Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CHD5	26038	broad.mit.edu	37	1	6181182	6181182	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6181182G>A	uc001amb.1	-	33	4995	c.4895C>T	c.(4894-4896)CCG>CTG	p.P1632L	CHD5_uc001alz.1_Missense_Mutation_p.P489L|CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	1632					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CAGCTGCTCCGGGGAGGGCGG	0.652					2304											0.583333	39.182045	39.344609	14	10	KEEP	---	---	---	---	6	11	7	6	-1	capture	Missense_Mutation	SNP	6181182	6181182	CHD5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3294	168
RORC	6097	broad.mit.edu	37	1	151789268	151789268	+	Missense_Mutation	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151789268C>T	uc001ezh.2	-	4	278	c.170G>A	c.(169-171)CGG>CAG	p.R57Q	RORC_uc001ezg.2_Missense_Mutation_p.R36Q|RORC_uc010pdo.1_Missense_Mutation_p.R111Q|RORC_uc010pdp.1_Missense_Mutation_p.R57Q	NM_005060	NP_005051	P51449	RORG_HUMAN	RAR-related orphan receptor C isoform a	57	Nuclear receptor.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GCGCTGGCTCCGGCGGAAGAA	0.637																0.432432	50.695176	50.842308	16	21	KEEP	---	---	---	---	9	7	14	12	-1	capture	Missense_Mutation	SNP	151789268	151789268	RORC	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13422	168
RPTN	126638	broad.mit.edu	37	1	152127687	152127687	+	Missense_Mutation	SNP	G	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152127687G>T	uc001ezs.1	-	3	1953	c.1888C>A	c.(1888-1890)CAA>AAA	p.Q630K		NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin	630	Gln-rich.					proteinaceous extracellular matrix	calcium ion binding				0						CCCTGGTTTTGGTACCCTTCC	0.498																0.420074	338.217371	339.719857	113	156	KEEP	---	---	---	---	53	75	80	96	0.4140625	capture	Missense_Mutation	SNP	152127687	152127687	RPTN	1	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	13556	168
HMCN1	83872	broad.mit.edu	37	1	185958748	185958748	+	Silent	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:185958748C>T	uc001grq.1	+	21	3406	c.3177C>T	c.(3175-3177)TAC>TAT	p.Y1059Y	HMCN1_uc001grr.1_Silent_p.Y400Y	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1059	Ig-like C2-type 7.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CAGCCGGCTACGCCAAAAGGA	0.483																0.478873	103.743628	103.771276	34	37	KEEP	---	---	---	---	21	21	28	22	-1	capture	Silent	SNP	185958748	185958748	HMCN1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7145	168
PLXDC2	84898	broad.mit.edu	37	10	20453469	20453469	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:20453469G>A	uc001iqg.1	+	7	1493	c.856G>A	c.(856-858)GTT>ATT	p.V286I	PLXDC2_uc001iqh.1_Missense_Mutation_p.V237I|PLXDC2_uc009xkc.1_RNA	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN	plexin domain containing 2 precursor	286	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4						TGCATTTGTCGTTGTCCACAG	0.443																0.05618	-7.697257	10.72951	5	84	KEEP	---	---	---	---	5	2	64	36	-1	capture	Missense_Mutation	SNP	20453469	20453469	PLXDC2	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12021	168
MYO3A	53904	broad.mit.edu	37	10	26463063	26463063	+	Silent	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:26463063C>T	uc001isn.2	+	30	4230	c.3870C>T	c.(3868-3870)AGC>AGT	p.S1290S	MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1290					protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						CTACACTTAGCCAAAGGTCAA	0.428					781											0.771739	227.458277	233.683367	71	21	KEEP	---	---	---	---	40	38	7	18	-1	capture	Silent	SNP	26463063	26463063	MYO3A	10	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	9986	168
DKK1	22943	broad.mit.edu	37	10	54076434	54076434	+	Missense_Mutation	SNP	A	G	G			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:54076434A>G	uc001jjr.2	+	4	822	c.668A>G	c.(667-669)CAT>CGT	p.H223R	uc001jjq.1_5'Flank|uc009xox.1_5'Flank	NM_012242	NP_036374	O94907	DKK1_HUMAN	dickkopf homolog 1 precursor	223	DKK-type Cys-2.				negative regulation of peptidyl-serine phosphorylation|negative regulation of protein complex assembly|negative regulation of transcription from RNA polymerase II promoter|positive regulation of heart induction by negative regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization	extracellular space|plasma membrane	growth factor activity|low-density lipoprotein particle receptor binding|receptor antagonist activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3						TGTACCAAGCATAGGAGAAAA	0.463					158											0.672566	268.336042	271.32044	76	37	KEEP	---	---	---	---	45	42	26	15	-1	capture	Missense_Mutation	SNP	54076434	54076434	DKK1	10	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	4502	168
TMEM26	219623	broad.mit.edu	37	10	63170245	63170245	+	Silent	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:63170245C>T	uc001jlo.2	-	6	1311	c.942G>A	c.(940-942)TCG>TCA	p.S314S	TMEM26_uc010qij.1_RNA|TMEM26_uc001jlp.1_RNA	NM_178505	NP_848600	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	314						integral to membrane					0	Prostate(12;0.0112)					GACTTCTCAACGAAGCACGGA	0.557																0.734375	150.488453	153.72914	47	17	KEEP	---	---	---	---	32	26	7	13	-1	capture	Silent	SNP	63170245	63170245	TMEM26	10	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	16034	168
RUFY2	55680	broad.mit.edu	37	10	70154149	70154149	+	Missense_Mutation	SNP	A	G	G			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:70154149A>G	uc001job.2	-	5	890	c.563T>C	c.(562-564)CTG>CCG	p.L188P	RUFY2_uc001jnz.1_RNA|RUFY2_uc001joc.2_Missense_Mutation_p.L119P|RUFY2_uc010qiw.1_Missense_Mutation_p.L95P|RUFY2_uc001jod.1_Missense_Mutation_p.L153P|RUFY2_uc009xpv.1_Missense_Mutation_p.L36P|RUFY2_uc001joe.1_Missense_Mutation_p.L153P	NM_017987	NP_060457	Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain-containing 2 isoform a	202	RUN.					nucleus	metal ion binding			ovary(1)	1						GCCAACCAGCAGCCCAACAAT	0.383																0.037975	-11.845471	6.396097	3	76	KEEP	---	---	---	---	0	6	38	54	-1	capture	Missense_Mutation	SNP	70154149	70154149	RUFY2	10	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	13631	168
COL17A1	1308	broad.mit.edu	37	10	105815707	105815707	+	Missense_Mutation	SNP	C	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105815707C>A	uc001kxr.2	-	18	1689	c.1520G>T	c.(1519-1521)AGG>ATG	p.R507M	COL17A1_uc010qqv.1_Missense_Mutation_p.R491M	NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	507	Extracellular (Potential).|Nonhelical region (NC16).				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CAGTATGCTCCTCCTGATCCT	0.597																0.020619	-42.887568	7.060635	4	190	KEEP	---	---	---	---	3	2	116	111	0.4	capture	Missense_Mutation	SNP	105815707	105815707	COL17A1	10	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	3639	168
UBQLN3	50613	broad.mit.edu	37	11	5529360	5529360	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5529360G>A	uc001may.1	-	2	1515	c.1429C>T	c.(1429-1431)CTG>TTG	p.L477L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_5'Flank|OR51B5_uc001maq.1_5'Flank	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN	ubiquilin 3	477										ovary(3)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGGATGGCAGCCAGGGAGGC	0.552	Ovarian(72;684 1260 12332 41642 52180)															0.345588	132.88312	135.746652	47	89	KEEP	---	---	---	---	20	37	55	43	-1	capture	Silent	SNP	5529360	5529360	UBQLN3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	16780	168
DCHS1	8642	broad.mit.edu	37	11	6646055	6646055	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6646055G>A	uc001mem.1	-	20	7601	c.7191C>T	c.(7189-7191)TCC>TCT	p.S2397S		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	2397	Cadherin 23.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGCAGAGACGGAGAGAATGG	0.557																0.048387	-5.626606	7.816158	3	59	KEEP	---	---	---	---	0	3	30	39	-1	capture	Silent	SNP	6646055	6646055	DCHS1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4246	168
RAG1	5896	broad.mit.edu	37	11	36597064	36597064	+	Missense_Mutation	SNP	G	A	A	rs104894286		TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:36597064G>A	uc001mwu.3	+	2	2334	c.2210G>A	c.(2209-2211)CGT>CAT	p.R737H	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	737			R -> H (in OS and CHIDG; reduced recombination activity when associated with T-507).		histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				GATGCCACCCGTCTGGAAGCC	0.502	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)				117							Familial_Hemophagocytic_Lymphohistiocytosis				0.431507	177.610171	178.204781	63	83	KEEP	---	---	---	---	30	40	45	48	-1	capture	Missense_Mutation	SNP	36597064	36597064	RAG1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12898	168
OR5D18	219438	broad.mit.edu	37	11	55587399	55587399	+	Silent	SNP	C	T	T	rs147156620	by1000genomes	TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55587399C>T	uc010rin.1	+	1	294	c.294C>T	c.(292-294)TGC>TGT	p.C98C		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	98	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				TTTTAGGATGCGTAGTACAAT	0.433																0.371981	449.750219	455.707911	154	260	KEEP	---	---	---	---	86	88	141	149	-1	capture	Silent	SNP	55587399	55587399	OR5D18	11	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	11061	168
OR8J3	81168	broad.mit.edu	37	11	55904467	55904467	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55904467G>A	uc010riz.1	-	1	728	c.728C>T	c.(727-729)TCG>TTG	p.S243L		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	243	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					TATCATATGCGAAGCGCAGGT	0.403																0.442177	191.726113	192.158123	65	82	KEEP	---	---	---	---	30	37	38	47	-1	capture	Missense_Mutation	SNP	55904467	55904467	OR8J3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11146	168
SLC43A3	29015	broad.mit.edu	37	11	57193641	57193641	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57193641G>A	uc001nkg.2	-	3	415	c.5C>T	c.(4-6)GCG>GTG	p.A2V	PRG2_uc001nke.2_5'Flank|SLC43A3_uc001nkh.2_Missense_Mutation_p.A2V|SLC43A3_uc010rjr.1_Missense_Mutation_p.A2V|SLC43A3_uc009yme.2_Missense_Mutation_p.A2V|SLC43A3_uc001nki.2_Missense_Mutation_p.A2V|SLC43A3_uc009ymf.1_Missense_Mutation_p.A2V|SLC43A3_uc010rjs.1_Missense_Mutation_p.A2V|SLC43A3_uc009ymg.1_Missense_Mutation_p.A2V	NM_014096	NP_054815	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	2					transmembrane transport	integral to membrane				central_nervous_system(1)	1						GCCCTGGCCCGCCATGAGCAG	0.587																0.0625	-4.251307	8.517955	4	60	KEEP	---	---	---	---	0	5	77	59	-1	capture	Missense_Mutation	SNP	57193641	57193641	SLC43A3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14526	168
DYNC2H1	79659	broad.mit.edu	37	11	103006524	103006524	+	Silent	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:103006524C>T	uc001pho.2	+	17	2565	c.2421C>T	c.(2419-2421)ATC>ATT	p.I807I	DYNC2H1_uc001phn.1_Silent_p.I807I|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	807	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AGAGATTCATCGGCATTCCAA	0.343																0.309524	35.758769	37.116813	13	29	KEEP	---	---	---	---	4	10	17	20	-1	capture	Silent	SNP	103006524	103006524	DYNC2H1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	4801	168
CD163L1	283316	broad.mit.edu	37	12	7519881	7519881	+	Silent	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7519881C>T	uc001qsy.2	-	18	4256	c.4230G>A	c.(4228-4230)GAG>GAA	p.E1410E	CD163L1_uc010sge.1_Silent_p.E1420E	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	1410	Cytoplasmic (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						AGGTCTCCATCTCATGGAATA	0.498																0.392405	93.212385	94.011315	31	48	KEEP	---	---	---	---	16	19	26	30	-1	capture	Silent	SNP	7519881	7519881	CD163L1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	2939	168
KRT18	3875	broad.mit.edu	37	12	53346096	53346096	+	Missense_Mutation	SNP	G	A	A	rs147541172	byFrequency	TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53346096G>A	uc001sbe.2	+	7	1211	c.1142G>A	c.(1141-1143)CGC>CAC	p.R381H	KRT18_uc009zmn.1_Missense_Mutation_p.R381H|KRT18_uc001sbf.1_Missense_Mutation_p.R208H|KRT18_uc001sbg.2_Missense_Mutation_p.R381H|KRT18_uc009zmo.2_Missense_Mutation_p.R381H|KRT8_uc009zml.1_5'Flank|KRT8_uc009zmm.1_5'Flank	NM_199187	NP_954657	P05783	K1C18_HUMAN	keratin 18	381	Interaction with DNAJB6.|Coil 2.|Rod.				anatomical structure morphogenesis|cell cycle|Golgi to plasma membrane CFTR protein transport|interspecies interaction between organisms|negative regulation of apoptosis	centriolar satellite|keratin filament|perinuclear region of cytoplasm	protein binding|structural molecule activity			skin(1)	1						GCCACCTACCGCCGCCTGCTG	0.602																0.357143	26.251211	26.750466	10	18	KEEP	---	---	---	---	9	4	6	18	-1	capture	Missense_Mutation	SNP	53346096	53346096	KRT18	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8375	168
ACACB	32	broad.mit.edu	37	12	109693958	109693958	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109693958G>A	uc001tob.2	+	45	6299	c.6180G>A	c.(6178-6180)ACG>ACA	p.T2060T	ACACB_uc001toc.2_Silent_p.T2060T|ACACB_uc010sxl.1_RNA|ACACB_uc001tod.2_RNA|ACACB_uc010sxm.1_Silent_p.T726T	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	2060	Carboxyltransferase.				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	TGAAGGGAACGTGGCAGAGCG	0.602					1843											0.392157	120.379453	121.417528	40	62	KEEP	---	---	---	---	29	21	35	43	-1	capture	Silent	SNP	109693958	109693958	ACACB	12	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	107	168
PITPNM2	57605	broad.mit.edu	37	12	123473301	123473301	+	Silent	SNP	T	C	C			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123473301T>C	uc001uej.1	-	18	2989	c.2850A>G	c.(2848-2850)TCA>TCG	p.S950S	PITPNM2_uc001uek.1_Silent_p.S944S	NM_020845	NP_065896	Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein,	950	DDHD.				metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CCACGTCTGTTGACTCCCAGT	0.632																0.2	6.644648	7.481236	2	8	KEEP	---	---	---	---	0	2	1	7	-1	capture	Silent	SNP	123473301	123473301	PITPNM2	12	T	C	C	C	1	0	0	0	0	0	0	0	1	808	63	3	3	11854	168
SPTBN5	51332	broad.mit.edu	37	15	42160382	42160382	+	Missense_Mutation	SNP	C	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42160382C>A	uc001zos.2	-	34	6320	c.5987G>T	c.(5986-5988)CGG>CTG	p.R1996L	hsa-mir-4310|MI0015840_5'Flank	NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2031	Spectrin 16.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CACCTGGTCCCGCTGGTCCTG	0.642																0.142857	4.840573	6.561012	2	12	KEEP	---	---	---	---	2	0	5	8	-1	capture	Missense_Mutation	SNP	42160382	42160382	SPTBN5	15	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	15014	168
ATP8B4	79895	broad.mit.edu	37	15	50209193	50209193	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50209193G>A	uc001zxu.2	-	20	2221	c.2079C>T	c.(2077-2079)GAC>GAT	p.D693D	ATP8B4_uc010ber.2_Silent_p.D566D|ATP8B4_uc010ufd.1_Silent_p.D503D|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	693	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CATTCATGTCGTCAGTCAGCA	0.333																0.40884	219.710559	221.02613	74	107	KEEP	---	---	---	---	34	54	72	58	-1	capture	Silent	SNP	50209193	50209193	ATP8B4	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1188	168
SH3GL3	6457	broad.mit.edu	37	15	84257442	84257442	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:84257442C>T	uc002bjw.2	+	8	952	c.757C>T	c.(757-759)CGA>TGA	p.R253*	SH3GL3_uc010uot.1_Nonsense_Mutation_p.R253*|SH3GL3_uc002bjx.2_Nonsense_Mutation_p.R184*|SH3GL3_uc002bju.2_Nonsense_Mutation_p.R261*|SH3GL3_uc002bjv.2_RNA	NM_003027	NP_003018	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	253	Interaction with ARC (By similarity).				central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3						TGTCCCCAGACGAGAATACAA	0.458																0.369048	88.100855	89.367745	31	53	KEEP	---	---	---	---	20	19	27	37	-1	capture	Nonsense_Mutation	SNP	84257442	84257442	SH3GL3	15	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	14145	168
DNAH9	1770	broad.mit.edu	37	17	11865572	11865572	+	Missense_Mutation	SNP	A	G	G			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:11865572A>G	uc002gne.2	+	68	13300	c.13232A>G	c.(13231-13233)CAG>CGG	p.Q4411R	DNAH9_uc010coo.2_Missense_Mutation_p.Q3629R|DNAH9_uc002gnf.2_Missense_Mutation_p.Q723R	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	4411					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGGGACACACAGGTAAAGCTT	0.473																0.025	-23.485653	6.543955	3	117	KEEP	---	---	---	---	0	4	60	74	-1	capture	Missense_Mutation	SNP	11865572	11865572	DNAH9	17	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	4564	168
ALDH3A1	218	broad.mit.edu	37	17	19642827	19642827	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:19642827G>A	uc010cqu.2	-	7	1440	c.1110C>T	c.(1108-1110)AAC>AAT	p.N370N	ALDH3A1_uc010vzd.1_Silent_p.N370N|ALDH3A1_uc002gwj.2_Silent_p.N370N|ALDH3A1_uc010cqv.2_Silent_p.N369N|ALDH3A1_uc002gwk.2_Silent_p.N487N|ALDH3A1_uc002gwl.1_Silent_p.N297N	NM_001135168	NP_001128640	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3A1	370					cellular aldehyde metabolic process	cytosol|endoplasmic reticulum	alcohol dehydrogenase (NADP+) activity|aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase			ovary(1)|pancreas(1)	2	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)	NADH(DB00157)	CCACCTTGTCGTTGCTGGAGA	0.443																0.4	23.797131	23.971662	8	12	KEEP	---	---	---	---	6	6	3	11	-1	capture	Silent	SNP	19642827	19642827	ALDH3A1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	497	168
DNAI2	64446	broad.mit.edu	37	17	72283178	72283178	+	Silent	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72283178C>T	uc002jkf.2	+	4	507	c.408C>T	c.(406-408)GAC>GAT	p.D136D	DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_Intron	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate polypeptide 2	136					cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity			ovary(2)|central_nervous_system(1)	3						ATTTCAATGACGAGGAGGCCA	0.507												Kartagener_syndrome				0.40625	74.937927	75.429304	26	38	KEEP	---	---	---	---	11	17	22	19	-1	capture	Silent	SNP	72283178	72283178	DNAI2	17	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4566	168
AFG3L2	10939	broad.mit.edu	37	18	12356814	12356814	+	Missense_Mutation	SNP	C	G	G			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:12356814C>G	uc002kqz.1	-	9	1156	c.1043G>C	c.(1042-1044)GGT>GCT	p.G348A		NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2	348	ATP (Potential).				cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	GCCTGGAGGACCAGTGAGAAT	0.418																0.375	98.572497	99.53533	27	45	KEEP	---	---	---	---	11	17	20	31	-1	capture	Missense_Mutation	SNP	12356814	12356814	AFG3L2	18	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	360	168
DSG4	147409	broad.mit.edu	37	18	28986155	28986155	+	Silent	SNP	A	G	G			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28986155A>G	uc002kwq.2	+	12	1887	c.1752A>G	c.(1750-1752)TTA>TTG	p.L584L	DSG4_uc002kwr.2_Silent_p.L584L	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	584	Extracellular (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TGGTGCAGTTATATGCCTGTG	0.483																0.325926	152.166192	155.788755	44	91	KEEP	---	---	---	---	24	24	41	57	-1	capture	Silent	SNP	28986155	28986155	DSG4	18	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	4734	168
THEG	51298	broad.mit.edu	37	19	362390	362390	+	Missense_Mutation	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:362390C>T	uc002lol.2	-	8	989	c.950G>A	c.(949-951)CGA>CAA	p.R317Q	THEG_uc002lom.2_Missense_Mutation_p.R293Q	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	317					cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGAGGATCTCGGTCAGGAAC	0.577																0.368644	256.675768	260.249709	87	149	KEEP	---	---	---	---	45	56	69	108	-1	capture	Missense_Mutation	SNP	362390	362390	THEG	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15742	168
GPX4	2879	broad.mit.edu	37	19	1105195	1105195	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1105195G>A	uc010xgg.1	+	2	202	c.95G>A	c.(94-96)CGG>CAG	p.R32Q	GPX4_uc010xgh.1_Missense_Mutation_p.R32Q|GPX4_uc010xgi.1_Missense_Mutation_p.R69Q	NM_002085	NP_002076	P36969	GPX4_HUMAN	glutathione peroxidase 4 isoform A precursor	32					multicellular organismal development|phospholipid metabolic process		glutathione peroxidase activity|phospholipid-hydroperoxide glutathione peroxidase activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glutathione(DB00143)	TGCGCGTCCCGGGACGACTGG	0.672																0.413793	71.48893	71.865376	24	34	KEEP	---	---	---	---	18	9	16	24	-1	capture	Missense_Mutation	SNP	1105195	1105195	GPX4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6675	168
CD209	30835	broad.mit.edu	37	19	7808071	7808071	+	Missense_Mutation	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7808071C>T	uc002mht.2	-	7	1136	c.1069G>A	c.(1069-1071)GCG>ACG	p.A357T	CD209_uc010xju.1_Missense_Mutation_p.A196T|CD209_uc010dvp.2_Missense_Mutation_p.R295H|CD209_uc002mhr.2_Missense_Mutation_p.A333T|CD209_uc002mhs.2_Missense_Mutation_p.A287T|CD209_uc002mhu.2_Missense_Mutation_p.A265T|CD209_uc010dvq.2_Missense_Mutation_p.A351T|CD209_uc002mhq.2_Missense_Mutation_p.A357T|CD209_uc002mhv.2_Missense_Mutation_p.A333T|CD209_uc002mhx.2_Missense_Mutation_p.A313T|CD209_uc002mhw.2_Missense_Mutation_p.A221T|CD209_uc010dvr.2_Missense_Mutation_p.A121T	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	357	Extracellular (Probable).|C-type lectin.				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						CTAAATTCCGCGCAGTCTTCC	0.527																0.376164	587.325433	594.550576	202	335	KEEP	---	---	---	---	142	124	222	233	-1	capture	Missense_Mutation	SNP	7808071	7808071	CD209	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2955	168
MUC16	94025	broad.mit.edu	37	19	9072932	9072932	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9072932G>A	uc002mkp.2	-	3	14718	c.14514C>T	c.(14512-14514)ACC>ACT	p.T4838T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	4840	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ATGCTGAACCGGTGGTCCCCA	0.463																0.022388	-27.299805	6.796329	3	131	KEEP	---	---	---	---	1	2	75	67	-1	capture	Silent	SNP	9072932	9072932	MUC16	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9883	168
ZNF844	284391	broad.mit.edu	37	19	12187275	12187275	+	Missense_Mutation	SNP	G	C	C			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12187275G>C	uc002mtb.2	+	4	1483	c.1340G>C	c.(1339-1341)CGT>CCT	p.R447P	ZNF844_uc010dym.1_Missense_Mutation_p.R290P	NM_001136501	NP_001129973	Q08AG5	ZN844_HUMAN	zinc finger protein 844	447					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAGAGAAACCGTATGAGTGTA	0.433																0.025641	-21.879741	7.274035	3	114	KEEP	---	---	---	---	0	3	61	65	-1	capture	Missense_Mutation	SNP	12187275	12187275	ZNF844	19	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	18066	168
ZNF345	25850	broad.mit.edu	37	19	37368940	37368940	+	Missense_Mutation	SNP	G	C	C			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37368940G>C	uc002oex.2	+	3	1586	c.1208G>C	c.(1207-1209)TGT>TCT	p.C403S	ZNF345_uc002oey.3_Missense_Mutation_p.C403S|ZNF345_uc002oez.2_Intron	NM_003419	NP_003410	Q14585	ZN345_HUMAN	zinc finger protein 345	403	C2H2-type 13.				negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGTAAAGAATGTGGAAAGTCC	0.418																0.028302	-17.645813	8.304808	3	103	KEEP	---	---	---	---	2	1	64	55	-1	capture	Missense_Mutation	SNP	37368940	37368940	ZNF345	19	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	17739	168
KIR3DL1	3811	broad.mit.edu	37	19	55341632	55341632	+	Missense_Mutation	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55341632C>T	uc002qhk.3	+	9	1300	c.1237C>T	c.(1237-1239)CGC>TGC	p.R413C	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.R338C|KIR3DL1_uc010esf.2_Missense_Mutation_p.R318C|KIR3DL1_uc010yfo.1_Missense_Mutation_p.R355C|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_5'Flank|KIR2DS4_uc002qhm.1_5'Flank	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	413	Cytoplasmic (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		AAAAATCACTCGCCCTTCTCA	0.507																0.393939	496.078689	500.303353	169	260	KEEP	---	---	---	---	80	106	140	137	-1	capture	Missense_Mutation	SNP	55341632	55341632	KIR3DL1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8242	168
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393																0.318182	19.617192	20.263649	7	15	KEEP	---	---	---	---	4	3	9	6	0.571428571429	capture	Missense_Mutation	SNP	58385546	58385546	ZNF814	19	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	18052	168
GTF2A1L	11036	broad.mit.edu	37	2	48960045	48960045	+	Missense_Mutation	SNP	G	C	C			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:48960045G>C	uc002rwt.2	+	9	1409	c.1343G>C	c.(1342-1344)AGG>ACG	p.R448T	LHCGR_uc002rwu.3_Intron|LHCGR_uc002rwv.2_Intron	NM_172196	NP_751946	Q9UNN4	TF2AY_HUMAN	general transcription factor IIA, 1-like isoform	Error:Variant_position_missing_in_Q9UNN4_after_alignment					regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	transcription factor TFIIA complex	DNA binding|transcription coactivator activity				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTCCCAAGAAGGACATCGTTT	0.249																0.017301	-64.901411	11.129653	5	284	KEEP	---	---	---	---	3	6	178	196	-1	capture	Missense_Mutation	SNP	48960045	48960045	GTF2A1L	2	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	6783	168
DPP10	57628	broad.mit.edu	37	2	116548904	116548904	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:116548904C>T	uc002tla.1	+	19	2129	c.1672C>T	c.(1672-1674)CGA>TGA	p.R558*	DPP10_uc002tlb.1_Nonsense_Mutation_p.R508*|DPP10_uc002tlc.1_Nonsense_Mutation_p.R554*|DPP10_uc002tle.2_Nonsense_Mutation_p.R562*|DPP10_uc002tlf.1_Nonsense_Mutation_p.R551*	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	558	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TTTTATGGACCGAAACCAGTA	0.289																0.326389	143.278205	147.126922	47	97	KEEP	---	---	---	---	18	42	56	72	-1	capture	Nonsense_Mutation	SNP	116548904	116548904	DPP10	2	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	4682	168
NCL	4691	broad.mit.edu	37	2	232325239	232325239	+	Missense_Mutation	SNP	T	C	C			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:232325239T>C	uc002vru.2	-	5	989	c.848A>G	c.(847-849)GAA>GGA	p.E283G	SNORD82_uc010fxw.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin	283					angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		TTTGGCCATTTCCTTCTTTCG	0.433																0.382514	458.287036	462.724662	140	226	KEEP	---	---	---	---	64	89	107	143	-1	capture	Missense_Mutation	SNP	232325239	232325239	NCL	2	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	10133	168
TOP1	7150	broad.mit.edu	37	20	39726941	39726941	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:39726941G>A	uc002xjl.2	+	11	1185	c.939G>A	c.(937-939)ACG>ACA	p.T313T		NM_003286	NP_003277	P11387	TOP1_HUMAN	DNA topoisomerase I	313					DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding			breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)	AAGCCCAGACGGAAGCTCGGA	0.368					252	T	NUP98	AML*								0.021053	-41.769872	6.995841	4	186	KEEP	---	---	---	---	2	2	91	120	-1	capture	Silent	SNP	39726941	39726941	TOP1	20	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	16246	168
SLC12A5	57468	broad.mit.edu	37	20	44665416	44665416	+	Missense_Mutation	SNP	A	G	G			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44665416A>G	uc010zxl.1	+	5	608	c.532A>G	c.(532-534)ACG>GCG	p.T178A	SLC12A5_uc002xra.2_Missense_Mutation_p.T155A|SLC12A5_uc010zxm.1_RNA|SLC12A5_uc002xrb.2_Missense_Mutation_p.T155A	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	178	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	TGCAATTGCAACGAATGGTGT	0.612																0.382812	174.370106	175.902276	49	79	KEEP	---	---	---	---	29	34	41	62	-1	capture	Missense_Mutation	SNP	44665416	44665416	SLC12A5	20	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	14279	168
TFF2	7032	broad.mit.edu	37	21	43767708	43767708	+	Missense_Mutation	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43767708C>T	uc002zaw.2	-	3	405	c.263G>A	c.(262-264)CGA>CAA	p.R88Q		NM_005423	NP_005414	Q03403	TFF2_HUMAN	trefoil factor 2 precursor	88	P-type 2.				digestion	extracellular region				pancreas(1)	1						ACAGTTTCTTCGGTCTGAGAC	0.602																0.463768	97.49097	97.570003	32	37	KEEP	---	---	---	---	23	22	23	31	-1	capture	Missense_Mutation	SNP	43767708	43767708	TFF2	21	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15689	168
KRTAP10-2	386679	broad.mit.edu	37	21	45970888	45970888	+	Missense_Mutation	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45970888C>T	uc002zfi.1	-	1	501	c.454G>A	c.(454-456)GTG>ATG	p.V152M	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198693	NP_941966	P60368	KR102_HUMAN	keratin associated protein 10-2	152	13.|22 X 5 AA repeats of C-C-X(3).					keratin filament				large_intestine(1)	1						CAGGTGGGCACGCAGCACACA	0.617																0.426667	188.178529	188.880105	64	86	KEEP	---	---	---	---	36	35	59	42	-1	capture	Missense_Mutation	SNP	45970888	45970888	KRTAP10-2	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8429	168
KRTAP10-7	386675	broad.mit.edu	37	21	46021573	46021573	+	Missense_Mutation	SNP	T	G	G			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46021573T>G	uc002zfn.3	+	2	1062	c.1037T>G	c.(1036-1038)GTG>GGG	p.V346G	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198689	NP_941962	P60409	KR107_HUMAN	keratin associated protein 10-7	351	30 X 5 AA repeats of C-C-X(3).					keratin filament					0						GCCTCCTGTGTGTCTCTCCTT	0.672																0.447761	101.935118	102.094467	30	37	KEEP	---	---	---	---	18	18	29	21	-1	capture	Missense_Mutation	SNP	46021573	46021573	KRTAP10-7	21	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	8434	168
CDC42EP1	11135	broad.mit.edu	37	22	37964570	37964570	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37964570G>A	uc003asz.3	+	3	1322	c.919G>A	c.(919-921)GGG>AGG	p.G307R		NM_152243	NP_689449	Q00587	BORG5_HUMAN	CDC42 effector protein 1	307					positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|endomembrane system|Golgi apparatus|plasma membrane	protein binding				0	Melanoma(58;0.0574)					CCCAGTGGGAGGGGGTCCCCG	0.692																0.444444	26.79806	26.846422	8	10	KEEP	---	---	---	---	3	7	4	6	-1	capture	Missense_Mutation	SNP	37964570	37964570	CDC42EP1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	3046	168
SUSD5	26032	broad.mit.edu	37	3	33194586	33194586	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:33194586G>A	uc003cfo.1	-	5	1956	c.1538C>T	c.(1537-1539)ACG>ATG	p.T513M		NM_015551	NP_056366	O60279	SUSD5_HUMAN	sushi domain containing 5 precursor	513	Extracellular (Potential).				cell adhesion	integral to membrane	hyaluronic acid binding			ovary(1)|central_nervous_system(1)	2						TGCCATGATCGTTGAGGGGAT	0.522																0.423077	61.614577	61.887821	22	30	KEEP	---	---	---	---	13	10	17	19	-1	capture	Missense_Mutation	SNP	33194586	33194586	SUSD5	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15299	168
VILL	50853	broad.mit.edu	37	3	38048114	38048114	+	Missense_Mutation	SNP	G	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38048114G>T	uc003chj.2	+	19	2666	c.2380G>T	c.(2380-2382)GGG>TGG	p.G794W	VILL_uc003chl.2_Missense_Mutation_p.G794W	NM_015873	NP_056957	O15195	VILL_HUMAN	villin-like protein	794	HP.				actin filament capping|cytoskeleton organization	actin cytoskeleton	actin binding|structural constituent of cytoskeleton				0				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		CACGATCAACGGGGGCCTGCG	0.672																0.068966	-1.713831	9.392227	4	54	KEEP	---	---	---	---	2	2	35	39	0.5	capture	Missense_Mutation	SNP	38048114	38048114	VILL	3	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	17047	168
SHISA5	51246	broad.mit.edu	37	3	48510545	48510545	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48510545G>A	uc003ctp.1	-	6	818	c.684C>T	c.(682-684)TAC>TAT	p.Y228Y	SHISA5_uc003ctn.1_Nonsense_Mutation_p.Q97*|SHISA5_uc003ctm.1_Silent_p.Y125Y|SHISA5_uc011bbk.1_Nonsense_Mutation_p.Q137*|SHISA5_uc003cto.1_Silent_p.Y197Y|SHISA5_uc003ctq.1_Silent_p.Y221Y|SHISA5_uc003ctr.1_Silent_p.Y197Y|SHISA5_uc003cts.1_Silent_p.Y197Y|SHISA5_uc003ctt.2_3'UTR|SHISA5_uc003ctu.1_RNA|SHISA5_uc011bbl.1_Silent_p.Y126Y	NM_016479	NP_057563	Q8N114	SHSA5_HUMAN	scotin precursor	228	Cytoplasmic (Potential).|Pro-rich.				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	signal transducer activity|WW domain binding				0						AGGCCGGGTTGTAAGGAGGCT	0.637																0.458904	194.208823	194.423261	67	79	KEEP	---	---	---	---	36	46	43	63	-1	capture	Silent	SNP	48510545	48510545	SHISA5	3	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	14176	168
POC1A	25886	broad.mit.edu	37	3	52156395	52156395	+	Silent	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52156395C>T	uc003dcu.2	-	9	1299	c.981G>A	c.(979-981)CTG>CTA	p.L327L	POC1A_uc003dcv.2_Silent_p.L289L|POC1A_uc003dcw.2_Silent_p.L327L	NM_015426	NP_056241	Q8NBT0	POC1A_HUMAN	WD repeat domain 51A isoform 1	327						centriole|microtubule basal body					0						AGCCACTTACCAGATTCCCCA	0.547																0.036145	-12.635882	6.729546	3	80	KEEP	---	---	---	---	2	1	59	68	-1	capture	Silent	SNP	52156395	52156395	POC1A	3	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	12078	168
EPHA6	285220	broad.mit.edu	37	3	97124120	97124120	+	Splice_Site	SNP	T	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97124120T>A	uc010how.1	+	6	1774	c.1731_splice	c.e6+2	p.K577_splice		NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						TATGAGAAAGTAGGTCTTATT	0.353					480											0.361111	36.96589	37.57673	13	23	KEEP	---	---	---	---	10	6	16	10	-1	capture	Splice_Site	SNP	97124120	97124120	EPHA6	3	T	A	A	A	1	0	0	0	0	0	0	1	0	741	57	5	4	5126	168
IMPG2	50939	broad.mit.edu	37	3	100964883	100964883	+	Missense_Mutation	SNP	C	G	G			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:100964883C>G	uc003duq.1	-	12	1509	c.1306G>C	c.(1306-1308)GAT>CAT	p.D436H	IMPG2_uc011bhe.1_Missense_Mutation_p.D299H	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	436	Extracellular (Potential).				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						GAGCTGAAATCAAGTGGTGGA	0.468																0.388571	235.56304	237.466216	68	107	KEEP	---	---	---	---	45	35	49	69	-1	capture	Missense_Mutation	SNP	100964883	100964883	IMPG2	3	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	7652	168
CASR	846	broad.mit.edu	37	3	122003194	122003194	+	Missense_Mutation	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122003194C>T	uc003eev.3	+	7	2765	c.2393C>T	c.(2392-2394)CCG>CTG	p.P798L	CASR_uc003eew.3_Missense_Mutation_p.P808L	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	798	Cytoplasmic (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CGGAAGCTGCCGGAGAACTTC	0.552																0.04717	-13.618713	9.549505	5	101	KEEP	---	---	---	---	1	5	52	51	-1	capture	Missense_Mutation	SNP	122003194	122003194	CASR	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2658	168
PLXNA1	5361	broad.mit.edu	37	3	126708342	126708342	+	Silent	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126708342C>T	uc003ejg.2	+	1	841	c.837C>T	c.(835-837)TGC>TGT	p.C279C		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	302	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		CCATTGGCTGCGAGCAGGCGG	0.662																0.371875	327.039103	331.653145	119	201	KEEP	---	---	---	---	108	78	175	150	-1	capture	Silent	SNP	126708342	126708342	PLXNA1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	12022	168
THPO	7066	broad.mit.edu	37	3	184090840	184090840	+	Missense_Mutation	SNP	G	A	A	rs144953270		TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184090840G>A	uc003fol.1	-	6	738	c.523C>T	c.(523-525)CGG>TGG	p.R175W	THPO_uc003fom.1_Missense_Mutation_p.R171W|THPO_uc003fon.2_Intron|THPO_uc011bro.1_Intron|THPO_uc003fop.2_Intron|THPO_uc011brp.1_Intron|THPO_uc011brq.1_Intron|THPO_uc003for.1_Intron|THPO_uc003fos.1_Intron	NM_000460	NP_000451	P40225	TPO_HUMAN	thrombopoietin precursor	175					cell proliferation|platelet activation	extracellular space	cytokine activity|growth factor activity|hormone activity			ovary(1)	1	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGTGGGGCCCGCCTGACGCAG	0.562																0.329897	156.90956	161.897855	64	130	KEEP	---	---	---	---	42	35	73	88	-1	capture	Missense_Mutation	SNP	184090840	184090840	THPO	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15757	168
PLEKHG4B	153478	broad.mit.edu	37	5	163559	163559	+	Silent	SNP	G	A	A	rs114260538	byFrequency;by1000genomes	TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:163559G>A	uc003jak.2	+	11	2354	c.2304G>A	c.(2302-2304)CCG>CCA	p.P768P		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	768					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AGAAGCTCCCGCTGTGGCAGC	0.652																0.375	73.802121	74.791624	27	45	KEEP	---	---	---	---	37	29	58	47	-1	capture	Silent	SNP	163559	163559	PLEKHG4B	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11975	168
MAST4	375449	broad.mit.edu	37	5	65892596	65892596	+	Missense_Mutation	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:65892596C>T	uc003jur.3	+	1	421	c.113C>T	c.(112-114)TCG>TTG	p.S38L	MAST4_uc010iwz.2_Missense_Mutation_p.S38L	NM_198828	NP_942123	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	38						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		GGTGCTTCCTCGGCCGAGTCC	0.731					805											0.133333	4.541235	6.496804	2	13	KEEP	---	---	---	---	0	2	11	9	-1	capture	Missense_Mutation	SNP	65892596	65892596	MAST4	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9240	168
TAF9	6880	broad.mit.edu	37	5	68647987	68647987	+	Silent	SNP	G	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:68647987G>T	uc003jwa.2	-	5	512	c.420C>A	c.(418-420)ATC>ATA	p.I140I	TAF9_uc003jwb.2_Silent_p.I137I	NM_016283	NP_057367	Q16594	TAF9_HUMAN	TAF9 RNA polymerase II, TATA box binding	Error:Variant_position_missing_in_Q16594_after_alignment					histone H3 acetylation|negative regulation of apoptosis|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of cell growth|positive regulation of response to cytokine stimulus|positive regulation of transcription from RNA polymerase II promoter|response to interleukin-1|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	MLL1 complex|PCAF complex|pre-snoRNP complex|STAGA complex|transcription factor TFIID complex|transcription factor TFTC complex	activating transcription factor binding|C2H2 zinc finger domain binding|p53 binding|transcription coactivator activity|transcription regulatory region DNA binding				0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.1e-56)|Epithelial(20;9.54e-53)|all cancers(19;2.2e-48)|Lung(70;0.0176)		GCTGATGCACGATTTCTTCCT	0.373																0.02521	-22.867919	6.856628	3	116	KEEP	---	---	---	---	2	2	71	76	0.5	capture	Silent	SNP	68647987	68647987	TAF9	5	G	T	T	T	1	0	0	0	0	0	0	0	1	473	37	4	4	15423	168
SEC24A	10802	broad.mit.edu	37	5	134033601	134033601	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:134033601G>A	uc003kzs.2	+	15	2408	c.2120G>A	c.(2119-2121)CGG>CAG	p.R707Q	SEC24A_uc011cxu.1_Missense_Mutation_p.R471Q	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A	707					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGTATTTCTCGGTATTCAGCA	0.383																0.029762	-62.748384	18.854109	10	326	KEEP	---	---	---	---	4	8	199	188	-1	capture	Missense_Mutation	SNP	134033601	134033601	SEC24A	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13887	168
SH3RF2	153769	broad.mit.edu	37	5	145435652	145435652	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:145435652G>A	uc003lnt.2	+	8	1669	c.1431G>A	c.(1429-1431)CGG>CGA	p.R477R	SH3RF2_uc011dbl.1_Silent_p.R477R|SH3RF2_uc011dbm.1_5'UTR|SH3RF2_uc003lnu.2_5'UTR|SH3RF2_uc011dbn.1_5'UTR	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	477							ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTGATCCACGGCAAAGCCGTC	0.562																0.014742	-100.414958	8.524522	6	401	KEEP	---	---	---	---	0	6	179	234	-1	capture	Silent	SNP	145435652	145435652	SH3RF2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	14152	168
TRIM41	90933	broad.mit.edu	37	5	180651777	180651777	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180651777G>A	uc003mne.1	+	1	1472	c.778G>A	c.(778-780)GTG>ATG	p.V260M	uc003mnb.1_Missense_Mutation_p.R39C|TRIM41_uc003mnc.1_Missense_Mutation_p.V260M|TRIM41_uc003mnd.1_Missense_Mutation_p.V260M|TRIM41_uc003mnf.1_RNA	NM_033549	NP_291027	Q8WV44	TRI41_HUMAN	tripartite motif-containing 41 isoform 1	260	B box-type.					cytoplasm|nucleus	ligase activity|protein binding|zinc ion binding				0	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACAGCACAGCGTGGTGCCATT	0.552																0.354331	129.042468	131.415894	45	82	KEEP	---	---	---	---	31	33	45	64	-1	capture	Missense_Mutation	SNP	180651777	180651777	TRIM41	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16399	168
MCM3	4172	broad.mit.edu	37	6	52141940	52141940	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:52141940G>A	uc003pan.1	-	8	1200	c.1090C>T	c.(1090-1092)CGA>TGA	p.R364*	MCM3_uc011dwu.1_Nonsense_Mutation_p.R318*	NM_002388	NP_002379	P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	364	MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	alpha DNA polymerase:primase complex|centrosome|MCM complex|perinuclear region of cytoplasm	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)|lung(1)|skin(1)	3	Lung NSC(77;0.0931)					GGGATAGCTCGGGGTGCAGTG	0.597																0.376471	95.459926	96.604227	32	53	KEEP	---	---	---	---	10	27	28	29	-1	capture	Nonsense_Mutation	SNP	52141940	52141940	MCM3	6	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	9300	168
BMP5	653	broad.mit.edu	37	6	55684540	55684540	+	Missense_Mutation	SNP	C	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55684540C>T	uc003pcq.2	-	2	1308	c.596G>A	c.(595-597)CGG>CAG	p.R199Q	BMP5_uc011dxf.1_Missense_Mutation_p.R199Q	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein	199					cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			CTTGTATATCCGGAATTCAGC	0.368																0.328571	67.490035	69.319759	23	47	KEEP	---	---	---	---	11	14	23	29	-1	capture	Missense_Mutation	SNP	55684540	55684540	BMP5	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1451	168
NOX3	50508	broad.mit.edu	37	6	155764472	155764472	+	Missense_Mutation	SNP	C	T	T	rs142034685		TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:155764472C>T	uc003qqm.2	-	5	524	c.421G>A	c.(421-423)GCA>ACA	p.A141T		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	141	Ferric oxidoreductase.|Extracellular (Potential).						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TTGGAAAGTGCGGCCAGAAGT	0.577																0.05	-6.422884	6.461699	3	57	KEEP	---	---	---	---	1	2	41	21	-1	capture	Missense_Mutation	SNP	155764472	155764472	NOX3	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10464	168
DTX2	113878	broad.mit.edu	37	7	76109950	76109950	+	Missense_Mutation	SNP	A	G	G			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:76109950A>G	uc003uff.3	+	4	680	c.124A>G	c.(124-126)ATC>GTC	p.I42V	DTX2_uc011kgk.1_Intron|DTX2_uc003ufg.3_Missense_Mutation_p.I42V|DTX2_uc003ufh.3_Missense_Mutation_p.I42V|DTX2_uc003ufj.3_Missense_Mutation_p.I42V	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN	deltex 2 isoform a	42	WWE 1.				Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding			ovary(1)|skin(1)	2						CTGCAGCTTCATCGAGCAGCA	0.662																0.020979	-30.294842	6.411315	3	140	KEEP	---	---	---	---	2	2	83	87	-1	capture	Missense_Mutation	SNP	76109950	76109950	DTX2	7	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	4749	168
CALCR	799	broad.mit.edu	37	7	93067382	93067382	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93067382G>A	uc003umv.1	-	12	1283	c.1022C>T	c.(1021-1023)GCG>GTG	p.A341V	CALCR_uc011kia.1_Missense_Mutation_p.A121V|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.A307V|CALCR_uc003umw.2_Missense_Mutation_p.A307V	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	323	Helical; Name=5; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	CACAAGTGCCGCCATGACAGG	0.348																0.260274	95.989691	103.582021	38	108	KEEP	---	---	---	---	17	27	65	68	-1	capture	Missense_Mutation	SNP	93067382	93067382	CALCR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2555	168
LAMB1	3912	broad.mit.edu	37	7	107600245	107600245	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107600245G>A	uc003vew.2	-	19	2684	c.2349C>T	c.(2347-2349)TCC>TCT	p.S783S	LAMB1_uc003vev.2_Silent_p.S807S|LAMB1_uc003vex.2_Silent_p.S783S	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	783	Laminin EGF-like 6.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GATCACACACGGAACTTAACG	0.572																0.241379	37.820679	41.359371	14	44	KEEP	---	---	---	---	10	7	20	28	-1	capture	Silent	SNP	107600245	107600245	LAMB1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8530	168
TRYX3	136541	broad.mit.edu	37	7	141955123	141955123	+	Missense_Mutation	SNP	C	T	T	rs138718517		TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141955123C>T	uc003vxb.2	-	3	508	c.188G>A	c.(187-189)CGG>CAG	p.R63Q	TRYX3_uc003vxc.3_Missense_Mutation_p.R63Q	NM_001001317	NP_001001317	Q8IYP2	PRS58_HUMAN	trypsin X3 precursor	63	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0	Melanoma(164;0.0272)					CAATATCACCCGAAGCTTTCT	0.428																0.201474	203.520024	237.225732	82	325	KEEP	---	---	---	---	48	56	193	203	-1	capture	Missense_Mutation	SNP	141955123	141955123	TRYX3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16487	168
ADAMDEC1	27299	broad.mit.edu	37	8	24251644	24251644	+	Missense_Mutation	SNP	C	G	G			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24251644C>G	uc003xdz.2	+	4	567	c.347C>G	c.(346-348)ACG>AGG	p.T116R	ADAMDEC1_uc010lub.2_Missense_Mutation_p.T37R|ADAMDEC1_uc011lab.1_Missense_Mutation_p.T37R	NM_014479	NP_055294	O15204	ADEC1_HUMAN	ADAM-like, decysin 1 isoform 1	116					integrin-mediated signaling pathway|negative regulation of cell adhesion|proteolysis	extracellular region|integral to membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)	2		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		GAAATTACCACGAAACCTGAG	0.463	Ovarian(147;687 1849 3699 25981 31337)															0.395062	113.583108	114.363678	32	49	KEEP	---	---	---	---	18	18	22	34	-1	capture	Missense_Mutation	SNP	24251644	24251644	ADAMDEC1	8	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	254	168
FZD3	7976	broad.mit.edu	37	8	28385048	28385048	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:28385048G>A	uc003xgx.2	+	5	1249	c.771G>A	c.(769-771)TTG>TTA	p.L257L	FZD3_uc010lvb.2_Silent_p.L257L	NM_017412	NP_059108	Q9NPG1	FZD3_HUMAN	frizzled 3 precursor	257	Helical; Name=2; (Potential).				canonical Wnt receptor signaling pathway|cell proliferation in midbrain|commissural neuron axon guidance|establishment of planar polarity|facial nucleus development|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|neural tube closure|vasculature development	apical part of cell|axon|cytoplasm|dendrite|integral to membrane|neuron projection membrane|neuronal cell body|presynaptic active zone	G-protein coupled receptor activity|PDZ domain binding|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		TTGGATTTTTGCTTGAAGATC	0.378																0.367589	245.743537	249.627449	93	160	KEEP	---	---	---	---	55	52	95	97	-1	capture	Silent	SNP	28385048	28385048	FZD3	8	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	6073	168
GPR124	25960	broad.mit.edu	37	8	37693258	37693258	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:37693258G>A	uc003xkj.2	+	13	2383	c.2020G>A	c.(2020-2022)GTG>ATG	p.V674M	GPR124_uc010lvy.2_Intron	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124 precursor	674	Extracellular (Potential).				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GAGGCGTGGCGTGGCCACCCC	0.652																0.470085	156.83515	156.923557	55	62	KEEP	---	---	---	---	23	36	26	45	-1	capture	Missense_Mutation	SNP	37693258	37693258	GPR124	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6572	168
C8orf84	157869	broad.mit.edu	37	8	73993342	73993342	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:73993342G>A	uc003xzf.2	-	2	526	c.321C>T	c.(319-321)AAC>AAT	p.N107N		NM_153225	NP_694957	Q8IVN8	RPESP_HUMAN	RPE-spondin precursor	107	TSP type-1.				immune response	extracellular region	polysaccharide binding|scavenger receptor activity				0						GCGCCCCGCCGTTCTGAGGCT	0.657																0.42953	177.711829	178.346635	64	85	KEEP	---	---	---	---	58	62	83	95	-1	capture	Silent	SNP	73993342	73993342	C8orf84	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	2417	168
VPS13B	157680	broad.mit.edu	37	8	100874087	100874087	+	Silent	SNP	C	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:100874087C>A	uc003yiv.2	+	58	11314	c.11203C>A	c.(11203-11205)CGG>AGG	p.R3735R	VPS13B_uc003yiw.2_Silent_p.R3710R	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3735					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GCACTACAACCGGCAGGAGGA	0.657	Colon(161;2205 2542 7338 31318)				1116											0.166667	5.443564	6.706547	2	10	KEEP	---	---	---	---	2	0	11	9	-1	capture	Silent	SNP	100874087	100874087	VPS13B	8	C	A	A	A	1	0	0	0	0	0	0	0	1	295	23	4	4	17072	168
PKHD1L1	93035	broad.mit.edu	37	8	110463211	110463211	+	Silent	SNP	A	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110463211A>T	uc003yne.2	+	41	6287	c.6183A>T	c.(6181-6183)GGA>GGT	p.G2061G		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2061	Extracellular (Potential).|IPT/TIG 13.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TAGGCACGGGAGCTGAGCAAG	0.458													HNSCC(38;0.096)	OREG0018931	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.465753	99.341053	99.415643	34	39	KEEP	---	---	---	---	22	16	20	24	-1	capture	Silent	SNP	110463211	110463211	PKHD1L1	8	A	T	T	T	1	0	0	0	0	0	0	0	1	132	11	4	4	11875	168
FLJ46321	389763	broad.mit.edu	37	9	84609453	84609453	+	Silent	SNP	C	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:84609453C>A	uc004amn.2	+	4	4115	c.4068C>A	c.(4066-4068)ACC>ACA	p.T1356T		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	1356						integral to membrane					0						GGATGAAGACCTCTTTGCAGT	0.433																0.458333	33.821909	33.858286	11	13	KEEP	---	---	---	---	3	10	5	11	0.769230769231	capture	Silent	SNP	84609453	84609453	FLJ46321	9	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	5876	168
ST6GALNAC6	30815	broad.mit.edu	37	9	130653179	130653179	+	Silent	SNP	C	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130653179C>A	uc004bso.1	-	5	560	c.441G>T	c.(439-441)GTG>GTT	p.V147V	ST6GALNAC6_uc004bsn.1_Silent_p.V113V|ST6GALNAC6_uc011man.1_Intron|ST6GALNAC6_uc004bsp.1_Silent_p.V147V|ST6GALNAC6_uc004bsq.1_Silent_p.V113V|ST6GALNAC6_uc004bsr.2_Silent_p.V113V|ST6GALNAC6_uc010mxp.1_RNA	NM_013443	NP_038471	Q969X2	SIA7F_HUMAN	sialytransferase 7F	147	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane|plasma membrane					0						TCTTGTTGCCCACATCAGCTG	0.607																0.059701	-5.337235	8.234287	4	63	KEEP	---	---	---	---	3	3	44	33	0.5	capture	Silent	SNP	130653179	130653179	ST6GALNAC6	9	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	15118	168
ZMYM3	9203	broad.mit.edu	37	X	70466243	70466243	+	Silent	SNP	G	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70466243G>T	uc004dzh.1	-	15	2619	c.2532C>A	c.(2530-2532)GTC>GTA	p.V844V	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Silent_p.V844V|ZMYM3_uc004dzj.1_Silent_p.V832V	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	844					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					CCTTGCAGGAGACGCCCCGAT	0.597																0.401575	140.988002	142.066856	51	76	KEEP	---	---	---	---	29	39	57	39	0.426470588235	capture	Silent	SNP	70466243	70466243	ZMYM3	23	G	T	T	T	1	0	0	0	0	0	0	0	1	418	33	4	4	17581	168
ERCC6L	54821	broad.mit.edu	37	X	71428507	71428507	+	Missense_Mutation	SNP	A	T	T			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:71428507A>T	uc004eaq.1	-	2	207	c.110T>A	c.(109-111)CTG>CAG	p.L37Q	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_5'UTR	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	37	TPR 1.				cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)					TGCTTCTTCCAGGTCTCCATT	0.363																0.285714	81.40313	85.732043	30	75	KEEP	---	---	---	---	14	18	30	56	-1	capture	Missense_Mutation	SNP	71428507	71428507	ERCC6L	23	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	5173	168
SLC6A14	11254	broad.mit.edu	37	X	115590033	115590033	+	Missense_Mutation	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:115590033G>A	uc004eqi.2	+	14	1945	c.1841G>A	c.(1840-1842)CGT>CAT	p.R614H		NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid	614	Cytoplasmic (Potential).				cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)	GAACAACATCGTGGGGAAAGA	0.403																0.427326	447.307892	448.883256	147	197	KEEP	---	---	---	---	87	80	121	113	-1	capture	Missense_Mutation	SNP	115590033	115590033	SLC6A14	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14569	168
ZNF280C	55609	broad.mit.edu	37	X	129339341	129339341	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129339341G>A	uc004evm.2	-	17	2245	c.2091C>T	c.(2089-2091)TCC>TCT	p.S697S		NM_017666	NP_060136	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	697					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)	3						GATCTAAGCCGGAAGAATCAG	0.323																0.026316	-21.777297	6.509662	3	111	KEEP	---	---	---	---	3	1	61	74	-1	capture	Silent	SNP	129339341	129339341	ZNF280C	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17696	168
F9	2158	broad.mit.edu	37	X	138643870	138643870	+	Silent	SNP	G	A	A			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138643870G>A	uc004fas.1	+	8	1055	c.1026G>A	c.(1024-1026)ACG>ACA	p.T342T	F9_uc004fat.1_Silent_p.T304T	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein	342	Peptidase S1.		T -> K (in HEMB; mild).|T -> M (in HEMB; moderate).		blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)	AGGAATACACGAACATCTTCC	0.433																0.367953	359.007759	364.17475	124	213	KEEP	---	---	---	---	62	80	109	132	-1	capture	Silent	SNP	138643870	138643870	F9	23	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	5305	168
MYH6	4624	broad.mit.edu	37	14	23861788	23861789	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23861788_23861789delTC	uc001wjv.2	-	25	3391_3392	c.3324_3325delGA	c.(3322-3327)AAGAAAfs	p.K1108fs		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1108_1109	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TCCTTCAGTTTCTTCTGTAGTT	0.505																0.40			254	383		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	23861788	23861789	MYH6	14	TC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	9948	168
KLC3	147700	broad.mit.edu	37	19	45849928	45849929	+	Frame_Shift_Ins	INS	-	G	G	rs141629020	by1000genomes	TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45849928_45849929insG	uc002pbf.1	+	3	500_501	c.385_386insG	c.(385-387)CGGfs	p.R129fs	KLC3_uc002pbe.2_Frame_Shift_Ins_p.R129fs|KLC3_uc010ejy.1_Frame_Shift_Ins_p.R129fs|KLC3_uc002pbg.1_Frame_Shift_Ins_p.R143fs	NM_177417	NP_803136	Q6P597	KLC3_HUMAN	kinesin light chain 3	129	Potential.					cytoplasm|kinesin complex|microtubule	microtubule motor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GACGCAGCGGCGGCTTCGGGCC	0.713					4											0.38			3	5		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	45849928	45849929	KLC3	19	-	G	G	G	1	0	1	1	0	0	0	0	0	347	27	5	5	8256	168
DEFB131	644414	broad.mit.edu	37	4	9452176	9452176	+	Frame_Shift_Del	DEL	G	-	-			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:9452176delG	uc011bwt.1	+	2	149	c.149delG	c.(148-150)TGTfs	p.C50fs		NM_001040448	NP_001035538	P59861	DB131_HUMAN	defensin, beta 131 precursor	50					defense response to bacterium	extracellular region					0						ATTAGATACTGTGCTGACTTC	0.383																0.37			29	49		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	9452176	9452176	DEFB131	4	G	-	-	-	1	0	1	0	1	0	0	0	0	624	48	5	5	4374	168
SLCO6A1	133482	broad.mit.edu	37	5	101794118	101794138	+	In_Frame_Del	DEL	TTCCAAGTTTCAGATCTTTAA	-	-			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101794118_101794138delTTCCAAGTTTCAGATCTTTAA	uc003knn.2	-	6	1251_1271	c.1079_1099delTTAAAGATCTGAAACTTGGAA	c.(1078-1101)CTTAAAGATCTGAAACTTGGAACT>CCT	p.360_367LKDLKLGT>P	SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.2_In_Frame_Del_p.360_367LKDLKLGT>P|SLCO6A1_uc003knq.2_In_Frame_Del_p.298_305LKDLKLGT>P	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	360_367	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TTGATATTAGTTCCAAGTTTCAGATCTTTAAGTCTGCTGTC	0.285																0.19			34	147		---	---	---	---						capture_indel	In_Frame_Del	DEL	101794118	101794138	SLCO6A1	5	TTCCAAGTTTCAGATCTTTAA	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	14624	168
PODXL	5420	broad.mit.edu	37	7	131195806	131195807	+	Frame_Shift_Ins	INS	-	G	G			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131195806_131195807insG	uc003vqw.3	-	2	744_745	c.486_487insC	c.(484-489)AGCAGCfs	p.S162fs	PODXL_uc003vqx.3_Frame_Shift_Ins_p.S162fs	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor	162_163	Thr-rich.|Extracellular (Potential).				cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)					ACACTGTGGCTGCTTTTCCCCC	0.535																0.01			7	896		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	131195806	131195807	PODXL	7	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	12083	168
F8	2157	broad.mit.edu	37	X	154194774	154194774	+	Frame_Shift_Del	DEL	T	-	-			TCGA-19-4068-01	TCGA-19-4068-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154194774delT	uc004fmt.2	-	8	1369	c.1198delA	c.(1198-1200)ACTfs	p.T400fs		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	400	F5/8 type A 2.|Plastocyanin-like 3.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TGTACCCAAGTTTTAGGATGC	0.448					359											0.37			62	105		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	154194774	154194774	F8	23	T	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	5304	168
