stimulus|sensory perception of smell		cAMP binding			skin(1)	1		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCTTCGGGCGTGACGCATGG	0.547																0.04461	-37.5258	22.15929	12	257	KEEP	---	---	---	---	7	5	153	123	-1	capture	Missense_Mutation	SNP	6261617	6261617	CNGA4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3564	166
OR10A6	390093	broad.mit.edu	37	11	7950020	7950020	+	Silent	SNP	G	A	A	rs141585665		TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7950020G>A	uc010rbh.1	-	1	190	c.190C>T	c.(190-192)CTG>TTG	p.L64L		NM_001004461	NP_001004461	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A,	64	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GATAAGTTCAGGAGAAACAGG	0.443																0.050314	-14.542512	19.549159	8	151	KEEP	---	---	---	---	3	5	72	94	-1	capture	Silent	SNP	7950020	7950020	OR10A6	11	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	10798	166
SYT13	57586	broad.mit.edu	37	11	45268002	45268002	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45268002C>T	uc001myq.2	-	5	1034	c.908G>A	c.(907-909)CGC>CAC	p.R303H	SYT13_uc009yku.1_Missense_Mutation_p.R159H	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	303	C2 2.|Cytoplasmic (Potential).					transport vesicle				ovary(1)	1						CACCAGGAGGCGGTTGGCAGC	0.572																0.090909	2.811089	15.762678	7	70	KEEP	---	---	---	---	5	4	41	38	-1	capture	Missense_Mutation	SNP	45268002	45268002	SYT13	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15357	166
ODZ4	26011	broad.mit.edu	37	11	78440577	78440577	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:78440577T>C	uc001ozl.3	-	22	3713	c.3250A>G	c.(3250-3252)ATC>GTC	p.I1084V		NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1084	Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						TTGAAGGGGATGGTCGGGTGG	0.567																0.375	68.164294	68.931321	21	35	KEEP	---	---	---	---	11	11	18	19	-1	capture	Missense_Mutation	SNP	78440577	78440577	ODZ4	11	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	10742	166
TMEM126B	55863	broad.mit.edu	37	11	85342819	85342819	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:85342819T>C	uc001pao.2	+	3	332	c.80T>C	c.(79-81)ATA>ACA	p.I27T	TMEM126B_uc001pan.1_Missense_Mutation_p.I27T|TMEM126B_uc001pap.2_Missense_Mutation_p.I27T|TMEM126B_uc001paq.1_Missense_Mutation_p.I27T	NM_018480	NP_060950	Q8IUX1	T126B_HUMAN	transmembrane protein 126B	57						integral to membrane					0		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				ATAGAAATCATAGAAAAAAAT	0.353																0.054348	-5.89898	13.35253	5	87	KEEP	---	---	---	---	3	2	51	44	-1	capture	Missense_Mutation	SNP	85342819	85342819	TMEM126B	11	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	15924	166
ARHGAP32	9743	broad.mit.edu	37	11	128840825	128840825	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:128840825G>C	uc009zcp.2	-	22	4241	c.4241C>G	c.(4240-4242)CCC>CGC	p.P1414R	ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_Missense_Mutation_p.P373R|ARHGAP32_uc001qez.2_Missense_Mutation_p.P1065R	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	1414	Interaction with GAB2.				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						CCTGGTGGGGGGCAGTGGTGC	0.592																0.119403	8.284881	17.785195	8	59	KEEP	---	---	---	---	8	2	40	26	-1	capture	Missense_Mutation	SNP	128840825	128840825	ARHGAP32	11	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	874	166
KIAA1467	57613	broad.mit.edu	37	12	13208755	13208755	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:13208755G>A	uc001rbi.2	+	2	331	c.308G>A	c.(307-309)CGC>CAC	p.R103H	KIAA1467_uc009zhx.1_RNA	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613	103						integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		TCATATGTGCGCACGTCTGTC	0.587																0.11976	21.968694	45.699992	20	147	KEEP	---	---	---	---	14	8	100	73	-1	capture	Missense_Mutation	SNP	13208755	13208755	KIAA1467	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8157	166
HIST4H4	121504	broad.mit.edu	37	12	14923761	14923761	+	Silent	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:14923761A>G	uc001rcf.3	-	1	305	c.258T>C	c.(256-258)GAT>GAC	p.D86D	HIST4H4_uc001rce.2_RNA	NM_175054	NP_778224	P62805	H4_HUMAN	histone cluster 4, H4	86					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(2)	2						CGTACACCACATCCATGGCCG	0.587														OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.122137	20.114573	38.432595	16	115	KEEP	---	---	---	---	8	10	55	75	-1	capture	Silent	SNP	14923761	14923761	HIST4H4	12	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	7110	166
FREM2	341640	broad.mit.edu	37	13	39425866	39425866	+	Silent	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:39425866A>G	uc001uwv.2	+	11	7095	c.6786A>G	c.(6784-6786)GAA>GAG	p.E2262E	FREM2_uc001uww.2_Silent_p.E348E	NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	2262	Extracellular (Potential).|Calx-beta 5.				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GTGTCACTGAACCCAAAGAAC	0.348																0.21978	60.452698	67.031181	20	71	KEEP	---	---	---	---	11	12	44	32	-1	capture	Silent	SNP	39425866	39425866	FREM2	13	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	5988	166
AKAP11	11215	broad.mit.edu	37	13	42877884	42877884	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:42877884A>G	uc001uys.1	+	8	5177	c.5002A>G	c.(5002-5004)AGT>GGT	p.S1668G		NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN	A-kinase anchor protein 11	1668					intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		AGAGCTGAGCAGTACCAGCCT	0.507																0.119048	7.244088	13.228855	5	37	KEEP	---	---	---	---	4	2	20	21	-1	capture	Missense_Mutation	SNP	42877884	42877884	AKAP11	13	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	447	166
RCBTB2	1102	broad.mit.edu	37	13	49089796	49089796	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49089796G>C	uc001vch.2	-	5	495	c.124C>G	c.(124-126)CTA>GTA	p.L42V	RCBTB2_uc010tgg.1_Missense_Mutation_p.L47V|RCBTB2_uc001vci.2_Missense_Mutation_p.L18V|RCBTB2_uc010tgh.1_5'UTR|RCBTB2_uc001vcj.2_Missense_Mutation_p.L46V|RCBTB2_uc010acv.1_RNA|RCBTB2_uc010tgi.1_Missense_Mutation_p.L18V	NM_001268	NP_001259	O95199	RCBT2_HUMAN	regulator of chromosome condensation and BTB	42							Ran guanyl-nucleotide exchange factor activity			ovary(2)|lung(2)|skin(1)	5		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		ATTAACTGTAGTTCTTCTTCA	0.363					264											0.050955	-13.441263	20.093767	8	149	KEEP	---	---	---	---	6	5	82	79	-1	capture	Missense_Mutation	SNP	49089796	49089796	RCBTB2	13	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	13067	166
RNASE4	6038	broad.mit.edu	37	14	21167918	21167918	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21167918C>T	uc001vxy.3	+	2	951	c.388C>T	c.(388-390)CGT>TGT	p.R130C	RNASE4_uc001vxx.3_RNA|RNASE4_uc001vya.2_Missense_Mutation_p.R130C	NM_002937	NP_002928	P34096	RNAS4_HUMAN	ribonuclease, RNase A family, 4 precursor	130					mRNA cleavage	extracellular region	nucleic acid binding|pancreatic ribonuclease activity			central_nervous_system(1)	1	all_cancers(95;0.00304)		Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	GBM - Glioblastoma multiforme(265;0.0133)		GAGCACTAGACGTGTTGTCAT	0.527	Esophageal Squamous(59;1059 1362 26290 51151)															0.206612	55.805312	65.46159	25	96	KEEP	---	---	---	---	14	13	55	58	-1	capture	Missense_Mutation	SNP	21167918	21167918	RNASE4	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13298	166
DUOX2	50506	broad.mit.edu	37	15	45401132	45401132	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45401132C>T	uc010bea.2	-	12	1456	c.1253G>A	c.(1252-1254)GGC>GAC	p.G418D	DUOX2_uc001zun.2_Missense_Mutation_p.G418D	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	418	Extracellular (Potential).|Peroxidase-like; mediates peroxidase activity (By similarity).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GGAGAATTTGCCAGGGCCAGG	0.552																0.061538	-4.650337	8.388019	4	61	KEEP	---	---	---	---	2	3	41	31	-1	capture	Missense_Mutation	SNP	45401132	45401132	DUOX2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4756	166
ALDH1A2	8854	broad.mit.edu	37	15	58256142	58256142	+	Missense_Mutation	SNP	G	A	A	rs137957671		TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:58256142G>A	uc002aex.2	-	9	1085	c.1027C>T	c.(1027-1029)CGG>TGG	p.R343W	ALDH1A2_uc002aey.2_Missense_Mutation_p.R305W|ALDH1A2_uc010ugv.1_Missense_Mutation_p.R322W|ALDH1A2_uc010ugw.1_Missense_Mutation_p.R314W|ALDH1A2_uc002aew.2_Missense_Mutation_p.R247W	NM_003888	NP_003879	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1A2 isoform 1	343					negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	CTCTTGGCCCGCTCCACGCTT	0.527																0.275229	75.518048	80.468618	30	79	KEEP	---	---	---	---	14	16	44	46	-1	capture	Missense_Mutation	SNP	58256142	58256142	ALDH1A2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	491	166
SLC28A1	9154	broad.mit.edu	37	15	85476431	85476431	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85476431C>T	uc002blg.2	+	13	1341	c.1139C>T	c.(1138-1140)GCC>GTC	p.A380V	SLC28A1_uc010bnb.2_Missense_Mutation_p.A380V|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Missense_Mutation_p.A380V|SLC28A1_uc010upg.1_Missense_Mutation_p.A380V	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1	380	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TGTGCCTTGGCCCTCTCCAAG	0.562																0.028736	-33.849717	8.655236	5	169	KEEP	---	---	---	---	1	4	115	95	-1	capture	Missense_Mutation	SNP	85476431	85476431	SLC28A1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14423	166
MVP	9961	broad.mit.edu	37	16	29855969	29855969	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29855969G>A	uc002dui.2	+	11	1874	c.1790G>A	c.(1789-1791)CGC>CAC	p.R597H	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MVP_uc002duj.2_Missense_Mutation_p.R597H|MVP_uc010vea.1_Missense_Mutation_p.R191H	NM_005115	NP_005106	Q14764	MVP_HUMAN	major vault protein	597					mRNA transport|protein transport|response to drug|transmembrane transport	cytoplasm|nuclear pore|ribonucleoprotein complex	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						AACTCAGCCCGCATCATTCGC	0.617																0.021858	-40.128589	6.564033	4	179	KEEP	---	---	---	---	1	3	87	107	-1	capture	Missense_Mutation	SNP	29855969	29855969	MVP	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9906	166
MT1A	4489	broad.mit.edu	37	16	56673190	56673190	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56673190T>C	uc002ejq.2	+	2	116	c.43T>C	c.(43-45)TGC>CGC	p.C15R	MT1A_uc002eji.2_Intron	NM_005946	NP_005937	P04731	MT1A_HUMAN	metallothionein 1A	15	Beta.	Divalent metal cation; cluster B.				cytoplasm	cadmium ion binding|copper ion binding|zinc ion binding				0						CTCCTGCACCTGCACTGGCTC	0.512																0.063291	-4.690126	10.997959	5	74	KEEP	---	---	---	---	3	8	33	60	-1	capture	Missense_Mutation	SNP	56673190	56673190	MT1A	16	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	9807	166
SLC12A3	6559	broad.mit.edu	37	16	56901059	56901059	+	Silent	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56901059C>T	uc010ccm.2	+	2	389	c.360C>T	c.(358-360)GGC>GGT	p.G120G	SLC12A3_uc002ekd.3_Silent_p.G120G|SLC12A3_uc010ccn.2_Silent_p.G119G	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	120	Cytoplasmic (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TGGTGGAGGGCGAGGCAGGCA	0.652																0.214286	13.438069	15.54646	6	22	KEEP	---	---	---	---	4	4	11	18	-1	capture	Silent	SNP	56901059	56901059	SLC12A3	16	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14277	166
TP53	7157	broad.mit.edu	37	17	7578555	7578555	+	Splice_Site	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578555C>T	uc002gim.2	-	5	570	c.376_splice	c.e5-1	p.Y126_splice	TP53_uc002gig.1_Splice_Site_p.Y126_splice|TP53_uc002gih.2_Splice_Site_p.Y126_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'UTR|TP53_uc010cng.1_5'UTR|TP53_uc002gii.1_5'UTR|TP53_uc010cnh.1_Splice_Site_p.Y126_splice|TP53_uc010cni.1_Splice_Site_p.Y126_splice|TP53_uc002gij.2_Splice_Site_p.Y126_splice|TP53_uc010cnj.1_Splice_Site|TP53_uc002gin.2_Splice_Site_p.Y33_splice|TP53_uc002gio.2_Splice_Site|TP53_uc010vug.1_Splice_Site_p.Y87_splice	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(31)|p.0?(7)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAGGGGAGTACTGTAGGAAGA	0.552	Pancreas(47;798 1329 9957 10801)		111	(F36P-Tumor)|(BICR56-Tumor)|(OVCAR8-Tumor)|(BECKER-Tumor)|(CORL279-Tumor)|(SNU201-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.633333	67.83436	68.304262	19	11	KEEP	---	---	---	---	5	14	7	4	-1	capture	Splice_Site	SNP	7578555	7578555	TP53	17	C	T	T	T	1	0	0	0	0	0	0	1	0	260	20	5	2	16264	166
MYH4	4622	broad.mit.edu	37	17	10350506	10350506	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10350506T>A	uc002gmn.2	-	35	5104	c.4993A>T	c.(4993-4995)ATC>TTC	p.I1665F	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1665	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						TGGCCTCTGATGGCATCATCC	0.468																0.155963	37.514791	49.822192	17	92	KEEP	---	---	---	---	10	9	51	49	-1	capture	Missense_Mutation	SNP	10350506	10350506	MYH4	17	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	9947	166
MYH1	4619	broad.mit.edu	37	17	10395868	10395868	+	Silent	SNP	G	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10395868G>T	uc002gmo.2	-	40	5779	c.5685C>A	c.(5683-5685)GTC>GTA	p.V1895V	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1895	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TGGAGAGGTTGACGTTGGATT	0.473					585											0.356322	168.996169	172.162562	62	112	KEEP	---	---	---	---	35	30	59	62	0.538461538462	capture	Silent	SNP	10395868	10395868	MYH1	17	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	9939	166
FAM83G	644815	broad.mit.edu	37	17	18906958	18906958	+	Silent	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18906958G>A	uc002guw.2	-	2	564	c.397C>T	c.(397-399)CTG>TTG	p.L133L	SLC5A10_uc002gur.1_Intron|SLC5A10_uc002guu.1_Intron|SLC5A10_uc002gut.1_Intron|SLC5A10_uc002guv.1_Intron|SLC5A10_uc010vyl.1_Intron	NM_001039999	NP_001035088	A6ND36	FA83G_HUMAN	hypothetical protein LOC644815	133										ovary(1)|central_nervous_system(1)	2						GGCCAGCCCAGGTCCAGCTGC	0.701																0.2	11.059596	13.15346	5	20	KEEP	---	---	---	---	3	3	14	9	-1	capture	Silent	SNP	18906958	18906958	FAM83G	17	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	5585	166
KRTAP4-8	728224	broad.mit.edu	37	17	39254054	39254054	+	Missense_Mutation	SNP	A	T	T	rs76270529	by1000genomes	TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39254054A>T	uc010wfo.1	-	1	322	c.283T>A	c.(283-285)TGC>AGC	p.C95S		NM_031960	NP_114166	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4.8	95	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].|15.					keratin filament					0						ctggagatgcagcagcTAGGG	0.318																0.176471	12.63093	15.983503	6	28	KEEP	---	---	---	---	4	6	25	32	-1	capture	Missense_Mutation	SNP	39254054	39254054	KRTAP4-8	17	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	8476	166
SGSH	6448	broad.mit.edu	37	17	78185892	78185892	+	Silent	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78185892G>A	uc002jxz.3	-	7	1014	c.927C>T	c.(925-927)AGC>AGT	p.S309S	SGSH_uc002jya.3_Silent_p.S106S|SGSH_uc002jxy.2_3'UTR|SGSH_uc010wue.1_3'UTR	NM_000199	NP_000190	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase precursor	309					proteoglycan metabolic process	lysosome	metal ion binding|N-sulfoglucosamine sulfohydrolase activity|sulfuric ester hydrolase activity			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CGTAGGCCTCGCTGACTTGGC	0.602																0.37931	66.73752	67.478179	22	36	KEEP	---	---	---	---	10	13	20	25	-1	capture	Silent	SNP	78185892	78185892	SGSH	17	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	14114	166
SETBP1	26040	broad.mit.edu	37	18	42533090	42533090	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:42533090G>C	uc010dni.2	+	4	4081	c.3785G>C	c.(3784-3786)AGA>ACA	p.R1262T		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	1262						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TGCACGAAAAGATACTCTGGC	0.537												Schinzel-Giedion_syndrome				0.093333	7.865004	20.337755	7	68	KEEP	---	---	---	---	3	7	47	60	-1	capture	Missense_Mutation	SNP	42533090	42533090	SETBP1	18	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	14022	166
ZNF407	55628	broad.mit.edu	37	18	72343319	72343319	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:72343319C>A	uc002llw.2	+	1	401	c.344C>A	c.(343-345)ACC>AAC	p.T115N	ZNF407_uc010xfc.1_Missense_Mutation_p.T115N|ZNF407_uc010dqu.1_Missense_Mutation_p.T115N|ZNF407_uc002llu.2_Missense_Mutation_p.T114N	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	115					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GGGAAGGAGACCTTTCTGAGT	0.443																0.068182	-6.493335	27.413623	12	164	KEEP	---	---	---	---	5	7	89	90	0.583333333333	capture	Missense_Mutation	SNP	72343319	72343319	ZNF407	18	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	17767	166
ELANE	1991	broad.mit.edu	37	19	855979	855979	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:855979G>A	uc002lqb.2	+	5	657	c.619G>A	c.(619-621)GTC>ATC	p.V207I		NM_001972	NP_001963	P08246	ELNE_HUMAN	neutrophil elastase preproprotein	207	Peptidase S1.				cellular calcium ion homeostasis|negative regulation of chemokine biosynthetic process|negative regulation of chemotaxis|negative regulation of inflammatory response|negative regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of MAP kinase activity|positive regulation of smooth muscle cell proliferation|protein catabolic process|proteolysis|response to UV	cell surface|extracellular region|stored secretory granule	bacterial cell surface binding|cytokine binding|heparin binding			pancreas(1)	1					Alpha-1-proteinase inhibitor(DB00058)|Filgrastim(DB00099)|Pegfilgrastim(DB00019)	CAGCCCCTTGGTCTGCAACGG	0.657												Kostmann_syndrome				0.025	-32.729667	7.295234	4	156	KEEP	---	---	---	---	2	4	79	94	-1	capture	Missense_Mutation	SNP	855979	855979	ELANE	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	5003	166
TRIP10	9322	broad.mit.edu	37	19	6751206	6751206	+	Missense_Mutation	SNP	G	A	A	rs139028261		TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6751206G>A	uc002mfs.2	+	15	1856	c.1790G>A	c.(1789-1791)CGA>CAA	p.R597Q	TRIP10_uc010dux.1_Missense_Mutation_p.E551K|TRIP10_uc002mfr.2_Missense_Mutation_p.R541Q|TRIP10_uc010duy.2_RNA|TRIP10_uc010duz.2_Missense_Mutation_p.R360Q	NM_004240	NP_004231	Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	597	Interaction with PDE6G (By similarity).|SH3.|Required for podosome formation.|Interaction with ARHGAP17, DAAM1, DIAPH1 and DIAPH2.|Interaction with DNM1 and WASL.|Required for interaction with FASLG and localization to lysosomes.|Interaction with WAS.				actin cytoskeleton organization|cell communication|endocytosis|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell projection|cytoskeleton|cytosol|Golgi apparatus|lysosome|perinuclear region of cytoplasm|phagocytic cup	GTPase activator activity|identical protein binding|lipid binding			ovary(1)	1						TCCTACCTCCGAGTCACGCTC	0.612																0.583333	286.913625	287.854586	91	65	KEEP	---	---	---	---	42	62	44	32	-1	capture	Missense_Mutation	SNP	6751206	6751206	TRIP10	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16437	166
C19orf43	79002	broad.mit.edu	37	19	12841881	12841881	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12841881A>G	uc002muu.2	-	3	483	c.425T>C	c.(424-426)GTA>GCA	p.V142A		NM_024038	NP_076943	Q9BQ61	CS043_HUMAN	hypothetical protein MGC2803	142											0						ACTTGTTAATACCTGTGGAAA	0.547																0.02381	-32.832843	9.502418	4	164	KEEP	---	---	---	---	1	3	104	73	-1	capture	Missense_Mutation	SNP	12841881	12841881	C19orf43	19	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	1909	166
CYP4F12	66002	broad.mit.edu	37	19	15807863	15807863	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15807863C>T	uc002nbl.2	+	13	1604	c.1543C>T	c.(1543-1545)CGG>TGG	p.R515W		NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)					GCTTTGGCTGCGGGTGGAGCC	0.567																0.208333	61.357572	72.730009	30	114	KEEP	---	---	---	---	18	17	65	70	-1	capture	Missense_Mutation	SNP	15807863	15807863	CYP4F12	19	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	4147	166
USP29	57663	broad.mit.edu	37	19	57641232	57641232	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57641232A>G	uc002qny.2	+	4	1545	c.1189A>G	c.(1189-1191)ACT>GCT	p.T397A		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	397					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CACTTTGAATACTGGGAAAGA	0.383																0.161905	43.912708	55.320938	17	88	KEEP	---	---	---	---	9	8	48	42	-1	capture	Missense_Mutation	SNP	57641232	57641232	USP29	19	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	16941	166
KIDINS220	57498	broad.mit.edu	37	2	8872006	8872006	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:8872006T>C	uc002qzc.2	-	30	4342	c.4160A>G	c.(4159-4161)TAT>TGT	p.Y1387C	KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Missense_Mutation_p.Y1288C|KIDINS220_uc002qzb.2_Missense_Mutation_p.Y241C	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	1387	Cytoplasmic (Potential).				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTATTCTCTATAGGCATCTCT	0.463																0.363958	362.067736	366.667929	103	180	KEEP	---	---	---	---	47	63	94	101	-1	capture	Missense_Mutation	SNP	8872006	8872006	KIDINS220	2	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	8193	166
TMEM214	54867	broad.mit.edu	37	2	27258019	27258019	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27258019T>A	uc002ria.3	+	3	478	c.368T>A	c.(367-369)CTG>CAG	p.L123Q	TMEM214_uc010yle.1_RNA|TMEM214_uc002rib.3_Missense_Mutation_p.L123Q	NM_017727	NP_060197	Q6NUQ4	TM214_HUMAN	transmembrane protein 214 isoform 1	123						integral to membrane	protein binding				0						GTGGCAGACCTGCAGAAGGAA	0.537																0.507042	114.60052	114.603619	36	35	KEEP	---	---	---	---	25	16	16	23	-1	capture	Missense_Mutation	SNP	27258019	27258019	TMEM214	2	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	16020	166
FAM176A	84141	broad.mit.edu	37	2	75745200	75745200	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:75745200C>A	uc002sni.2	-	3	545	c.67G>T	c.(67-69)GCC>TCC	p.A23S	FAM176A_uc002snj.1_Missense_Mutation_p.A10S|FAM176A_uc002snk.1_Missense_Mutation_p.A23S	NM_001135032	NP_001128504	Q9H8M9	F176A_HUMAN	family with sequence similarity 176, member A	23	Necessary for the localization and biological activity.				apoptosis|autophagy	endoplasmic reticulum membrane|integral to membrane|lysosomal membrane|plasma membrane					0						AAGGAATAGGCCGCTAGGATG	0.612																0.304348	81.365661	84.507564	28	64	KEEP	---	---	---	---	15	17	28	43	0.53125	capture	Missense_Mutation	SNP	75745200	75745200	FAM176A	2	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	5452	166
SEPT10	151011	broad.mit.edu	37	2	110350668	110350668	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:110350668G>C	uc002tew.2	-	2	438	c.59C>G	c.(58-60)ACA>AGA	p.T20R	SEPT10_uc010ywu.1_Missense_Mutation_p.T20R|SEPT10_uc002tex.2_Intron|SEPT10_uc002tey.2_Missense_Mutation_p.T20R|SEPT10_uc010ywv.1_5'UTR	NM_144710	NP_653311	Q9P0V9	SEP10_HUMAN	septin 10 isoform 1	20					cell cycle|cell division	septin complex	GTP binding				0						CATACAAGTTGTTTTCGTTGC	0.323																0.095238	19.864301	47.490607	16	152	KEEP	---	---	---	---	12	6	76	94	-1	capture	Missense_Mutation	SNP	110350668	110350668	SEPT10	2	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	13953	166
NEB	4703	broad.mit.edu	37	2	152518698	152518698	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:152518698T>C	uc010fnx.2	-	46	6112	c.5921A>G	c.(5920-5922)GAC>GGC	p.D1974G		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1974	Nebulin 52.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GTTCATCGAGTCCATGAGTGT	0.413																0.321739	121.335277	124.580438	37	78	KEEP	---	---	---	---	27	14	48	42	-1	capture	Missense_Mutation	SNP	152518698	152518698	NEB	2	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	10209	166
LASS6	253782	broad.mit.edu	37	2	169404150	169404150	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:169404150A>G	uc002ueb.1	+	2	339	c.215A>G	c.(214-216)AAT>AGT	p.N72S	LASS6_uc002uec.1_Missense_Mutation_p.N72S	NM_203463	NP_982288	Q6ZMG9	CERS6_HUMAN	longevity assurance homolog 6	72	Cytoplasmic (Potential).|Homeobox.					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			skin(1)	1						ATTCAGGCCAATGGACCACAA	0.413																0.101695	9.205334	18.538896	6	53	KEEP	---	---	---	---	5	4	30	32	-1	capture	Missense_Mutation	SNP	169404150	169404150	LASS6	2	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	8563	166
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393	Pancreas(158;264 1958 3300 35450 36047)				134	Mis		gliobastoma 								0.347107	119.214605	121.710939	42	79	KEEP	---	---	---	---	24	19	38	51	-1	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	166
ZNF142	7701	broad.mit.edu	37	2	219521105	219521105	+	Silent	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219521105C>T	uc002vin.2	-	4	484	c.48G>A	c.(46-48)GAG>GAA	p.E16E	ZNF142_uc002vil.2_5'UTR|ZNF142_uc010fvt.2_5'UTR|ZNF142_uc002vim.2_5'UTR|BCS1L_uc002vio.2_5'Flank	NM_001105537	NP_001099007	P52746	ZN142_HUMAN	zinc finger protein 142	16					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GTCCATCCATCTCCCCGGTGC	0.582	Colon(170;867 1942 8995 15834 18053)															0.464789	107.169876	107.246405	33	38	KEEP	---	---	---	---	17	25	24	24	-1	capture	Silent	SNP	219521105	219521105	ZNF142	2	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	17611	166
MYH7B	57644	broad.mit.edu	37	20	33572918	33572918	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:33572918C>T	uc002xbi.1	+	11	1009	c.917C>T	c.(916-918)GCG>GTG	p.A306V		NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	264	Myosin head-like.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CTGGCATCCGCGGATATTGAC	0.642																0.171429	35.78764	46.501408	18	87	KEEP	---	---	---	---	8	11	55	41	-1	capture	Missense_Mutation	SNP	33572918	33572918	MYH7B	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9950	166
PTPRT	11122	broad.mit.edu	37	20	40911144	40911144	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:40911144G>A	uc002xkg.2	-	13	2345	c.2161C>T	c.(2161-2163)CGT>TGT	p.R721C	PTPRT_uc010ggj.2_Missense_Mutation_p.R721C	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	721	Extracellular (Potential).|Fibronectin type-III 4.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GTAGCCAGACGAACACAGTTG	0.348					646											0.217391	48.649935	55.424724	20	72	KEEP	---	---	---	---	12	12	42	50	-1	capture	Missense_Mutation	SNP	40911144	40911144	PTPRT	20	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12707	166
KCNE1	3753	broad.mit.edu	37	21	35821746	35821746	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:35821746G>T	uc010gmp.2	-	2	617	c.187C>A	c.(187-189)CTG>ATG	p.L63M	KCNE1_uc002ytz.2_Missense_Mutation_p.L63M|KCNE1_uc010gmq.2_Missense_Mutation_p.L63M|KCNE1_uc010gmr.2_Missense_Mutation_p.L63M|KCNE1_uc010gms.2_Missense_Mutation_p.L63M|KCNE1_uc002yua.2_RNA	NM_001127670	NP_001121142	P15382	KCNE1_HUMAN	potassium voltage-gated channel, Isk-related	63	Helical; (Potential).				blood circulation|membrane depolarization|muscle contraction|sensory perception of sound	lysosome	delayed rectifier potassium channel activity|potassium channel regulator activity			ovary(2)	2					Indapamide(DB00808)	ATGTAGCTCAGCATGATGCCC	0.592																0.228571	37.573895	42.297604	16	54	KEEP	---	---	---	---	5	12	31	26	0.294117647059	capture	Missense_Mutation	SNP	35821746	35821746	KCNE1	21	G	T	T	T	1	0	0	0	0	1	0	0	0	438	34	4	4	7943	166
KRTAP10-2	386679	broad.mit.edu	37	21	45971183	45971183	+	Silent	SNP	C	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45971183C>G	uc002zfi.1	-	1	206	c.159G>C	c.(157-159)GTG>GTC	p.V53V	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198693	NP_941966	P60368	KR102_HUMAN	keratin associated protein 10-2	53	22 X 5 AA repeats of C-C-X(3).					keratin filament				large_intestine(1)	1						AGGGGCTGGACACACAGCTCA	0.697																0.486486	119.789225	119.801234	36	38	KEEP	---	---	---	---	23	18	31	31	-1	capture	Silent	SNP	45971183	45971183	KRTAP10-2	21	C	G	G	G	1	0	0	0	0	0	0	0	1	210	17	4	4	8429	166
OSBP2	23762	broad.mit.edu	37	22	31137202	31137202	+	Silent	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31137202G>A	uc003aiy.1	+	2	803	c.699G>A	c.(697-699)GCG>GCA	p.A233A	OSBP2_uc011ala.1_Silent_p.A68A|OSBP2_uc010gwc.1_Silent_p.A60A|OSBP2_uc003aix.1_Silent_p.A233A|OSBP2_uc011alb.1_Silent_p.A233A|OSBP2_uc003aiz.1_Silent_p.A233A	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a	233	PH.				lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						TGTCCACCGCGCACATTGACA	0.557																0.105263	5.407579	14.235992	6	51	KEEP	---	---	---	---	2	4	17	41	-1	capture	Silent	SNP	31137202	31137202	OSBP2	22	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11178	166
CYTH4	27128	broad.mit.edu	37	22	37707507	37707507	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37707507C>T	uc003arf.2	+	11	1012	c.896C>T	c.(895-897)CCA>CTA	p.P299L	CYTH4_uc011amw.1_Missense_Mutation_p.P242L|CYTH4_uc010gxe.2_Intron	NM_013385	NP_037517	Q9UIA0	CYH4_HUMAN	cytohesin 4	299	PH.				regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						GACAAGGAGCCACGGGGAATT	0.582																0.267857	43.198784	45.924031	15	41	KEEP	---	---	---	---	9	8	23	22	-1	capture	Missense_Mutation	SNP	37707507	37707507	CYTH4	22	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	4165	166
MCHR1	2847	broad.mit.edu	37	22	41077826	41077826	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:41077826G>A	uc003ayz.2	+	2	1431	c.1163G>A	c.(1162-1164)CGC>CAC	p.R388H	MCHR1_uc003aza.2_Missense_Mutation_p.R277H|uc003azb.1_RNA	NM_005297	NP_005288	Q99705	MCHR1_HUMAN	G protein-coupled receptor 24	388	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration|feeding behavior|generation of precursor metabolites and energy|inhibition of adenylate cyclase activity by G-protein signaling pathway	integral to plasma membrane|nonmotile primary cilium	neuropeptide receptor activity				0						GAGACGTTCCGCAAACGCTTG	0.572																0.145695	35.346919	53.579208	22	129	KEEP	---	---	---	---	11	14	58	84	-1	capture	Missense_Mutation	SNP	41077826	41077826	MCHR1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9295	166
NUP210	23225	broad.mit.edu	37	3	13432743	13432743	+	Silent	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13432743C>T	uc003bxv.1	-	4	584	c.501G>A	c.(499-501)GCG>GCA	p.A167A		NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210 precursor	167	Lumenal (Probable).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11	all_neural(104;0.187)					AGAACCTGTCCGCCTCGGAGT	0.582					587											0.285714	22.789017	23.942375	8	20	KEEP	---	---	---	---	5	4	11	12	-1	capture	Silent	SNP	13432743	13432743	NUP210	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10667	166
NICN1	84276	broad.mit.edu	37	3	49463788	49463788	+	Missense_Mutation	SNP	T	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49463788T>G	uc003cwz.1	-	2	291	c.206A>C	c.(205-207)CAC>CCC	p.H69P	NICN1_uc003cxa.2_RNA|NICN1_uc011bcr.1_Missense_Mutation_p.H69P	NM_032316	NP_115692	Q9BSH3	NICN1_HUMAN	nicolin 1	69						microtubule|nucleus					0				BRCA - Breast invasive adenocarcinoma(193;4.52e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GGCAGGTGTGTGTGCTGAGGT	0.498																0.21875	37.426136	42.083305	14	50	KEEP	---	---	---	---	7	10	34	21	-1	capture	Missense_Mutation	SNP	49463788	49463788	NICN1	3	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	10320	166
C3orf17	25871	broad.mit.edu	37	3	112724550	112724550	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:112724550T>C	uc003dzr.2	-	9	1598	c.1537A>G	c.(1537-1539)ATG>GTG	p.M513V	GTPBP8_uc011bhy.1_Intron|C3orf17_uc003dzq.2_Missense_Mutation_p.M138V|C3orf17_uc011bhz.1_Missense_Mutation_p.M138V|C3orf17_uc010hqh.2_Missense_Mutation_p.M138V|C3orf17_uc003dzt.2_Missense_Mutation_p.M416V|C3orf17_uc003dzs.2_Missense_Mutation_p.M377V|C3orf17_uc010hqg.2_Missense_Mutation_p.M338V|C3orf17_uc011bia.1_Missense_Mutation_p.M310V|C3orf17_uc003dzu.2_Missense_Mutation_p.M442V|C3orf17_uc011bib.1_Missense_Mutation_p.M402V|C3orf17_uc011bic.1_Missense_Mutation_p.M346V|C3orf17_uc011bid.1_RNA	NM_015412	NP_056227	Q6NW34	CC017_HUMAN	hypothetical protein LOC25871	513						integral to membrane					0						ATGACAGGCATTGAAACTCCA	0.388																0.391509	296.588389	298.77074	83	129	KEEP	---	---	---	---	44	47	71	69	-1	capture	Missense_Mutation	SNP	112724550	112724550	C3orf17	3	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	2190	166
CCDC37	348807	broad.mit.edu	37	3	126138549	126138549	+	Silent	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126138549G>A	uc003eiu.1	+	9	900	c.801G>A	c.(799-801)TCG>TCA	p.S267S	CCDC37_uc010hsg.1_Silent_p.S268S	NM_182628	NP_872434	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	267										ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.166)		ACAAGCTGTCGCCCAAGGAGT	0.488																0.1375	31.942534	52.284814	22	138	KEEP	---	---	---	---	10	18	79	86	-1	capture	Silent	SNP	126138549	126138549	CCDC37	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	2783	166
CP	1356	broad.mit.edu	37	3	148903188	148903188	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148903188C>T	uc003ewy.3	-	12	2376	c.2123G>A	c.(2122-2124)GGC>GAC	p.G708D	CP_uc011bnr.1_RNA|CP_uc003ewx.3_Missense_Mutation_p.G489D|CP_uc003ewz.2_Missense_Mutation_p.G708D	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	708	Plastocyanin-like 4.|F5/8 type A 2.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	TTGCTTCATGCCGCCTGTGTA	0.368																0.034043	-41.616231	13.989194	8	227	KEEP	---	---	---	---	3	5	127	126	-1	capture	Missense_Mutation	SNP	148903188	148903188	CP	3	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3752	166
VEPH1	79674	broad.mit.edu	37	3	157213090	157213090	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:157213090C>A	uc003fbj.1	-	2	366	c.49G>T	c.(49-51)GCT>TCT	p.A17S	VEPH1_uc003fbk.1_Missense_Mutation_p.A17S|VEPH1_uc010hvu.1_Missense_Mutation_p.A17S|VEPH1_uc003fbm.2_Missense_Mutation_p.A17S|VEPH1_uc003fbn.2_Missense_Mutation_p.A17S	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1	17						plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			AGGTCCCCAGCTCGTGAAAGA	0.413																0.123077	30.858006	57.972771	24	171	KEEP	---	---	---	---	8	19	101	86	0.703703703704	capture	Missense_Mutation	SNP	157213090	157213090	VEPH1	3	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	17036	166
TP63	8626	broad.mit.edu	37	3	189607256	189607256	+	Silent	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:189607256A>G	uc003fry.2	+	12	1724	c.1635A>G	c.(1633-1635)ACA>ACG	p.T545T	TP63_uc003frz.2_Silent_p.T545T|TP63_uc010hzc.1_Intron|TP63_uc003fsc.2_Silent_p.T451T|TP63_uc003fsd.2_Silent_p.T451T|TP63_uc010hzd.1_Silent_p.T366T	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	545	SAM.				anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CGTATCCCACAGATTGCAGCA	0.597					423							Hay-Wells_syndrome	HNSCC(45;0.13)			0.025641	-22.683473	6.475468	3	114	KEEP	---	---	---	---	2	2	58	78	-1	capture	Silent	SNP	189607256	189607256	TP63	3	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	16275	166
LGI2	55203	broad.mit.edu	37	4	25019723	25019723	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:25019723C>A	uc003grf.2	-	6	642	c.543G>T	c.(541-543)TGG>TGT	p.W181C		NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	181	LRRCT.					extracellular region					0		Breast(46;0.173)				TCATCTTCAACCACAGGTATA	0.373																0.574661	397.439842	398.512778	127	94	KEEP	---	---	---	---	73	57	54	42	0.438461538462	capture	Missense_Mutation	SNP	25019723	25019723	LGI2	4	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	8672	166
UGT2A3	79799	broad.mit.edu	37	4	69798344	69798344	+	Splice_Site	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69798344A>G	uc003hef.2	-	3	1027	c.996_splice	c.e3+1	p.K332_splice	UGT2A3_uc010ihp.1_Splice_Site	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,							integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						GGTTTTACTGACCTTCTGTGG	0.398																0.060714	-9.149146	47.278894	17	263	KEEP	---	---	---	---	13	8	155	137	-1	capture	Splice_Site	SNP	69798344	69798344	UGT2A3	4	A	G	G	G	1	0	0	0	0	0	0	1	0	130	10	5	3	16837	166
PCDH18	54510	broad.mit.edu	37	4	138442804	138442804	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:138442804G>T	uc003ihe.3	-	4	3174	c.2787C>A	c.(2785-2787)GAC>GAA	p.D929E	PCDH18_uc003ihf.3_Missense_Mutation_p.D921E|PCDH18_uc011cgz.1_Missense_Mutation_p.D140E|PCDH18_uc003ihg.3_Missense_Mutation_p.D708E|PCDH18_uc011cha.1_Missense_Mutation_p.D109E	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN	protocadherin 18 precursor	929	Interaction with DAB1 (By similarity).|Cytoplasmic (Potential).				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)					TCCAGCACTGGTCAGAGTGTC	0.498																0.183168	79.671025	98.839527	37	165	KEEP	---	---	---	---	27	15	96	89	0.642857142857	capture	Missense_Mutation	SNP	138442804	138442804	PCDH18	4	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	11416	166
SPOCK3	50859	broad.mit.edu	37	4	167921580	167921580	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:167921580C>T	uc003iri.1	-	5	420	c.279G>A	c.(277-279)ATG>ATA	p.M93I	SPOCK3_uc011cjp.1_Missense_Mutation_p.M90I|SPOCK3_uc011cjq.1_Missense_Mutation_p.M102I|SPOCK3_uc011cjr.1_Intron|SPOCK3_uc003irj.1_Missense_Mutation_p.M90I|SPOCK3_uc011cjs.1_Missense_Mutation_p.M42I|SPOCK3_uc011cjt.1_Missense_Mutation_p.M1I|SPOCK3_uc011cju.1_Intron|SPOCK3_uc011cjv.1_Intron|SPOCK3_uc003irk.3_Missense_Mutation_p.M90I|SPOCK3_uc011cjw.1_RNA	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2	93					signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		GACTACATTTCATCTTTAAGC	0.348																0.118644	12.29201	29.360726	14	104	KEEP	---	---	---	---	9	7	68	49	-1	capture	Missense_Mutation	SNP	167921580	167921580	SPOCK3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	14973	166
MFAP3L	9848	broad.mit.edu	37	4	170926952	170926952	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:170926952G>A	uc003isp.3	-	2	255	c.77C>T	c.(76-78)GCC>GTC	p.A26V	MFAP3L_uc003isn.3_5'Flank	NM_021647	NP_067679	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like isoform	26						integral to membrane|plasma membrane				ovary(1)	1		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		CTTAGCGGTGGCTAGAGTGGA	0.458																0.552239	117.396966	117.56003	37	30	KEEP	---	---	---	---	24	24	19	19	-1	capture	Missense_Mutation	SNP	170926952	170926952	MFAP3L	4	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	9428	166
TLR3	7098	broad.mit.edu	37	4	187003773	187003773	+	Silent	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:187003773G>A	uc003iyq.2	+	4	1034	c.933G>A	c.(931-933)CAG>CAA	p.Q311Q	TLR3_uc011ckz.1_Silent_p.Q34Q|TLR3_uc003iyr.2_Silent_p.Q34Q	NM_003265	NP_003256	O15455	TLR3_HUMAN	toll-like receptor 3 precursor	311	Lumenal (Potential).|LRR 11.				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|defense response to bacterium|defense response to virus|detection of virus|hyperosmotic response|I-kappaB phosphorylation|inflammatory response|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of osteoclast differentiation|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|toll-like receptor 3 signaling pathway	endoplasmic reticulum membrane|endosome membrane|integral to plasma membrane	double-stranded RNA binding|transmembrane receptor activity			ovary(2)|prostate(1)|lung(1)|breast(1)	5		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		ATAATATACAGCATTTGTTTT	0.383					155											0.090226	4.892825	27.430605	12	121	KEEP	---	---	---	---	8	5	76	51	-1	capture	Silent	SNP	187003773	187003773	TLR3	4	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	15837	166
FAT2	2196	broad.mit.edu	37	5	150934173	150934173	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150934173A>G	uc003lue.3	-	4	3708	c.3695T>C	c.(3694-3696)ATC>ACC	p.I1232T	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	1232	Extracellular (Potential).|Cadherin 10.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GACGTCCAAGATGCCTACCAC	0.552																0.375	292.273469	295.453887	87	145	KEEP	---	---	---	---	46	51	58	95	-1	capture	Missense_Mutation	SNP	150934173	150934173	FAT2	5	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	5636	166
TIMD4	91937	broad.mit.edu	37	5	156381617	156381617	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156381617C>T	uc003lwh.2	-	2	266	c.209G>A	c.(208-210)CGC>CAC	p.R70H	TIMD4_uc010jii.2_Missense_Mutation_p.R70H	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain	70	Ig-like V-type.|Extracellular (Potential).					integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCATCAGTGCGGATGAGCGC	0.522																0.079365	-1.753483	21.012201	10	116	KEEP	---	---	---	---	2	9	65	63	-1	capture	Missense_Mutation	SNP	156381617	156381617	TIMD4	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15788	166
FGFR4	2264	broad.mit.edu	37	5	176520301	176520301	+	Missense_Mutation	SNP	A	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176520301A>C	uc003mfl.2	+	9	1387	c.1220A>C	c.(1219-1221)CAG>CCG	p.Q407P	FGFR4_uc003mfm.2_Missense_Mutation_p.Q407P|FGFR4_uc011dfu.1_Intron|FGFR4_uc011dfw.1_3'UTR|FGFR4_uc003mfo.2_Intron	NM_002011	NP_002002	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4 isoform 1	407	Cytoplasmic (Potential).				insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity			lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)	GCCACTGTGCAGAAGCTCTCC	0.692					219								TSP Lung(9;0.080)			0.065421	-6.861747	14.149929	7	100	KEEP	---	---	---	---	2	5	64	49	-1	capture	Missense_Mutation	SNP	176520301	176520301	FGFR4	5	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	5814	166
KIAA0319	9856	broad.mit.edu	37	6	24563608	24563608	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:24563608A>G	uc011djo.1	-	16	2807	c.2570T>C	c.(2569-2571)ATT>ACT	p.I857T	KIAA0319_uc011djp.1_Missense_Mutation_p.I812T|KIAA0319_uc003neh.1_Missense_Mutation_p.I857T|KIAA0319_uc011djq.1_Missense_Mutation_p.I848T|KIAA0319_uc011djr.1_Missense_Mutation_p.I857T|KIAA0319_uc010jpt.1_Missense_Mutation_p.I268T	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	857	Extracellular (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						GTGGGCCCGAATCTTCTGGAC	0.567																0.142857	22.867829	32.349268	11	66	KEEP	---	---	---	---	9	3	30	40	-1	capture	Missense_Mutation	SNP	24563608	24563608	KIAA0319	6	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	8090	166
HIST1H3F	8968	broad.mit.edu	37	6	26250643	26250643	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26250643C>T	uc003nhg.1	-	1	193	c.191G>A	c.(190-192)CGC>CAC	p.R64H	HIST1H2BH_uc003nhh.2_5'Flank	NM_021018	NP_066298	P68431	H31_HUMAN	histone cluster 1, H3f	64					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0						TGGTAGCTTGCGAATCAGTAG	0.612														OREG0017241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.229508	93.223361	105.461831	42	141	KEEP	---	---	---	---	26	23	114	75	-1	capture	Missense_Mutation	SNP	26250643	26250643	HIST1H3F	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7085	166
TULP1	7287	broad.mit.edu	37	6	35477607	35477607	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35477607T>C	uc003okv.3	-	6	610	c.598A>G	c.(598-600)AAA>GAA	p.K200E	TULP1_uc003okw.3_Missense_Mutation_p.K147E	NM_003322	NP_003313	O00294	TULP1_HUMAN	tubby like protein 1	200					dendrite development|eye photoreceptor cell development|phagocytosis|photoreceptor cell maintenance|positive regulation of phagocytosis	cell junction|cytoplasm|extracellular region|photoreceptor inner segment|photoreceptor outer segment|synapse	actin filament binding|phosphatidylinositol-4,5-bisphosphate binding			ovary(2)|central_nervous_system(1)	3						GGCTCACCTTTCTTCTTGGTC	0.592	GBM(55;1027 1091 11115 23439)															0.131757	71.456167	110.639861	39	257	KEEP	---	---	---	---	27	18	148	139	-1	capture	Missense_Mutation	SNP	35477607	35477607	TULP1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	16655	166
CAPN11	11131	broad.mit.edu	37	6	44140965	44140965	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44140965T>A	uc003owt.1	+	7	711	c.673T>A	c.(673-675)TCC>ACC	p.S225T		NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11	225	Calpain catalytic.				proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GCTGAGTGGGTCCTATGAAGC	0.617														OREG0017466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.025641	-31.21965	7.637711	4	152	KEEP	---	---	---	---	3	2	84	87	-1	capture	Missense_Mutation	SNP	44140965	44140965	CAPN11	6	T	A	A	A	1	0	0	0	0	1	0	0	0	754	58	4	4	2600	166
SPACA1	81833	broad.mit.edu	37	6	88769216	88769216	+	Missense_Mutation	SNP	A	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:88769216A>C	uc003pmn.2	+	5	637	c.520A>C	c.(520-522)AAG>CAG	p.K174Q		NM_030960	NP_112222	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1 precursor	174	Extracellular (Potential).					integral to membrane					0		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		AGAAGTACGCAAGGAAAGTCA	0.343																0.596491	127.162762	127.627134	34	23	KEEP	---	---	---	---	20	17	11	14	-1	capture	Missense_Mutation	SNP	88769216	88769216	SPACA1	6	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	14864	166
ASCC3	10973	broad.mit.edu	37	6	101110219	101110219	+	Splice_Site	SNP	A	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:101110219A>T	uc003pqk.2	-	15	2807	c.2478_splice	c.e15+1	p.K826_splice	ASCC3_uc011eai.1_Splice_Site_p.K728_splice	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GTAAGCTCTTACCTTAATAAT	0.398																0.061224	-3.214852	6.632596	3	46	KEEP	---	---	---	---	0	3	28	21	-1	capture	Splice_Site	SNP	101110219	101110219	ASCC3	6	A	T	T	T	1	0	0	0	0	0	0	1	0	182	14	5	4	1024	166
CCDC129	223075	broad.mit.edu	37	7	31617703	31617703	+	Silent	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31617703G>A	uc003tcj.1	+	8	1818	c.825G>A	c.(823-825)GAG>GAA	p.E275E	CCDC129_uc011kad.1_Silent_p.E285E|CCDC129_uc003tci.1_Intron|CCDC129_uc011kae.1_Silent_p.E301E|CCDC129_uc003tck.1_Silent_p.E183E	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	275											0						AGGTATCAGAGTCCTTCAAGG	0.453																0.107143	5.705665	14.284318	6	50	KEEP	---	---	---	---	2	5	23	28	-1	capture	Silent	SNP	31617703	31617703	CCDC129	7	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	2738	166
TRIM74	378108	broad.mit.edu	37	7	75028495	75028495	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:75028495G>A	uc003udc.1	+	2	478	c.278G>A	c.(277-279)CGG>CAG	p.R93Q	TRIM74_uc010ldc.2_Missense_Mutation_p.R93Q|TRIM74_uc010ldd.2_Missense_Mutation_p.R93Q	NM_198924	NP_944606	Q86UV6	TRI74_HUMAN	tripartite motif-containing 73	93	B box-type.					intracellular	zinc ion binding				0						GTGCACCACCGGAACCCGCTC	0.667																0.040541	-10.151619	6.585765	3	71	KEEP	---	---	---	---	1	3	79	53	-1	capture	Missense_Mutation	SNP	75028495	75028495	TRIM74	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16430	166
CFTR	1080	broad.mit.edu	37	7	117180363	117180363	+	Missense_Mutation	SNP	C	G	G	rs75053309		TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117180363C>G	uc003vjd.2	+	8	1211	c.1079C>G	c.(1078-1080)ACA>AGA	p.T360R	CFTR_uc011knq.1_5'UTR	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance	360	Cytoplasmic (Potential).|ABC transmembrane type-1 1.		QT -> KK (in CF).		respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	GCTGTACAAACATGGTATGAC	0.388												Cystic_Fibrosis				0.189349	84.794755	100.05392	32	137	KEEP	---	---	---	---	23	11	75	80	-1	capture	Missense_Mutation	SNP	117180363	117180363	CFTR	7	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	3260	166
SND1	27044	broad.mit.edu	37	7	127724820	127724820	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:127724820G>T	uc003vmi.2	+	19	2381	c.2155G>T	c.(2155-2157)GCC>TCC	p.A719S	SND1_uc010lle.2_Missense_Mutation_p.A372S	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1	719					gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						CAATGACATTGCCAGTCACCC	0.562																0.061224	-12.153609	7.524703	6	92	KEEP	---	---	---	---	1	5	53	46	0.166666666667	capture	Missense_Mutation	SNP	127724820	127724820	SND1	7	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	14736	166
SSPO	23145	broad.mit.edu	37	7	149477563	149477563	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:149477563C>A	uc010lpk.2	+	12	1634	c.1634C>A	c.(1633-1635)CCC>CAC	p.P545H	SSPO_uc010lpl.1_Intron	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	545					cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CTGTGTAACCCCTGGTGGGTC	0.627																0.121951	5.040771	10.792546	5	36	KEEP	---	---	---	---	2	3	20	20	0.6	capture	Missense_Mutation	SNP	149477563	149477563	SSPO	7	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	15081	166
POLR3D	661	broad.mit.edu	37	8	22106020	22106020	+	Silent	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22106020C>T	uc003xbl.2	+	6	596	c.513C>T	c.(511-513)AAC>AAT	p.N171N	POLR3D_uc003xbm.2_Silent_p.N171N|POLR3D_uc011kze.1_RNA	NM_001722	NP_001713	P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	171					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity				0				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		GCCTGAGGAACGACACTCGAA	0.527																0.182292	69.637287	87.820308	35	157	KEEP	---	---	---	---	10	27	91	85	-1	capture	Silent	SNP	22106020	22106020	POLR3D	8	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12133	166
KCTD9	54793	broad.mit.edu	37	8	25287394	25287394	+	Silent	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25287394G>A	uc003xeo.2	-	12	1307	c.1149C>T	c.(1147-1149)CAC>CAT	p.H383H	PPP2R2A_uc003xek.2_Intron|KCTD9_uc011lad.1_RNA	NM_017634	NP_060104	Q7L273	KCTD9_HUMAN	potassium channel tetramerisation domain	383						voltage-gated potassium channel complex	voltage-gated potassium channel activity				0		all_cancers(63;0.0164)|Ovarian(32;0.000878)|all_epithelial(46;0.00542)|Breast(100;0.0164)|Hepatocellular(4;0.114)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Epithelial(17;2.39e-12)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0438)		TTTGTGACATGTGTAGTGGTG	0.428																0.142857	53.848397	83.974185	35	210	KEEP	---	---	---	---	21	22	117	111	-1	capture	Silent	SNP	25287394	25287394	KCTD9	8	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	8038	166
FAM110B	90362	broad.mit.edu	37	8	59058884	59058884	+	Missense_Mutation	SNP	A	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:59058884A>T	uc003xtj.1	+	5	975	c.95A>T	c.(94-96)AAG>ATG	p.K32M		NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362	32						microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				ATCCTGAACAAGGGGCCAGAC	0.657																0.083333	-0.034401	8.433276	4	44	KEEP	---	---	---	---	2	2	26	21	-1	capture	Missense_Mutation	SNP	59058884	59058884	FAM110B	8	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	5351	166
NCOA2	10499	broad.mit.edu	37	8	71069277	71069277	+	Silent	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:71069277A>G	uc003xyn.1	-	11	1485	c.1323T>C	c.(1321-1323)TTT>TTC	p.F441F		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	441					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CAGAACCACCAAACCTGCCCA	0.502					476	T	RUNXBP2	AML								0.13	22.405725	35.725685	13	87	KEEP	---	---	---	---	11	4	49	45	-1	capture	Silent	SNP	71069277	71069277	NCOA2	8	A	G	G	G	1	0	0	0	0	0	0	0	1	63	5	3	3	10136	166
NCALD	83988	broad.mit.edu	37	8	102705056	102705056	+	Silent	SNP	T	C	C			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:102705056T>C	uc003yke.2	-	3	816	c.447A>G	c.(445-447)ACA>ACG	p.T149T	NCALD_uc003ykf.2_Silent_p.T149T|NCALD_uc003ykg.2_Silent_p.T149T|NCALD_uc003ykh.2_Silent_p.T149T|NCALD_uc003yki.2_Silent_p.T149T|NCALD_uc003ykj.2_Silent_p.T149T|NCALD_uc003ykk.2_Silent_p.T149T|NCALD_uc003ykl.2_Silent_p.T149T	NM_032041	NP_114430	P61601	NCALD_HUMAN	neurocalcin delta	149	EF-hand 4.				synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			AGATCTTTTCTGTTCTTTTCT	0.507																0.327731	119.571359	122.709898	39	80	KEEP	---	---	---	---	20	25	55	37	-1	capture	Silent	SNP	102705056	102705056	NCALD	8	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	10108	166
PKHD1L1	93035	broad.mit.edu	37	8	110460477	110460477	+	Missense_Mutation	SNP	A	G	G			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110460477A>G	uc003yne.2	+	39	5986	c.5882A>G	c.(5881-5883)AAT>AGT	p.N1961S		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1961	Extracellular (Potential).|IPT/TIG 12.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACCATGGCCAATGATAGTGTG	0.438													HNSCC(38;0.096)			0.3	38.386075	39.814567	12	28	KEEP	---	---	---	---	5	9	16	15	-1	capture	Missense_Mutation	SNP	110460477	110460477	PKHD1L1	8	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	11875	166
FER1L6	654463	broad.mit.edu	37	8	125047566	125047566	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:125047566G>A	uc003yqw.2	+	19	2541	c.2335G>A	c.(2335-2337)GTG>ATG	p.V779M	uc003yqx.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	779	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AAAAGTCGACGTGTACCTGTG	0.493																0.146789	24.641876	37.699282	16	93	KEEP	---	---	---	---	12	7	54	51	-1	capture	Missense_Mutation	SNP	125047566	125047566	FER1L6	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5761	166
FXN	2395	broad.mit.edu	37	9	71687595	71687595	+	Nonsense_Mutation	SNP	G	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:71687595G>T	uc004aha.2	+	5	770	c.550G>T	c.(550-552)GAG>TAG	p.E184*	FXN_uc011lrr.1_Intron|FXN_uc004agz.2_Missense_Mutation_p.M186I	NM_000144	NP_000135	Q16595	FRDA_HUMAN	frataxin isoform 1 preproprotein	184					cellular iron ion homeostasis|cellular response to hydrogen peroxide|heme biosynthetic process|ion transport|iron incorporation into metallo-sulfur cluster|negative regulation of apoptosis|negative regulation of release of cytochrome c from mitochondria|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity|protein autoprocessing|regulation of ferrochelatase activity|response to iron ion	cytosol|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferric iron binding|ferrous iron binding|ferroxidase activity|iron chaperone activity|protein binding				0						GTCCCTCCATGAGCTGCTGGC	0.498																0.158228	43.665204	61.270412	25	133	KEEP	---	---	---	---	15	11	57	81	0.576923076923	capture	Nonsense_Mutation	SNP	71687595	71687595	FXN	9	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	6056	166
TLE4	7091	broad.mit.edu	37	9	82227600	82227600	+	Silent	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:82227600C>T	uc004ald.2	+	5	1110	c.261C>T	c.(259-261)ATC>ATT	p.I87I	TLE4_uc004alc.2_Silent_p.I94I|TLE4_uc010mpr.2_5'UTR|TLE4_uc004ale.2_5'UTR|TLE4_uc011lsq.1_Silent_p.I87I|TLE4_uc010mps.2_Silent_p.I87I|TLE4_uc004alf.2_Silent_p.I32I	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4	Error:Variant_position_missing_in_O60756_after_alignment										lung(2)|ovary(1)|breast(1)|skin(1)	5						TGAATGCTATCTGTGCACAAG	0.408																0.018957	-47.500658	7.408363	4	207	KEEP	---	---	---	---	1	3	129	117	-1	capture	Silent	SNP	82227600	82227600	TLE4	9	C	T	T	T	1	0	0	0	0	0	0	0	1	408	32	2	2	15826	166
TDRD7	23424	broad.mit.edu	37	9	100235814	100235814	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100235814G>T	uc004axj.2	+	11	2210	c.1985G>T	c.(1984-1986)TGC>TTC	p.C662F	TDRD7_uc011lux.1_Missense_Mutation_p.C588F|TDRD7_uc010msp.1_5'UTR|TDRD7_uc011luy.1_Missense_Mutation_p.C11F	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	662					lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)				ACTAATATTTGCTCTGATGGG	0.443																0.357143	294.306399	299.34631	100	180	KEEP	---	---	---	---	54	55	110	92	0.495412844037	capture	Missense_Mutation	SNP	100235814	100235814	TDRD7	9	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	15620	166
CDK5RAP2	55755	broad.mit.edu	37	9	123313122	123313122	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:123313122T>A	uc004bkf.2	-	4	435	c.254A>T	c.(253-255)GAG>GTG	p.E85V	CDK5RAP2_uc004bkg.2_Missense_Mutation_p.E85V|CDK5RAP2_uc011lxw.1_5'UTR|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_5'UTR|CDK5RAP2_uc011lya.1_5'UTR|CDK5RAP2_uc004bkh.1_Missense_Mutation_p.E85V	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	85					brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						CATTCTTTCCTCAAGGAAATA	0.383																0.029703	-38.636951	10.449916	6	196	KEEP	---	---	---	---	1	5	124	105	-1	capture	Missense_Mutation	SNP	123313122	123313122	CDK5RAP2	9	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	3116	166
TOR1A	1861	broad.mit.edu	37	9	132585088	132585088	+	Silent	SNP	C	T	T			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:132585088C>T	uc004byl.2	-	2	293	c.216G>A	c.(214-216)CAG>CAA	p.Q72Q	TOR1A_uc004bym.2_RNA|TOR1A_uc004byn.2_Silent_p.Q72Q	NM_000113	NP_000104	O14656	TOR1A_HUMAN	torsin A precursor	72					chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding			central_nervous_system(1)	1		Ovarian(14;0.00556)				TTGCAAGATGCTGTCCAAAGA	0.483																0.020979	-30.411968	6.311207	3	140	KEEP	---	---	---	---	0	3	79	68	-1	capture	Silent	SNP	132585088	132585088	TOR1A	9	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	16254	166
ZNF644	84146	broad.mit.edu	37	1	91403294	91403296	+	In_Frame_Del	DEL	CTT	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91403294_91403296delCTT	uc001dnw.2	-	4	3576_3578	c.3434_3436delAAG	c.(3433-3438)GAAGGG>GGG	p.E1145del	ZNF644_uc001dnv.2_Intron|ZNF644_uc001dnx.2_Intron	NM_201269	NP_958357	Q9H582	ZN644_HUMAN	zinc finger protein 644 isoform 1	1145					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		AAATTCAGCCCTTCTTCTTCTGA	0.365																0.03			11	429		---	---	---	---						capture_indel	In_Frame_Del	DEL	91403294	91403296	ZNF644	1	CTT	-	-	-	1	0	1	0	1	0	0	0	0	312	24	5	5	17938	166
TMED5	50999	broad.mit.edu	37	1	93620253	93620256	+	Frame_Shift_Del	DEL	CAAA	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:93620253_93620256delCAAA	uc001dpn.2	-	4	1108_1111	c.661_664delTTTG	c.(661-666)TTTGAAfs	p.F221fs	TMED5_uc001dpo.2_3'UTR|TMED5_uc001dpp.2_RNA	NM_016040	NP_057124	Q9Y3A6	TMED5_HUMAN	transmembrane emp24 protein transport domain	221_222	Cytoplasmic (Potential).				transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane				ovary(1)	1		all_lung(203;0.0223)|Lung NSC(277;0.071)|Melanoma(281;0.147)|Glioma(108;0.188)		all cancers(265;0.00108)|GBM - Glioblastoma multiforme(16;0.00407)|Epithelial(280;0.0797)		CTCTTATCTTCAAACAGACTCTTC	0.348																0.38			49	81		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	93620253	93620256	TMED5	1	CAAA	-	-	-	1	0	1	0	1	0	0	0	0	377	29	5	5	15892	166
NOS1AP	9722	broad.mit.edu	37	1	162257211	162257213	+	In_Frame_Del	DEL	GAA	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:162257211_162257213delGAA	uc001gbv.2	+	3	642_644	c.255_257delGAA	c.(253-258)CTGAAG>CTG	p.K90del	NOS1AP_uc010pkr.1_In_Frame_Del_p.K92del|NOS1AP_uc010pks.1_RNA|NOS1AP_uc001gbw.2_In_Frame_Del_p.K92del	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor	90	PID.				regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			AAGTGATTCTGAAGAAGAAGAAA	0.433																0.33			51	102		---	---	---	---						capture_indel	In_Frame_Del	DEL	162257211	162257213	NOS1AP	1	GAA	-	-	-	1	0	1	0	1	0	0	0	0	574	45	5	5	10449	166
TNNT2	7139	broad.mit.edu	37	1	201331099	201331101	+	In_Frame_Del	DEL	TCT	-	-	rs45578238;rs121964859		TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201331099_201331101delTCT	uc001gwf.2	-	13	719_721	c.650_652delAGA	c.(649-654)AAGATT>ATT	p.K217del	TNNT2_uc009wzn.2_5'Flank|TNNT2_uc009wzo.2_5'Flank|TNNT2_uc009wzp.2_RNA|TNNT2_uc001gwg.2_In_Frame_Del_p.K207del|TNNT2_uc001gwh.2_In_Frame_Del_p.K204del|TNNT2_uc001gwi.2_In_Frame_Del_p.K177del|TNNT2_uc009wzr.2_In_Frame_Del_p.K148del	NM_000364	NP_000355	P45379	TNNT2_HUMAN	troponin T type 2, cardiac isoform 1	220			Missing (in CMD1D).		ATP catabolic process|muscle filament sliding|negative regulation of ATPase activity|positive regulation of ATPase activity|regulation of heart contraction|response to calcium ion|response to calcium ion|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|tropomyosin binding|troponin C binding|troponin I binding				0						TCAGCCAGAATCTTCTTCTTCTT	0.576														OREG0014076	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.04			15	340		---	---	---	---						capture_indel	In_Frame_Del	DEL	201331099	201331101	TNNT2	1	TCT	-	-	-	1	0	1	0	1	0	0	0	0	650	50	5	5	16214	166
JMJD1C	221037	broad.mit.edu	37	10	64960280	64960282	+	In_Frame_Del	DEL	TTC	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:64960280_64960282delTTC	uc001jmn.2	-	11	5530_5532	c.5230_5232delGAA	c.(5230-5232)GAAdel	p.E1744del	JMJD1C_uc001jml.2_In_Frame_Del_p.E1525del|JMJD1C_uc001jmm.2_In_Frame_Del_p.E1456del|JMJD1C_uc010qiq.1_In_Frame_Del_p.E1562del|JMJD1C_uc009xpi.2_In_Frame_Del_p.E1562del|JMJD1C_uc009xpj.1_Intron|JMJD1C_uc009xpk.1_Intron	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	1744					blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					AGTGAGCTGGTTCTTCTCCTTTT	0.350																0.38			20	33		---	---	---	---						capture_indel	In_Frame_Del	DEL	64960280	64960282	JMJD1C	10	TTC	-	-	-	1	0	1	0	1	0	0	0	0	777	60	5	5	7873	166
PSMC3	5702	broad.mit.edu	37	11	47446172	47446173	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:47446172_47446173delTT	uc001nfh.2	-	4	569_570	c.375_376delAA	c.(373-378)AAAACCfs	p.K125fs	PSMC3_uc009ylr.1_Frame_Shift_Del_p.K83fs	NM_002804	NP_002795	P17980	PRS6A_HUMAN	proteasome 26S ATPase subunit 3	125_126					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|nucleoside-triphosphatase activity|protein binding|transcription coactivator activity|transcription corepressor activity			ovary(4)	4				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CGTGTAGAGGTTTTGATCACAG	0.545																0.35			61	111		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	47446172	47446173	PSMC3	11	TT	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	12582	166
SSRP1	6749	broad.mit.edu	37	11	57093935	57093937	+	In_Frame_Del	DEL	TTC	-	-	rs142261788		TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57093935_57093937delTTC	uc001njt.2	-	17	2341_2343	c.2074_2076delGAA	c.(2074-2076)GAAdel	p.E692del	TNKS1BP1_uc001njs.2_5'Flank|TNKS1BP1_uc009ymd.1_5'Flank	NM_003146	NP_003137	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	692	Ser-rich.				DNA repair|DNA replication|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|cytoplasm|nucleoplasm	DNA binding|protein binding			ovary(2)	2						TACTGGCTAGTTCTTCTTCTTCA	0.552	Colon(89;1000 1340 6884 23013 41819)															0.16			31	162		---	---	---	---						capture_indel	In_Frame_Del	DEL	57093935	57093937	SSRP1	11	TTC	-	-	-	1	0	1	0	1	0	0	0	0	777	60	5	5	15086	166
FOLH1B	219595	broad.mit.edu	37	11	89424051	89424054	+	Frame_Shift_Del	DEL	AAAC	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89424051_89424054delAAAC	uc001pda.2	+	11	1227_1230	c.701_704delAAAC	c.(700-705)GAAACAfs	p.E234fs		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	234_235					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						TTTCTGTAGGAAACAAACAAATTC	0.319																0.22			27	94		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	89424051	89424054	FOLH1B	11	AAAC	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	5924	166
ARID2	196528	broad.mit.edu	37	12	46245922	46245923	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:46245922_46245923delAG	uc001ros.1	+	15	4016_4017	c.4016_4017delAG	c.(4015-4017)CAGfs	p.Q1339fs	ARID2_uc001ror.2_Frame_Shift_Del_p.Q1339fs|ARID2_uc009zkg.1_Frame_Shift_Del_p.Q795fs|ARID2_uc009zkh.1_Frame_Shift_Del_p.Q966fs|ARID2_uc001rou.1_Frame_Shift_Del_p.Q673fs	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1339					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TCTGGGAAACAGAACTCAGAAC	0.371																0.39			32	50		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	46245922	46245923	ARID2	12	AG	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	908	166
GMPR2	51292	broad.mit.edu	37	14	24707579	24707581	+	In_Frame_Del	DEL	GAA	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24707579_24707581delGAA	uc001wnr.2	+	9	1207_1209	c.825_827delGAA	c.(823-828)ATGAAG>ATG	p.K277del	GMPR2_uc001wnv.2_In_Frame_Del_p.K114del|GMPR2_uc001wns.2_In_Frame_Del_p.K277del|GMPR2_uc001wnt.2_In_Frame_Del_p.K244del|GMPR2_uc001wnu.2_In_Frame_Del_p.K241del|GMPR2_uc001wnw.2_In_Frame_Del_p.K277del|GMPR2_uc010all.2_In_Frame_Del_p.K249del|GMPR2_uc001wnx.2_In_Frame_Del_p.K295del|GMPR2_uc010tod.1_In_Frame_Del_p.K244del|GMPR2_uc010alk.1_In_Frame_Del_p.K277del|GMPR2_uc010toe.1_In_Frame_Del_p.K277del	NM_001002001	NP_001002001	Q9P2T1	GMPR2_HUMAN	guanosine monophosphate reductase 2 isoform 2	277					nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage	cytosol	GMP reductase activity|metal ion binding			ovary(3)	3				GBM - Glioblastoma multiforme(265;0.0181)		AAATGGCCATGAAGAAGTATGCT	0.537					35											0.21			14	52		---	---	---	---						capture_indel	In_Frame_Del	DEL	24707579	24707581	GMPR2	14	GAA	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	6433	166
SCAPER	49855	broad.mit.edu	37	15	77059334	77059336	+	In_Frame_Del	DEL	TTC	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:77059334_77059336delTTC	uc002bby.2	-	10	1401_1403	c.1342_1344delGAA	c.(1342-1344)GAAdel	p.E448del	SCAPER_uc002bbx.2_In_Frame_Del_p.E202del|SCAPER_uc002bbz.1_In_Frame_Del_p.E319del|SCAPER_uc002bca.1_In_Frame_Del_p.E313del|SCAPER_uc002bcb.1_In_Frame_Del_p.E454del|SCAPER_uc002bcc.1_In_Frame_Del_p.E448del	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	447	Glu-rich.					endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						TAGTTAACTGTTCTTCTTCAGCA	0.355																0.32			8	17		---	---	---	---						capture_indel	In_Frame_Del	DEL	77059334	77059336	SCAPER	15	TTC	-	-	-	1	0	1	0	1	0	0	0	0	777	60	5	5	13770	166
CNOT1	23019	broad.mit.edu	37	16	58562381	58562385	+	Frame_Shift_Del	DEL	TTAGA	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:58562381_58562385delTTAGA	uc002env.2	-	44	6740_6744	c.6447_6451delTCTAA	c.(6445-6453)AATCTAAAGfs	p.N2149fs	CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Frame_Shift_Del_p.N2144fs|CNOT1_uc002ent.2_Frame_Shift_Del_p.N87fs|CNOT1_uc010vik.1_Frame_Shift_Del_p.N1106fs	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	2149_2151					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		AACCTTACCTTTAGATTAGGAGTGA	0.400																0.29			63	154		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	58562381	58562385	CNOT1	16	TTAGA	-	-	-	1	0	1	0	1	0	0	0	0	832	64	5	5	3582	166
DNAH9	1770	broad.mit.edu	37	17	11757746	11757749	+	Splice_Site	DEL	GTGA	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:11757746_11757749delGTGA	uc002gne.2	+	50	10001	c.9933_splice	c.e50+1	p.A3311_splice	DNAH9_uc010coo.2_Splice_Site_p.A2605_splice	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAAGATCGCTGTGAGTGACCCCAG	0.515																0.18			12	54		---	---	---	---						capture_indel	Splice_Site	DEL	11757746	11757749	DNAH9	17	GTGA	-	-	-	1	0	1	0	1	0	0	1	0	624	48	5	5	4564	166
ACACA	31	broad.mit.edu	37	17	35564699	35564701	+	In_Frame_Del	DEL	GGA	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:35564699_35564701delGGA	uc002hnm.2	-	31	3801_3803	c.3610_3612delTCC	c.(3610-3612)TCCdel	p.S1204del	ACACA_uc002hnk.2_In_Frame_Del_p.S1126del|ACACA_uc002hnl.2_In_Frame_Del_p.S1146del|ACACA_uc002hnn.2_In_Frame_Del_p.S1204del|ACACA_uc002hno.2_In_Frame_Del_p.S1241del|ACACA_uc010cuy.2_5'Flank	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	1204					acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GGTTGAGGTTGGAGGAGAAGGAC	0.473	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)				742											0.06			7	113		---	---	---	---						capture_indel	In_Frame_Del	DEL	35564699	35564701	ACACA	17	GGA	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	106	166
MYO5B	4645	broad.mit.edu	37	18	47479673	47479674	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:47479673_47479674delTC	uc002leb.2	-	14	1996_1997	c.1708_1709delGA	c.(1708-1710)GACfs	p.D570fs	MYO5B_uc002lec.1_Frame_Shift_Del_p.D569fs	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	570	Myosin head-like.				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		ATACACCGTGTCTCTGTTTTTC	0.520																0.37			49	85		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	47479673	47479674	MYO5B	18	TC	-	-	-	1	0	1	0	1	0	0	0	0	754	58	5	5	9989	166
TMIGD2	126259	broad.mit.edu	37	19	4298041	4298042	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4298041_4298042delTA	uc002lzx.1	-	2	393_394	c.347_348delTA	c.(346-348)GTAfs	p.V116fs	TMIGD2_uc010dtv.1_Frame_Shift_Del_p.V116fs	NM_144615	NP_653216	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain	116	Extracellular (Potential).|Ig-like.					integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGAATCTCTACGGCCGCCCA	0.653																0.26			94	274		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	4298041	4298042	TMIGD2	19	TA	-	-	-	1	0	1	0	1	0	0	0	0	678	53	5	5	16114	166
DPYSL5	56896	broad.mit.edu	37	2	27165614	27165616	+	In_Frame_Del	DEL	AGA	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27165614_27165616delAGA	uc002rhu.3	+	11	1594_1596	c.1436_1438delAGA	c.(1435-1440)GAGAAG>GAG	p.K480del	DPYSL5_uc002rhv.3_In_Frame_Del_p.K480del	NM_020134	NP_064519	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	480					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCCAGAGAGAGAAGGTGAGGTG	0.557														OREG0014510	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.25			21	63		---	---	---	---						capture_indel	In_Frame_Del	DEL	27165614	27165616	DPYSL5	2	AGA	-	-	-	1	0	1	0	1	0	0	0	0	143	11	5	5	4705	166
TMPRSS6	164656	broad.mit.edu	37	22	37492125	37492125	+	Frame_Shift_Del	DEL	C	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37492125delC	uc003aqs.1	-	5	551	c.437delG	c.(436-438)GGAfs	p.G146fs	TMPRSS6_uc003aqt.1_Frame_Shift_Del_p.G137fs|TMPRSS6_uc003aqu.2_Frame_Shift_Del_p.G137fs	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	146	Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						GGTGAGGGGTCCCTCCCTAAG	0.567																0.48			33	36		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	37492125	37492125	TMPRSS6	22	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	16134	166
DDX17	10521	broad.mit.edu	37	22	38890068	38890069	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38890068_38890069delTT	uc003avy.3	-	9	1385_1386	c.1282_1283delAA	c.(1282-1284)AAGfs	p.K428fs	DDX17_uc003avx.3_Frame_Shift_Del_p.K428fs|DDX17_uc011anu.1_Frame_Shift_Del_p.K341fs	NM_001098504	NP_001091974	Q92841	DDX17_HUMAN	DEAD box polypeptide 17 isoform 3	349	Helicase C-terminal.				RNA processing	nucleus	ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity|RNA-dependent ATPase activity			skin(3)|upper_aerodigestive_tract(1)	4	Melanoma(58;0.0286)					ACAGCGTCTCTTTGTCTCCACA	0.386	Ovarian(55;1085 1454 6392 21425)															0.13			27	177		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	38890068	38890069	DDX17	22	TT	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	4302	166
MRPS25	64432	broad.mit.edu	37	3	15094113	15094115	+	In_Frame_Del	DEL	CTC	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:15094113_15094115delCTC	uc003bzl.2	-	4	470_472	c.355_357delGAG	c.(355-357)GAGdel	p.E119del	MRPS25_uc011avl.1_In_Frame_Del_p.89_90RR>R|MRPS25_uc011avm.1_Intron	NM_022497	NP_071942	P82663	RT25_HUMAN	mitochondrial ribosomal protein S25	119					translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0						GCTGCTTTTTCTCCTCCTCCTCT	0.586																0.13			56	391		---	---	---	---						capture_indel	In_Frame_Del	DEL	15094113	15094115	MRPS25	3	CTC	-	-	-	1	0	1	0	1	0	0	0	0	415	32	5	5	9746	166
TMEM115	11070	broad.mit.edu	37	3	50396188	50396190	+	In_Frame_Del	DEL	AGA	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50396188_50396190delAGA	uc003dan.1	-	1	750_752	c.305_307delTCT	c.(304-309)TTCTCA>TCA	p.F102del		NM_007024	NP_008955	Q12893	TM115_HUMAN	PL6 protein	102	Helical; (Potential).				negative regulation of cell proliferation	Golgi apparatus|integral to membrane|nucleus					0				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		TTCACCACTGAGAAGAAGATGAG	0.601																0.10			18	167		---	---	---	---						capture_indel	In_Frame_Del	DEL	50396188	50396190	TMEM115	3	AGA	-	-	-	1	0	1	0	1	0	0	0	0	143	11	5	5	15914	166
USP53	54532	broad.mit.edu	37	4	120213685	120213686	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:120213685_120213686delCT	uc003ics.3	+	18	3607_3608	c.2541_2542delCT	c.(2539-2544)AACTCTfs	p.N847fs	USP53_uc003icr.3_Frame_Shift_Del_p.N847fs|USP53_uc003icu.3_Frame_Shift_Del_p.N470fs	NM_019050	NP_061923	Q70EK8	UBP53_HUMAN	ubiquitin specific protease 53	847_848					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			ovary(1)|breast(1)|kidney(1)|skin(1)	4						ACGTTGATAACTCTGCTTCTGG	0.391																0.21			25	96		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	120213685	120213686	USP53	4	CT	-	-	-	1	0	1	0	1	0	0	0	0	259	20	5	5	16966	166
SPEF2	79925	broad.mit.edu	37	5	35771803	35771804	+	Frame_Shift_Ins	INS	-	A	A			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:35771803_35771804insA	uc003jjo.2	+	27	4005_4006	c.3894_3895insA	c.(3892-3897)AATAAAfs	p.N1298fs	SPEF2_uc003jjp.1_Frame_Shift_Ins_p.N784fs|SPEF2_uc003jjr.2_5'Flank	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	1298_1299					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGGGTGCAAATAAAAAAGTCAA	0.426																0.09			9	94		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	35771803	35771804	SPEF2	5	-	A	A	A	1	0	1	1	0	0	0	0	0	634	49	5	5	14927	166
PIK3R1	5295	broad.mit.edu	37	5	67589619	67589621	+	In_Frame_Del	DEL	GAG	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589619_67589621delGAG	uc003jva.2	+	11	1942_1944	c.1382_1384delGAG	c.(1381-1386)CGAGAA>CAA	p.461_462RE>Q	PIK3R1_uc003jvb.2_In_Frame_Del_p.461_462RE>Q|PIK3R1_uc003jvc.2_In_Frame_Del_p.161_162RE>Q|PIK3R1_uc003jvd.2_In_Frame_Del_p.191_192RE>Q|PIK3R1_uc003jve.2_In_Frame_Del_p.140_141RE>Q|PIK3R1_uc011crb.1_In_Frame_Del_p.131_132RE>Q	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	461_462					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.D434_Q475del(2)|p.?(1)|p.F456_R461>S(1)|p.Q457_R461del(1)|p.F456_R461del(1)|p.R461*(1)|p.T454_D464del(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	GAAAAAAGTCGAGAATATGATAG	0.281					370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.34			30	57		---	---	---	---						capture_indel	In_Frame_Del	DEL	67589619	67589621	PIK3R1	5	GAG	-	-	-	1	0	1	0	1	0	0	0	0	481	37	5	5	11821	166
HOMER1	9456	broad.mit.edu	37	5	78752779	78752781	+	In_Frame_Del	DEL	TTC	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:78752779_78752781delTTC	uc003kfy.2	-	2	1169_1171	c.66_68delGAA	c.(64-69)AAGAAC>AAC	p.K22del	HOMER1_uc010jab.2_In_Frame_Del_p.K22del|HOMER1_uc010jac.2_In_Frame_Del_p.K22del|HOMER1_uc010jad.2_Intron	NM_004272	NP_004263	Q86YM7	HOME1_HUMAN	homer 1	22	WH1.				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane					0		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		GGGTACCCAGTTCTTCTTTGTGT	0.433																0.40			117	179		---	---	---	---						capture_indel	In_Frame_Del	DEL	78752779	78752781	HOMER1	5	TTC	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	7203	166
RAB23	51715	broad.mit.edu	37	6	57055306	57055309	+	Frame_Shift_Del	DEL	TTTG	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:57055306_57055309delTTTG	uc003pds.2	-	7	870_873	c.664_667delCAAA	c.(664-669)CAAAGGfs	p.Q222fs	RAB23_uc003pdt.2_Frame_Shift_Del_p.Q222fs|RAB23_uc010kac.2_Frame_Shift_Del_p.Q222fs|RAB23_uc010kad.2_RNA	NM_183227	NP_899050	Q9ULC3	RAB23_HUMAN	Ras-related protein Rab-23	222_223					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			skin(1)	1	Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TTCTTGGTCCTTTGTTTGTTGGGT	0.387																0.19			36	155		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	57055306	57055309	RAB23	6	TTTG	-	-	-	1	0	1	0	1	0	0	0	0	726	56	5	5	12805	166
SMURF1	57154	broad.mit.edu	37	7	98636097	98636099	+	In_Frame_Del	DEL	GTT	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98636097_98636099delGTT	uc003upu.1	-	15	1998_2000	c.1678_1680delAAC	c.(1678-1680)AACdel	p.N560del	SMURF1_uc003upv.1_In_Frame_Del_p.N534del|SMURF1_uc003upt.2_In_Frame_Del_p.N534del	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	Smad ubiquitination regulatory factor 1 isoform	560	HECT.				BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			GCCCGAAGGCGTTGTGTTCCACG	0.512					444											0.10			11	100		---	---	---	---						capture_indel	In_Frame_Del	DEL	98636097	98636099	SMURF1	7	GTT	-	-	-	1	0	1	0	1	0	0	0	0	516	40	5	5	14711	166
SLC7A13	157724	broad.mit.edu	37	8	87235301	87235301	+	Frame_Shift_Del	DEL	G	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:87235301delG	uc003ydq.1	-	2	815	c.717delC	c.(715-717)CCCfs	p.P239fs	SLC7A13_uc003ydr.1_Frame_Shift_Del_p.P230fs	NM_138817	NP_620172	Q8TCU3	S7A13_HUMAN	solute carrier family 7, (cationic amino acid	239	Cytoplasmic (Potential).					integral to membrane	amino acid transmembrane transporter activity			central_nervous_system(1)	1						ATATGCATTTGGGAATTGTTG	0.358																0.09			26	279		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	87235301	87235301	SLC7A13	8	G	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	14587	166
DGAT1	8694	broad.mit.edu	37	8	145540703	145540703	+	Frame_Shift_Del	DEL	G	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145540703delG	uc003zbv.3	-	15	1498	c.1230delC	c.(1228-1230)GCCfs	p.A410fs	DGAT1_uc010mfv.2_Frame_Shift_Del_p.L245fs	NM_012079	NP_036211	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	410	Lumenal (Potential).				triglyceride biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane	diacylglycerol O-acyltransferase activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			AGAAGGCCGAGGCCAGGAACA	0.637																0.21			19	72		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	145540703	145540703	DGAT1	8	G	-	-	-	1	0	1	0	1	0	0	0	0	444	35	5	5	4415	166
HSDL2	84263	broad.mit.edu	37	9	115181194	115181194	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:115181194delA	uc004bga.1	+	6	647	c.554delA	c.(553-555)GAAfs	p.E185fs	HSDL2_uc011lwv.1_Frame_Shift_Del_p.E64fs|HSDL2_uc004bgb.1_Frame_Shift_Del_p.N36fs|HSDL2_uc004bgc.1_Frame_Shift_Del_p.E112fs|HSDL2_uc011lww.1_Intron	NM_032303	NP_115679	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	185						peroxisome	oxidoreductase activity|sterol binding				0						ATGGCAGAAGAATTTAAAGGT	0.279																0.29			39	95		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	115181194	115181194	HSDL2	9	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	7319	166
ATRX	546	broad.mit.edu	37	X	76939674	76939675	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-19-2629-01	TCGA-19-2629-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76939674_76939675delTT	uc004ecp.3	-	9	1305_1306	c.1073_1074delAA	c.(1072-1074)AAAfs	p.K358fs	ATRX_uc004ecq.3_Frame_Shift_Del_p.K320fs|ATRX_uc004eco.3_Frame_Shift_Del_p.K143fs|ATRX_uc004ecr.2_Frame_Shift_Del_p.K319fs|ATRX_uc010nlx.1_Frame_Shift_Del_p.K358fs|ATRX_uc010nly.1_Frame_Shift_Del_p.K303fs	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	358					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TCTCAATCAGTTTTTTTGCCTT	0.366					2	Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						0.69			99	44		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	76939674	76939675	ATRX	23	TT	-	-	-	1	0	1	0	1	0	0	0	0	777	60	5	5	1199	166
