Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ZNF642	339559	broad.mit.edu	37	1	40960711	40960711	+	Silent	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40960711G>A	uc001cfo.2	+	6	855	c.561G>A	c.(559-561)ACG>ACA	p.T187T	ZNF642_uc009vwb.2_Silent_p.T187T|ZNF642_uc010ojk.1_Silent_p.T188T	NM_198494	NP_940896	Q49AA0	ZN642_HUMAN	zinc finger protein 642	187					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.81e-19)			TTTATTCCACGTTGAGAAAAG	0.398																0.368421	120.923143	122.656655	42	72	KEEP	---	---	---	---	24	21	39	40	-1	capture	Silent	SNP	40960711	40960711	ZNF642	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	17936	176
PRKG1	5592	broad.mit.edu	37	10	54053584	54053584	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:54053584G>A	uc001jjm.2	+	18	2134	c.1940G>A	c.(1939-1941)AGT>AAT	p.S647N	PRKG1_uc001jjo.2_Missense_Mutation_p.S662N|PRKG1_uc009xow.1_Missense_Mutation_p.S365N|uc001jjq.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform	647	AGC-kinase C-terminal.				actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity	p.L647L(1)		lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		ACAGACACAAGTAATTTTGAC	0.388					1247											0.336735	101.043616	103.354919	33	65	KEEP	---	---	---	---	18	23	34	40	-1	capture	Missense_Mutation	SNP	54053584	54053584	PRKG1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	12418	176
RRP12	23223	broad.mit.edu	37	10	99130292	99130292	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:99130292G>A	uc001knf.2	-	23	2748	c.2609C>T	c.(2608-2610)TCG>TTG	p.S870L	RRP12_uc009xvl.2_5'UTR|RRP12_uc009xvm.2_Missense_Mutation_p.S588L|RRP12_uc010qou.1_Missense_Mutation_p.S809L|RRP12_uc009xvn.2_Missense_Mutation_p.S770L	NM_015179	NP_055994	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog isoform 1	870						integral to membrane|nuclear membrane|nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		TGCGCCCACCGACACCTCCTT	0.612																0.107143	3.005443	7.292401	3	25	KEEP	---	---	---	---	2	1	12	18	-1	capture	Missense_Mutation	SNP	99130292	99130292	RRP12	10	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13578	176
RIC8A	60626	broad.mit.edu	37	11	209871	209871	+	Silent	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:209871G>A	uc001log.2	+	3	922	c.597G>A	c.(595-597)ACG>ACA	p.T199T	BET1L_uc001loe.2_5'Flank|BET1L_uc001lod.2_5'Flank|RIC8A_uc001lof.2_Silent_p.T199T|RIC8A_uc001loh.2_Silent_p.T192T	NM_021932	NP_068751	Q9NPQ8	RIC8A_HUMAN	resistance to inhibitors of cholinesterase 8	199						cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity				0		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		TGGAGCTGACGCTGGGGGTGA	0.602																0.323529	58.831012	60.708937	22	46	KEEP	---	---	---	---	11	11	22	29	-1	capture	Silent	SNP	209871	209871	RIC8A	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13247	176
OR52A4	390053	broad.mit.edu	37	11	5142008	5142008	+	Silent	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5142008C>T	uc001lzz.1	-	1	801	c.801G>A	c.(799-801)TCG>TCA	p.S267S		NM_001005222	NP_001005222			olfactory receptor, family 52, subfamily A,											ovary(2)	2		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		TCCAAATCTGCGAGTAAAAAA	0.368																0.278351	71.488287	75.77243	27	70	KEEP	---	---	---	---	14	18	30	52	-1	capture	Silent	SNP	5142008	5142008	OR52A4	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11013	176
MMP3	4314	broad.mit.edu	37	11	102709358	102709358	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102709358C>T	uc001phj.1	-	8	1218	c.1153G>A	c.(1153-1155)GTG>ATG	p.V385M		NM_002422	NP_002413	P08254	MMP3_HUMAN	matrix metalloproteinase 3 preproprotein	385					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			lung(1)|kidney(1)	2		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)|Simvastatin(DB00641)	ATTTTCCTCACGGTTGGAGGG	0.403																0.385321	124.775512	126.013464	42	67	KEEP	---	---	---	---	20	23	35	38	-1	capture	Missense_Mutation	SNP	102709358	102709358	MMP3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9578	176
SCN2B	6327	broad.mit.edu	37	11	118037799	118037799	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118037799G>T	uc001psf.2	-	4	642	c.451C>A	c.(451-453)CCC>ACC	p.P151T		NM_004588	NP_004579	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta	151	Ig-like C2-type.|Extracellular (Potential).				synaptic transmission	voltage-gated sodium channel complex	voltage-gated sodium channel activity				0	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)		CGCTCAGGGGGCTCTGGAAAG	0.627																0.395349	47.558102	47.972423	17	26	KEEP	---	---	---	---	6	11	10	18	0.352941176471	capture	Missense_Mutation	SNP	118037799	118037799	SCN2B	11	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	13810	176
PIWIL1	9271	broad.mit.edu	37	12	130833883	130833883	+	Silent	SNP	T	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130833883T>A	uc001uik.2	+	8	924	c.834T>A	c.(832-834)ACT>ACA	p.T278T	PIWIL1_uc001uij.1_Silent_p.T278T	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	278	PAZ.				gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		GAAGTGAGACTGTTTTGGATT	0.383																0.352941	54.03454	55.007251	18	33	KEEP	---	---	---	---	3	15	17	16	-1	capture	Silent	SNP	130833883	130833883	PIWIL1	12	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	11860	176
IRS2	8660	broad.mit.edu	37	13	110436118	110436118	+	Silent	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:110436118C>T	uc001vqv.2	-	1	2797	c.2283G>A	c.(2281-2283)CTG>CTA	p.L761L		NM_003749	NP_003740	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	761					fibroblast growth factor receptor signaling pathway|glucose metabolic process|insulin receptor signaling pathway|lipid homeostasis|negative regulation of B cell apoptosis|negative regulation of kinase activity|negative regulation of plasma membrane long-chain fatty acid transport|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of B cell proliferation|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|response to glucose stimulus	cytosol|plasma membrane	insulin receptor binding|signal transducer activity			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|skin(1)|ovary(1)|kidney(1)	8	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			CCCCGTTGGGCAGCAGCTTGC	0.692	Melanoma(100;613 2409 40847)				156											0.333333	10.795496	11.090955	4	8	KEEP	---	---	---	---	2	3	4	5	-1	capture	Silent	SNP	110436118	110436118	IRS2	13	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	7764	176
NFATC4	4776	broad.mit.edu	37	14	24845826	24845826	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24845826C>T	uc001wpc.2	+	9	2704	c.2383C>T	c.(2383-2385)CGG>TGG	p.R795W	NFATC4_uc010tok.1_Missense_Mutation_p.R858W|NFATC4_uc010tol.1_Missense_Mutation_p.R858W|NFATC4_uc010alr.2_Intron|NFATC4_uc010tom.1_Missense_Mutation_p.R808W|NFATC4_uc010ton.1_Missense_Mutation_p.R808W|NFATC4_uc010too.1_Intron|NFATC4_uc010alt.2_Missense_Mutation_p.R827W|NFATC4_uc010top.1_Missense_Mutation_p.R827W|NFATC4_uc010toq.1_Intron|NFATC4_uc010tor.1_Intron|NFATC4_uc010tos.1_Missense_Mutation_p.R725W|NFATC4_uc010tot.1_Missense_Mutation_p.R783W|NFATC4_uc010tou.1_Missense_Mutation_p.R725W|NFATC4_uc010tov.1_Intron|NFATC4_uc010tow.1_Intron|NFATC4_uc010alv.2_Missense_Mutation_p.R783W|NFATC4_uc010tox.1_Missense_Mutation_p.R725W|NFATC4_uc001wpd.2_Missense_Mutation_p.R330W|NFATC4_uc010toy.1_Intron|NFATC4_uc010toz.1_Missense_Mutation_p.R330W|NFATC4_uc010tpa.1_Missense_Mutation_p.R83W|NFATC4_uc010tpb.1_Missense_Mutation_p.R83W	NM_004554	NP_004545	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells,	795	Pro-rich.				cell differentiation|inflammatory response|transcription from RNA polymerase II promoter	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(265;0.018)		GTATGGAGGGCGGGGCTCCTC	0.642																0.381818	108.682701	110.041863	42	68	KEEP	---	---	---	---	18	28	38	34	-1	capture	Missense_Mutation	SNP	24845826	24845826	NFATC4	14	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	10272	176
C14orf105	55195	broad.mit.edu	37	14	57949812	57949812	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:57949812G>A	uc001xcy.2	-	3	507	c.364C>T	c.(364-366)CGA>TGA	p.R122*	C14orf105_uc010trl.1_Nonsense_Mutation_p.R122*|C14orf105_uc010trm.1_Nonsense_Mutation_p.R34*|C14orf105_uc010trn.1_Nonsense_Mutation_p.R34*|C14orf105_uc001xcz.2_Nonsense_Mutation_p.R122*|C14orf105_uc010aox.1_RNA|C14orf105_uc010aoy.1_Nonsense_Mutation_p.R44*	NM_018168	NP_060638	Q9NVL8	CN105_HUMAN	hypothetical protein LOC55195	122											0						CTGGCTTCTCGCTGGCTCAGG	0.522																0.046154	-7.882439	6.357454	3	62	KEEP	---	---	---	---	2	3	42	29	-1	capture	Nonsense_Mutation	SNP	57949812	57949812	C14orf105	14	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	1723	176
ATP10A	57194	broad.mit.edu	37	15	25924506	25924506	+	Silent	SNP	A	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:25924506A>T	uc010ayu.2	-	21	4588	c.4482T>A	c.(4480-4482)TCT>TCA	p.S1494S		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1494	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		ACCGCCTTGAAGATGCTCCTA	0.408					877											0.325301	74.593145	76.84251	27	56	KEEP	---	---	---	---	16	16	38	30	-1	capture	Silent	SNP	25924506	25924506	ATP10A	15	A	T	T	T	1	0	0	0	0	0	0	0	1	28	3	4	4	1107	176
CACNA1H	8912	broad.mit.edu	37	16	1259347	1259347	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1259347G>A	uc002cks.2	+	17	3927	c.3679G>A	c.(3679-3681)GAC>AAC	p.D1227N	CACNA1H_uc002ckt.2_Missense_Mutation_p.D1227N|CACNA1H_uc002cku.2_5'Flank|CACNA1H_uc010brj.2_5'Flank|CACNA1H_uc002ckv.2_5'Flank	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,	1227	Cytoplasmic (Potential).				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)	CCTGCCCAGCGACTTCTTCCT	0.736																0.136364	8.625314	14.257263	6	38	KEEP	---	---	---	---	6	1	16	28	-1	capture	Missense_Mutation	SNP	1259347	1259347	CACNA1H	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2521	176
CORO7	79585	broad.mit.edu	37	16	4409376	4409376	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4409376C>T	uc002cwh.3	-	23	2381	c.2261G>A	c.(2260-2262)CGT>CAT	p.R754H	CORO7_uc002cwe.2_RNA|CORO7_uc002cwf.2_Missense_Mutation_p.R754H|CORO7_uc002cwg.3_Missense_Mutation_p.R534H|CORO7_uc010uxh.1_Missense_Mutation_p.R736H|CORO7_uc010uxi.1_Missense_Mutation_p.R669H|CORO7_uc002cwi.1_Missense_Mutation_p.R534H	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7	754	WD 8.					cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						CAGGAATACACGGGTGTCGCC	0.667														OREG0023580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.371429	36.366978	36.874798	13	22	KEEP	---	---	---	---	4	11	8	15	-1	capture	Missense_Mutation	SNP	4409376	4409376	CORO7	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3724	176
MGRN1	23295	broad.mit.edu	37	16	4731589	4731589	+	Silent	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4731589G>A	uc002cwz.2	+	13	1306	c.1170G>A	c.(1168-1170)TCG>TCA	p.S390S	MGRN1_uc002cxa.2_Silent_p.S390S|MGRN1_uc010btx.2_Silent_p.S369S|MGRN1_uc010btw.2_Silent_p.S369S|MGRN1_uc002cxb.2_Silent_p.S429S|MGRN1_uc010uxo.1_Silent_p.S368S|MGRN1_uc010uxp.1_Silent_p.S368S|MGRN1_uc010uxq.1_RNA	NM_001142290	NP_001135762	O60291	MGRN1_HUMAN	mahogunin, ring finger 1 isoform 3	390					endosome to lysosome transport|negative regulation of cAMP-mediated signaling|negative regulation of G-protein coupled receptor protein signaling pathway|protein monoubiquitination	cytosol|early endosome|nucleus|plasma membrane|plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2						AGCCCATCTCGCTGCTCGAGG	0.647																0.378788	74.860893	75.711001	25	41	KEEP	---	---	---	---	11	17	31	25	-1	capture	Silent	SNP	4731589	4731589	MGRN1	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9471	176
NKD1	85407	broad.mit.edu	37	16	50664787	50664787	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50664787C>T	uc002egg.1	+	8	885	c.661C>T	c.(661-663)CGG>TGG	p.R221W		NM_033119	NP_149110	Q969G9	NKD1_HUMAN	naked cuticle homolog 1	221					Wnt receptor signaling pathway	cytoplasm|plasma membrane	calcium ion binding|protein binding				0		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		TGAGGACCTGCGGAGCTGGGA	0.612																0.416667	15.272837	15.345611	5	7	KEEP	---	---	---	---	2	4	2	8	-1	capture	Missense_Mutation	SNP	50664787	50664787	NKD1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	10348	176
CNGB1	1258	broad.mit.edu	37	16	57949167	57949167	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57949167G>A	uc002emt.2	-	23	2355	c.2290C>T	c.(2290-2292)CCC>TCC	p.P764S	CNGB1_uc010cdh.2_Missense_Mutation_p.P758S	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform	764	Extracellular (Potential).				sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						AAACAGCGGGGCAGGCGGAGG	0.602	Colon(156;1293 1853 16336 28962 38659)															0.285714	51.188448	54.062863	20	50	KEEP	---	---	---	---	11	11	23	43	-1	capture	Missense_Mutation	SNP	57949167	57949167	CNGB1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3565	176
MYH4	4622	broad.mit.edu	37	17	10355578	10355578	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10355578G>A	uc002gmn.2	-	27	3529	c.3418C>T	c.(3418-3420)CGC>TGC	p.R1140C	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1140	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						AGGTCAGAGCGCTGCTTCTCT	0.582																0.357724	124.868677	127.060182	44	79	KEEP	---	---	---	---	26	21	49	39	-1	capture	Missense_Mutation	SNP	10355578	10355578	MYH4	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9947	176
DNAH9	1770	broad.mit.edu	37	17	11572540	11572540	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:11572540C>T	uc002gne.2	+	16	2959	c.2891C>T	c.(2890-2892)CCA>CTA	p.P964L	DNAH9_uc010coo.2_Missense_Mutation_p.P258L	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	964	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCTCTGGTGCCACGGCTTTCC	0.527																0.372727	116.319865	117.894469	41	69	KEEP	---	---	---	---	32	14	37	34	-1	capture	Missense_Mutation	SNP	11572540	11572540	DNAH9	17	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	4564	176
ERAL1	26284	broad.mit.edu	37	17	27182172	27182172	+	Silent	SNP	A	G	G			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27182172A>G	uc002hcy.1	+	1	130	c.120A>G	c.(118-120)CAA>CAG	p.Q40Q	ERAL1_uc002hcx.1_Silent_p.Q40Q|ERAL1_uc002hcz.1_RNA|ERAL1_uc002hda.1_5'Flank|ERAL1_uc002hdb.1_5'Flank	NM_005702	NP_005693	O75616	ERAL1_HUMAN	Era-like 1	40					ribosomal small subunit assembly	mitochondrial inner membrane|mitochondrial matrix	GTP binding|ribosomal small subunit binding|rRNA binding			skin(1)	1	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.12e-05)|all cancers(11;5.32e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.105)			TAGGCTTCCAACGGAGGTGCG	0.627																0.206897	62.137749	71.371164	24	92	KEEP	---	---	---	---	11	16	61	48	-1	capture	Silent	SNP	27182172	27182172	ERAL1	17	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	5157	176
ICAM4	3386	broad.mit.edu	37	19	10398453	10398453	+	Silent	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10398453G>A	uc002mns.1	+	2	675	c.636G>A	c.(634-636)GCG>GCA	p.A212A	ICAM4_uc002mnr.1_Missense_Mutation_p.A187T|ICAM4_uc002mnt.1_Silent_p.A212A|ICAM5_uc002mnu.3_5'Flank	NM_001544	NP_001535	Q14773	ICAM4_HUMAN	intercellular adhesion molecule 4 isoform 1	212	Ig-like C2-type 2.|Extracellular (Potential).				cell-cell adhesion|regulation of immune response	extracellular region|integral to membrane|plasma membrane	integrin binding			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			TCTGCCACGCGCGCCTCAATC	0.642																0.100917	17.411021	52.043621	22	196	KEEP	---	---	---	---	11	18	103	121	-1	capture	Silent	SNP	10398453	10398453	ICAM4	19	G	A	A	A	1	0	0	0	0	0	0	0	1	494	38	1	1	7407	176
OR10H1	26539	broad.mit.edu	37	19	15918076	15918076	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15918076C>T	uc002nbq.2	-	1	861	c.772G>A	c.(772-774)GTC>ATC	p.V258I		NM_013940	NP_039228	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGGTAAATGACGGAGGCAAAG	0.552																0.15493	18.87947	26.959748	11	60	KEEP	---	---	---	---	12	5	41	42	-1	capture	Missense_Mutation	SNP	15918076	15918076	OR10H1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10809	176
PSG9	5678	broad.mit.edu	37	19	43766196	43766196	+	Silent	SNP	G	A	A	rs150952802		TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43766196G>A	uc002owd.3	-	3	624	c.525C>T	c.(523-525)GAC>GAT	p.D175D	PSG9_uc002owe.3_Silent_p.D175D|PSG9_uc010xwm.1_Intron|PSG9_uc002owf.3_Intron|PSG9_uc002owg.2_Silent_p.D175D|PSG9_uc002owh.2_Intron	NM_002784	NP_002775	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	175	Ig-like C2-type 1.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				GGTAGCTTGCGTCCAGAGTCT	0.532																0.346405	301.264981	307.634648	106	200	KEEP	---	---	---	---	51	62	110	107	-1	capture	Silent	SNP	43766196	43766196	PSG9	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12557	176
PLEKHA4	57664	broad.mit.edu	37	19	49360714	49360714	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49360714G>A	uc002pkx.2	-	9	1563	c.1012C>T	c.(1012-1014)CGG>TGG	p.R338W	PLEKHA4_uc002pkw.1_Intron|PLEKHA4_uc010eml.2_Intron	NM_020904	NP_065955	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing family A	338	Pro-rich.					cytoplasm|membrane	1-phosphatidylinositol binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		CCAGGGGGCCGCGGGGGGAGC	0.512																0.4	38.337891	38.64521	14	21	KEEP	---	---	---	---	11	4	11	13	-1	capture	Missense_Mutation	SNP	49360714	49360714	PLEKHA4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	11961	176
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393																0.3	8.220735	8.57832	3	7	KEEP	---	---	---	---	1	2	5	2	0.333333333333	capture	Missense_Mutation	SNP	58385546	58385546	ZNF814	19	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	18052	176
LRPPRC	10128	broad.mit.edu	37	2	44152273	44152273	+	Silent	SNP	C	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:44152273C>A	uc002rtr.2	-	27	2887	c.2829G>T	c.(2827-2829)GTG>GTT	p.V943V	LRPPRC_uc010yob.1_Silent_p.V843V	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	943					mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GTGTCAGCTCCACTAATTTTT	0.323																0.37415	165.485253	167.53088	55	92	KEEP	---	---	---	---	25	37	54	52	0.596774193548	capture	Silent	SNP	44152273	44152273	LRPPRC	2	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	8881	176
RAB11FIP5	26056	broad.mit.edu	37	2	73315641	73315641	+	Missense_Mutation	SNP	G	C	C			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73315641G>C	uc002siu.3	-	3	1346	c.1105C>G	c.(1105-1107)CAA>GAA	p.Q369E	RAB11FIP5_uc002sit.3_Missense_Mutation_p.Q291E	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	369					protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0						GAGACAGCTTGCAAGGAGCCA	0.617																0.3	66.57001	69.058898	21	49	KEEP	---	---	---	---	8	16	26	29	-1	capture	Missense_Mutation	SNP	73315641	73315641	RAB11FIP5	2	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	12792	176
YSK4	80122	broad.mit.edu	37	2	135738725	135738725	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135738725G>A	uc002tue.1	-	9	3617	c.3586C>T	c.(3586-3588)CCA>TCA	p.P1196S	YSK4_uc002tuf.1_Missense_Mutation_p.P378S|YSK4_uc010fnc.1_Missense_Mutation_p.P330S|YSK4_uc010fnd.1_Missense_Mutation_p.P1083S|YSK4_uc010zbg.1_Missense_Mutation_p.P328S|YSK4_uc002tuh.3_Missense_Mutation_p.P924S|YSK4_uc002tui.3_3'UTR	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	1196	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		ATTCCAGTTGGCATGAGCATA	0.428					411											0.365854	129.032327	130.98262	45	78	KEEP	---	---	---	---	20	27	34	51	-1	capture	Missense_Mutation	SNP	135738725	135738725	YSK4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17376	176
TTN	7273	broad.mit.edu	37	2	179605482	179605482	+	Missense_Mutation	SNP	T	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179605482T>A	uc010zfh.1	-	46	12189	c.11965A>T	c.(11965-11967)ACC>TCC	p.T3989S	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.T3922S|TTN_uc010zfj.1_Missense_Mutation_p.T3797S|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGAGAAGGTTTTCTGGGAC	0.453					8722											0.31746	110.956181	114.688271	40	86	KEEP	---	---	---	---	14	28	56	40	-1	capture	Missense_Mutation	SNP	179605482	179605482	TTN	2	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	16617	176
MX2	4600	broad.mit.edu	37	21	42770891	42770891	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:42770891G>A	uc002yzf.1	+	9	1321	c.1217G>A	c.(1216-1218)CGT>CAT	p.R406H	MX2_uc011aer.1_RNA|MX2_uc002yzg.1_Missense_Mutation_p.R129H|MX2_uc010gop.1_5'UTR	NM_002463	NP_002454	P20592	MX2_HUMAN	myxovirus resistance protein 2	406					response to virus|type I interferon-mediated signaling pathway	cytoplasm|nucleus	GTP binding|GTPase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				GAGCTGCGGCGTTGCGGGGCT	0.527																0.338129	129.894736	133.109346	47	92	KEEP	---	---	---	---	24	32	48	59	-1	capture	Missense_Mutation	SNP	42770891	42770891	MX2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9908	176
CACNA1D	776	broad.mit.edu	37	3	53757913	53757913	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53757913A>G	uc003dgv.3	+	14	2150	c.1987A>G	c.(1987-1989)ATC>GTC	p.I663V	CACNA1D_uc003dgu.3_Missense_Mutation_p.I683V|CACNA1D_uc003dgy.3_Missense_Mutation_p.I663V|CACNA1D_uc003dgw.3_Missense_Mutation_p.I330V	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	663	Helical; Name=S5 of repeat II; (Potential).|II.				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	CTTCATTATCATCTTTTCCTT	0.438																0.326531	137.544298	141.47096	48	99	KEEP	---	---	---	---	23	27	44	65	-1	capture	Missense_Mutation	SNP	53757913	53757913	CACNA1D	3	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	2517	176
CNOT6L	246175	broad.mit.edu	37	4	78650009	78650009	+	Silent	SNP	T	C	C			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:78650009T>C	uc011ccd.1	-	10	1382	c.1251A>G	c.(1249-1251)TCA>TCG	p.S417S	CNOT6L_uc003hks.2_Silent_p.S417S|CNOT6L_uc003hkt.1_Silent_p.S260S	NM_144571	NP_653172	Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	417					nuclear-transcribed mRNA poly(A) tail shortening	cytosol	exonuclease activity|protein binding			large_intestine(1)	1						TATAAATACCTGAATCTGGCA	0.403																0.025641	-22.183552	6.974569	3	114	KEEP	---	---	---	---	1	2	57	70	-1	capture	Silent	SNP	78650009	78650009	CNOT6L	4	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	3588	176
FRAS1	80144	broad.mit.edu	37	4	79236756	79236756	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79236756C>A	uc003hlb.2	+	16	2127	c.1687C>A	c.(1687-1689)CAA>AAA	p.Q563K	FRAS1_uc003hkw.2_Missense_Mutation_p.Q563K|FRAS1_uc003hky.1_Missense_Mutation_p.Q267K|FRAS1_uc003hkz.2_Missense_Mutation_p.Q267K|FRAS1_uc003hla.1_Missense_Mutation_p.Q74K	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	563	FU 4.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						AGCTTGTGACCAATCCTGTGA	0.478																0.301724	99.293641	103.358256	35	81	KEEP	---	---	---	---	17	26	37	63	0.604651162791	capture	Missense_Mutation	SNP	79236756	79236756	FRAS1	4	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	5986	176
HCN1	348980	broad.mit.edu	37	5	45303842	45303842	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45303842A>T	uc003jok.2	-	6	1502	c.1477T>A	c.(1477-1479)TTT>ATT	p.F493I		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	493	cAMP.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						AACACCTCAAATCTCAACTTG	0.413																0.3375	157.701038	161.437617	54	106	KEEP	---	---	---	---	21	37	52	63	-1	capture	Missense_Mutation	SNP	45303842	45303842	HCN1	5	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	6922	176
PLK2	10769	broad.mit.edu	37	5	57754862	57754862	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:57754862C>T	uc003jrn.2	-	2	455	c.328G>A	c.(328-330)GCA>ACA	p.A110T	PLK2_uc011cql.1_Missense_Mutation_p.A12T	NM_006622	NP_006613	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	110	Protein kinase.				positive regulation of I-kappaB kinase/NF-kappaB cascade		ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|lung(1)|skin(1)	4		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		ATAATTTTTGCGGCGTAGACT	0.423				p.A110T(HCC1428-Tumor)|p.A110T(OVISE-Tumor)	266											0.372263	150.080906	152.04722	51	86	KEEP	---	---	---	---	27	33	56	41	-1	capture	Missense_Mutation	SNP	57754862	57754862	PLK2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11999	176
PIK3R1	5295	broad.mit.edu	37	5	67589149	67589149	+	Missense_Mutation	SNP	A	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589149A>T	uc003jva.2	+	10	1697	c.1137A>T	c.(1135-1137)AAA>AAT	p.K379N	PIK3R1_uc003jvb.2_Missense_Mutation_p.K379N|PIK3R1_uc003jvc.2_Missense_Mutation_p.K79N|PIK3R1_uc003jvd.2_Missense_Mutation_p.K109N|PIK3R1_uc003jve.2_Missense_Mutation_p.K58N|PIK3R1_uc011crb.1_Missense_Mutation_p.K49N	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	379	SH2 1.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	GAAATAACAAATTAATCAAAA	0.308				p.L380del(DAOY-Tumor)	370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.092105	3.484805	16.200771	7	69	KEEP	---	---	---	---	4	4	37	41	-1	capture	Missense_Mutation	SNP	67589149	67589149	PIK3R1	5	A	T	T	T	1	0	0	0	0	1	0	0	0	50	4	4	4	11821	176
TGFBI	7045	broad.mit.edu	37	5	135385160	135385160	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:135385160G>T	uc003lbf.3	+	7	965	c.804G>T	c.(802-804)ATG>ATT	p.M268I	TGFBI_uc003lbg.3_Missense_Mutation_p.M1I|TGFBI_uc003lbh.3_Missense_Mutation_p.M94I|TGFBI_uc011cyb.1_Missense_Mutation_p.M94I|TGFBI_uc010jed.2_Missense_Mutation_p.M1I	NM_000358	NP_000349	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	268	FAS1 2.				angiogenesis|cell adhesion|cell proliferation|negative regulation of cell adhesion|response to stimulus|visual perception	extracellular space|proteinaceous extracellular matrix	integrin binding			breast(3)|ovary(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCAACACGATGCTTGAAGGTA	0.567																0.32	46.283444	47.722187	16	34	KEEP	---	---	---	---	12	10	17	23	0.545454545455	capture	Missense_Mutation	SNP	135385160	135385160	TGFBI	5	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	15705	176
PCDHB8	56128	broad.mit.edu	37	5	140559327	140559327	+	Missense_Mutation	SNP	C	T	T	rs141057693		TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140559327C>T	uc011dai.1	+	1	1898	c.1712C>T	c.(1711-1713)GCG>GTG	p.A571V	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	571	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AATGGCTCCGCGCCCTGCACC	0.716																0.206612	57.337623	66.969312	25	96	KEEP	---	---	---	---	21	21	94	121	-1	capture	Missense_Mutation	SNP	140559327	140559327	PCDHB8	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11451	176
NDST1	3340	broad.mit.edu	37	5	149925000	149925000	+	Silent	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149925000C>T	uc003lsk.3	+	11	2599	c.2097C>T	c.(2095-2097)GTC>GTT	p.V699V	NDST1_uc011dcj.1_Silent_p.V699V	NM_001543	NP_001534	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan	699	Heparan sulfate N-sulfotransferase 1.|Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process|inflammatory response	Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			breast(1)|skin(1)	2		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGCCAAGGTCCTGACCATCC	0.612																0.350318	313.261708	319.465273	110	204	KEEP	---	---	---	---	59	71	119	122	-1	capture	Silent	SNP	149925000	149925000	NDST1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	10162	176
ANXA6	309	broad.mit.edu	37	5	150512089	150512089	+	Silent	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150512089G>A	uc003ltl.1	-	10	836	c.684C>T	c.(682-684)GCC>GCT	p.A228A	ANXA6_uc011dcp.1_Silent_p.A196A|ANXA6_uc003ltm.1_Silent_p.A228A|ANXA6_uc003ltn.1_Intron|ANXA6_uc003lto.1_Intron	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1	228	Annexin 3.					melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCGGATGCTGGCTTCAATCG	0.542																0.321429	26.666608	27.458841	9	19	KEEP	---	---	---	---	6	5	13	9	-1	capture	Silent	SNP	150512089	150512089	ANXA6	5	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	716	176
PRSS16	10279	broad.mit.edu	37	6	27222902	27222902	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27222902G>T	uc003nja.2	+	11	1480	c.1468G>T	c.(1468-1470)GGG>TGG	p.G490W	PRSS16_uc011dkt.1_RNA|PRSS16_uc003njb.2_Missense_Mutation_p.G233W|PRSS16_uc003njd.2_RNA	NM_005865	NP_005856	Q9NQE7	TSSP_HUMAN	protease, serine, 16 precursor	490					protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity			ovary(2)|central_nervous_system(2)|skin(1)	5						CCTCCGCCTAGGGCGCCAGGT	0.507	NSCLC(178;1118 2105 17078 23587 44429)															0.310526	161.738292	167.825772	59	131	KEEP	---	---	---	---	33	33	70	77	0.5	capture	Missense_Mutation	SNP	27222902	27222902	PRSS16	6	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	12511	176
MSH5	4439	broad.mit.edu	37	6	31721395	31721395	+	Missense_Mutation	SNP	G	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31721395G>T	uc003nwv.1	+	12	1082	c.1003G>T	c.(1003-1005)GTT>TTT	p.V335F	MSH5_uc003nwt.1_Missense_Mutation_p.V352F|MSH5_uc003nwu.1_Missense_Mutation_p.V335F|MSH5_uc003nww.1_Missense_Mutation_p.V335F|MSH5_uc003nwx.1_Missense_Mutation_p.V352F|MSH5_uc011dof.1_Missense_Mutation_p.V34F|MSH5_uc003nwy.1_5'Flank	NM_172166	NP_751898	O43196	MSH5_HUMAN	mutS homolog 5 isoform c	335					chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			ovary(2)|breast(1)	3						CGACTGGCAGGTTCTCTACAA	0.493				p.V352I(IM95-Tumor)	274						Direct_reversal_of_damage|MMR					0.34	52.058803	53.190728	17	33	KEEP	---	---	---	---	12	9	18	28	0.571428571429	capture	Missense_Mutation	SNP	31721395	31721395	MSH5	6	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	9783	176
ANKRD6	22881	broad.mit.edu	37	6	90333750	90333750	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:90333750C>T	uc003pni.3	+	12	1533	c.1192C>T	c.(1192-1194)CGG>TGG	p.R398W	ANKRD6_uc003pne.3_Missense_Mutation_p.R398W|ANKRD6_uc003pnf.3_Missense_Mutation_p.R363W|ANKRD6_uc011dzy.1_Missense_Mutation_p.R398W|ANKRD6_uc010kcd.2_Missense_Mutation_p.R339W|LYRM2_uc010kce.1_Intron|LYRM2_uc003png.2_Intron|ANKRD6_uc003pnh.3_5'UTR|LYRM2_uc010kcf.1_Intron|ANKRD6_uc003pnj.3_5'UTR	NM_014942	NP_055757	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	398							protein binding			ovary(2)|pancreas(1)	3		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		CACATTGTACCGGGGCAAGGA	0.522																0.5	16.474972	16.474972	5	5	KEEP	---	---	---	---	5	1	2	4	-1	capture	Missense_Mutation	SNP	90333750	90333750	ANKRD6	6	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	680	176
SLC22A3	6581	broad.mit.edu	37	6	160819102	160819102	+	Missense_Mutation	SNP	A	G	G			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160819102A>G	uc003qti.2	+	2	548	c.521A>G	c.(520-522)TAT>TGT	p.Y174C	SLC22A3_uc011efx.1_RNA	NM_021977	NP_068812	O75751	S22A3_HUMAN	solute carrier family 22 member 3	174						integral to plasma membrane|membrane fraction	protein binding|quaternary ammonium group transmembrane transporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)		ACCTTAGGCTATGCAGCAGAC	0.433					170											0.380165	149.916696	151.4422	46	75	KEEP	---	---	---	---	29	21	41	40	-1	capture	Missense_Mutation	SNP	160819102	160819102	SLC22A3	6	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	14347	176
ABCB1	5243	broad.mit.edu	37	7	87135283	87135283	+	Missense_Mutation	SNP	G	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87135283G>A	uc003uiz.1	-	28	3984	c.3566C>T	c.(3565-3567)GCC>GTC	p.A1189V	ABCB1_uc011khc.1_Missense_Mutation_p.A1125V	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	1189	Cytoplasmic (Potential).|ABC transporter 2.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	TCTAACAAGGGCACGAGCTAT	0.403																0.317241	128.892357	133.201695	46	99	KEEP	---	---	---	---	24	33	52	65	-1	capture	Missense_Mutation	SNP	87135283	87135283	ABCB1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	40	176
MLL3	58508	broad.mit.edu	37	7	151970848	151970848	+	Missense_Mutation	SNP	C	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151970848C>A	uc003wla.2	-	7	1173	c.954G>T	c.(952-954)CAG>CAT	p.Q318H		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	318					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GACTGAAATCCTGAAAGGTGC	0.423	Colon(68;14 1149 1884 27689 34759)			p.Q318Q(LNCAPCLONEFGC-Tumor)|p.Q318Q(NCIH2106-Tumor)	1780	N		medulloblastoma								0.047619	-41.900039	31.324541	16	320	KEEP	---	---	---	---	10	7	165	198	0.411764705882	capture	Missense_Mutation	SNP	151970848	151970848	MLL3	7	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	9534	176
SAMD12	401474	broad.mit.edu	37	8	119593041	119593041	+	Silent	SNP	A	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:119593041A>T	uc003yom.2	-	2	234	c.105T>A	c.(103-105)TCT>TCA	p.S35S	SAMD12_uc010mda.1_Silent_p.S35S|SAMD12_uc010mdb.1_RNA	NM_207506	NP_997389	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12 isoform	35										ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			TAATGGATTGAGATTCCACAC	0.453																0.357143	85.424551	86.935373	30	54	KEEP	---	---	---	---	19	12	31	27	-1	capture	Silent	SNP	119593041	119593041	SAMD12	8	A	T	T	T	1	0	0	0	0	0	0	0	1	132	11	4	4	13709	176
TBC1D2	55357	broad.mit.edu	37	9	100971301	100971301	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100971301C>T	uc011lvb.1	-	9	1979	c.1799G>A	c.(1798-1800)CGG>CAG	p.R600Q	TBC1D2_uc004ayp.2_Missense_Mutation_p.R140Q|TBC1D2_uc004ayq.2_Missense_Mutation_p.R600Q|TBC1D2_uc004ayr.2_Missense_Mutation_p.R382Q|TBC1D2_uc004ayo.3_Missense_Mutation_p.R600Q	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	600						cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		CCTCAGCGGCCGATCCACAGC	0.652																0.351485	217.771951	221.698509	71	131	KEEP	---	---	---	---	34	41	62	77	-1	capture	Missense_Mutation	SNP	100971301	100971301	TBC1D2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15496	176
ITIH5L	347365	broad.mit.edu	37	X	54785074	54785074	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54785074C>T	uc004dtj.2	-	8	1463	c.1433G>A	c.(1432-1434)CGT>CAT	p.R478H		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	478					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						GTAGTTCAGACGCACATCTGC	0.597					249											0.692308	57.76497	58.630904	18	8	KEEP	---	---	---	---	10	8	1	8	-1	capture	Missense_Mutation	SNP	54785074	54785074	ITIH5L	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7831	176
TBC1D8B	54885	broad.mit.edu	37	X	106109162	106109162	+	Missense_Mutation	SNP	C	T	T			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:106109162C>T	uc004emo.2	+	16	2726	c.2561C>T	c.(2560-2562)GCT>GTT	p.A854V	MORC4_uc004emp.3_Intron	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	854						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						AGTCCCTGGGCTCATTCTGCA	0.408																0.696429	266.95646	270.802778	78	34	KEEP	---	---	---	---	38	55	17	21	-1	capture	Missense_Mutation	SNP	106109162	106109162	TBC1D8B	23	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	15513	176
PCDH11Y	83259	broad.mit.edu	37	Y	4925190	4925190	+	Missense_Mutation	SNP	T	A	A			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:4925190T>A	uc004fqo.2	+	1	1060	c.326T>A	c.(325-327)ATT>AAT	p.I109N	PCDH11Y_uc010nwg.1_Missense_Mutation_p.I98N|PCDH11Y_uc004fql.1_Missense_Mutation_p.I98N|PCDH11Y_uc004fqm.1_Missense_Mutation_p.I98N|PCDH11Y_uc004fqn.1_Missense_Mutation_p.I109N	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	109	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						CTGATTCGAATTGAAGAGGAT	0.443																0.74359	204.484453	208.681089	58	20	KEEP	---	---	---	---	36	27	12	13	-1	capture	Missense_Mutation	SNP	4925190	4925190	PCDH11Y	24	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	11412	176
CHERP	10523	broad.mit.edu	37	19	16640581	16640583	+	In_Frame_Del	DEL	TGC	-	-			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16640581_16640583delTGC	uc002nei.1	-	8	1079_1081	c.1005_1007delGCA	c.(1003-1008)CAGCAA>CAA	p.335_336QQ>Q	MED26_uc002nee.2_Intron	NM_006387	NP_006378	Q8IWX8	CHERP_HUMAN	calcium homeostasis endoplasmic reticulum	335_336	Gln-rich.				cellular calcium ion homeostasis|negative regulation of cell proliferation|nervous system development|RNA processing	endoplasmic reticulum|perinuclear region of cytoplasm	RNA binding			ovary(2)	2						ctgctgctgttgctgctgctgct	0.552																0.09			7	73		---	---	---	---						capture_indel	In_Frame_Del	DEL	16640581	16640583	CHERP	19	TGC	-	-	-	1	0	1	0	1	0	0	0	0	819	63	5	5	3302	176
DOCK2	1794	broad.mit.edu	37	5	169098173	169098174	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169098173_169098174delTA	uc003maf.2	+	5	396_397	c.316_317delTA	c.(316-318)TATfs	p.Y106fs	DOCK2_uc011der.1_RNA	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	106					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAAACAACTCTATGTGGTGAGA	0.441																0.26			18	51		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	169098173	169098174	DOCK2	5	TA	-	-	-	1	0	1	0	1	0	0	0	0	689	53	5	5	4643	176
BHLHE22	27319	broad.mit.edu	37	8	65493617	65493618	+	In_Frame_Ins	INS	-	GGC	GGC			TCGA-19-5958-01	TCGA-19-5958-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:65493617_65493618insGGC	uc003xvi.2	+	1	804_805	c.270_271insGGC	c.(268-273)insGGC	p.97_98insG	LOC401463_uc003xvh.2_Intron	NM_152414	NP_689627	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix domain containing, class	97_98	Gly-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						gcgcgggaagtggcggcggcgg	0.584	Colon(113;104 1586 2865 9855 18065)															0.33			2	4		---	---	---	---						capture_indel	In_Frame_Ins	INS	65493617	65493618	BHLHE22	8	-	GGC	GGC	GGC	1	0	1	1	0	0	0	0	0	764	59	5	5	1409	176
