Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SCNN1D	6339	broad.mit.edu	37	1	1222931	1222931	+	Missense_Mutation	SNP	A	G	G			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1222931A>G	uc001adu.1	+	9	1486	c.862A>G	c.(862-864)ACG>GCG	p.T288A	SCNN1D_uc001adt.1_Missense_Mutation_p.T452A|SCNN1D_uc001adw.2_Missense_Mutation_p.T354A|SCNN1D_uc001adx.2_Silent_p.T51T|SCNN1D_uc001adv.2_Missense_Mutation_p.T288A	NM_002978	NP_002969			sodium channel, nonvoltage-gated 1, delta												0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		CAGCTGCTACACGGTCGATGG	0.677																0.186047	18.376644	22.346946	8	35	KEEP	---	---	---	---	5	3	22	30	-1	capture	Missense_Mutation	SNP	1222931	1222931	SCNN1D	1	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	13822	209
ACTL8	81569	broad.mit.edu	37	1	18152553	18152553	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:18152553G>A	uc001bat.2	+	3	856	c.640G>A	c.(640-642)GTG>ATG	p.V214M		NM_030812	NP_110439	Q9H568	ACTL8_HUMAN	actin-like 8	214						cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		CAAGTGCTACGTGCCGCAGAA	0.567														OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.1	4.869754	14.40245	6	54	KEEP	---	---	---	---	2	4	23	34	-1	capture	Missense_Mutation	SNP	18152553	18152553	ACTL8	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	202	209
SCMH1	22955	broad.mit.edu	37	1	41514522	41514522	+	Silent	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:41514522G>A	uc001cgo.2	-	11	1427	c.1116C>T	c.(1114-1116)CAC>CAT	p.H372H	SCMH1_uc010ojr.1_Silent_p.H214H|SCMH1_uc001cgp.2_Silent_p.H311H|SCMH1_uc001cgr.2_Silent_p.H311H|SCMH1_uc001cgs.2_Silent_p.H382H|SCMH1_uc001cgt.2_Silent_p.H311H|SCMH1_uc001cgq.2_Silent_p.H325H|SCMH1_uc010ojs.1_RNA	NM_001031694	NP_001026864	Q96GD3	SCMH1_HUMAN	sex comb on midleg 1 isoform 1	372					anatomical structure morphogenesis|gene silencing|multicellular organismal development|negative regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				TCTTATCTAAGTGGGGGCCTG	0.493																0.16	35.152024	48.888555	20	105	KEEP	---	---	---	---	8	12	45	67	-1	capture	Silent	SNP	41514522	41514522	SCMH1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	13801	209
CPT2	1376	broad.mit.edu	37	1	53666396	53666396	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53666396C>T	uc001cvb.3	+	2	673	c.158C>T	c.(157-159)CCT>CTT	p.P53L		NM_000098	NP_000089	P23786	CPT2_HUMAN	carnitine O-palmitoyltransferase precursor	53	Mitochondrial matrix (By similarity).				carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	mitochondrial inner membrane	carnitine O-palmitoyltransferase activity				0					L-Carnitine(DB00583)|Perhexiline(DB01074)	CCCAGGCTGCCTATTCCCAAA	0.433																0.17284	31.298306	39.487087	14	67	KEEP	---	---	---	---	8	9	38	39	-1	capture	Missense_Mutation	SNP	53666396	53666396	CPT2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	3799	209
FLG	2312	broad.mit.edu	37	1	152284782	152284782	+	Silent	SNP	C	T	T	rs146300888	byFrequency	TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152284782C>T	uc001ezu.1	-	3	2616	c.2580G>A	c.(2578-2580)TCG>TCA	p.S860S	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	860	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCTATCTACCGATTGCTCGT	0.587												Ichthyosis				0.145873	131.642219	194.393933	76	445	KEEP	---	---	---	---	47	38	274	219	-1	capture	Silent	SNP	152284782	152284782	FLG	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5867	209
PKLR	5313	broad.mit.edu	37	1	155264053	155264053	+	Silent	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155264053C>T	uc001fkb.3	-	7	1128	c.1089G>A	c.(1087-1089)GCG>GCA	p.A363A	RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Silent_p.A332A	NM_000298	NP_000289	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC isoform 1	363					endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity			skin(4)|ovary(1)	5	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	CAGGCTTGCCCGCCAAGTTGC	0.577																0.113208	6.921861	14.737547	6	47	KEEP	---	---	---	---	4	3	24	28	-1	capture	Silent	SNP	155264053	155264053	PKLR	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11879	209
MPZL1	9019	broad.mit.edu	37	1	167757139	167757139	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167757139C>T	uc001geo.2	+	6	993	c.791C>T	c.(790-792)GCG>GTG	p.A264V	MPZL1_uc001gep.2_3'UTR|MPZL1_uc001geq.2_Missense_Mutation_p.A114V|MPZL1_uc009wvh.2_RNA	NM_003953	NP_003944	O95297	MPZL1_HUMAN	myelin protein zero-like 1 isoform a	264	ITIM motif 2.|Cytoplasmic (Potential).				cell-cell signaling|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	protein binding|structural molecule activity			ovary(2)	2	all_hematologic(923;0.215)					GTGGTGTATGCGGATATCCGA	0.448																0.097561	-0.231718	6.737924	4	37	KEEP	---	---	---	---	1	3	13	25	-1	capture	Missense_Mutation	SNP	167757139	167757139	MPZL1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9661	209
HMCN1	83872	broad.mit.edu	37	1	185956672	185956672	+	Missense_Mutation	SNP	C	G	G			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:185956672C>G	uc001grq.1	+	20	3273	c.3044C>G	c.(3043-3045)TCC>TGC	p.S1015C	HMCN1_uc001grr.1_Missense_Mutation_p.S356C	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1015	Ig-like C2-type 7.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GTCATCTGGTCCAAGGTAAAT	0.458																0.113208	9.50992	17.33464	6	47	KEEP	---	---	---	---	2	4	19	32	-1	capture	Missense_Mutation	SNP	185956672	185956672	HMCN1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	7145	209
RBBP5	5929	broad.mit.edu	37	1	205065884	205065884	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205065884G>A	uc001hbu.1	-	12	1452	c.1322C>T	c.(1321-1323)TCA>TTA	p.S441L	RBBP5_uc010prd.1_Missense_Mutation_p.S476L|RBBP5_uc001hbv.1_Missense_Mutation_p.S441L|RBBP5_uc010pre.1_Missense_Mutation_p.S308L	NM_005057	NP_005048	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5	441					histone H3-K4 methylation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription, DNA-dependent	MLL1 complex|Set1C/COMPASS complex	methylated histone residue binding|transcription regulatory region DNA binding			lung(1)	1	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			CCCATCTGCTGAGGACTGCCT	0.493																0.181818	60.788135	77.55151	32	144	KEEP	---	---	---	---	10	24	68	89	-1	capture	Missense_Mutation	SNP	205065884	205065884	RBBP5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	12997	209
KCNK1	3775	broad.mit.edu	37	1	233802400	233802400	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:233802400G>A	uc010pxo.1	+	2	583	c.415G>A	c.(415-417)GTC>ATC	p.V139I	KCNK1_uc001hvw.2_RNA|KCNK1_uc001hvx.2_RNA	NM_002245	NP_002236	O00180	KCNK1_HUMAN	potassium channel, subfamily K, member 1	139	Helical; (Potential).					voltage-gated potassium channel complex	inward rectifier potassium channel activity			central_nervous_system(1)	1		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)			Ibutilide(DB00308)|Quinidine(DB00908)	CATCTACTCCGTCATTGGCAT	0.582																0.24	27.877783	30.961419	12	38	KEEP	---	---	---	---	7	5	20	22	-1	capture	Missense_Mutation	SNP	233802400	233802400	KCNK1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7980	209
RYR2	6262	broad.mit.edu	37	1	237947838	237947838	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237947838G>A	uc001hyl.1	+	90	12946	c.12826G>A	c.(12826-12828)GTG>ATG	p.V4276M	RYR2_uc010pya.1_Missense_Mutation_p.V691M	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4276					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAAGATGACCGTGAAGGACAT	0.468																0.104167	3.243063	10.724975	5	43	KEEP	---	---	---	---	3	2	17	29	-1	capture	Missense_Mutation	SNP	237947838	237947838	RYR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13661	209
NLRP3	114548	broad.mit.edu	37	1	247587842	247587842	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247587842G>A	uc001icr.2	+	5	1235	c.1097G>A	c.(1096-1098)CGG>CAG	p.R366Q	NLRP3_uc001ics.2_Missense_Mutation_p.R366Q|NLRP3_uc001icu.2_Missense_Mutation_p.R366Q|NLRP3_uc001icw.2_Missense_Mutation_p.R366Q|NLRP3_uc001icv.2_Missense_Mutation_p.R366Q|NLRP3_uc010pyw.1_Missense_Mutation_p.R364Q|NLRP3_uc001ict.1_Missense_Mutation_p.R364Q	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	366	NACHT.				detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GACCATCCTCGGCATGTGGAG	0.547					412											0.164948	27.705466	38.106094	16	81	KEEP	---	---	---	---	8	9	31	55	-1	capture	Missense_Mutation	SNP	247587842	247587842	NLRP3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10385	209
MYO3A	53904	broad.mit.edu	37	10	26465747	26465747	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:26465747C>T	uc001isn.2	+	31	4771	c.4411C>T	c.(4411-4413)CGA>TGA	p.R1471*	MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1471					protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						AATTAATAGACGAGTTTCTTC	0.378					781											0.174603	21.349536	27.594498	11	52	KEEP	---	---	---	---	7	5	27	30	-1	capture	Nonsense_Mutation	SNP	26465747	26465747	MYO3A	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	9986	209
OR5D16	390144	broad.mit.edu	37	11	55606359	55606359	+	Silent	SNP	T	C	C			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55606359T>C	uc010rio.1	+	1	132	c.132T>C	c.(130-132)AAT>AAC	p.N44N		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	44	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				TGGTAGGGAATCTTGGGATGA	0.438																0.134454	30.027909	45.436835	16	103	KEEP	---	---	---	---	10	9	41	66	-1	capture	Silent	SNP	55606359	55606359	OR5D16	11	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	11060	209
OR5AR1	219493	broad.mit.edu	37	11	56431688	56431688	+	Missense_Mutation	SNP	A	G	G			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56431688A>G	uc010rjm.1	+	1	527	c.527A>G	c.(526-528)CAT>CGT	p.H176R		NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR,	176	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATCATCAATCATTTCTTCTGC	0.488																0.163043	30.27029	40.194637	15	77	KEEP	---	---	---	---	6	12	40	46	-1	capture	Missense_Mutation	SNP	56431688	56431688	OR5AR1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	11049	209
LRRC32	2615	broad.mit.edu	37	11	76372493	76372493	+	Silent	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:76372493C>T	uc001oxq.3	-	3	387	c.144G>A	c.(142-144)CCG>CCA	p.P48P	LRRC32_uc001oxr.3_Silent_p.P48P|LRRC32_uc010rsf.1_Silent_p.P48P	NM_005512	NP_005503	Q14392	LRC32_HUMAN	leucine rich repeat containing 32 precursor	48	Extracellular (Potential).					integral to plasma membrane					0						CAGTGTCTGGCGGGAGCACCG	0.622																0.137931	6.282291	9.957388	4	25	KEEP	---	---	---	---	0	4	18	13	-1	capture	Silent	SNP	76372493	76372493	LRRC32	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8903	209
PTPRR	5801	broad.mit.edu	37	12	71078010	71078010	+	Missense_Mutation	SNP	G	A	A	rs150540173		TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:71078010G>A	uc001swi.1	-	10	1810	c.1394C>T	c.(1393-1395)ACG>ATG	p.T465M	PTPRR_uc001swh.1_Missense_Mutation_p.T220M|PTPRR_uc009zrs.2_Missense_Mutation_p.T314M|PTPRR_uc010stq.1_Missense_Mutation_p.T353M|PTPRR_uc010str.1_Missense_Mutation_p.T314M	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	465	Tyrosine-protein phosphatase.|Cytoplasmic (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		GGGGCCCTGCGTGGCAATGAA	0.433																0.133333	5.88698	9.795198	4	26	KEEP	---	---	---	---	3	1	11	16	-1	capture	Missense_Mutation	SNP	71078010	71078010	PTPRR	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12705	209
CHD8	57680	broad.mit.edu	37	14	21897194	21897194	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21897194G>A	uc001was.1	-	3	401	c.307C>T	c.(307-309)CAG>TAG	p.Q103*	CHD8_uc001war.1_5'UTR	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	382	Gln-rich.				ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CCCATTATCTGAGCCTGCTGT	0.517					886											0.16129	30.993429	44.576936	20	104	KEEP	---	---	---	---	15	7	68	50	-1	capture	Nonsense_Mutation	SNP	21897194	21897194	CHD8	14	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	3297	209
EPB42	2038	broad.mit.edu	37	15	43499515	43499515	+	Silent	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43499515C>T	uc001zra.3	-	9	1500	c.1200G>A	c.(1198-1200)GAG>GAA	p.E400E	EPB42_uc001zqz.3_Silent_p.E67E|EPB42_uc010bde.2_Silent_p.E245E|EPB42_uc001zrb.3_Silent_p.E430E|EPB42_uc010udm.1_Silent_p.E322E	NM_001114134	NP_001107606	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2 isoform 2	400					erythrocyte maturation|peptide cross-linking|regulation of cell shape	cytoplasm|cytoskeleton|plasma membrane	ATP binding|protein binding|protein-glutamine gamma-glutamyltransferase activity|structural constituent of cytoskeleton			ovary(2)	2		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		GTGTCCCATCCTCACAGCACT	0.552																0.083333	0.960084	9.431221	4	44	KEEP	---	---	---	---	2	2	23	23	-1	capture	Silent	SNP	43499515	43499515	EPB42	15	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	5113	209
CILP	8483	broad.mit.edu	37	15	65489544	65489544	+	Missense_Mutation	SNP	A	G	G			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:65489544A>G	uc002aon.2	-	9	3261	c.3080T>C	c.(3079-3081)GTC>GCC	p.V1027A		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	1027					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						CTGGGGGATGACCTTCACCAG	0.592																0.045455	-7.61452	6.93484	3	63	KEEP	---	---	---	---	1	2	30	34	-1	capture	Missense_Mutation	SNP	65489544	65489544	CILP	15	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	3394	209
C15orf17	57184	broad.mit.edu	37	15	75198690	75198690	+	Silent	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75198690C>T	uc002azh.3	-	2	552	c.231G>A	c.(229-231)CTG>CTA	p.L77L	C15orf17_uc010bkh.2_5'UTR|C15orf17_uc002azg.2_Silent_p.L77L|C15orf17_uc002azf.2_Silent_p.L77L	NM_020447	NP_065180	Q5XKK7	CO017_HUMAN	hypothetical protein LOC57184	77							cytochrome-c oxidase activity				0						CGGCCTTGGCCAGGTCCCGGT	0.657																0.238095	10.963066	12.280121	5	16	KEEP	---	---	---	---	3	2	8	12	-1	capture	Silent	SNP	75198690	75198690	C15orf17	15	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	1769	209
DNAH2	146754	broad.mit.edu	37	17	7643079	7643079	+	Missense_Mutation	SNP	G	A	A	rs145686578		TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7643079G>A	uc002giu.1	+	8	1213	c.1199G>A	c.(1198-1200)CGC>CAC	p.R400H	DNAH2_uc002git.2_Missense_Mutation_p.R482H|DNAH2_uc010vuk.1_Missense_Mutation_p.R400H	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	400	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CACTTCGCCCGCTGGGAAGAT	0.483																0.191489	18.550806	22.728274	9	38	KEEP	---	---	---	---	8	4	17	22	-1	capture	Missense_Mutation	SNP	7643079	7643079	DNAH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4559	209
DNAH9	1770	broad.mit.edu	37	17	11650946	11650946	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:11650946C>T	uc002gne.2	+	32	6541	c.6473C>T	c.(6472-6474)TCA>TTA	p.S2158L	DNAH9_uc010coo.2_Missense_Mutation_p.S1452L	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2158	AAA 2 (By similarity).|ATP (Potential).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ACCGGCAAGTCACAGGTGCTG	0.562																0.164179	18.979969	26.158587	11	56	KEEP	---	---	---	---	4	7	35	26	-1	capture	Missense_Mutation	SNP	11650946	11650946	DNAH9	17	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	4564	209
KRTAP4-9	100132386	broad.mit.edu	37	17	39261693	39261693	+	Missense_Mutation	SNP	A	T	T	rs113059833	by1000genomes	TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39261693A>T	uc010wfp.1	+	1	53	c.53A>T	c.(52-54)GAC>GTC	p.D18V		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	18						keratin filament					0						TGCGGCCAAGACCTCTGTCAG	0.627																0.16129	8.35412	11.740407	5	26	KEEP	---	---	---	---	3	2	14	16	-1	capture	Missense_Mutation	SNP	39261693	39261693	KRTAP4-9	17	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	8477	209
ITGB3	3690	broad.mit.edu	37	17	45376748	45376748	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45376748C>T	uc002ilj.2	+	11	1785	c.1765C>T	c.(1765-1767)CGT>TGT	p.R589C	ITGB3_uc010wkr.1_RNA	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor	589	Extracellular (Potential).|III.|Cysteine-rich tandem repeats.				activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CTGTACCACGCGTACTGACAC	0.607																0.185841	41.107276	51.564323	21	92	KEEP	---	---	---	---	8	14	44	54	-1	capture	Missense_Mutation	SNP	45376748	45376748	ITGB3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7818	209
SPAG9	9043	broad.mit.edu	37	17	49062314	49062314	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:49062314C>T	uc002itc.2	-	24	3267	c.3058G>A	c.(3058-3060)GGC>AGC	p.G1020S	SPAG9_uc002itb.2_Missense_Mutation_p.G1006S|SPAG9_uc002itd.2_Missense_Mutation_p.G1010S|SPAG9_uc002ita.2_Missense_Mutation_p.G863S	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1	1020					positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			GCAAGGGTGCCGTCAGCCAGG	0.458																0.141026	36.350581	55.660434	22	134	KEEP	---	---	---	---	9	14	75	80	-1	capture	Missense_Mutation	SNP	49062314	49062314	SPAG9	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14877	209
CD300LB	124599	broad.mit.edu	37	17	72521999	72521999	+	Silent	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72521999C>T	uc002jkx.2	-	2	382	c.369G>A	c.(367-369)ACG>ACA	p.T123T	CD300LB_uc010wqz.1_Silent_p.T123T	NM_174892	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	86	Ig-like V-type.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(1)	1						TCACAGTGAACGTGCGGTCTT	0.517																0.117978	24.169969	49.681167	21	157	KEEP	---	---	---	---	8	15	76	89	-1	capture	Silent	SNP	72521999	72521999	CD300LB	17	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	2970	209
EVPL	2125	broad.mit.edu	37	17	74005267	74005267	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74005267G>A	uc002jqi.2	-	22	4247	c.4019C>T	c.(4018-4020)GCG>GTG	p.A1340V	EVPL_uc010wss.1_Missense_Mutation_p.A1362V|EVPL_uc010wst.1_Missense_Mutation_p.A810V	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	1340	Central fibrous rod domain.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						CTTCTGGGCCGCCTCCCGCAC	0.672																0.234483	72.508444	81.857671	34	111	KEEP	---	---	---	---	17	22	62	72	-1	capture	Missense_Mutation	SNP	74005267	74005267	EVPL	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5247	209
ENGASE	64772	broad.mit.edu	37	17	77073797	77073797	+	Silent	SNP	G	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77073797G>T	uc002jwv.2	+	3	275	c.267G>T	c.(265-267)TCG>TCT	p.S89S	ENGASE_uc002jwu.1_Silent_p.S89S|ENGASE_uc010wtz.1_5'UTR|ENGASE_uc002jww.2_5'Flank	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	89						cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						ACTTGTCTTCGCTGGAGGAGC	0.527																0.147826	30.599489	44.293528	17	98	KEEP	---	---	---	---	12	10	43	70	0.545454545455	capture	Silent	SNP	77073797	77073797	ENGASE	17	G	T	T	T	1	0	0	0	0	0	0	0	1	483	38	4	4	5073	209
DENND1C	79958	broad.mit.edu	37	19	6479059	6479059	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6479059G>A	uc002mfe.2	-	5	277	c.185C>T	c.(184-186)CCC>CTC	p.P62L	DENND1C_uc002mfb.2_5'Flank|DENND1C_uc002mfc.2_5'Flank|DENND1C_uc002mfd.2_5'UTR|DENND1C_uc010xje.1_Missense_Mutation_p.P18L	NM_024898	NP_079174	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C	62	UDENN.					clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity			large_intestine(1)	1						GGCGGGGCTGGGGGGCTCCCT	0.632																0.176471	39.497579	49.550901	18	84	KEEP	---	---	---	---	6	17	48	56	-1	capture	Missense_Mutation	SNP	6479059	6479059	DENND1C	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	4386	209
MUC16	94025	broad.mit.edu	37	19	9069613	9069613	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9069613C>T	uc002mkp.2	-	3	18037	c.17833G>A	c.(17833-17835)GCA>ACA	p.A5945T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5947	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCTGATACTGCGGAATAAAGA	0.512																0.105263	8.319595	25.978253	12	102	KEEP	---	---	---	---	7	7	61	48	-1	capture	Missense_Mutation	SNP	9069613	9069613	MUC16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9883	209
SLC5A7	60482	broad.mit.edu	37	2	108604723	108604723	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108604723C>T	uc002tdv.2	+	2	388	c.112C>T	c.(112-114)CGC>TGC	p.R38C	SLC5A7_uc010ywm.1_5'UTR|SLC5A7_uc010fjj.2_Missense_Mutation_p.R38C|SLC5A7_uc010ywn.1_Intron	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),	38	Extracellular (Potential).				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	CGCAGAAGAGCGCAGCGAAGC	0.502																0.081395	0.501816	15.719969	7	79	KEEP	---	---	---	---	4	3	39	46	-1	capture	Missense_Mutation	SNP	108604723	108604723	SLC5A7	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14562	209
MYO7B	4648	broad.mit.edu	37	2	128366343	128366343	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128366343C>T	uc002top.2	+	22	2757	c.2704C>T	c.(2704-2706)CGC>TGC	p.R902C		NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	902						apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		TGCCAAGAAGCGCAGATCCAT	0.652																0.09375	1.603886	6.909824	3	29	KEEP	---	---	---	---	1	2	16	17	-1	capture	Missense_Mutation	SNP	128366343	128366343	MYO7B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9993	209
POTEE	445582	broad.mit.edu	37	2	131976471	131976471	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131976471G>A	uc002tsn.2	+	1	548	c.496G>A	c.(496-498)GTG>ATG	p.V166M	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Translation_Start_Site|POTEE_uc002tsl.2_Translation_Start_Site	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	166							ATP binding				0						GGACACTGACGTGAACAAGAA	0.592																0.051793	-27.30827	26.011089	13	238	KEEP	---	---	---	---	17	9	173	110	-1	capture	Missense_Mutation	SNP	131976471	131976471	POTEE	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12165	209
TTN	7273	broad.mit.edu	37	2	179542438	179542438	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179542438C>T	uc010zfg.1	-	143	30693	c.30469G>A	c.(30469-30471)GAA>AAA	p.E10157K	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.E6818K|TTN_uc010fre.1_Intron|TTN_uc002una.1_RNA|TTN_uc010frf.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11084							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTCTTCTTCGGGAGGAACT	0.453					8722											0.185185	10.758705	13.267849	5	22	KEEP	---	---	---	---	4	1	10	13	-1	capture	Missense_Mutation	SNP	179542438	179542438	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16617	209
TTN	7273	broad.mit.edu	37	2	179639038	179639038	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179639038C>T	uc010zfg.1	-	30	7177	c.6953G>A	c.(6952-6954)CGT>CAT	p.R2318H	TTN_uc010zfh.1_Missense_Mutation_p.R2272H|TTN_uc010zfi.1_Missense_Mutation_p.R2272H|TTN_uc010zfj.1_Missense_Mutation_p.R2272H|TTN_uc002unb.2_Missense_Mutation_p.R2318H|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2318							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGACGTCCACGACGAGATGT	0.403				p.R2318H(SW900-Tumor)|p.R2318H(ISHIKAWAHERAKLIO02ER-Tumor)	8722											0.147727	22.118775	32.603455	13	75	KEEP	---	---	---	---	7	6	34	53	-1	capture	Missense_Mutation	SNP	179639038	179639038	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	209
DOCK10	55619	broad.mit.edu	37	2	225670162	225670162	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:225670162T>C	uc010fwz.1	-	35	4138	c.3899A>G	c.(3898-3900)AAT>AGT	p.N1300S	DOCK10_uc002vob.2_Missense_Mutation_p.N1294S|DOCK10_uc002voa.2_5'UTR|DOCK10_uc002voc.2_Missense_Mutation_p.N154S	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1300							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GCTCTTCTCATTGGTACTTGG	0.423																0.25	14.385801	15.508431	5	15	KEEP	---	---	---	---	3	2	6	11	-1	capture	Missense_Mutation	SNP	225670162	225670162	DOCK10	2	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	4641	209
MC3R	4159	broad.mit.edu	37	20	54824818	54824818	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:54824818C>T	uc002xxb.2	+	1	1031	c.919C>T	c.(919-921)CGC>TGC	p.R307C		NM_019888	NP_063941	P41968	MC3R_HUMAN	melanocortin 3 receptor	344	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding	p.R344C(1)		ovary(2)|breast(2)	4			Colorectal(105;0.202)			CCTGGAATTGCGCAACACCTT	0.517																0.14557	33.820582	52.920436	23	135	KEEP	---	---	---	---	13	10	56	88	-1	capture	Missense_Mutation	SNP	54824818	54824818	MC3R	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9278	209
TPTE	7179	broad.mit.edu	37	21	10969096	10969096	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:10969096C>T	uc002yip.1	-	7	520	c.152G>A	c.(151-153)CGG>CAG	p.R51Q	TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	51					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGGTGACACCCGGGCTGCTCC	0.328																0.039474	-22.581045	12.195987	6	146	KEEP	---	---	---	---	3	4	74	89	-1	capture	Missense_Mutation	SNP	10969096	10969096	TPTE	21	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16313	209
C21orf29	54084	broad.mit.edu	37	21	45948429	45948429	+	Silent	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45948429C>T	uc002zfe.1	-	6	894	c.828G>A	c.(826-828)CCG>CCA	p.P276P	C21orf29_uc010gpv.1_Silent_p.P208P	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor	276					cell adhesion	extracellular region	structural molecule activity				0						CCTCGGTACACGGTGGCTGGG	0.577																0.166667	25.076267	33.253616	13	65	KEEP	---	---	---	---	6	8	31	40	-1	capture	Silent	SNP	45948429	45948429	C21orf29	21	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	2105	209
MYO18B	84700	broad.mit.edu	37	22	26228907	26228907	+	Missense_Mutation	SNP	C	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26228907C>A	uc003abz.1	+	16	3253	c.3003C>A	c.(3001-3003)GAC>GAA	p.D1001E	MYO18B_uc003aca.1_Missense_Mutation_p.D882E|MYO18B_uc010guy.1_Missense_Mutation_p.D882E|MYO18B_uc010guz.1_Missense_Mutation_p.D882E|MYO18B_uc011aka.1_Missense_Mutation_p.D155E|MYO18B_uc011akb.1_Missense_Mutation_p.D514E	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1001	Myosin head-like.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						TGCAGTTTGACCTCCCGGACC	0.507					968											0.128205	13.295588	23.803691	10	68	KEEP	---	---	---	---	6	5	41	32	0.454545454545	capture	Missense_Mutation	SNP	26228907	26228907	MYO18B	22	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	9976	209
KCNJ4	3761	broad.mit.edu	37	22	38823844	38823844	+	Silent	SNP	G	C	C			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38823844G>C	uc003avs.1	-	2	391	c.294C>G	c.(292-294)GGC>GGG	p.G98G	KCNJ4_uc003avt.1_Silent_p.G98G	NM_004981	NP_004972	P48050	IRK4_HUMAN	potassium inwardly-rectifying channel J4	98	Val/Gly/Ala/Pro stretch.|Extracellular (By similarity).				synaptic transmission	basolateral plasma membrane|voltage-gated potassium channel complex	inward rectifier potassium channel activity|PDZ domain binding				0	Melanoma(58;0.0286)					ccgccgccgggccccccgccg	0.567																0.136364	4.009649	6.83055	3	19	KEEP	---	---	---	---	2	3	13	16	-1	capture	Silent	SNP	38823844	38823844	KCNJ4	22	G	C	C	C	1	0	0	0	0	0	0	0	1	535	42	4	4	7975	209
UBA7	7318	broad.mit.edu	37	3	49849871	49849871	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49849871C>T	uc003cxr.2	-	6	835	c.664G>A	c.(664-666)GAC>AAC	p.D222N		NM_003335	NP_003326	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	222	2 approximate repeats.				ISG15-protein conjugation|negative regulation of type I interferon production	cytosol	ATP binding|ISG15 activating enzyme activity|ligase activity			ovary(1)|pancreas(1)	2				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GGATCACAGTCGTTGAGCTCA	0.567																0.171875	20.990148	27.498843	11	53	KEEP	---	---	---	---	7	4	23	35	-1	capture	Missense_Mutation	SNP	49849871	49849871	UBA7	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16715	209
EPHB1	2047	broad.mit.edu	37	3	134851749	134851749	+	Silent	SNP	C	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:134851749C>A	uc003eqt.2	+	5	1375	c.1155C>A	c.(1153-1155)GGC>GGA	p.G385G	EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_3'UTR|EPHB1_uc003equ.2_5'UTR	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	385	Extracellular (Potential).|Fibronectin type-III 1.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						GGCAGCTGGGCCTGACGGAGT	0.597					376											0.162162	8.315883	12.352282	6	31	KEEP	---	---	---	---	6	2	15	17	0.25	capture	Silent	SNP	134851749	134851749	EPHB1	3	C	A	A	A	1	0	0	0	0	0	0	0	1	327	26	4	4	5129	209
HTR3E	285242	broad.mit.edu	37	3	183824082	183824082	+	Silent	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183824082G>A	uc010hxq.2	+	8	1558	c.1092G>A	c.(1090-1092)GCG>GCA	p.A364A	HTR3E_uc003fml.3_Silent_p.A349A|HTR3E_uc003fmm.2_Silent_p.A379A|HTR3E_uc010hxr.2_Silent_p.A390A|HTR3E_uc003fmn.2_Silent_p.A364A	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	364	Cytoplasmic (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity	p.S364S(1)		ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GTCCCACTGCGCCCCAGAAGG	0.557	Melanoma(7;227 727 6634 44770)															0.291667	16.413796	17.347914	7	17	KEEP	---	---	---	---	5	2	9	11	-1	capture	Silent	SNP	183824082	183824082	HTR3E	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7373	209
DGKG	1608	broad.mit.edu	37	3	185975697	185975697	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:185975697G>A	uc003fqa.2	-	17	1993	c.1456C>T	c.(1456-1458)CGT>TGT	p.R486C	DGKG_uc003fqb.2_Missense_Mutation_p.R447C|DGKG_uc003fqc.2_Missense_Mutation_p.R461C|DGKG_uc011brx.1_Missense_Mutation_p.R427C	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1	486	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	GCCAAAACACGGAAGTCTGGA	0.463					546											0.209877	42.032828	48.33987	17	64	KEEP	---	---	---	---	8	10	29	45	-1	capture	Missense_Mutation	SNP	185975697	185975697	DGKG	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4427	209
BDH1	622	broad.mit.edu	37	3	197238913	197238913	+	Silent	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:197238913C>T	uc003fxr.2	-	8	1287	c.885G>A	c.(883-885)ACG>ACA	p.T295T	BDH1_uc003fxs.2_Silent_p.T295T|BDH1_uc003fxt.2_Silent_p.T208T|BDH1_uc003fxu.2_Silent_p.T295T	NM_203314	NP_976059	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1	295					cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)	TGACAGGGGACGTGTCTGTGG	0.577																0.133333	20.321467	35.991508	16	104	KEEP	---	---	---	---	6	11	59	62	-1	capture	Silent	SNP	197238913	197238913	BDH1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	1379	209
AMBN	258	broad.mit.edu	37	4	71472354	71472354	+	Silent	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71472354G>A	uc003hfl.2	+	13	1326	c.1251G>A	c.(1249-1251)ACG>ACA	p.T417T		NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor	417					bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			TGGATACCACGATGGCCCCAA	0.512																0.147059	17.107077	25.243095	10	58	KEEP	---	---	---	---	0	11	28	40	-1	capture	Silent	SNP	71472354	71472354	AMBN	4	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	563	209
IRX1	79192	broad.mit.edu	37	5	3600344	3600344	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:3600344G>A	uc003jde.2	+	2	1334	c.1282G>A	c.(1282-1284)GCC>ACC	p.A428T		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	428						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						TGGAGACAAGGCCTCGGTCCG	0.697																0.25	6.11762	6.800888	3	9	KEEP	---	---	---	---	3	0	10	4	-1	capture	Missense_Mutation	SNP	3600344	3600344	IRX1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7766	209
CMYA5	202333	broad.mit.edu	37	5	79026546	79026546	+	Missense_Mutation	SNP	T	C	C			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79026546T>C	uc003kgc.2	+	2	2030	c.1958T>C	c.(1957-1959)CTC>CCC	p.L653P		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	653						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GAGAGCTCTCTCTCACCATCC	0.458																0.139535	11.537082	16.920265	6	37	KEEP	---	---	---	---	3	4	18	22	-1	capture	Missense_Mutation	SNP	79026546	79026546	CMYA5	5	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	3555	209
ABLIM3	22885	broad.mit.edu	37	5	148617052	148617052	+	Silent	SNP	G	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148617052G>T	uc003lpy.2	+	11	1181	c.930G>T	c.(928-930)GCG>GCT	p.A310A	ABLIM3_uc003lpz.1_Silent_p.A310A|ABLIM3_uc003lqa.1_Intron|ABLIM3_uc003lqb.2_Intron|ABLIM3_uc003lqc.1_Silent_p.A310A|ABLIM3_uc003lqd.1_Intron|ABLIM3_uc003lqf.2_Intron|ABLIM3_uc003lqe.1_Intron	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	310					axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGACCTGGCGGCTCTCCCCA	0.468																0.206612	60.042927	69.670146	25	96	KEEP	---	---	---	---	11	16	40	63	0.407407407407	capture	Silent	SNP	148617052	148617052	ABLIM3	5	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	96	209
SLIT3	6586	broad.mit.edu	37	5	168620553	168620553	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168620553G>A	uc003mab.2	-	4	763	c.343C>T	c.(343-345)CGC>TGC	p.R115C	SLIT3_uc010jjg.2_Missense_Mutation_p.R115C|SLIT3_uc010jji.2_Missense_Mutation_p.R115C	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	115	LRR 3.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTGTTCAGGCGCCTAAAGAGG	0.408	Ovarian(29;311 847 10864 17279 24903)															0.12963	8.640303	15.807546	7	47	KEEP	---	---	---	---	2	6	28	23	-1	capture	Missense_Mutation	SNP	168620553	168620553	SLIT3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14633	209
MDC1	9656	broad.mit.edu	37	6	30682871	30682871	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30682871C>T	uc003nrg.3	-	2	522	c.82G>A	c.(82-84)GTG>ATG	p.V28M	MDC1_uc003nrf.3_5'Flank|MDC1_uc011dmp.1_Translation_Start_Site|MDC1_uc003nrh.1_Translation_Start_Site|MDC1_uc003nri.2_Missense_Mutation_p.V28M	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	28	Interaction with the MRN complex.|Interaction with CHEK2.				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						ACTGGCTCCACGTTACACCTC	0.458											Other_conserved_DNA_damage_response_genes					0.192308	27.475661	34.3802	15	63	KEEP	---	---	---	---	9	6	32	38	-1	capture	Missense_Mutation	SNP	30682871	30682871	MDC1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9316	209
IER3	8870	broad.mit.edu	37	6	30711832	30711832	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30711832C>T	uc003nrn.2	-	2	384	c.352G>A	c.(352-354)GCA>ACA	p.A118T	FLOT1_uc003nrm.2_5'Flank|FLOT1_uc011dmr.1_5'Flank	NM_003897	NP_003888	P46695	IEX1_HUMAN	immediate early response 3	118	Extracellular (Potential).				anatomical structure morphogenesis|anti-apoptosis|apoptosis	integral to membrane	protein binding				0						GCCAGGGATGCGGCGTTAGGG	0.627																0.061224	-3.507498	6.333793	3	46	KEEP	---	---	---	---	3	0	27	24	-1	capture	Missense_Mutation	SNP	30711832	30711832	IER3	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7431	209
BBS9	27241	broad.mit.edu	37	7	33397475	33397475	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:33397475C>T	uc003tdn.1	+	16	2074	c.1561C>T	c.(1561-1563)CGA>TGA	p.R521*	BBS9_uc003tdo.1_Nonsense_Mutation_p.R486*|BBS9_uc003tdp.1_Nonsense_Mutation_p.R516*|BBS9_uc003tdq.1_Nonsense_Mutation_p.R481*|BBS9_uc010kwn.1_RNA|BBS9_uc003tdr.1_Nonsense_Mutation_p.R45*|BBS9_uc003tds.1_5'UTR|BBS9_uc011kao.1_Nonsense_Mutation_p.R399*	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	521					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			AGGCATTCCGCGAGTTATCCA	0.323												Bardet-Biedl_syndrome				0.222222	8.989739	10.268033	4	14	KEEP	---	---	---	---	2	2	10	6	-1	capture	Nonsense_Mutation	SNP	33397475	33397475	BBS9	7	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	1331	209
PCLO	27445	broad.mit.edu	37	7	82584801	82584801	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82584801G>A	uc003uhx.2	-	5	5757	c.5468C>T	c.(5467-5469)CCA>CTA	p.P1823L	PCLO_uc003uhv.2_Missense_Mutation_p.P1823L	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1754					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TGGTGTCTTTGGCCTTTCCCT	0.423																0.026846	-28.334614	8.515074	4	145	KEEP	---	---	---	---	2	2	72	93	-1	capture	Missense_Mutation	SNP	82584801	82584801	PCLO	7	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	11486	209
DMTF1	9988	broad.mit.edu	37	7	86815172	86815172	+	Silent	SNP	A	G	G			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86815172A>G	uc003uih.2	+	12	1403	c.1077A>G	c.(1075-1077)GAA>GAG	p.E359E	DMTF1_uc003uii.2_Silent_p.E93E|DMTF1_uc003uij.2_Silent_p.E93E|DMTF1_uc011khb.1_Silent_p.E271E|DMTF1_uc003uik.2_RNA|DMTF1_uc003uil.2_Silent_p.E359E|DMTF1_uc003uin.2_Silent_p.E93E	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	359	Interaction with CCND1, CCND2 and CCND3 (By similarity).|Required for DNA-binding (By similarity).|Myb-like 2.				cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(14;0.0058)					TAGCTGATGAAAATGACATTA	0.398																0.150943	36.831421	49.201555	16	90	KEEP	---	---	---	---	7	11	53	47	-1	capture	Silent	SNP	86815172	86815172	DMTF1	7	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	4550	209
CNTNAP2	26047	broad.mit.edu	37	7	146997320	146997320	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:146997320C>T	uc003weu.1	+	9	1952	c.1436C>T	c.(1435-1437)GCA>GTA	p.A479V		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	479	Extracellular (Potential).|Laminin G-like 2.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GGAGATGAAGCATCAGCAGTT	0.428													HNSCC(39;0.1)			0.136364	11.5259	19.981971	9	57	KEEP	---	---	---	---	5	5	32	27	-1	capture	Missense_Mutation	SNP	146997320	146997320	CNTNAP2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	3612	209
DOCK8	81704	broad.mit.edu	37	9	404947	404947	+	Silent	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:404947G>A	uc003zgf.2	+	27	3376	c.3264G>A	c.(3262-3264)ACG>ACA	p.T1088T	DOCK8_uc010mgu.2_Silent_p.T390T|DOCK8_uc010mgv.2_Silent_p.T988T|DOCK8_uc010mgw.1_Silent_p.T390T|DOCK8_uc003zgk.2_Silent_p.T546T	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1088					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ACCTTCCAACGCTCATTTCCA	0.418																0.179487	14.313054	18.073006	7	32	KEEP	---	---	---	---	2	6	15	18	-1	capture	Silent	SNP	404947	404947	DOCK8	9	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4649	209
ANKS6	203286	broad.mit.edu	37	9	101533299	101533299	+	Silent	SNP	G	A	A			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101533299G>A	uc004ayu.2	-	10	1872	c.1851C>T	c.(1849-1851)AGC>AGT	p.S617S	ANKS6_uc004ayt.2_Silent_p.S316S|ANKS6_uc004ayv.1_Silent_p.S79S|ANKS6_uc004ayw.1_Silent_p.S199S|ANKS6_uc004ayx.1_RNA|ANKS6_uc004ayy.1_RNA	NM_173551	NP_775822	Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain	617	Ser-rich.									ovary(2)	2		Acute lymphoblastic leukemia(62;0.0527)				TTCTGGGGAGGCTTGGAAATT	0.582																0.189189	11.772478	15.16557	7	30	KEEP	---	---	---	---	4	4	20	14	-1	capture	Silent	SNP	101533299	101533299	ANKS6	9	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	686	209
BRD3	8019	broad.mit.edu	37	9	136918434	136918434	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136918434C>T	uc004cew.2	-	2	354	c.166G>A	c.(166-168)GCC>ACC	p.A56T	BRD3_uc004cex.2_Missense_Mutation_p.A56T	NM_007371	NP_031397	Q15059	BRD3_HUMAN	bromodomain containing protein 3	56	Bromo 1.					nucleus	protein binding		BRD3/C15orf55(3)	stomach(4)|midline_organs(3)|kidney(1)	8				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		AAGGGCCAGGCGAACTGGTGT	0.617					497	T	NUT|C15orf55	lethal midline carcinoma of young people								0.168831	24.19834	32.138978	13	64	KEEP	---	---	---	---	6	9	30	44	-1	capture	Missense_Mutation	SNP	136918434	136918434	BRD3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1491	209
FMR1NB	158521	broad.mit.edu	37	X	147088330	147088330	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2501-01	TCGA-28-2501-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:147088330C>T	uc004fcm.2	+	3	580	c.506C>T	c.(505-507)ACG>ATG	p.T169M		NM_152578	NP_689791	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	169	P-type.|Extracellular (Potential).					integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					TCGGGGACCACGAGCTTCAAA	0.363																0.346154	51.337099	52.422424	18	34	KEEP	---	---	---	---	9	12	18	21	-1	capture	Missense_Mutation	SNP	147088330	147088330	FMR1NB	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5905	209
