Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
EPHA8	2046	broad.mit.edu	37	1	22927229	22927229	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22927229T>C	uc001bfx.1	+	14	2589	c.2464T>C	c.(2464-2466)TGG>CGG	p.W822R		NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	822	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CAGCGACGTGTGGAGCTTCGG	0.657					520											0.07971	1.833579	26.694871	11	127	KEEP	---	---	---	---	5	6	75	81	-1	capture	Missense_Mutation	SNP	22927229	22927229	EPHA8	1	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	5128	197
ABCD3	5825	broad.mit.edu	37	1	94965170	94965170	+	Silent	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:94965170G>A	uc001dqn.3	+	20	1842	c.1740G>A	c.(1738-1740)GCG>GCA	p.A580A	ABCD3_uc010oto.1_Silent_p.A604A|ABCD3_uc010otp.1_Silent_p.A507A|ABCD3_uc009wdr.2_Silent_p.A470A|ABCD3_uc001dqo.3_Silent_p.A268A	NM_002858	NP_002849	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D, member 3	580	ABC transporter.				peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		AAAGAATGGCGGTAAGTATAC	0.418																0.026549	-21.477429	6.521353	3	110	KEEP	---	---	---	---	3	0	66	66	-1	capture	Silent	SNP	94965170	94965170	ABCD3	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	62	197
FCRL5	83416	broad.mit.edu	37	1	157490328	157490328	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157490328G>A	uc001fqu.2	-	12	2683	c.2525C>T	c.(2524-2526)GCG>GTG	p.A842V	FCRL5_uc009wsm.2_Missense_Mutation_p.A842V	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	842	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				ACTTCTGTTCGCGGTCAGCCC	0.657																0.555556	31.651613	31.699966	10	8	KEEP	---	---	---	---	9	4	3	6	-1	capture	Missense_Mutation	SNP	157490328	157490328	FCRL5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5744	197
SPTA1	6708	broad.mit.edu	37	1	158615013	158615013	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158615013G>A	uc001fst.1	-	29	4358	c.4159C>T	c.(4159-4161)CGC>TGC	p.R1387C		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1387	Spectrin 13.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					ATCTTCTTGCGTTTTTCCCAA	0.433																0.344512	320.172573	327.177037	113	215	KEEP	---	---	---	---	69	67	127	136	-1	capture	Missense_Mutation	SNP	158615013	158615013	SPTA1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15008	197
CFHR4	10877	broad.mit.edu	37	1	196887346	196887346	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196887346G>T	uc001gto.2	+	6	875	c.806G>T	c.(805-807)TGT>TTT	p.C269F	CFHR4_uc009wyy.2_Missense_Mutation_p.C515F|CFHR4_uc001gtp.2_Missense_Mutation_p.C516F	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	269	Sushi 5.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						TCAGATCCATGTATAATAACT	0.264																0.04878	-9.775321	7.972979	4	78	KEEP	---	---	---	---	1	3	45	36	0.25	capture	Missense_Mutation	SNP	196887346	196887346	CFHR4	1	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	3253	197
OR2AK2	391191	broad.mit.edu	37	1	248129572	248129572	+	Silent	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248129572G>A	uc010pzd.1	+	1	939	c.939G>A	c.(937-939)ACG>ACA	p.T313T	OR2L13_uc001ids.2_Intron	NM_001004491	NP_001004491	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK,	313	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			AGGAAGTGACGGGGGCAGTGA	0.433	Melanoma(45;390 1181 23848 28461 41504)															0.390071	175.397623	176.888802	55	86	KEEP	---	---	---	---	23	42	54	50	-1	capture	Silent	SNP	248129572	248129572	OR2AK2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10890	197
ADARB2	105	broad.mit.edu	37	10	1262895	1262895	+	Missense_Mutation	SNP	C	T	T	rs142663256	byFrequency	TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:1262895C>T	uc009xhq.2	-	7	2052	c.1678G>A	c.(1678-1680)GCC>ACC	p.A560T		NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	560	A to I editase.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CCTCACCTGGCGATCTTGTCC	0.677					191											0.485714	48.168794	48.174983	17	18	KEEP	---	---	---	---	9	10	8	15	-1	capture	Missense_Mutation	SNP	1262895	1262895	ADARB2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	283	197
GDF10	2662	broad.mit.edu	37	10	48429388	48429388	+	Silent	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:48429388C>T	uc001jfb.2	-	2	954	c.498G>A	c.(496-498)CCG>CCA	p.P166P	GDF10_uc009xnp.2_Silent_p.P165P|GDF10_uc009xnq.1_Silent_p.P166P	NM_004962	NP_004953	P55107	BMP3B_HUMAN	growth differentiation factor 10 precursor	166					growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity			lung(1)|central_nervous_system(1)	2						GGCGTGTGGGCGGGCCCAGGG	0.726																0.857143	38.506712	40.224919	12	2	KEEP	---	---	---	---	7	7	2	1	-1	capture	Silent	SNP	48429388	48429388	GDF10	10	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6251	197
MAT1A	4143	broad.mit.edu	37	10	82034333	82034333	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:82034333C>T	uc001kbw.2	-	8	1283	c.1028G>A	c.(1027-1029)CGA>CAA	p.R343Q		NM_000429	NP_000420	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	343					methylation|S-adenosylmethionine biosynthetic process|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity				0			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CAGCAGCTCTCGCTCTGTCTT	0.557																0.719101	214.143435	217.996917	64	25	KEEP	---	---	---	---	33	34	11	20	-1	capture	Missense_Mutation	SNP	82034333	82034333	MAT1A	10	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9242	197
PTEN	5728	broad.mit.edu	37	10	89720670	89720671	+	Missense_Mutation	DNP	GG	CT	CT			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720670_89720671GG>CT	uc001kfb.2	+	9	1852_1853	c.821_822GG>CT	c.(820-822)TGG>TCT	p.W274S		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	274	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.W274*(6)|p.R55fs*1(4)|p.?(2)|p.W274fs*2(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.D268_F279>VGQNVSLLGKYI(2)|p.G165_*404del(1)|p.W274G(1)|p.W274_F341del(1)|p.W274R(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTTCACTTTTGGGTAAATACAT	0.243			31	p.W274*(WM793-Tumor)|p.W274fs(BT549-Tumor)|p.W274*(P12ICHIKAWA-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.703704	70.835976	71.837721	19	8	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	89720670	89720671	PTEN	10	GG	CT	CT	CT	1	0	0	0	0	1	0	0	0	611	47	4	4	12633	197
AFAP1L2	84632	broad.mit.edu	37	10	116062141	116062141	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:116062141C>T	uc001lbn.2	-	12	1688	c.1387G>A	c.(1387-1389)GAT>AAT	p.D463N	AFAP1L2_uc001lbo.2_Missense_Mutation_p.D463N|AFAP1L2_uc010qse.1_Missense_Mutation_p.D516N|AFAP1L2_uc001lbp.2_Missense_Mutation_p.D491N|AFAP1L2_uc001lbr.1_Missense_Mutation_p.D463N|AFAP1L2_uc001lbm.2_5'Flank|AFAP1L2_uc010qsd.1_Missense_Mutation_p.D29N|AFAP1L2_uc001lbq.1_5'Flank	NM_001001936	NP_001001936	Q8N4X5	AF1L2_HUMAN	KIAA1914 protein isoform 1	463					inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding			ovary(1)|breast(1)	2		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		GAGACCCTATCGGCATCCACA	0.527																0.693182	405.611373	411.472602	122	54	KEEP	---	---	---	---	77	58	29	32	-1	capture	Missense_Mutation	SNP	116062141	116062141	AFAP1L2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	355	197
C11orf35	256329	broad.mit.edu	37	11	556891	556891	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:556891C>T	uc001lpx.2	-	8	983	c.920G>A	c.(919-921)CGC>CAC	p.R307H	uc001lpy.2_5'Flank|uc001lpz.2_5'Flank	NM_173573	NP_775844	Q8IXW0	CK035_HUMAN	hypothetical protein LOC256329	307										pancreas(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAGGAAGCGCGGTGGTCCCG	0.692																0.294118	13.278612	13.917518	5	12	KEEP	---	---	---	---	5	2	9	7	-1	capture	Missense_Mutation	SNP	556891	556891	C11orf35	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1624	197
OR4A15	81328	broad.mit.edu	37	11	55135749	55135749	+	Silent	SNP	T	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55135749T>C	uc010rif.1	+	1	390	c.390T>C	c.(388-390)TTT>TTC	p.F130F		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	130	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CTCAACTTTTTATGGATCATT	0.403																0.084112	41.682892	154.387553	54	588	KEEP	---	---	---	---	32	25	368	299	-1	capture	Silent	SNP	55135749	55135749	OR4A15	11	T	C	C	C	1	0	0	0	0	0	0	0	1	790	61	3	3	10944	197
OR8H2	390151	broad.mit.edu	37	11	55873210	55873210	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55873210C>T	uc010riy.1	+	1	692	c.692C>T	c.(691-693)ACT>ATT	p.T231I		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	231	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					ATTAATTCCACTTCAGGAAAG	0.373													HNSCC(53;0.14)			0.284404	258.227152	271.880132	93	234	KEEP	---	---	---	---	47	49	127	120	-1	capture	Missense_Mutation	SNP	55873210	55873210	OR8H2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	11142	197
ZP1	22917	broad.mit.edu	37	11	60637220	60637220	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60637220C>G	uc001nqd.2	+	3	549	c.529C>G	c.(529-531)CAT>GAT	p.H177D	ZP1_uc001nqe.2_5'Flank	NM_207341	NP_997224	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 precursor	177	Extracellular (Potential).				single fertilization	integral to membrane|plasma membrane|proteinaceous extracellular matrix					0						AGGCTCTGGCCATGCCTTTCC	0.627																0.12987	16.59434	26.861198	10	67	KEEP	---	---	---	---	5	5	39	42	-1	capture	Missense_Mutation	SNP	60637220	60637220	ZP1	11	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	18091	197
FTH1	2495	broad.mit.edu	37	11	61732280	61732280	+	Silent	SNP	G	C	C	rs11554851		TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61732280G>C	uc001nsu.2	-	4	706	c.471C>G	c.(469-471)CGC>CGG	p.R157R		NM_002032	NP_002023	P02794	FRIH_HUMAN	ferritin, heavy polypeptide 1	157	Ferritin-like diiron.				cell proliferation|cellular membrane organization|immune response|intracellular sequestering of iron ion|iron ion transport|negative regulation of cell proliferation|post-Golgi vesicle-mediated transport	cytosol|intracellular ferritin complex	ferric iron binding|ferroxidase activity|protein binding			ovary(1)	1					Iron Dextran(DB00893)	CTCCCATCTTGCGCAAGTTGG	0.493																0.029126	-18.541762	6.544956	3	100	KEEP	---	---	---	---	3	1	51	56	-1	capture	Silent	SNP	61732280	61732280	FTH1	11	G	C	C	C	1	0	0	0	0	0	0	0	1	587	46	4	4	6024	197
PGR	5241	broad.mit.edu	37	11	100933263	100933263	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:100933263G>T	uc001pgh.2	-	4	2870	c.2127C>A	c.(2125-2127)GAC>GAA	p.D709E	PGR_uc001pgg.2_Missense_Mutation_p.D90E|PGR_uc001pgi.2_Intron|PGR_uc009yww.1_Intron|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	709	Steroid-binding.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)	AACTGGAGGTGTCAGGTTTTG	0.408	Pancreas(124;2271 2354 21954 22882)				429											0.105114	32.003206	86.589851	37	315	KEEP	---	---	---	---	22	19	189	159	0.536585365854	capture	Missense_Mutation	SNP	100933263	100933263	PGR	11	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	11708	197
CDCA3	83461	broad.mit.edu	37	12	6959664	6959664	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6959664T>C	uc001qrg.2	-	3	345	c.217A>G	c.(217-219)ATT>GTT	p.I73V	CDCA3_uc001qre.2_Missense_Mutation_p.I73V|uc001qrf.1_5'Flank|USP5_uc001qri.3_5'Flank|USP5_uc001qrh.3_5'Flank	NM_031299	NP_112589	Q99618	CDCA3_HUMAN	cell division cycle associated 3	73					cell division|mitosis	cytosol					0						GTCCGTGCAATACCAAGAGTA	0.547																0.078212	13.040915	78.115842	28	330	KEEP	---	---	---	---	16	18	181	192	-1	capture	Missense_Mutation	SNP	6959664	6959664	CDCA3	12	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	3058	197
ABCC9	10060	broad.mit.edu	37	12	21960380	21960380	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21960380C>G	uc001rfi.1	-	36	4369	c.4349G>C	c.(4348-4350)AGC>ACC	p.S1450T	ABCC9_uc001rfh.2_Missense_Mutation_p.S1450T|ABCC9_uc001rfj.1_Missense_Mutation_p.S1414T|ABCC9_uc001rfg.2_5'UTR	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1450	Cytoplasmic (Potential).|ABC transporter 2.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CTGTCCAACGCTAAAATTCTC	0.433																0.21164	110.490379	125.023167	40	149	KEEP	---	---	---	---	22	24	79	82	-1	capture	Missense_Mutation	SNP	21960380	21960380	ABCC9	12	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	59	197
ABCC9	10060	broad.mit.edu	37	12	21968784	21968784	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21968784G>C	uc001rfi.1	-	32	3956	c.3936C>G	c.(3934-3936)ATC>ATG	p.I1312M	ABCC9_uc001rfh.2_Missense_Mutation_p.I1312M|ABCC9_uc001rfj.1_Missense_Mutation_p.I1276M	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1312	Cytoplasmic (Potential).|ABC transporter 2.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CATGTATCTTGATCTCCCCTT	0.403																0.23445	149.866161	163.349228	49	160	KEEP	---	---	---	---	27	28	91	87	-1	capture	Missense_Mutation	SNP	21968784	21968784	ABCC9	12	G	C	C	C	1	0	0	0	0	1	0	0	0	577	45	4	4	59	197
ABCC9	10060	broad.mit.edu	37	12	21970190	21970190	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21970190G>A	uc001rfi.1	-	31	3843	c.3823C>T	c.(3823-3825)CAG>TAG	p.Q1275*	ABCC9_uc001rfh.2_Nonsense_Mutation_p.Q1275*|ABCC9_uc001rfj.1_Nonsense_Mutation_p.Q1239*	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1275	Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	GCACCCATCTGGACCTCCAGG	0.368																0.240964	277.38808	302.794942	100	315	KEEP	---	---	---	---	49	59	180	180	-1	capture	Nonsense_Mutation	SNP	21970190	21970190	ABCC9	12	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	59	197
ABCC9	10060	broad.mit.edu	37	12	21981913	21981913	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21981913G>T	uc001rfi.1	-	29	3668	c.3648C>A	c.(3646-3648)AAC>AAA	p.N1216K	ABCC9_uc001rfh.2_Missense_Mutation_p.N1216K|ABCC9_uc001rfj.1_Missense_Mutation_p.N1180K	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1216	Extracellular (Potential).|ABC transmembrane type-1 2.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CCAGCCATCTGTTGGCAGCTG	0.423																0.22028	159.762366	180.37245	63	223	KEEP	---	---	---	---	40	31	114	155	0.56338028169	capture	Missense_Mutation	SNP	21981913	21981913	ABCC9	12	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	59	197
OR6C6	283365	broad.mit.edu	37	12	55688288	55688288	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55688288C>G	uc010sph.1	-	1	729	c.729G>C	c.(727-729)ATG>ATC	p.M243I		NM_001005493	NP_001005493	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C,	243	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|skin(1)	2						AGACAACAATCATGTGGGAAG	0.368																0.291005	182.64813	190.043167	55	134	KEEP	---	---	---	---	38	21	70	77	-1	capture	Missense_Mutation	SNP	55688288	55688288	OR6C6	12	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	11098	197
NUP107	57122	broad.mit.edu	37	12	69115670	69115670	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:69115670G>A	uc001suf.2	+	16	1476	c.1361G>A	c.(1360-1362)CGG>CAG	p.R454Q	NUP107_uc001sug.2_Missense_Mutation_p.R301Q|NUP107_uc010stj.1_Missense_Mutation_p.R425Q	NM_020401	NP_065134	P57740	NU107_HUMAN	nucleoporin 107kDa	454					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			skin(1)	1	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			GCCTACTTCCGGGTGATGGTG	0.448																0.312925	138.605599	143.179826	46	101	KEEP	---	---	---	---	32	24	60	54	-1	capture	Missense_Mutation	SNP	69115670	69115670	NUP107	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10660	197
FLT3	2322	broad.mit.edu	37	13	28636174	28636174	+	Silent	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28636174C>T	uc001urw.2	-	3	280	c.198G>A	c.(196-198)GCG>GCA	p.A66A	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Silent_p.A66A	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	66	Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity	p.599_560>LTGSSDNEYFYVDFREYEY(1)		haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	GGGGTCTCAACGCACACCCGA	0.537					630	Mis|O		AML|ALL								0.094828	6.660565	25.762965	11	105	KEEP	---	---	---	---	6	6	64	55	-1	capture	Silent	SNP	28636174	28636174	FLT3	13	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	5886	197
RNASE11	122651	broad.mit.edu	37	14	21052270	21052270	+	Missense_Mutation	SNP	G	A	A	rs144501463	byFrequency	TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21052270G>A	uc010ahv.2	-	2	549	c.364C>T	c.(364-366)CGC>TGC	p.R122C	RNASE11_uc010ahx.2_Missense_Mutation_p.R122C|RNASE11_uc010ahw.2_Missense_Mutation_p.R122C|RNASE11_uc001vxs.2_Missense_Mutation_p.R122C	NM_145250	NP_660293	Q8TAA1	RNS11_HUMAN	ribonuclease, RNase A family, 11 (non-active)	122						extracellular region	nucleic acid binding|pancreatic ribonuclease activity			ovary(3)	3	all_cancers(95;0.00238)	all_lung(585;0.235)	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.0139)		GTGGAGCTGCGGATGAAGTTA	0.488																0.422018	145.04019	145.616386	46	63	KEEP	---	---	---	---	21	26	32	32	-1	capture	Missense_Mutation	SNP	21052270	21052270	RNASE11	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13293	197
GALNTL1	57452	broad.mit.edu	37	14	69795188	69795188	+	Missense_Mutation	SNP	G	A	A	rs61748871	byFrequency	TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:69795188G>A	uc010aqu.1	+	6	683	c.590G>A	c.(589-591)CGT>CAT	p.R197H	GALNTL1_uc001xla.1_Missense_Mutation_p.R197H|GALNTL1_uc001xlb.1_Missense_Mutation_p.R197H	NM_020692	NP_065743	Q8N428	GLTL1_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	197	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)		TCCCGAGTGCGTGGGGCGGAC	0.632																0.407767	252.488596	254.010926	84	122	KEEP	---	---	---	---	77	30	93	65	-1	capture	Missense_Mutation	SNP	69795188	69795188	GALNTL1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6161	197
FBLN5	10516	broad.mit.edu	37	14	92343924	92343924	+	Silent	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:92343924G>A	uc001xzx.3	-	10	1565	c.1092C>T	c.(1090-1092)GAC>GAT	p.D364D	FBLN5_uc010aud.2_Silent_p.D369D|FBLN5_uc010aue.2_Silent_p.D405D|FBLN5_uc001xzw.2_5'Flank	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor	364					cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				TTTGGAAGATGTCAGCGGGAA	0.537					478											0.075188	-6.266016	18.396194	10	123	KEEP	---	---	---	---	8	6	72	73	-1	capture	Silent	SNP	92343924	92343924	FBLN5	14	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	5646	197
PAPOLA	10914	broad.mit.edu	37	14	96991694	96991694	+	Silent	SNP	A	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96991694A>G	uc001yfq.2	+	4	507	c.297A>G	c.(295-297)ACA>ACG	p.T99T	PAPOLA_uc001yfo.2_Silent_p.T99T|PAPOLA_uc001yfp.2_Silent_p.T99T|PAPOLA_uc001yfr.2_Silent_p.T99T|PAPOLA_uc010twv.1_Silent_p.T99T|PAPOLA_uc010avp.2_5'UTR	NM_032632	NP_116021	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	99					mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding				0		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		AAATTTTTACATTTGGATCTT	0.323	NSCLC(19;254 734 11908 35501 39234)															0.286885	104.880187	109.847263	35	87	KEEP	---	---	---	---	19	20	46	56	-1	capture	Silent	SNP	96991694	96991694	PAPOLA	14	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	11333	197
KIF26A	26153	broad.mit.edu	37	14	104642036	104642036	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:104642036G>T	uc001yos.3	+	12	2911	c.2911G>T	c.(2911-2913)GGG>TGG	p.G971W		NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	971					blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity			pancreas(1)	1		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GCCTGGGGGAGGGGGCACTGA	0.701																0.235294	9.490593	10.58058	4	13	KEEP	---	---	---	---	2	3	7	6	0.4	capture	Missense_Mutation	SNP	104642036	104642036	KIF26A	14	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	8216	197
TUBGCP5	114791	broad.mit.edu	37	15	22868917	22868917	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:22868917A>G	uc001yur.3	+	20	2919	c.2789A>G	c.(2788-2790)CAC>CGC	p.H930R	TUBGCP5_uc001yuq.2_Missense_Mutation_p.H930R	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	930					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		ATTAAAATTCACTATAGGTAT	0.453																0.07563	-1.811797	20.156067	9	110	KEEP	---	---	---	---	4	6	66	51	-1	capture	Missense_Mutation	SNP	22868917	22868917	TUBGCP5	15	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	16651	197
C15orf2	23742	broad.mit.edu	37	15	24922713	24922713	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:24922713T>C	uc001ywo.2	+	1	2173	c.1699T>C	c.(1699-1701)TCA>CCA	p.S567P		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	567					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		CCACCTAACCTCACAGACTGC	0.488					443											0.28934	181.817218	189.639563	57	140	KEEP	---	---	---	---	38	24	59	102	-1	capture	Missense_Mutation	SNP	24922713	24922713	C15orf2	15	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	1770	197
RPAP1	26015	broad.mit.edu	37	15	41810311	41810311	+	Missense_Mutation	SNP	G	A	A	rs141969064		TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41810311G>A	uc001zod.2	-	23	3989	c.3865C>T	c.(3865-3867)CGG>TGG	p.R1289W	RPAP1_uc001zoc.2_Missense_Mutation_p.R308W	NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	1289						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		ACCAGGGTCCGGAAGTAGAGC	0.582																0.030303	-17.462232	6.496093	3	96	KEEP	---	---	---	---	0	3	50	52	-1	capture	Missense_Mutation	SNP	41810311	41810311	RPAP1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	13433	197
DUOX2	50506	broad.mit.edu	37	15	45387648	45387648	+	Missense_Mutation	SNP	A	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45387648A>C	uc010bea.2	-	31	4429	c.4226T>G	c.(4225-4227)ATG>AGG	p.M1409R	DUOX2_uc001zun.2_Missense_Mutation_p.M1409R	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	1409	Cytoplasmic (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CTTACACAGCATTTGGCTGCC	0.532																0.092486	18.869659	47.77771	16	157	KEEP	---	---	---	---	8	14	93	82	-1	capture	Missense_Mutation	SNP	45387648	45387648	DUOX2	15	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	4756	197
ZNF263	10127	broad.mit.edu	37	16	3339694	3339694	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3339694C>A	uc002cuq.2	+	6	1520	c.1188C>A	c.(1186-1188)CAC>CAA	p.H396Q	ZNF263_uc010uww.1_Missense_Mutation_p.H44Q|ZNF263_uc002cur.2_Missense_Mutation_p.H44Q	NM_005741	NP_005732	O14978	ZN263_HUMAN	zinc finger protein 263	396	C2H2-type 1.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(3)|ovary(1)	4						TAATTAGGCACCAGAGAATAC	0.478																0.386935	238.040178	240.265554	77	122	KEEP	---	---	---	---	49	41	68	66	0.455555555556	capture	Missense_Mutation	SNP	3339694	3339694	ZNF263	16	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	17683	197
ATF7IP2	80063	broad.mit.edu	37	16	10525310	10525310	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10525310A>G	uc002czu.2	+	3	1060	c.833A>G	c.(832-834)AAC>AGC	p.N278S	ATF7IP2_uc002czv.2_Missense_Mutation_p.N278S|ATF7IP2_uc010uyo.1_RNA|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Missense_Mutation_p.N278S|ATF7IP2_uc010uyq.1_RNA	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting	278					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						ACTAATAACAACAGTAAGTAT	0.313																0.074627	3.044578	27.926632	10	124	KEEP	---	---	---	---	6	6	67	69	-1	capture	Missense_Mutation	SNP	10525310	10525310	ATF7IP2	16	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	1079	197
AQP8	343	broad.mit.edu	37	16	25232824	25232824	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:25232824G>A	uc002doc.2	+	3	389	c.307G>A	c.(307-309)GGA>AGA	p.G103R		NM_001169	NP_001160	O94778	AQP8_HUMAN	aquaporin 8	103	Helical; (Potential).				cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)		CATGCTGATCGGAGGCCTCAA	0.627																0.437158	248.044986	248.678741	80	103	KEEP	---	---	---	---	56	37	63	68	-1	capture	Missense_Mutation	SNP	25232824	25232824	AQP8	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	825	197
TP53	7157	broad.mit.edu	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577114C>T	uc002gim.2	-	8	1018	c.824G>A	c.(823-825)TGT>TAT	p.C275Y	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.C275Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C143Y|TP53_uc010cng.1_Missense_Mutation_p.C143Y|TP53_uc002gii.1_Missense_Mutation_p.C143Y|TP53_uc010cnh.1_Missense_Mutation_p.C275Y|TP53_uc010cni.1_Missense_Mutation_p.C275Y|TP53_uc002gij.2_Missense_Mutation_p.C275Y	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	275	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		C -> S (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C275Y(44)|p.C275F(34)|p.C275G(7)|p.C275W(7)|p.0?(7)|p.C275R(6)|p.C275C(4)|p.C275fs*70(2)|p.C275fs*31(2)|p.?(2)|p.C275S(2)|p.R273_C275delRVC(1)|p.C275_A276ins10(1)|p.V274_P278del(1)|p.C275*(1)|p.F270_D281del12(1)|p.C275_R283delCACPGRDRR(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275fs*20(1)|p.A276fs*29(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGGACAGGCACAAACACGCAC	0.552	Pancreas(47;798 1329 9957 10801)		111	p.C275Y(GI1-Tumor)|p.C275F(CHAGOK1-Tumor)|p.V274fs(SCC9-Tumor)|p.C275F(JHOM2B-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.526316	88.546844	88.580831	30	27	KEEP	---	---	---	---	13	18	15	14	-1	capture	Missense_Mutation	SNP	7577114	7577114	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	16264	197
TP53	7157	broad.mit.edu	37	17	7577610	7577610	+	Splice_Site	SNP	T	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577610T>C	uc002gim.2	-	7	867	c.673_splice	c.e7-1	p.V225_splice	TP53_uc002gig.1_Splice_Site_p.V225_splice|TP53_uc002gih.2_Splice_Site_p.V225_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Splice_Site_p.V93_splice|TP53_uc010cng.1_Splice_Site_p.V93_splice|TP53_uc002gii.1_Splice_Site_p.V93_splice|TP53_uc010cnh.1_Splice_Site_p.V225_splice|TP53_uc010cni.1_Splice_Site_p.V225_splice|TP53_uc002gij.2_Splice_Site_p.V225_splice|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(22)|p.0?(7)|p.V225fs*24(1)|p.E224_V225insXX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGAGCCAACCTAGGAGATAAC	0.483	Pancreas(47;798 1329 9957 10801)		111	(MHHES1-Tumor)|(TF1-Tumor)|(NCIH1092-Tumor)|(HCC1599-Tumor)|(NCIH209-Tumor)|(OCIM1-Tumor)|(KYSE30-Tumor)|(NCIH1650-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.339623	58.937226	60.140693	18	35	KEEP	---	---	---	---	6	14	19	18	-1	capture	Splice_Site	SNP	7577610	7577610	TP53	17	T	C	C	C	1	0	0	0	0	0	0	1	0	689	53	5	3	16264	197
CCDC42	146849	broad.mit.edu	37	17	8644917	8644917	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8644917G>A	uc002gln.2	-	4	594	c.367C>T	c.(367-369)CAG>TAG	p.Q123*	CCDC42_uc002glo.2_Nonsense_Mutation_p.Q123*	NM_144681	NP_653282	Q96M95	CCD42_HUMAN	coiled-coil domain containing 42 isoform 1	123	Potential.									ovary(1)	1						GTCAGCTCCTGCATGTGCTGG	0.602																0.078947	-0.984364	19.630495	9	105	KEEP	---	---	---	---	8	4	68	71	-1	capture	Nonsense_Mutation	SNP	8644917	8644917	CCDC42	17	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	2788	197
DNAH9	1770	broad.mit.edu	37	17	11568211	11568211	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:11568211C>A	uc002gne.2	+	15	2725	c.2657C>A	c.(2656-2658)TCT>TAT	p.S886Y	DNAH9_uc010coo.2_Missense_Mutation_p.S180Y	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	886	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TATGTTAACTCTATTGACAAT	0.383																0.393617	206.796458	208.663048	74	114	KEEP	---	---	---	---	49	30	71	54	0.379746835443	capture	Missense_Mutation	SNP	11568211	11568211	DNAH9	17	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	4564	197
DHX58	79132	broad.mit.edu	37	17	40263362	40263362	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40263362G>T	uc002hyw.3	-	4	545	c.322C>A	c.(322-324)CAG>AAG	p.Q108K	DHX58_uc002hyv.3_Intron|DHX58_uc010wgf.1_Missense_Mutation_p.Q101K	NM_024119	NP_077024	Q96C10	DHX58_HUMAN	RNA helicase LGP2	108	Helicase ATP-binding.				innate immune response	cytoplasm	ATP binding|DNA binding|helicase activity|protein binding|RNA binding|zinc ion binding				0		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AGTGCCATCTGCAGAAGCTCT	0.622																0.402174	111.460754	112.229275	37	55	KEEP	---	---	---	---	21	22	28	30	0.488372093023	capture	Missense_Mutation	SNP	40263362	40263362	DHX58	17	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	4472	197
HEATR6	63897	broad.mit.edu	37	17	58137429	58137429	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:58137429G>C	uc002iyk.1	-	10	1462	c.1445C>G	c.(1444-1446)TCT>TGT	p.S482C	HEATR6_uc010ddk.1_Missense_Mutation_p.S21C|HEATR6_uc010wos.1_Missense_Mutation_p.S314C	NM_022070	NP_071353	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	482	HEAT 2.						binding			ovary(1)|skin(1)	2	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			CAAGATGGCAGATAAAACTTG	0.433																0.413265	289.747959	291.033699	81	115	KEEP	---	---	---	---	37	55	63	61	-1	capture	Missense_Mutation	SNP	58137429	58137429	HEATR6	17	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	6960	197
KCNJ16	3773	broad.mit.edu	37	17	68128948	68128948	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:68128948A>T	uc002jin.2	+	5	1206	c.720A>T	c.(718-720)TTA>TTT	p.L240F	KCNJ16_uc002jio.2_Missense_Mutation_p.L240F|KCNJ16_uc002jip.2_Missense_Mutation_p.L240F|KCNJ16_uc002jiq.2_Missense_Mutation_p.L272F	NM_018658	NP_061128	Q9NPI9	IRK16_HUMAN	potassium inwardly-rectifying channel J16	240	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Breast(10;2.96e-09)					ACCTCAAATTAGTCAACGACC	0.483																0.057471	-20.867418	32.742423	15	246	KEEP	---	---	---	---	9	6	116	149	-1	capture	Missense_Mutation	SNP	68128948	68128948	KCNJ16	17	A	T	T	T	1	0	0	0	0	1	0	0	0	193	15	4	4	7972	197
SMCHD1	23347	broad.mit.edu	37	18	2688412	2688412	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:2688412G>A	uc002klm.3	+	6	848	c.659G>A	c.(658-660)CGT>CAT	p.R220H		NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible	220					chromosome organization		ATP binding				0						GGATATGTTCGTCCAGTACCA	0.368																0.04918	-20.32875	19.122033	9	174	KEEP	---	---	---	---	3	6	101	95	-1	capture	Missense_Mutation	SNP	2688412	2688412	SMCHD1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14680	197
DSG4	147409	broad.mit.edu	37	18	28993484	28993484	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28993484G>A	uc002kwq.2	+	16	3184	c.3049G>A	c.(3049-3051)GTT>ATT	p.V1017I	DSG4_uc002kwr.2_Missense_Mutation_p.V1036I	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	1017	Cytoplasmic (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			AGGCCAAACCGTTGGCTCCAC	0.453																0.698413	293.346209	297.776676	88	38	KEEP	---	---	---	---	56	45	24	18	-1	capture	Missense_Mutation	SNP	28993484	28993484	DSG4	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4734	197
CDH19	28513	broad.mit.edu	37	18	64218401	64218401	+	Silent	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:64218401C>T	uc002lkc.1	-	5	843	c.705G>A	c.(703-705)GCG>GCA	p.A235A	CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_Silent_p.A235A|CDH19_uc002lkd.2_Silent_p.A235A	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein	235	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				TTCCAGACAACGCTCCTGGCT	0.328																0.742268	240.34247	245.501376	72	25	KEEP	---	---	---	---	42	44	14	16	-1	capture	Silent	SNP	64218401	64218401	CDH19	18	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	3075	197
FBN3	84467	broad.mit.edu	37	19	8191373	8191373	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8191373G>C	uc002mjf.2	-	19	2554	c.2533C>G	c.(2533-2535)CCC>GCC	p.P845A		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	845	TB 4.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CGTTCGCAGGGGCTCCCCCAG	0.667																0.394737	48.611518	48.981566	15	23	KEEP	---	---	---	---	7	9	13	13	-1	capture	Missense_Mutation	SNP	8191373	8191373	FBN3	19	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	5650	197
TNPO2	30000	broad.mit.edu	37	19	12825902	12825902	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12825902G>A	uc002muo.2	-	8	915	c.730C>T	c.(730-732)CGG>TGG	p.R244W	TNPO2_uc002mup.2_Missense_Mutation_p.R336W|TNPO2_uc002muq.2_Missense_Mutation_p.R244W|TNPO2_uc002mur.2_Missense_Mutation_p.R244W	NM_001136196	NP_001129668	O14787	TNPO2_HUMAN	transportin 2 (importin 3, karyopherin beta 2b)	244	HEAT 3.				intracellular protein transport	cytoplasm|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			ovary(1)	1						CTGTCAATCCGCACTTCCAGA	0.632																0.052632	-5.520611	6.530108	3	54	KEEP	---	---	---	---	2	1	31	29	-1	capture	Missense_Mutation	SNP	12825902	12825902	TNPO2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	16219	197
ZNF17	7565	broad.mit.edu	37	19	57931383	57931383	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57931383A>G	uc002qoo.1	+	3	754	c.523A>G	c.(523-525)AGG>GGG	p.R175G	ZNF547_uc002qpm.3_Intron|ZNF17_uc002qop.1_Missense_Mutation_p.R177G	NM_006959	NP_008890	P17021	ZNF17_HUMAN	zinc finger protein 17	175					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		GAAGCCACACAGGGACACTCA	0.488	Melanoma(149;1637 1853 29914 42869 44988)															0.388489	168.217566	169.731438	54	85	KEEP	---	---	---	---	34	27	45	57	-1	capture	Missense_Mutation	SNP	57931383	57931383	ZNF17	19	A	G	G	G	1	0	0	0	0	1	0	0	0	88	7	3	3	17623	197
ALLC	55821	broad.mit.edu	37	2	3727515	3727515	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:3727515G>A	uc010ewt.2	+	5	390	c.229G>A	c.(229-231)GTG>ATG	p.V77M		NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a	96							allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		GGGCTTCGACGTGGACGTTTC	0.547													HNSCC(21;0.051)			0.26776	125.015128	133.913535	49	134	KEEP	---	---	---	---	22	30	69	79	-1	capture	Missense_Mutation	SNP	3727515	3727515	ALLC	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	534	197
RAD51AP2	729475	broad.mit.edu	37	2	17696534	17696534	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:17696534C>A	uc002rcl.1	-	1	3173	c.3149G>T	c.(3148-3150)TGG>TTG	p.W1050L	RAD51AP2_uc010exn.1_Missense_Mutation_p.W1041L	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	1050										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TACAGTTTTCCATTTAAATAA	0.368																0.504587	177.215806	177.217701	55	54	KEEP	---	---	---	---	32	33	30	28	0.507692307692	capture	Missense_Mutation	SNP	17696534	17696534	RAD51AP2	2	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	12882	197
MSH6	2956	broad.mit.edu	37	2	48026087	48026087	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:48026087C>T	uc002rwd.3	+	4	1117	c.965C>T	c.(964-966)GCC>GTC	p.A322V	MSH6_uc002rwc.2_Missense_Mutation_p.A322V|MSH6_uc010fbj.2_Missense_Mutation_p.A20V|MSH6_uc010yoi.1_Missense_Mutation_p.A192V|MSH6_uc010yoj.1_Missense_Mutation_p.A20V	NM_000179	NP_000170	P52701	MSH6_HUMAN	mutS homolog 6	322					determination of adult lifespan|DNA damage response, signal transduction resulting in induction of apoptosis|isotype switching|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|response to UV|somatic hypermutation of immunoglobulin genes	MutSalpha complex	ATP binding|DNA-dependent ATPase activity|protein binding			large_intestine(53)|central_nervous_system(28)|endometrium(28)|stomach(22)|haematopoietic_and_lymphoid_tissue(9)|lung(7)|skin(6)|urinary_tract(5)|breast(5)|ovary(3)|thyroid(1)|upper_aerodigestive_tract(1)	168		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			ACGCCCTCAGCCACCAAACAA	0.473					517	Mis|N|F|S		colorectal	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				0.242991	187.731485	207.035019	78	243	KEEP	---	---	---	---	45	46	130	154	-1	capture	Missense_Mutation	SNP	48026087	48026087	MSH6	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9784	197
TSGA10	80705	broad.mit.edu	37	2	99634812	99634812	+	Silent	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:99634812C>T	uc002szg.3	-	18	2551	c.1923G>A	c.(1921-1923)AGG>AGA	p.R641R	TSGA10_uc002szh.3_Silent_p.R641R|TSGA10_uc002szi.3_Silent_p.R641R|TSGA10_uc010fin.1_Silent_p.R641R	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN	testis specific, 10	641	Interaction with HIF1A (By similarity).				spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2						CGGCCCTCTCCCTAAAGCAAA	0.323																0.434783	155.190059	155.623163	50	65	KEEP	---	---	---	---	32	26	37	35	-1	capture	Silent	SNP	99634812	99634812	TSGA10	2	C	T	T	T	1	0	0	0	0	0	0	0	1	285	22	2	2	16500	197
IL1R1	3554	broad.mit.edu	37	2	102789175	102789175	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102789175A>T	uc002tbq.2	+	9	1186	c.868A>T	c.(868-870)AGT>TGT	p.S290C	IL1R1_uc010fix.2_Missense_Mutation_p.S290C|IL1R1_uc002tbp.2_Missense_Mutation_p.S290C|IL1R1_uc002tbr.2_Missense_Mutation_p.S290C	NM_000877	NP_000868	P14778	IL1R1_HUMAN	interleukin 1 receptor, type I precursor	290	Ig-like C2-type 3.|Extracellular (Potential).				innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity|platelet-derived growth factor receptor binding			skin(1)	1					Anakinra(DB00026)	CAAAAGAAGGAGTACCCTCAT	0.348					429											0.418367	118.755048	119.325696	41	57	KEEP	---	---	---	---	25	17	27	35	-1	capture	Missense_Mutation	SNP	102789175	102789175	IL1R1	2	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	7581	197
SLC9A4	389015	broad.mit.edu	37	2	103141556	103141556	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103141556G>A	uc002tbz.3	+	10	2349	c.1892G>A	c.(1891-1893)CGC>CAC	p.R631H		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	631	Cytoplasmic (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						CTGATCCGCCGCCAGAACACC	0.507																0.47191	377.521872	377.705522	126	141	KEEP	---	---	---	---	65	72	69	81	-1	capture	Missense_Mutation	SNP	103141556	103141556	SLC9A4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14608	197
XIRP2	129446	broad.mit.edu	37	2	168103543	168103543	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:168103543C>T	uc002udx.2	+	8	5659	c.5641C>T	c.(5641-5643)CGA>TGA	p.R1881*	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Nonsense_Mutation_p.R1706*|XIRP2_uc010fpq.2_Nonsense_Mutation_p.R1659*|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1706					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ATCAAGCCATCGATGGAAAGA	0.378																0.36	135.14332	137.299084	45	80	KEEP	---	---	---	---	32	36	58	51	-1	capture	Nonsense_Mutation	SNP	168103543	168103543	XIRP2	2	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	17311	197
TTN	7273	broad.mit.edu	37	2	179431526	179431526	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179431526G>A	uc010zfg.1	-	275	71853	c.71629C>T	c.(71629-71631)CGT>TGT	p.R23877C	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R17572C|TTN_uc010zfi.1_Missense_Mutation_p.R17505C|TTN_uc010zfj.1_Missense_Mutation_p.R17380C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24804							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCTTAGACGCAAATCTGTA	0.408					8722											0.028409	-35.278972	7.835178	5	171	KEEP	---	---	---	---	2	3	106	85	-1	capture	Missense_Mutation	SNP	179431526	179431526	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16617	197
ANGPT4	51378	broad.mit.edu	37	20	870858	870858	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:870858G>A	uc002wei.2	-	2	566	c.463C>T	c.(463-465)CAG>TAG	p.Q155*	ANGPT4_uc010zpn.1_Nonsense_Mutation_p.Q149*	NM_015985	NP_057069	Q9Y264	ANGP4_HUMAN	angiopoietin 4 precursor	155	Potential.				anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			ovary(2)	2						TCTGTTACCTGAGCCTCCATG	0.607	Pancreas(181;481 2077 3259 31286 49856)															0.376623	79.815089	80.857717	29	48	KEEP	---	---	---	---	24	12	29	28	-1	capture	Nonsense_Mutation	SNP	870858	870858	ANGPT4	20	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	609	197
SIRPA	140885	broad.mit.edu	37	20	1915375	1915375	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1915375A>T	uc002wfq.2	+	8	1601	c.1241A>T	c.(1240-1242)GAG>GTG	p.E414V	SIRPA_uc010zps.1_Missense_Mutation_p.E394V|SIRPA_uc002wfr.2_Missense_Mutation_p.E414V|SIRPA_uc002wfs.2_Missense_Mutation_p.E414V|SIRPA_uc002wft.2_Missense_Mutation_p.E414V	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	414	Cytoplasmic (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CATGAGCCCGAGAAGAATGCC	0.338	GBM(155;1668 1920 5945 42733 48121)															0.079646	-0.528032	40.226165	18	208	KEEP	---	---	---	---	9	12	138	111	-1	capture	Missense_Mutation	SNP	1915375	1915375	SIRPA	20	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	14225	197
PTPRT	11122	broad.mit.edu	37	20	41385120	41385120	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:41385120C>T	uc002xkg.2	-	6	1025	c.841G>A	c.(841-843)GCG>ACG	p.A281T	PTPRT_uc010ggj.2_Missense_Mutation_p.A281T	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	281	Extracellular (Potential).|Ig-like C2-type.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				ATCAGCTCCGCGTAGTTGGAC	0.567					646											0.432836	82.148093	82.413795	29	38	KEEP	---	---	---	---	9	22	21	22	-1	capture	Missense_Mutation	SNP	41385120	41385120	PTPRT	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12707	197
TRIM71	131405	broad.mit.edu	37	3	32932739	32932739	+	Silent	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:32932739G>A	uc003cff.2	+	4	2106	c.2043G>A	c.(2041-2043)ACG>ACA	p.T681T		NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71	681	NHL 2.				multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						AGATCTTCACGTTCGAGGGCC	0.582																0.451327	155.621495	155.8529	51	62	KEEP	---	---	---	---	22	32	29	41	-1	capture	Silent	SNP	32932739	32932739	TRIM71	3	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	16427	197
AMIGO3	386724	broad.mit.edu	37	3	49756785	49756785	+	Silent	SNP	A	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49756785A>G	uc003cxj.2	-	1	454	c.114T>C	c.(112-114)TGT>TGC	p.C38C	RNF123_uc003cxh.2_Intron|RNF123_uc003cxi.2_Intron	NM_198722	NP_942015	Q86WK7	AMGO3_HUMAN	adhesion molecule with Ig-like domain 3	38	Extracellular (Potential).|LRRNT.				heterophilic cell-cell adhesion	integral to membrane				pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CAGCGCAGATACATTTGTAGG	0.647														OREG0015572	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.367925	133.805033	135.427464	39	67	KEEP	---	---	---	---	23	23	40	32	-1	capture	Silent	SNP	49756785	49756785	AMIGO3	3	A	G	G	G	1	0	0	0	0	0	0	0	1	180	14	3	3	577	197
HTR1F	3355	broad.mit.edu	37	3	88040099	88040099	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:88040099T>A	uc003dqr.2	+	2	358	c.200T>A	c.(199-201)GTC>GAC	p.V67D		NM_000866	NP_000857	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F	67	Helical; Name=2; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	serotonin binding|serotonin receptor activity			ovary(3)	3	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	TCCCTTGCAGTCACAGATTTT	0.463																0.29927	111.521317	116.454386	41	96	KEEP	---	---	---	---	40	21	67	58	-1	capture	Missense_Mutation	SNP	88040099	88040099	HTR1F	3	T	A	A	A	1	0	0	0	0	1	0	0	0	754	58	4	4	7365	197
FAM55C	91775	broad.mit.edu	37	3	101520152	101520152	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:101520152G>A	uc003dvn.2	+	5	804	c.167G>A	c.(166-168)GGA>GAA	p.G56E	FAM55C_uc010hpn.2_Missense_Mutation_p.G56E	NM_145037	NP_659474	Q969Y0	FA55C_HUMAN	hypothetical protein LOC91775 precursor	56						extracellular region				ovary(1)|pancreas(1)|skin(1)	3						CAGGTGACAGGAATTAGCCGA	0.522																0.099448	22.708141	80.934606	36	326	KEEP	---	---	---	---	19	22	175	179	-1	capture	Missense_Mutation	SNP	101520152	101520152	FAM55C	3	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	5534	197
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	Colon(199;1504 1750 3362 26421 31210 32040)	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	p.E545K(NCIH508-Tumor)|p.E545K(L363-Tumor)|p.E545K(KYSE510-Tumor)|p.E545K(MKN1-Tumor)|p.E545K(BFTC909-Tumor)|p.E545K(NCIH460-Tumor)|p.E545K(HCC202-Tumor)|p.E545K(KPL1-Tumor)|p.E545K(NCIH596-Tumor)|p.E545K(HUH28-Tumor)|p.E545K(MDAMB361-Tumor)|p.E545K(ESS1-Tumor)|p.E545K(TE5-Tumor)|p.E545K(HSC4-Tumor)|p.E545K(RERFLCSQ1-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.140187	23.145419	36.527378	15	92	KEEP	---	---	---	---	10	7	57	46	-1	capture	Missense_Mutation	SNP	178936091	178936091	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	11816	197
GABRB1	2560	broad.mit.edu	37	4	47322182	47322182	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:47322182G>T	uc003gxh.2	+	5	874	c.500G>T	c.(499-501)AGA>ATA	p.R167I	GABRB1_uc011bze.1_Missense_Mutation_p.R97I	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	167	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	GATCTTCGAAGATATCCATTG	0.418																0.258065	99.228696	107.449926	40	115	KEEP	---	---	---	---	23	26	68	75	0.469387755102	capture	Missense_Mutation	SNP	47322182	47322182	GABRB1	4	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	6108	197
HPSE	10855	broad.mit.edu	37	4	84216623	84216623	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:84216623C>G	uc003hoj.3	-	12	1605	c.1506G>C	c.(1504-1506)ATG>ATC	p.M502I	uc003hoi.2_5'Flank|HPSE_uc010ika.2_Missense_Mutation_p.M444I|HPSE_uc011ccq.1_RNA|HPSE_uc011ccr.1_RNA|HPSE_uc011ccs.1_Missense_Mutation_p.M245I|HPSE_uc011cct.1_Missense_Mutation_p.M428I|HPSE_uc003hok.3_Missense_Mutation_p.M502I	NM_001098540	NP_001092010	Q9Y251	HPSE_HUMAN	heparanase precursor	502					carbohydrate metabolic process|cell adhesion|proteoglycan metabolic process	extracellular region|lysosomal membrane|nucleus	beta-glucuronidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Heparin(DB01109)	GATCATCCACCATCTTTAGAG	0.443																0.141104	45.111807	65.369288	23	140	KEEP	---	---	---	---	13	13	75	87	-1	capture	Missense_Mutation	SNP	84216623	84216623	HPSE	4	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	7269	197
LRIT3	345193	broad.mit.edu	37	4	110791269	110791269	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110791269C>A	uc003hzx.3	+	3	1422	c.1229C>A	c.(1228-1230)GCA>GAA	p.A410E	LRIT3_uc003hzw.3_Missense_Mutation_p.A272E	NM_198506	NP_940908	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and	410						integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		TTAAAGGTGGCAAAGAATGGA	0.453																0.063636	-7.645645	14.137691	7	103	KEEP	---	---	---	---	3	6	46	59	0.666666666667	capture	Missense_Mutation	SNP	110791269	110791269	LRIT3	4	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	8865	197
MYOZ2	51778	broad.mit.edu	37	4	120072132	120072132	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:120072132G>A	uc003icp.3	+	3	395	c.182G>A	c.(181-183)CGT>CAT	p.R61H		NM_016599	NP_057683	Q9NPC6	MYOZ2_HUMAN	myozenin 2	61							protein phosphatase 2B binding				0						TTTAAGATGCGTCAAAGAAGA	0.398																0.336	117.606802	120.583437	42	83	KEEP	---	---	---	---	25	21	48	45	-1	capture	Missense_Mutation	SNP	120072132	120072132	MYOZ2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10006	197
FSTL5	56884	broad.mit.edu	37	4	162577565	162577565	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:162577565C>G	uc003iqh.2	-	7	1245	c.809G>C	c.(808-810)TGT>TCT	p.C270S	FSTL5_uc003iqi.2_Missense_Mutation_p.C269S|FSTL5_uc010iqv.2_Missense_Mutation_p.C269S	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	270	Ig-like 1.					extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TTGAATGGCACAGCTCAGAAC	0.393																0.189189	60.033432	70.044483	21	90	KEEP	---	---	---	---	14	9	54	55	-1	capture	Missense_Mutation	SNP	162577565	162577565	FSTL5	4	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	6022	197
OSMR	9180	broad.mit.edu	37	5	38904563	38904563	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:38904563T>A	uc003jln.1	+	9	1610	c.1243T>A	c.(1243-1245)TGG>AGG	p.W415R		NM_003999	NP_003990	Q99650	OSMR_HUMAN	oncostatin M receptor precursor	415	WSXWS motif.|Fibronectin type-III 1.|Extracellular (Potential).				cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)					CTTCTGGAAATGGAGTGAATG	0.488																0.277778	118.462608	124.84526	40	104	KEEP	---	---	---	---	18	30	67	68	-1	capture	Missense_Mutation	SNP	38904563	38904563	OSMR	5	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	11196	197
COX7C	1350	broad.mit.edu	37	5	85915176	85915176	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:85915176C>T	uc003kir.2	+	2	171	c.82C>T	c.(82-84)CCA>TCA	p.P28S		NM_001867	NP_001858	P15954	COX7C_HUMAN	cytochrome c oxidase subunit VIIc precursor	28	Mitochondrial matrix (By similarity).				respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	cytochrome-c oxidase activity				0		all_cancers(142;7e-06)|Lung NSC(167;0.000601)|all_lung(232;0.000693)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;1.56e-40)|Epithelial(54;3.17e-34)|all cancers(79;3.36e-29)		ACAGAATTTGCCATTTTCAGT	0.338																0.021368	-51.836862	8.104766	5	229	KEEP	---	---	---	---	4	1	148	105	-1	capture	Missense_Mutation	SNP	85915176	85915176	COX7C	5	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3749	197
PCDHA12	56137	broad.mit.edu	37	5	140255258	140255258	+	Silent	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140255258G>A	uc003lic.2	+	1	328	c.201G>A	c.(199-201)GCG>GCA	p.A67A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.A67A	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	67	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCGGGTGGCGTCCAAAAGAC	0.632	Pancreas(113;759 1672 13322 24104 50104)															0.385787	211.644978	213.898965	76	121	KEEP	---	---	---	---	51	43	78	101	-1	capture	Silent	SNP	140255258	140255258	PCDHA12	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11425	197
SH3RF2	153769	broad.mit.edu	37	5	145393533	145393533	+	Missense_Mutation	SNP	T	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:145393533T>G	uc003lnt.2	+	5	1206	c.968T>G	c.(967-969)ATC>AGC	p.I323S	SH3RF2_uc011dbl.1_Missense_Mutation_p.I323S	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	323							ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATGGTAGAGATCAGCACCCCA	0.567																0.403175	416.481331	419.056012	127	188	KEEP	---	---	---	---	60	77	93	115	-1	capture	Missense_Mutation	SNP	145393533	145393533	SH3RF2	5	T	G	G	G	1	0	0	0	0	1	0	0	0	650	50	4	4	14152	197
ITPR3	3710	broad.mit.edu	37	6	33644615	33644615	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33644615G>A	uc011drk.1	+	26	3572	c.3353G>A	c.(3352-3354)CGG>CAG	p.R1118Q		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	1118	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						GACCGGCTGCGGACCATGGTG	0.597																0.09375	4.610028	15.218388	6	58	KEEP	---	---	---	---	3	4	35	35	-1	capture	Missense_Mutation	SNP	33644615	33644615	ITPR3	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7845	197
CUL9	23113	broad.mit.edu	37	6	43164484	43164484	+	Missense_Mutation	SNP	C	A	A	rs142672693	byFrequency	TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43164484C>A	uc003ouk.2	+	11	2762	c.2687C>A	c.(2686-2688)ACG>AAG	p.T896K	CUL9_uc003oul.2_Missense_Mutation_p.T896K|CUL9_uc010jyk.2_Missense_Mutation_p.T48K	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	896					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						CTGAGAGACACGTTGTTTAGG	0.517																0.333333	218.518383	223.60452	69	138	KEEP	---	---	---	---	22	49	67	78	0.69014084507	capture	Missense_Mutation	SNP	43164484	43164484	CUL9	6	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	4021	197
ABCC10	89845	broad.mit.edu	37	6	43413522	43413522	+	Silent	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43413522G>A	uc003ouy.1	+	15	3431	c.3216G>A	c.(3214-3216)CCG>CCA	p.P1072P	ABCC10_uc003ouz.1_Silent_p.P1044P|ABCC10_uc010jyo.1_Silent_p.P178P	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	1072	ABC transmembrane type-1 2.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			TCCTGCTGCCGCCTTTGAGCA	0.662																0.454545	99.864403	99.994732	35	42	KEEP	---	---	---	---	24	15	31	23	-1	capture	Silent	SNP	43413522	43413522	ABCC10	6	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	50	197
GCM1	8521	broad.mit.edu	37	6	52993580	52993580	+	Silent	SNP	T	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:52993580T>C	uc003pbp.2	-	6	944	c.735A>G	c.(733-735)GGA>GGG	p.G245G		NM_003643	NP_003634	Q9NP62	GCM1_HUMAN	glial cells missing homolog a	245						transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			central_nervous_system(1)	1	Lung NSC(77;0.0755)					CTGTGATTCCTCCCAGACCAT	0.453																0.149254	41.806686	57.624726	20	114	KEEP	---	---	---	---	10	11	70	58	-1	capture	Silent	SNP	52993580	52993580	GCM1	6	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	6237	197
LGSN	51557	broad.mit.edu	37	6	63990360	63990360	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:63990360G>A	uc003peh.2	-	4	1130	c.1096C>T	c.(1096-1098)CGA>TGA	p.R366*	LGSN_uc003pei.2_3'UTR	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	366					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	TAACGCTTTCGGCAGCTAACA	0.478																0.43007	403.282015	404.501181	123	163	KEEP	---	---	---	---	70	60	97	79	-1	capture	Nonsense_Mutation	SNP	63990360	63990360	LGSN	6	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	8679	197
PHF3	23469	broad.mit.edu	37	6	64422167	64422167	+	Silent	SNP	A	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:64422167A>G	uc003pep.1	+	15	4709	c.4683A>G	c.(4681-4683)AGA>AGG	p.R1561R	PHF3_uc003pen.2_Silent_p.R1473R|PHF3_uc011dxs.1_Silent_p.R830R	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3	1561					multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			TTAGTCTCAGAGGTAAGCCAC	0.353	GBM(135;136 1820 29512 34071 46235)				350											0.121212	30.303691	48.863522	16	116	KEEP	---	---	---	---	9	9	69	62	-1	capture	Silent	SNP	64422167	64422167	PHF3	6	A	G	G	G	1	0	0	0	0	0	0	0	1	141	11	3	3	11739	197
SEC63	11231	broad.mit.edu	37	6	108250659	108250659	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:108250659G>A	uc003psc.3	-	2	453	c.184C>T	c.(184-186)CGG>TGG	p.R62W		NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein	62	Cytoplasmic (Potential).				protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TTTAATAACCGTAAACGATAC	0.299																0.4	221.365209	222.939126	72	108	KEEP	---	---	---	---	38	50	70	59	-1	capture	Missense_Mutation	SNP	108250659	108250659	SEC63	6	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	13898	197
SLC22A2	6582	broad.mit.edu	37	6	160663362	160663362	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160663362C>A	uc003qtf.2	-	8	1522	c.1352G>T	c.(1351-1353)TGC>TTC	p.C451F	SLC22A2_uc003qte.1_Missense_Mutation_p.C451F	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2	451	Helical; (Potential).	Involved in recognition of organic cations and participates in structural changes that occur during translocation of organic cations (By similarity).			body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		ATTGACCAGGCAGACTATCTC	0.438																0.286325	184.146285	193.721231	67	167	KEEP	---	---	---	---	27	49	93	105	0.644736842105	capture	Missense_Mutation	SNP	160663362	160663362	SLC22A2	6	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	14343	197
DGKB	1607	broad.mit.edu	37	7	14733777	14733777	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:14733777C>T	uc003ssz.2	-	8	821	c.634G>A	c.(634-636)GGA>AGA	p.G212R	DGKB_uc011jxt.1_Missense_Mutation_p.G205R|DGKB_uc003sta.2_Missense_Mutation_p.G212R|DGKB_uc011jxu.1_Missense_Mutation_p.G212R|DGKB_uc011jxv.1_Missense_Mutation_p.G212R	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	212	EF-hand 2.|2 (Potential).				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	GACACGGTTCCATCATGATCA	0.418					800											0.2	14.902667	17.834912	7	28	KEEP	---	---	---	---	6	2	18	16	-1	capture	Missense_Mutation	SNP	14733777	14733777	DGKB	7	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	4424	197
TRA2A	29896	broad.mit.edu	37	7	23552560	23552560	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:23552560G>C	uc003swi.2	-	4	692	c.478C>G	c.(478-480)CGA>GGA	p.R160G	TRA2A_uc011jzb.1_RNA|TRA2A_uc011jzc.1_Missense_Mutation_p.R59G|TRA2A_uc011jzd.1_Missense_Mutation_p.R59G|TRA2A_uc010kuo.1_RNA	NM_013293	NP_037425	Q13595	TRA2A_HUMAN	transformer-2 alpha	160	RRM.				nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1						GCAAATCCTCGAGATCGCCCA	0.378	Pancreas(121;2137 2973 46590)															0.201835	121.694111	139.686116	44	174	KEEP	---	---	---	---	20	30	98	107	-1	capture	Missense_Mutation	SNP	23552560	23552560	TRA2A	7	G	C	C	C	1	0	0	0	0	1	0	0	0	480	37	4	4	16316	197
GHRHR	2692	broad.mit.edu	37	7	31009513	31009513	+	Silent	SNP	C	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31009513C>A	uc003tbx.2	+	4	348	c.300C>A	c.(298-300)GGC>GGA	p.G100G	GHRHR_uc003tbw.1_Silent_p.G100G|GHRHR_uc003tby.2_Silent_p.G36G|GHRHR_uc003tbz.2_Translation_Start_Site	NM_000823	NP_000814	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	100	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation|positive regulation of growth hormone secretion|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of multicellular organism growth|response to estrogen stimulus|response to glucocorticoid stimulus	cell surface|integral to membrane|nuclear inner membrane|nuclear matrix|nuclear outer membrane|plasma membrane|stored secretory granule	growth factor binding|growth hormone-releasing hormone receptor activity|peptide hormone binding			ovary(2)|lung(1)|breast(1)|large_intestine(1)	5					Sermorelin(DB00010)	CTATCACTGGCTGGTCTGAGC	0.582																0.156667	80.514361	114.28222	47	253	KEEP	---	---	---	---	34	25	197	205	0.423728813559	capture	Silent	SNP	31009513	31009513	GHRHR	7	C	A	A	A	1	0	0	0	0	0	0	0	1	353	28	4	4	6312	197
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	A	A	rs149840192		TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>A	uc003tqk.2	+	7	1112	c.866C>A	c.(865-867)GCC>GAC	p.A289D	EGFR_uc003tqh.2_Missense_Mutation_p.A289D|EGFR_uc003tqi.2_Missense_Mutation_p.A289D|EGFR_uc003tqj.2_Missense_Mutation_p.A289D|EGFR_uc010kzg.1_Missense_Mutation_p.A244D|EGFR_uc011kco.1_Missense_Mutation_p.A236D|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592			8	p.A289V(HEC6-Tumor)|p.A289D(HS683-Tumor)|p.A289V(RL952-Tumor)	608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.925293	2864.44288	3037.839104	867	70	KEEP	---	---	---	---	459	467	30	42	0.504319654428	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	4922	197
PCLO	27445	broad.mit.edu	37	7	82474620	82474620	+	Silent	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82474620G>A	uc003uhx.2	-	13	14302	c.14013C>T	c.(14011-14013)CCC>CCT	p.P4671P	PCLO_uc003uhv.2_Silent_p.P4671P|PCLO_uc003uht.1_Silent_p.P122P|PCLO_uc003uhu.1_Silent_p.P101P	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	4559					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TGCTCACTGAGGGGGACCCTG	0.488																0.260563	101.905796	109.277919	37	105	KEEP	---	---	---	---	17	24	54	74	-1	capture	Silent	SNP	82474620	82474620	PCLO	7	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	11486	197
STEAP4	79689	broad.mit.edu	37	7	87913202	87913202	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87913202G>A	uc003ujs.2	-	2	488	c.383C>T	c.(382-384)GCC>GTC	p.A128V	STEAP4_uc010lek.2_Missense_Mutation_p.A128V|STEAP4_uc003ujt.2_Missense_Mutation_p.A128V	NM_024636	NP_078912	Q687X5	STEA4_HUMAN	tumor necrosis factor, alpha-induced protein 9	128					fat cell differentiation|ion transport|iron ion homeostasis	Golgi membrane|integral to membrane|plasma membrane	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	Esophageal squamous(14;0.00802)					TACCACGTGGGCTCCTGGCAC	0.428																0.021236	-114.894175	17.76886	11	507	KEEP	---	---	---	---	3	9	264	295	-1	capture	Missense_Mutation	SNP	87913202	87913202	STEAP4	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15170	197
ZNF655	79027	broad.mit.edu	37	7	99170930	99170930	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99170930G>T	uc003urh.2	+	3	1592	c.1199G>T	c.(1198-1200)AGA>ATA	p.R400I	ZNF655_uc010lga.2_Missense_Mutation_p.R435I|ZNF655_uc010lgc.2_Missense_Mutation_p.R435I|ZNF655_uc003urj.2_Missense_Mutation_p.R400I|ZNF655_uc003urk.2_Missense_Mutation_p.R237I|ZNF655_uc010lgd.2_Missense_Mutation_p.R237I	NM_138494	NP_612503	Q8N720	ZN655_HUMAN	zinc finger protein 655 isoform a	400	C2H2-type 5.				G1 phase|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					CAGCATCAAAGAATTCACACA	0.353																0.118321	30.717941	68.244822	31	231	KEEP	---	---	---	---	20	12	120	122	0.625	capture	Missense_Mutation	SNP	99170930	99170930	ZNF655	7	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	17946	197
RELN	5649	broad.mit.edu	37	7	103368622	103368622	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103368622T>C	uc003vca.2	-	7	849	c.689A>G	c.(688-690)CAG>CGG	p.Q230R	RELN_uc010liz.2_Missense_Mutation_p.Q230R	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	230					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CGCGCCACACTGTTCTCCAGT	0.458	NSCLC(146;835 1944 15585 22231 52158)															0.203065	123.426082	144.797868	53	208	KEEP	---	---	---	---	25	38	119	119	-1	capture	Missense_Mutation	SNP	103368622	103368622	RELN	7	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	13115	197
TAS2R16	50833	broad.mit.edu	37	7	122635067	122635067	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:122635067G>T	uc003vkl.1	-	1	688	c.622C>A	c.(622-624)CAA>AAA	p.Q208K		NM_016945	NP_058641	Q9NYV7	T2R16_HUMAN	taste receptor T2R16	208	Cytoplasmic (Potential).				detection of chemical stimulus involved in sensory perception of bitter taste	endoplasmic reticulum|external side of plasma membrane|trans-Golgi network	bitter taste receptor activity|protein binding			ovary(1)|skin(1)	2						CTATGATGTTGTATCTGCTTG	0.463																0.196491	132.624095	157.094451	56	229	KEEP	---	---	---	---	33	33	124	127	0.5	capture	Missense_Mutation	SNP	122635067	122635067	TAS2R16	7	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	15457	197
TRPV6	55503	broad.mit.edu	37	7	142575732	142575732	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142575732T>C	uc003wbx.1	-	2	392	c.176A>G	c.(175-177)CAG>CGG	p.Q59R	TRPV6_uc003wbw.1_5'Flank|TRPV6_uc010lou.1_5'UTR	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	59	ANK 1.|Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					GTTCAGGGCCTGGACATCATT	0.493																0.101983	36.024614	91.799337	36	317	KEEP	---	---	---	---	22	24	190	193	-1	capture	Missense_Mutation	SNP	142575732	142575732	TRPV6	7	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	16483	197
DCTN6	10671	broad.mit.edu	37	8	30040689	30040689	+	Nonstop_Mutation	SNP	A	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30040689A>C	uc003xhy.2	+	7	660	c.573A>C	c.(571-573)TAA>TAC	p.*191Y		NM_006571	NP_006562	O00399	DCTN6_HUMAN	dynactin 6	191						centrosome	transferase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(542;0.099)|Kidney(114;0.119)		TAAAGAACTAAGAACAGTGTA	0.378																0.244186	50.028173	55.159977	21	65	KEEP	---	---	---	---	12	11	28	42	-1	capture	Nonstop_Mutation	SNP	30040689	30040689	DCTN6	8	A	C	C	C	1	0	0	0	0	0	0	0	0	37	3	5	4	4270	197
PLEKHA2	59339	broad.mit.edu	37	8	38826181	38826181	+	Silent	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:38826181C>T	uc003xmi.3	+	11	1143	c.909C>T	c.(907-909)CAC>CAT	p.H303H	PLEKHA2_uc011lce.1_Silent_p.H253H	NM_021623	NP_067636	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A	303					positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding				0		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			TCAAGTGCCACCCCAGAGTAA	0.498																0.25641	78.363043	84.614367	30	87	KEEP	---	---	---	---	14	17	47	52	-1	capture	Silent	SNP	38826181	38826181	PLEKHA2	8	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	11959	197
ANK1	286	broad.mit.edu	37	8	41543721	41543721	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:41543721T>A	uc003xok.2	-	36	4423	c.4339A>T	c.(4339-4341)AGT>TGT	p.S1447C	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.S763C|ANK1_uc003xoi.2_Missense_Mutation_p.S1447C|ANK1_uc003xoj.2_Missense_Mutation_p.S1447C|ANK1_uc003xol.2_Missense_Mutation_p.S1447C|ANK1_uc003xom.2_Missense_Mutation_p.S1488C	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	1447	55 kDa regulatory domain.|Death.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			AAGGCCACACTCTGCTCCAAC	0.557																0.291262	79.408018	83.428572	30	73	KEEP	---	---	---	---	16	15	33	43	-1	capture	Missense_Mutation	SNP	41543721	41543721	ANK1	8	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	617	197
IL7	3574	broad.mit.edu	37	8	79645969	79645969	+	Silent	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:79645969C>T	uc003ybg.2	-	6	1114	c.513G>A	c.(511-513)TTG>TTA	p.L171L	IL7_uc003ybe.2_Silent_p.L86L|IL7_uc011lfm.1_RNA|IL7_uc003ybh.2_RNA|IL7_uc003ybi.3_RNA	NM_000880	NP_000871	P13232	IL7_HUMAN	interleukin 7 precursor	171					bone resorption|cell-cell signaling|humoral immune response|organ morphogenesis|positive regulation of B cell proliferation|positive regulation of T cell differentiation	extracellular space	cytokine activity|growth factor activity|interleukin-7 receptor binding				0						TAGTGCCCATCAAAATTTTAT	0.323																0.025862	-48.173086	9.591785	6	226	KEEP	---	---	---	---	2	4	128	133	-1	capture	Silent	SNP	79645969	79645969	IL7	8	C	T	T	T	1	0	0	0	0	0	0	0	1	376	29	2	2	7627	197
RGS22	26166	broad.mit.edu	37	8	101016271	101016271	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:101016271C>T	uc003yjb.1	-	17	2705	c.2510G>A	c.(2509-2511)CGA>CAA	p.R837Q	RGS22_uc003yja.1_Missense_Mutation_p.R656Q|RGS22_uc003yjc.1_Missense_Mutation_p.R825Q|RGS22_uc011lgz.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	837					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ATATTCTGTTCGTTTAGAGAC	0.353					790											0.316901	126.986996	131.24194	45	97	KEEP	---	---	---	---	28	25	61	48	-1	capture	Missense_Mutation	SNP	101016271	101016271	RGS22	8	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13197	197
SMARCA2	6595	broad.mit.edu	37	9	2029232	2029232	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:2029232G>C	uc003zhc.2	+	2	309	c.210G>C	c.(208-210)ATG>ATC	p.M70I	SMARCA2_uc003zhd.2_Missense_Mutation_p.M70I|SMARCA2_uc010mha.2_Missense_Mutation_p.M61I	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	70					chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		AGGAAGGCATGCATCAAATGC	0.493																0.4125	116.659785	117.19502	33	47	KEEP	---	---	---	---	13	29	22	28	-1	capture	Missense_Mutation	SNP	2029232	2029232	SMARCA2	9	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	14661	197
IL33	90865	broad.mit.edu	37	9	6251142	6251142	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:6251142A>G	uc003zjt.2	+	4	277	c.220A>G	c.(220-222)AGA>GGA	p.R74G	IL33_uc011lmg.1_Missense_Mutation_p.R74G|IL33_uc011lmh.1_Intron|IL33_uc003zju.1_Missense_Mutation_p.R74G	NM_033439	NP_254274	O95760	IL33_HUMAN	interleukin 33 precursor	74					positive regulation of chemokine secretion|positive regulation of inflammatory response|positive regulation of macrophage activation|positive regulation of transcription from RNA polymerase II promoter	extracellular space	cytokine activity				0		Acute lymphoblastic leukemia(23;0.158)|Prostate(43;0.167)		GBM - Glioblastoma multiforme(50;0.0161)|Lung(218;0.105)		GTCTGCAGGTAGAAAGCACAA	0.493																0.278571	124.568205	130.741227	39	101	KEEP	---	---	---	---	21	19	54	58	-1	capture	Missense_Mutation	SNP	6251142	6251142	IL33	9	A	G	G	G	1	0	0	0	0	1	0	0	0	192	15	3	3	7616	197
ZNF484	83744	broad.mit.edu	37	9	95610513	95610513	+	Nonsense_Mutation	SNP	C	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95610513C>A	uc004asu.1	-	5	705	c.556G>T	c.(556-558)GAG>TAG	p.E186*	ANKRD19_uc004asr.3_Intron|ZNF484_uc011lub.1_Nonsense_Mutation_p.E188*|ZNF484_uc010mrb.1_Nonsense_Mutation_p.E150*|ZNF484_uc004asv.1_Nonsense_Mutation_p.E150*	NM_031486	NP_113674	Q5JVG2	ZN484_HUMAN	zinc finger protein 484 isoform a	186					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATGATAGGCTCCAAATTCTTT	0.343																0.295567	304.955173	320.127249	120	286	KEEP	---	---	---	---	76	54	151	154	0.415384615385	capture	Nonsense_Mutation	SNP	95610513	95610513	ZNF484	9	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	17816	197
ZNF462	58499	broad.mit.edu	37	9	109687562	109687562	+	Missense_Mutation	SNP	C	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:109687562C>G	uc004bcz.2	+	3	1658	c.1369C>G	c.(1369-1371)CAC>GAC	p.H457D	ZNF462_uc010mto.2_Missense_Mutation_p.H305D|ZNF462_uc004bda.2_Missense_Mutation_p.H305D	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	457	C2H2-type 4.				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						CATCTCTCGTCACATAGAAAA	0.438																0.30888	263.886643	272.327278	80	179	KEEP	---	---	---	---	52	33	90	109	-1	capture	Missense_Mutation	SNP	109687562	109687562	ZNF462	9	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	17805	197
FAM129B	64855	broad.mit.edu	37	9	130289580	130289580	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130289580C>T	uc004brh.2	-	3	410	c.208G>A	c.(208-210)GTC>ATC	p.V70I	FAM129B_uc004bri.2_Missense_Mutation_p.V57I|FAM129B_uc004brj.3_Missense_Mutation_p.V70I	NM_022833	NP_073744	Q96TA1	NIBL1_HUMAN	hypothetical protein LOC64855 isoform 1	70	PH.						protein binding				0						CCCGAGAAGACGATGCGCTCG	0.637																0.324324	66.508952	68.518084	24	50	KEEP	---	---	---	---	16	15	33	23	-1	capture	Missense_Mutation	SNP	130289580	130289580	FAM129B	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5391	197
PAEP	5047	broad.mit.edu	37	9	138453719	138453719	+	Silent	SNP	C	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138453719C>A	uc004cge.1	+	1	116	c.72C>A	c.(70-72)ACC>ACA	p.T24T	PAEP_uc010naw.1_Silent_p.T24T|PAEP_uc010naz.2_RNA|PAEP_uc010nay.2_Silent_p.T24T|PAEP_uc010nba.1_Silent_p.T24T|PAEP_uc004cgd.1_Silent_p.T24T|PAEP_uc011mdp.1_Silent_p.T24T|PAEP_uc004cgg.1_Silent_p.T24T|PAEP_uc010nbc.1_Silent_p.T24T|PAEP_uc004cgf.1_Silent_p.T24T	NM_001018049	NP_001018059	P09466	PAEP_HUMAN	glycodelin precursor	24					multicellular organismal development	extracellular region	binding|transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		TCCCCCAGACCAAGCAGGACC	0.682																0.384615	14.971672	15.123516	5	8	KEEP	---	---	---	---	4	2	2	6	0.333333333333	capture	Silent	SNP	138453719	138453719	PAEP	9	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	11286	197
MXRA5	25878	broad.mit.edu	37	X	3235331	3235331	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3235331C>T	uc004crg.3	-	6	6548	c.6391G>A	c.(6391-6393)GCG>ACG	p.A2131T		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2131	Ig-like C2-type 5.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GTCCTGCGCGCGGAGCCTACC	0.662																0.282051	29.512055	31.174479	11	28	KEEP	---	---	---	---	10	3	15	19	-1	capture	Missense_Mutation	SNP	3235331	3235331	MXRA5	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9913	197
MAGEB6	158809	broad.mit.edu	37	X	26212996	26212996	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:26212996C>T	uc004dbr.2	+	2	1182	c.1033C>T	c.(1033-1035)CGG>TGG	p.R345W	MAGEB6_uc010ngc.1_Missense_Mutation_p.R125W	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	345	MAGE.									ovary(3)	3						CGTGGTTTACCGGCAGGTGTG	0.498																0.085044	8.538362	68.074644	29	312	KEEP	---	---	---	---	12	25	288	259	-1	capture	Missense_Mutation	SNP	26212996	26212996	MAGEB6	23	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	9093	197
USP9X	8239	broad.mit.edu	37	X	41075579	41075579	+	Missense_Mutation	SNP	G	C	C			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:41075579G>C	uc004dfb.2	+	35	6392	c.5759G>C	c.(5758-5760)TGT>TCT	p.C1920S	USP9X_uc004dfc.2_Missense_Mutation_p.C1920S	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	1920					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						AAAAACCAGTGTTTTGGTGGA	0.388	Ovarian(172;1807 2695 35459 49286)															0.078689	8.544752	63.860063	24	281	KEEP	---	---	---	---	10	14	153	148	-1	capture	Missense_Mutation	SNP	41075579	41075579	USP9X	23	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	16972	197
SSX7	280658	broad.mit.edu	37	X	52677324	52677324	+	Silent	SNP	A	G	G			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:52677324A>G	uc004dqx.1	-	6	612	c.453T>C	c.(451-453)ATT>ATC	p.I151I		NM_173358	NP_775494	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	151					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding			skin(1)	1	Ovarian(276;0.236)					ATGTCTTGTTAATCTTCTCAG	0.512																0.054795	-30.975441	60.387419	24	414	KEEP	---	---	---	---	15	13	220	215	-1	capture	Silent	SNP	52677324	52677324	SSX7	23	A	G	G	G	1	0	0	0	0	0	0	0	1	164	13	3	3	15099	197
KIAA2022	340533	broad.mit.edu	37	X	73963402	73963402	+	Silent	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:73963402C>T	uc004eby.2	-	3	1607	c.990G>A	c.(988-990)CAG>CAA	p.Q330Q		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	330					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						GGGCATCTTCCTGCATCAAAA	0.448					126											0.02	-77.912881	12.58726	7	343	KEEP	---	---	---	---	5	2	186	192	-1	capture	Silent	SNP	73963402	73963402	KIAA2022	23	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	8191	197
KIAA1210	57481	broad.mit.edu	37	X	118220581	118220581	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:118220581C>T	uc004era.3	-	11	4612	c.4612G>A	c.(4612-4614)GTT>ATT	p.V1538I		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	1538										ovary(4)|skin(1)	5						TTATCTGCAACGTAAGATATT	0.507																0.277228	224.851092	238.334285	84	219	KEEP	---	---	---	---	45	50	136	103	-1	capture	Missense_Mutation	SNP	118220581	118220581	KIAA1210	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8136	197
DCAF12L1	139170	broad.mit.edu	37	X	125686304	125686304	+	Silent	SNP	C	T	T	rs141018282		TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125686304C>T	uc004eul.2	-	1	539	c.288G>A	c.(286-288)ACG>ACA	p.T96T		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	96										skin(3)|ovary(1)	4						CCTTGTTGACCGTGCCCAGCT	0.657																0.25625	113.71069	122.323119	41	119	KEEP	---	---	---	---	32	15	71	65	-1	capture	Silent	SNP	125686304	125686304	DCAF12L1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4223	197
MAGEA10	4109	broad.mit.edu	37	X	151303934	151303934	+	Silent	SNP	G	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151303934G>A	uc004ffk.2	-	5	567	c.159C>T	c.(157-159)CCC>CCT	p.P53P	MAGEA10_uc004ffl.2_Silent_p.P53P	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	53											0	Acute lymphoblastic leukemia(192;6.56e-05)					aggaggaggagggaaaagagg	0.418																0.032864	-36.271634	14.476555	7	206	KEEP	---	---	---	---	6	1	116	102	-1	capture	Silent	SNP	151303934	151303934	MAGEA10	23	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	9078	197
RENBP	5973	broad.mit.edu	37	X	153209567	153209567	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153209567C>A	uc004fjo.1	-	3	348	c.178G>T	c.(178-180)GAT>TAT	p.D60Y	RENBP_uc011mzh.1_Missense_Mutation_p.D60Y	NM_002910	NP_002901	P51606	RENBP_HUMAN	renin binding protein	60					mannose metabolic process|regulation of blood pressure		endopeptidase inhibitor activity|mannose-6-phosphate isomerase activity|N-acylglucosamine 2-epimerase activity			ovary(1)|pancreas(1)	2	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	TTGAGGTCATCATACACCCGC	0.632																0.08046	-1.74112	13.874577	7	80	KEEP	---	---	---	---	7	6	51	58	0.461538461538	capture	Missense_Mutation	SNP	153209567	153209567	RENBP	23	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	13120	197
OR5D16	390144	broad.mit.edu	37	11	55606949	55606950	+	Frame_Shift_Ins	INS	-	CACCT	CACCT			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55606949_55606950insCACCT	uc010rio.1	+	1	722_723	c.722_723insCACCT	c.(721-723)TCCfs	p.S241fs		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				AAAGTCTTCTCCACCTGTGCCT	0.490																0.17			41	197		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	55606949	55606950	OR5D16	11	-	CACCT	CACCT	CACCT	1	0	1	1	0	0	0	0	0	390	30	5	5	11060	197
KCNK16	83795	broad.mit.edu	37	6	39282798	39282814	+	Frame_Shift_Del	DEL	TGGATATGGGGAAGTCC	-	-	rs11756091;rs147542213	byFrequency;by1000genomes;byFrequency	TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:39282798_39282814delTGGATATGGGGAAGTCC	uc003ooq.2	-	6	908_924	c.894_910delGGACTTCCCCATATCCA	c.(892-912)CAGGACTTCCCCATATCCAAGfs	p.Q298fs	KCNK17_uc003ooo.2_5'Flank|KCNK17_uc003oop.2_5'Flank|KCNK16_uc003oor.3_3'UTR|KCNK16_uc010jwy.2_Frame_Shift_Del_p.Q251fs	NM_032115	NP_115491	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	298_304	Cytoplasmic (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(1)	3						AGTCCTTTCTTGGATATGGGGAAGTCCTGGGGTGTGA	0.590																0.06			12	200		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	39282798	39282814	KCNK16	6	TGGATATGGGGAAGTCC	-	-	-	1	0	1	0	1	0	0	0	0	819	63	5	5	7985	197
SLC9A7	84679	broad.mit.edu	37	X	46491045	46491047	+	In_Frame_Del	DEL	GTT	-	-			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:46491045_46491047delGTT	uc004dgu.1	-	14	1719_1721	c.1711_1713delAAC	c.(1711-1713)AACdel	p.N571del		NM_032591	NP_115980	Q96T83	SL9A7_HUMAN	solute carrier family 9, member 7	571					regulation of pH	Golgi membrane|integral to membrane|recycling endosome membrane|trans-Golgi network	potassium:hydrogen antiporter activity|protein homodimerization activity|sodium:hydrogen antiporter activity			ovary(2)	2						GAAAGCTGTCGTTGTTGGGTGGT	0.384	Pancreas(118;454 1696 1930 13865 39976)															0.36			27	49		---	---	---	---						capture_indel	In_Frame_Del	DEL	46491045	46491047	SLC9A7	23	GTT	-	-	-	1	0	1	0	1	0	0	0	0	516	40	5	5	14611	197
PAK3	5063	broad.mit.edu	37	X	110406206	110406208	+	In_Frame_Del	DEL	GAA	-	-			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:110406206_110406208delGAA	uc004epa.2	+	6	604_606	c.577_579delGAA	c.(577-579)GAAdel	p.E197del	PAK3_uc010npt.1_In_Frame_Del_p.E182del|PAK3_uc010npu.1_In_Frame_Del_p.E182del|PAK3_uc004eoy.1_5'UTR|PAK3_uc004eoz.2_In_Frame_Del_p.E182del|PAK3_uc011mst.1_RNA|PAK3_uc010npv.1_In_Frame_Del_p.E218del|PAK3_uc010npw.1_In_Frame_Del_p.E203del	NM_001128173	NP_001121645	O75914	PAK3_HUMAN	p21-activated kinase 3 isoform d	197	Linker.				multicellular organismal development		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding			lung(6)|ovary(3)|large_intestine(1)	10						agatgaagaggaagaagaagaag	0.325					137								TSP Lung(19;0.15)			0.02			7	385		---	---	---	---						capture_indel	In_Frame_Del	DEL	110406206	110406208	PAK3	23	GAA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	11306	197
USP26	83844	broad.mit.edu	37	X	132160788	132160788	+	Frame_Shift_Del	DEL	A	-	-			TCGA-27-1838-01	TCGA-27-1838-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:132160788delA	uc010nrm.1	-	6	1931	c.1461delT	c.(1459-1461)TTTfs	p.F487fs	USP26_uc011mvf.1_Frame_Shift_Del_p.F487fs	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26	487					protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity	p.G488fs*6(2)|p.F487fs*7(1)		lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8	Acute lymphoblastic leukemia(192;0.000127)					CTTCTGCTCCAAAAAAAAGAT	0.383	NSCLC(104;342 1621 36940 47097 52632)															0.01			8	774		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	132160788	132160788	USP26	23	A	-	-	-	1	0	1	0	1	0	0	0	0	63	5	5	5	16939	197
