Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PLEKHN1	84069	broad.mit.edu	37	1	909247	909247	+	Missense_Mutation	SNP	C	T	T	rs72631892	by1000genomes	TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:909247C>T	uc001ace.2	+	13	1660	c.1625C>T	c.(1624-1626)ACG>ATG	p.T542M	PLEKHN1_uc001acd.2_Missense_Mutation_p.T490M|PLEKHN1_uc001acf.2_Missense_Mutation_p.T455M	NM_032129	NP_115505	Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N	542											0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		CGTGGACCCACGCCCTCGAGC	0.682																0.230769	27.176693	30.628694	12	40	KEEP	---	---	---	---	5	8	21	30	-1	capture	Missense_Mutation	SNP	909247	909247	PLEKHN1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11986	229
TAS1R2	80834	broad.mit.edu	37	1	19168299	19168299	+	Silent	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19168299C>T	uc001bba.1	-	5	1516	c.1515G>A	c.(1513-1515)AAG>AAA	p.K505K		NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor	505	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	CCACAGGCTTCTTCTTTTGCC	0.557																0.043478	-27.39658	8.6507	7	154	KEEP	---	---	---	---	10	6	87	104	-1	capture	Silent	SNP	19168299	19168299	TAS1R2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	15451	229
RIMS3	9783	broad.mit.edu	37	1	41107474	41107474	+	Missense_Mutation	SNP	C	T	T	rs149583022		TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:41107474C>T	uc001cfu.1	-	3	593	c.124G>A	c.(124-126)GCC>ACC	p.A42T	RIMS3_uc001cfv.1_Missense_Mutation_p.A42T	NM_014747	NP_055562	Q9UJD0	RIMS3_HUMAN	regulating synaptic membrane exocytosis 3	42					neurotransmitter transport	cell junction|synapse					0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.47e-17)			CGCTTCTTGGCGGTGGTGGTC	0.657																0.333333	57.297362	58.997126	23	46	KEEP	---	---	---	---	11	22	29	50	-1	capture	Missense_Mutation	SNP	41107474	41107474	RIMS3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13261	229
PTPRF	5792	broad.mit.edu	37	1	44069550	44069550	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44069550G>A	uc001cjr.2	+	16	3067	c.2727G>A	c.(2725-2727)AGG>AGA	p.R909R	PTPRF_uc001cjs.2_Silent_p.R900R|PTPRF_uc001cju.2_Intron|PTPRF_uc009vwt.2_Silent_p.R469R|PTPRF_uc001cjv.2_Silent_p.R369R|PTPRF_uc001cjw.2_Silent_p.R135R	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	909	Extracellular (Potential).|Fibronectin type-III 6.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGGAGATCAGGACCCCCGAGG	0.627																0.25	40.872641	45.208958	19	57	KEEP	---	---	---	---	10	11	28	34	-1	capture	Silent	SNP	44069550	44069550	PTPRF	1	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	12696	229
WLS	79971	broad.mit.edu	37	1	68603590	68603590	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:68603590G>A	uc001def.1	-	11	1660	c.1389C>T	c.(1387-1389)GGC>GGT	p.G463G	uc001deb.1_Intron|uc001dec.1_Intron|WLS_uc001dee.2_Silent_p.G461G|WLS_uc001deg.1_Silent_p.G372G|WLS_uc009wbf.1_Silent_p.G418G	NM_024911	NP_079187	Q5T9L3	WLS_HUMAN	G protein-coupled receptor 177 isoform 1	463	Lumenal (Potential).				multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Wnt receptor signaling pathway	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	signal transducer activity				0						CTGTGACGCCGCCCCATTTCC	0.443					563											0.133333	20.900103	38.494033	18	117	KEEP	---	---	---	---	6	14	59	70	-1	capture	Silent	SNP	68603590	68603590	WLS	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17257	229
ATP1A1	476	broad.mit.edu	37	1	116943788	116943788	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:116943788C>T	uc001ege.2	+	20	3094	c.2755C>T	c.(2755-2757)CAC>TAC	p.H919Y	ATP1A1_uc010owv.1_Missense_Mutation_p.H888Y|ATP1A1_uc010oww.1_Missense_Mutation_p.H919Y|ATP1A1_uc010owx.1_Missense_Mutation_p.H888Y|C1orf203_uc009whb.2_Intron|C1orf203_uc001egg.3_Intron|ATP1A1_uc001egh.2_Missense_Mutation_p.H61Y	NM_000701	NP_000692	P05023	AT1A1_HUMAN	Na+/K+ -ATPase alpha 1 subunit isoform a	919	Helical; (Potential).				ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)	GTTCACCTGCCACACAGCCTT	0.532																0.044118	-8.637198	6.494456	3	65	KEEP	---	---	---	---	3	0	49	43	-1	capture	Missense_Mutation	SNP	116943788	116943788	ATP1A1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	1119	229
TBX15	6913	broad.mit.edu	37	1	119441665	119441665	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:119441665A>G	uc001ehl.1	-	7	1007	c.692T>C	c.(691-693)ATG>ACG	p.M231T	TBX15_uc009whj.1_Missense_Mutation_p.M22T	NM_152380	NP_689593	Q96SF7	TBX15_HUMAN	T-box 15	337						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		CTGCTTCTGCATGGTGGTGAA	0.527																0.215054	50.550673	57.519511	20	73	KEEP	---	---	---	---	16	10	42	43	-1	capture	Missense_Mutation	SNP	119441665	119441665	TBX15	1	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	15539	229
SV2A	9900	broad.mit.edu	37	1	149885276	149885276	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:149885276G>A	uc001etg.2	-	2	608	c.117C>T	c.(115-117)GAC>GAT	p.D39D	SV2A_uc001eth.2_Silent_p.D39D	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2	39	Cytoplasmic (Potential).|Interaction with SYT1 (By similarity).				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(6)|pancreas(1)	7	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	GGGAATATTCGTCCTGGACTC	0.542																0.251163	129.902751	141.963202	54	161	KEEP	---	---	---	---	30	28	83	102	-1	capture	Silent	SNP	149885276	149885276	SV2A	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15305	229
FLG	2312	broad.mit.edu	37	1	152283084	152283084	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152283084G>A	uc001ezu.1	-	3	4314	c.4278C>T	c.(4276-4278)TCC>TCT	p.S1426S	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1426	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCCACGTGCGGACTCTTTGT	0.557												Ichthyosis				0.223377	206.546928	233.565718	86	299	KEEP	---	---	---	---	33	59	146	191	-1	capture	Silent	SNP	152283084	152283084	FLG	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5867	229
USH2A	7399	broad.mit.edu	37	1	216371751	216371751	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216371751C>A	uc001hku.1	-	18	4374	c.3987G>T	c.(3985-3987)TTG>TTT	p.L1329F	USH2A_uc001hkv.2_Missense_Mutation_p.L1329F	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1329	Fibronectin type-III 3.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGTATGGCTCCAAGCCAGTGA	0.443													HNSCC(13;0.011)			0.033149	-36.21533	6.842263	6	175	KEEP	---	---	---	---	10	7	125	93	0.411764705882	capture	Missense_Mutation	SNP	216371751	216371751	USH2A	1	C	A	A	A	1	0	0	0	0	1	0	0	0	272	21	4	4	16918	229
SLC18A3	6572	broad.mit.edu	37	10	50820049	50820049	+	Silent	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50820049C>T	uc001jhw.2	+	1	1703	c.1263C>T	c.(1261-1263)TAC>TAT	p.Y421Y	CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank|CHAT_uc010qgs.1_5'Flank	NM_003055	NP_003046	Q16572	VACHT_HUMAN	vesicular acetylcholine transporter	421	Cytoplasmic (Potential).				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity			ovary(2)	2						GCAGCGTCTACGCCATCGCCG	0.622																0.357143	25.939937	26.444164	10	18	KEEP	---	---	---	---	8	3	9	18	-1	capture	Silent	SNP	50820049	50820049	SLC18A3	10	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14320	229
TMEM26	219623	broad.mit.edu	37	10	63212688	63212688	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:63212688G>A	uc001jlo.2	-	1	521	c.152C>T	c.(151-153)GCG>GTG	p.A51V	TMEM26_uc010qij.1_RNA|TMEM26_uc001jlq.2_RNA|uc001jlr.2_RNA	NM_178505	NP_848600	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	51	Helical; (Potential).					integral to membrane					0	Prostate(12;0.0112)					GAGGGTGAGCGCAGTCTCCAG	0.642																0.022727	-37.948957	6.730617	4	172	KEEP	---	---	---	---	2	2	103	96	-1	capture	Missense_Mutation	SNP	63212688	63212688	TMEM26	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16034	229
ZNF365	22891	broad.mit.edu	37	10	64159484	64159484	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:64159484G>A	uc001jly.3	+	5	1267	c.1205G>A	c.(1204-1206)CGC>CAC	p.R402H	ZNF365_uc001jmb.3_Intron|ZNF365_uc001jmc.2_Intron|ZNF365_uc001jlz.3_Missense_Mutation_p.R387H|ZNF365_uc001jma.3_RNA	NM_014951	NP_055766	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform A	Error:Variant_position_missing_in_Q70YC4_after_alignment										ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					GGGTTTGGCCGCAAAGGCAAC	0.537																0.043478	-13.765777	6.774677	4	88	KEEP	---	---	---	---	2	2	47	44	-1	capture	Missense_Mutation	SNP	64159484	64159484	ZNF365	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17749	229
VCL	7414	broad.mit.edu	37	10	75849002	75849002	+	Silent	SNP	T	C	C			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:75849002T>C	uc001jwd.2	+	9	1165	c.1071T>C	c.(1069-1071)TCT>TCC	p.S357S	VCL_uc009xrr.2_Silent_p.S106S|VCL_uc010qky.1_Silent_p.S264S|VCL_uc001jwe.2_Silent_p.S357S|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL	357	1.|N-terminal globular head.|3 X 112 AA tandem repeats.				adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					AGCAGGTATCTCAGGGTCTGG	0.488																0.041667	-4.491417	6.344068	2	46	KEEP	---	---	---	---	2	0	26	23	-1	capture	Silent	SNP	75849002	75849002	VCL	10	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	17021	229
PTEN	5728	broad.mit.edu	37	10	89653808	89653808	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89653808G>A	uc001kfb.2	+	3	1137	c.106G>A	c.(106-108)GGA>AGA	p.G36R		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	36	Phosphatase tensin-type.		G -> R (in endometrial hyperplasia).|G -> E (in glioma).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(4)|p.G36E(4)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.G36V(2)|p.G36*(1)|p.A34_G36del(1)|p.G36R(1)|p.G36fs*18(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TATTGCTATGGGATTTCCTGC	0.284			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.245614	76.662177	83.367463	28	86	KEEP	---	---	---	---	19	14	56	50	-1	capture	Missense_Mutation	SNP	89653808	89653808	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	12633	229
TNKS2	80351	broad.mit.edu	37	10	93619322	93619322	+	Silent	SNP	C	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:93619322C>A	uc001khp.2	+	25	3495	c.3198C>A	c.(3196-3198)TCC>TCA	p.S1066S		NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related	1066	PARP catalytic.				positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding	p.S1066F(1)		kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)				AAAACTCTTCCAAAAGCAATC	0.398					718											0.030534	-25.022355	6.650478	4	127	KEEP	---	---	---	---	3	1	73	63	0.25	capture	Silent	SNP	93619322	93619322	TNKS2	10	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	16204	229
HPSE2	60495	broad.mit.edu	37	10	100374687	100374687	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:100374687C>T	uc001kpn.1	-	9	1354	c.1294G>A	c.(1294-1296)GTG>ATG	p.V432M	HPSE2_uc009xwc.1_Missense_Mutation_p.V422M|HPSE2_uc001kpo.1_Missense_Mutation_p.V364M|HPSE2_uc009xwd.1_Missense_Mutation_p.V310M	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	432					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		TTCTGGTCCACGAGGTGATTG	0.418																0.047619	-18.6033	13.429811	7	140	KEEP	---	---	---	---	6	2	72	83	-1	capture	Missense_Mutation	SNP	100374687	100374687	HPSE2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7270	229
DNMBP	23268	broad.mit.edu	37	10	101716779	101716779	+	Missense_Mutation	SNP	C	T	T	rs138795130		TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:101716779C>T	uc001kqj.2	-	4	544	c.452G>A	c.(451-453)CGG>CAG	p.R151Q	NCRNA00093_uc001kqk.1_RNA	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	151	SH3 3.				intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CATTAGGGCCCGGGCTTGTCC	0.557																0.376623	85.370004	86.393239	29	48	KEEP	---	---	---	---	10	19	20	35	-1	capture	Missense_Mutation	SNP	101716779	101716779	DNMBP	10	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4630	229
OR51F2	119694	broad.mit.edu	37	11	4842972	4842972	+	Silent	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4842972C>T	uc010qyn.1	+	1	357	c.357C>T	c.(355-357)CAC>CAT	p.H119H		NM_001004753	NP_001004753	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F,	119	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTTTCTACACGGATTTACTT	0.468																0.191223	124.082852	152.513012	61	258	KEEP	---	---	---	---	32	34	127	158	-1	capture	Silent	SNP	4842972	4842972	OR51F2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11001	229
UEVLD	55293	broad.mit.edu	37	11	18587922	18587922	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18587922C>G	uc001mot.2	-	5	545	c.465G>C	c.(463-465)TTG>TTC	p.L155F	UEVLD_uc001mou.2_Missense_Mutation_p.L155F|UEVLD_uc010rde.1_Missense_Mutation_p.L25F|UEVLD_uc010rdf.1_Missense_Mutation_p.L133F|UEVLD_uc010rdg.1_Missense_Mutation_p.L25F|UEVLD_uc001mov.2_Missense_Mutation_p.L133F|UEVLD_uc010rdh.1_Missense_Mutation_p.L155F	NM_001040697	NP_001035787	Q8IX04	UEVLD_HUMAN	ubiquitin-conjugating enzyme E2-like isoform a	155					cellular carbohydrate metabolic process|protein modification process|protein transport		binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor				0						TATAGGCTAGCAAGTCTACCT	0.368																0.223404	46.637035	53.246951	21	73	KEEP	---	---	---	---	10	15	42	50	-1	capture	Missense_Mutation	SNP	18587922	18587922	UEVLD	11	C	G	G	G	1	0	0	0	0	1	0	0	0	324	25	4	4	16815	229
OR10AG1	282770	broad.mit.edu	37	11	55735344	55735344	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55735344G>A	uc010rit.1	-	1	596	c.596C>T	c.(595-597)ACG>ATG	p.T199M		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	199	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					AAATGGCACCGTGATAAACAC	0.408																0.053763	-9.997674	9.535349	5	88	KEEP	---	---	---	---	2	4	48	49	-1	capture	Missense_Mutation	SNP	55735344	55735344	OR10AG1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10801	229
OR10AG1	282770	broad.mit.edu	37	11	55735807	55735807	+	Missense_Mutation	SNP	C	T	T	rs139897319	byFrequency	TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55735807C>T	uc010rit.1	-	1	133	c.133G>A	c.(133-135)GCT>ACT	p.A45T		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	45	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					GTCTGGAGAGCGGGGTGAATT	0.348																0.118959	34.425119	72.770963	32	237	KEEP	---	---	---	---	20	14	127	155	-1	capture	Missense_Mutation	SNP	55735807	55735807	OR10AG1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10801	229
SLC22A10	387775	broad.mit.edu	37	11	63071595	63071595	+	Missense_Mutation	SNP	G	A	A	rs112720090		TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63071595G>A	uc009yor.2	+	8	1509	c.1301G>A	c.(1300-1302)CGT>CAT	p.R434H	SLC22A10_uc010rmo.1_Intron|SLC22A10_uc001nwu.3_RNA|SLC22A10_uc010rmp.1_Missense_Mutation_p.V228M	NM_001039752	NP_001034841	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	434	Cytoplasmic (Potential).					integral to membrane	transmembrane transporter activity			ovary(2)	2						CAGACCCTGCGTGTGGCTTTG	0.453																0.219424	143.326752	163.486516	61	217	KEEP	---	---	---	---	41	60	151	188	-1	capture	Missense_Mutation	SNP	63071595	63071595	SLC22A10	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14334	229
NAALADL1	10004	broad.mit.edu	37	11	64820765	64820765	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64820765C>T	uc001ocn.2	-	8	1139	c.1123G>A	c.(1123-1125)GGG>AGG	p.G375R	NAALADL1_uc010rnw.1_5'UTR	NM_005468	NP_005459	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic	375	NAALADase.|Extracellular (Potential).				proteolysis	apical plasma membrane|integral to membrane	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity				0						TCCACAGCCCCGTGCACCCAG	0.672																0.25	6.346962	6.800846	2	6	KEEP	---	---	---	---	2	0	4	3	-1	capture	Missense_Mutation	SNP	64820765	64820765	NAALADL1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10039	229
PCNXL3	399909	broad.mit.edu	37	11	65402835	65402835	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65402835G>A	uc001oey.2	+	31	5100	c.5100G>A	c.(5098-5100)GCG>GCA	p.A1700A	PCNXL3_uc001oez.2_Silent_p.A587A	NM_032223	NP_115599	Q9H6A9	PCX3_HUMAN	pecanex-like 3	1700						integral to membrane					0						CCCTGCTGGCGCTGCGCCATG	0.632																0.206897	12.736225	15.043698	6	23	KEEP	---	---	---	---	3	4	12	13	-1	capture	Silent	SNP	65402835	65402835	PCNXL3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11496	229
GDF3	9573	broad.mit.edu	37	12	7842931	7842931	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7842931C>T	uc001qte.2	-	2	674	c.638G>A	c.(637-639)GGG>GAG	p.G213E		NM_020634	NP_065685	Q9NR23	GDF3_HUMAN	growth differentiation factor 3 precursor	213					eye development|growth|skeletal system development	extracellular space	cytokine activity|growth factor activity			skin(3)|ovary(1)|lung(1)|central_nervous_system(1)	6						AAAATTCACCCCTGAGTCTCT	0.493																0.267045	125.390402	133.989595	47	129	KEEP	---	---	---	---	17	30	57	76	-1	capture	Missense_Mutation	SNP	7842931	7842931	GDF3	12	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	6255	229
NELL2	4753	broad.mit.edu	37	12	45173691	45173691	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:45173691C>T	uc001rog.2	-	4	1045	c.450G>A	c.(448-450)TGG>TGA	p.W150*	NELL2_uc001rof.3_Nonsense_Mutation_p.W149*|NELL2_uc001roh.2_Nonsense_Mutation_p.W150*|NELL2_uc009zkd.2_Nonsense_Mutation_p.W149*|NELL2_uc010skz.1_Nonsense_Mutation_p.W200*|NELL2_uc010sla.1_Nonsense_Mutation_p.W173*|NELL2_uc001roi.1_Nonsense_Mutation_p.W150*|NELL2_uc010slb.1_Nonsense_Mutation_p.W149*|NELL2_uc001roj.2_Nonsense_Mutation_p.W150*	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	150	TSP N-terminal.				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		AGAGCTTGTGCCACTTGTCAT	0.438																0.02682	-53.537223	10.972926	7	254	KEEP	---	---	---	---	1	7	143	142	-1	capture	Nonsense_Mutation	SNP	45173691	45173691	NELL2	12	C	T	T	T	1	0	0	0	0	0	1	0	0	338	26	5	2	10241	229
ARID2	196528	broad.mit.edu	37	12	46245949	46245949	+	Missense_Mutation	SNP	A	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:46245949A>T	uc001ros.1	+	15	4043	c.4043A>T	c.(4042-4044)GAT>GTT	p.D1348V	ARID2_uc001ror.2_Missense_Mutation_p.D1348V|ARID2_uc009zkg.1_Missense_Mutation_p.D804V|ARID2_uc009zkh.1_Missense_Mutation_p.D975V|ARID2_uc001rou.1_Missense_Mutation_p.D682V	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1348					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GACATGCAAGATATCAAAAGT	0.358																0.257426	70.706455	76.090431	26	75	KEEP	---	---	---	---	14	12	42	35	-1	capture	Missense_Mutation	SNP	46245949	46245949	ARID2	12	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	908	229
KRT78	196374	broad.mit.edu	37	12	53242331	53242331	+	Silent	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53242331C>T	uc001sbc.1	-	1	448	c.384G>A	c.(382-384)AAG>AAA	p.K128K		NM_173352	NP_775487	Q8N1N4	K2C78_HUMAN	keratin 5b	128	Coil 1A.|Rod.					keratin filament	protein binding|structural molecule activity			ovary(2)	2						TGACCCTCACCTTGTCAATGA	0.537																0.142857	13.379959	20.249229	8	48	KEEP	---	---	---	---	4	5	21	31	-1	capture	Silent	SNP	53242331	53242331	KRT78	12	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	8411	229
SLC24A6	80024	broad.mit.edu	37	12	113770568	113770568	+	Missense_Mutation	SNP	T	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113770568T>A	uc001tvc.2	-	2	326	c.116A>T	c.(115-117)CAG>CTG	p.Q39L	SLC24A6_uc001tvd.1_Missense_Mutation_p.Q39L	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor	39	Extracellular (Potential).				response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						AGCTGGAAACTGGGGGCTAAT	0.527																0.260274	47.790079	51.589556	19	54	KEEP	---	---	---	---	11	9	18	37	-1	capture	Missense_Mutation	SNP	113770568	113770568	SLC24A6	12	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	14362	229
TBX5	6910	broad.mit.edu	37	12	114832695	114832695	+	Missense_Mutation	SNP	T	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:114832695T>A	uc001tvo.2	-	6	1009	c.514A>T	c.(514-516)ATT>TTT	p.I172F	TBX5_uc001tvp.2_Missense_Mutation_p.I172F|TBX5_uc001tvq.2_Missense_Mutation_p.I122F|TBX5_uc010syv.1_Missense_Mutation_p.I172F	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	172	T-box.				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GAATTTAGAATAATCTAAAAA	0.368	NSCLC(152;1358 1980 4050 23898 40356)															0.230769	191.023144	214.319813	81	270	KEEP	---	---	---	---	42	46	122	179	-1	capture	Missense_Mutation	SNP	114832695	114832695	TBX5	12	T	A	A	A	1	0	0	0	0	1	0	0	0	637	49	4	4	15548	229
UCHL3	7347	broad.mit.edu	37	13	76134909	76134909	+	Silent	SNP	A	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:76134909A>T	uc001vjq.2	+	3	105	c.75A>T	c.(73-75)CTA>CTT	p.L25L	UCHL3_uc001vjr.2_5'UTR	NM_006002	NP_005993	P15374	UCHL3_HUMAN	ubiquitin carboxyl-terminal esterase L3	25					ubiquitin-dependent protein catabolic process	cytoplasm	cysteine-type peptidase activity|ubiquitin binding|ubiquitin thiolesterase activity				0				GBM - Glioblastoma multiforme(99;0.0125)		AATTAGGTCTACATCCTAACT	0.333																0.217391	44.647084	51.431192	20	72	KEEP	---	---	---	---	12	9	35	40	-1	capture	Silent	SNP	76134909	76134909	UCHL3	13	A	T	T	T	1	0	0	0	0	0	0	0	1	171	14	4	4	16803	229
POTEG	404785	broad.mit.edu	37	14	19553823	19553823	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:19553823G>A	uc001vuz.1	+	1	459	c.407G>A	c.(406-408)CGT>CAT	p.R136H	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	136								p.R136H(1)		ovary(1)	1						TACCACGTCCGTCGAGAAGAT	0.577																0.092063	7.917939	60.728739	29	286	KEEP	---	---	---	---	20	25	313	293	-1	capture	Missense_Mutation	SNP	19553823	19553823	POTEG	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12167	229
OXA1L	5018	broad.mit.edu	37	14	23239044	23239044	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23239044G>A	uc001wgn.2	+	4	664	c.664G>A	c.(664-666)GGC>AGC	p.G222S	OXA1L_uc001wgo.2_RNA|OXA1L_uc010akc.2_Missense_Mutation_p.G222S|OXA1L_uc001wgp.2_Missense_Mutation_p.G146S|OXA1L_uc001wgq.2_5'UTR	NM_005015	NP_005006	Q15070	OXA1L_HUMAN	oxidase (cytochrome c) assembly 1-like	162	Mitochondrial intermembrane (Potential).				aerobic respiration|mitochondrial proton-transporting ATP synthase complex assembly|mitochondrial respiratory chain complex I assembly|negative regulation of ATPase activity|negative regulation of oxidoreductase activity|protein insertion into membrane|protein tetramerization	integral to mitochondrial membrane|mitochondrial respiratory chain|protein complex	protein homodimerization activity|ribosome binding			central_nervous_system(1)	1	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.0096)		CATCGTGACGGGCCAGCGAGA	0.488																0.141317	181.435494	285.05343	118	717	KEEP	---	---	---	---	102	99	402	395	-1	capture	Missense_Mutation	SNP	23239044	23239044	OXA1L	14	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11232	229
PCK2	5106	broad.mit.edu	37	14	24567814	24567814	+	Silent	SNP	T	C	C			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24567814T>C	uc001wlt.2	+	4	723	c.591T>C	c.(589-591)CCT>CCC	p.P197P	NRL_uc001wlq.2_Intron|PCK2_uc001wlr.1_Silent_p.P209P|PCK2_uc001wls.2_Silent_p.P197P|PCK2_uc010tnw.1_Silent_p.P63P|PCK2_uc010ald.2_Silent_p.P49P|PCK2_uc010ale.2_Silent_p.P63P|PCK2_uc010tnx.1_Silent_p.P63P|PCK2_uc001wlu.3_Silent_p.P63P	NM_004563	NP_004554	Q16822	PCKGM_HUMAN	mitochondrial phosphoenolpyruvate carboxykinase	197					gluconeogenesis	mitochondrial matrix	GTP binding|metal ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.0184)		TGGGGACACCTGTGCTTCAGG	0.617																0.0375	-11.045321	7.47781	3	77	KEEP	---	---	---	---	0	3	51	38	-1	capture	Silent	SNP	24567814	24567814	PCK2	14	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	11485	229
FOXG1	2290	broad.mit.edu	37	14	29237322	29237322	+	Silent	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:29237322C>T	uc001wqe.2	+	1	1036	c.837C>T	c.(835-837)ACC>ACT	p.T279T		NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1	279					axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		GCTCCACCACCTCGCGGGCCA	0.701																0.223881	36.394749	41.087268	15	52	KEEP	---	---	---	---	9	13	24	32	-1	capture	Silent	SNP	29237322	29237322	FOXG1	14	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	5951	229
TDRD9	122402	broad.mit.edu	37	14	104488645	104488645	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:104488645G>A	uc001yom.3	+	24	2614	c.2584G>A	c.(2584-2586)GTC>ATC	p.V862I	TDRD9_uc001yon.3_Missense_Mutation_p.V600I	NM_153046	NP_694591	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	862					cell differentiation|DNA methylation involved in gamete generation|fertilization|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	nucleus|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				AGGCATGAACGTCTCAAAGCT	0.448																0.206349	28.139462	33.176386	13	50	KEEP	---	---	---	---	9	6	25	40	-1	capture	Missense_Mutation	SNP	104488645	104488645	TDRD9	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15621	229
PLD4	122618	broad.mit.edu	37	14	105397140	105397140	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105397140C>T	uc001ypu.1	+	7	920	c.779C>T	c.(778-780)ACC>ATC	p.T260I	PLD4_uc010tyl.1_Missense_Mutation_p.T267I	NM_138790	NP_620145	Q96BZ4	PLD4_HUMAN	phospholipase D4	260					lipid catabolic process	integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity			central_nervous_system(1)|skin(1)	2		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)		Choline(DB00122)	CTGGAGAAGACCTTCCAGACC	0.572																0.230415	112.156312	126.605703	50	167	KEEP	---	---	---	---	27	25	93	94	-1	capture	Missense_Mutation	SNP	105397140	105397140	PLD4	14	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	11951	229
GPR132	29933	broad.mit.edu	37	14	105518239	105518239	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105518239C>T	uc001yqd.2	-	4	1134	c.235G>A	c.(235-237)GTC>ATC	p.V79I	GPR132_uc001yqc.2_5'UTR|GPR132_uc001yqe.2_Missense_Mutation_p.V70I	NM_013345	NP_037477	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	79	Cytoplasmic (Potential).				response to stress	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		AGCAGGTAGACGGCCAGCACG	0.657																0.215827	68.080315	78.434312	30	109	KEEP	---	---	---	---	12	18	52	67	-1	capture	Missense_Mutation	SNP	105518239	105518239	GPR132	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6576	229
PLA2G4F	255189	broad.mit.edu	37	15	42442026	42442026	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42442026C>T	uc001zoz.2	-	11	1007	c.944G>A	c.(943-945)CGC>CAC	p.R315H	PLA2G4F_uc001zoy.2_5'Flank|PLA2G4F_uc010bcr.2_Missense_Mutation_p.R66H|PLA2G4F_uc001zpa.2_Missense_Mutation_p.R66H|PLA2G4F_uc010bcs.2_Missense_Mutation_p.R102H	NM_213600	NP_998765	Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	315	PLA2c.				phospholipid catabolic process	cytosol|lysosomal membrane	metal ion binding|phospholipase A2 activity			ovary(4)	4		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		AAAGCCAAGGCGTAGGTCTAG	0.632																0.090361	0.592155	28.713783	15	151	KEEP	---	---	---	---	6	10	92	100	-1	capture	Missense_Mutation	SNP	42442026	42442026	PLA2G4F	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11909	229
TLN2	83660	broad.mit.edu	37	15	63055766	63055766	+	Missense_Mutation	SNP	A	C	C			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:63055766A>C	uc002alb.3	+	37	4966	c.4966A>C	c.(4966-4968)AAG>CAG	p.K1656Q	TLN2_uc002alc.3_Missense_Mutation_p.K49Q|TLN2_uc002ald.2_Missense_Mutation_p.K49Q	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1656					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						TTCCAGGGACAAGGCCCCTGG	0.617																0.216981	65.567806	73.402834	23	83	KEEP	---	---	---	---	14	13	27	74	-1	capture	Missense_Mutation	SNP	63055766	63055766	TLN2	15	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	15833	229
C15orf39	56905	broad.mit.edu	37	15	75503308	75503308	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75503308G>A	uc002azp.3	+	3	3315	c.2995G>A	c.(2995-2997)GGC>AGC	p.G999S	C15orf39_uc002azq.3_Missense_Mutation_p.G999S|C15orf39_uc002azr.3_3'UTR	NM_015492	NP_056307	Q6ZRI6	CO039_HUMAN	hypothetical protein LOC56905	999											0						CAGCCCACCTGGCCCCACACT	0.662																0.123077	10.658536	19.691675	8	57	KEEP	---	---	---	---	4	5	37	34	-1	capture	Missense_Mutation	SNP	75503308	75503308	C15orf39	15	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	1779	229
C15orf27	123591	broad.mit.edu	37	15	76496348	76496348	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:76496348C>T	uc002bbq.2	+	11	1443	c.1288C>T	c.(1288-1290)CCA>TCA	p.P430S	C15orf27_uc010bkp.2_Missense_Mutation_p.P246S|C15orf27_uc002bbr.2_Missense_Mutation_p.P246S|C15orf27_uc002bbs.2_Missense_Mutation_p.P108S	NM_152335	NP_689548	Q2M3C6	CO027_HUMAN	hypothetical protein LOC123591	430						integral to membrane					0						CCCGCCGCTGCCATCCCAGCA	0.701																0.241379	16.309263	18.079701	7	22	KEEP	---	---	---	---	3	9	13	21	-1	capture	Missense_Mutation	SNP	76496348	76496348	C15orf27	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	1774	229
DECR2	26063	broad.mit.edu	37	16	460737	460737	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:460737G>A	uc002chb.2	+	6	615	c.509G>A	c.(508-510)CGG>CAG	p.R170Q	DECR2_uc002chc.2_Missense_Mutation_p.R86Q|DECR2_uc010bqv.2_Missense_Mutation_p.R86Q|DECR2_uc002chd.2_Missense_Mutation_p.R86Q|DECR2_uc002che.1_RNA	NM_020664	NP_065715	Q9NUI1	DECR2_HUMAN	2,4-dienoyl CoA reductase 2	170						peroxisome	2,4-dienoyl-CoA reductase (NADPH) activity|binding				0		Hepatocellular(16;0.00015)				CTGGGGAACCGGGGGCAGGCG	0.701																0.212121	17.306584	19.834575	7	26	KEEP	---	---	---	---	4	6	27	11	-1	capture	Missense_Mutation	SNP	460737	460737	DECR2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4341	229
IGFALS	3483	broad.mit.edu	37	16	1841525	1841525	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1841525G>A	uc002cmy.2	-	2	975	c.894C>T	c.(892-894)TCC>TCT	p.S298S	IGFALS_uc010uvn.1_Silent_p.S336S|IGFALS_uc010uvo.1_5'UTR	NM_004970	NP_004961	P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid	298	LRR 10.				cell adhesion|signal transduction	soluble fraction	insulin-like growth factor binding				0						TGGCGTTGTGGGACAGCCGCA	0.687																0.416667	15.072633	15.145455	5	7	KEEP	---	---	---	---	1	4	4	6	-1	capture	Silent	SNP	1841525	1841525	IGFALS	16	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	7502	229
PRSS22	64063	broad.mit.edu	37	16	2903295	2903295	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2903295G>A	uc002cry.1	-	6	819	c.753C>T	c.(751-753)GAC>GAT	p.D251D	PRSS22_uc002crz.1_Silent_p.D141D	NM_022119	NP_071402	Q9GZN4	BSSP4_HUMAN	protease, serine, 22 precursor	251	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			central_nervous_system(1)	1						GCCAGGCGCCGTCCACCTGGC	0.711																0.192308	9.157637	11.459087	5	21	KEEP	---	---	---	---	3	3	9	20	-1	capture	Silent	SNP	2903295	2903295	PRSS22	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12514	229
DNAH3	55567	broad.mit.edu	37	16	21045351	21045351	+	Silent	SNP	G	A	A	rs143127393	by1000genomes	TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21045351G>A	uc010vbe.1	-	36	5142	c.5142C>T	c.(5140-5142)GGC>GGT	p.G1714G		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1714	ATP (Potential).|AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		AGGTCTTGCCGCCCATGGGGT	0.498																0.26087	59.065915	63.82409	24	68	KEEP	---	---	---	---	9	22	40	47	-1	capture	Silent	SNP	21045351	21045351	DNAH3	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4560	229
ITGAD	3681	broad.mit.edu	37	16	31427865	31427865	+	Silent	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31427865C>T	uc002ebv.1	+	20	2446	c.2397C>T	c.(2395-2397)AAC>AAT	p.N799N	ITGAD_uc010cap.1_Silent_p.N800N	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	799	Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						TGGAGCTCAACGTGATTGTGA	0.617																0.237918	150.254752	167.147357	64	205	KEEP	---	---	---	---	33	36	112	123	-1	capture	Silent	SNP	31427865	31427865	ITGAD	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7807	229
ZFHX3	463	broad.mit.edu	37	16	72993903	72993903	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:72993903C>A	uc002fck.2	-	2	815	c.142G>T	c.(142-144)GGG>TGG	p.G48W	ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	48					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				TCCAAGGGCCCGTGGCTCTCG	0.667																0.024194	-24.84183	6.303158	3	121	KEEP	---	---	---	---	2	1	72	69	0.333333333333	capture	Missense_Mutation	SNP	72993903	72993903	ZFHX3	16	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	17514	229
USP22	23326	broad.mit.edu	37	17	20924447	20924447	+	Silent	SNP	G	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:20924447G>T	uc002gym.3	-	3	601	c.397C>A	c.(397-399)CGA>AGA	p.R133R	USP22_uc002gyn.3_Silent_p.R121R|USP22_uc002gyl.3_Silent_p.R28R	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22	133					cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						CAAGCTTTTCGCTGCTCCTCC	0.478																0.031579	-16.449913	6.356946	3	92	KEEP	---	---	---	---	0	4	62	54	-1	capture	Silent	SNP	20924447	20924447	USP22	17	G	T	T	T	1	0	0	0	0	0	0	0	1	493	38	4	4	16936	229
KIF2B	84643	broad.mit.edu	37	17	51901070	51901070	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:51901070C>T	uc002iua.2	+	1	832	c.676C>T	c.(676-678)CGA>TGA	p.R226*	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	226	Kinesin-motor.				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						TCTCAACCAGCGAGAGACAAC	0.557																0.207792	32.638706	38.755873	16	61	KEEP	---	---	---	---	9	8	17	46	-1	capture	Nonsense_Mutation	SNP	51901070	51901070	KIF2B	17	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	8220	229
MARCH10	162333	broad.mit.edu	37	17	60879073	60879073	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:60879073C>A	uc010ddr.2	-	2	262	c.24G>T	c.(22-24)AGG>AGT	p.R8S	MARCH10_uc002jag.3_Missense_Mutation_p.R8S|MARCH10_uc010dds.2_Missense_Mutation_p.R8S|MARCH10_uc002jah.2_Missense_Mutation_p.R8S	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190	8							ligase activity|zinc ion binding				0						AGAACTTCTGCCTGTCCCTTG	0.453																0.227679	116.983962	132.176247	51	173	KEEP	---	---	---	---	28	30	95	113	0.51724137931	capture	Missense_Mutation	SNP	60879073	60879073	MARCH10	17	C	A	A	A	1	0	0	0	0	1	0	0	0	337	26	4	4	9212	229
LRRC37A3	374819	broad.mit.edu	37	17	62856062	62856062	+	Missense_Mutation	SNP	A	C	C	rs139735390	by1000genomes	TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62856062A>C	uc002jey.2	-	11	4733	c.4202T>G	c.(4201-4203)GTT>GGT	p.V1401G	LRRC37A3_uc010wqg.1_Missense_Mutation_p.V519G|LRRC37A3_uc002jex.1_Missense_Mutation_p.V378G|LRRC37A3_uc010wqf.1_Missense_Mutation_p.V439G|LRRC37A3_uc010dek.1_Missense_Mutation_p.V407G	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1401	Extracellular (Potential).					integral to membrane					0						TTCCATAAAAACATTTTCTTC	0.368																0.237624	67.752756	74.103107	24	77	KEEP	---	---	---	---	12	15	38	45	-1	capture	Missense_Mutation	SNP	62856062	62856062	LRRC37A3	17	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	8908	229
HELZ	9931	broad.mit.edu	37	17	65119252	65119252	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:65119252A>G	uc010wqk.1	-	26	3654	c.3467T>C	c.(3466-3468)ATT>ACT	p.I1156T	HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.I1155T	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AGGATTGCCAATAAGTACAGA	0.388																0.313953	87.496659	90.14401	27	59	KEEP	---	---	---	---	13	17	36	30	-1	capture	Missense_Mutation	SNP	65119252	65119252	HELZ	17	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	6975	229
KIF19	124602	broad.mit.edu	37	17	72345437	72345437	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72345437C>T	uc002jkm.3	+	10	1300	c.1162C>T	c.(1162-1164)CGG>TGG	p.R388W	KIF19_uc002jkj.2_Missense_Mutation_p.R388W|KIF19_uc002jkk.2_Missense_Mutation_p.R346W|KIF19_uc002jkl.2_Missense_Mutation_p.R346W	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	388	Potential.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						GCAGACTGGGCGGGGCCAGGC	0.662																0.06	-3.111238	7.006741	3	47	KEEP	---	---	---	---	0	3	30	32	-1	capture	Missense_Mutation	SNP	72345437	72345437	KIF19	17	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	8204	229
CBX2	84733	broad.mit.edu	37	17	77758656	77758656	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77758656G>A	uc002jxc.2	+	5	1456	c.1414G>A	c.(1414-1416)GAC>AAC	p.D472N		NM_005189	NP_005180	Q14781	CBX2_HUMAN	chromobox homolog 2 isoform 1	472					cell differentiation|chromatin modification|development of primary sexual characteristics|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	PcG protein complex	DNA binding				0			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CTCCGACCCCGACTCCGCCTC	0.662																0.136364	7.720905	13.356233	6	38	KEEP	---	---	---	---	2	4	27	15	-1	capture	Missense_Mutation	SNP	77758656	77758656	CBX2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2692	229
FOXK2	3607	broad.mit.edu	37	17	80521333	80521333	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80521333G>A	uc002kfn.2	+	2	694	c.523G>A	c.(523-525)GTA>ATA	p.V175I	FOXK2_uc002kfm.1_Missense_Mutation_p.V175I|FOXK2_uc010diu.2_Missense_Mutation_p.V175I	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2	175					embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			AGTGAAGGCCGTACAGCCACA	0.582																0.043478	-18.525493	7.243588	5	110	KEEP	---	---	---	---	3	2	70	58	-1	capture	Missense_Mutation	SNP	80521333	80521333	FOXK2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5959	229
LRRC8E	80131	broad.mit.edu	37	19	7963647	7963647	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7963647G>T	uc002mir.2	+	3	341	c.240G>T	c.(238-240)CAG>CAT	p.Q80H		NM_025061	NP_079337	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member	80						integral to membrane				lung(1)|pancreas(1)	2						TCCCTGAGCAGATTGGGGCCC	0.522																0.19661	111.96044	137.284253	58	237	KEEP	---	---	---	---	26	32	120	129	0.448275862069	capture	Missense_Mutation	SNP	7963647	7963647	LRRC8E	19	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	8940	229
ZNF844	284391	broad.mit.edu	37	19	12187275	12187275	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12187275G>C	uc002mtb.2	+	4	1483	c.1340G>C	c.(1339-1341)CGT>CCT	p.R447P	ZNF844_uc010dym.1_Missense_Mutation_p.R290P	NM_001136501	NP_001129973	Q08AG5	ZN844_HUMAN	zinc finger protein 844	447					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAGAGAAACCGTATGAGTGTA	0.433																0.019608	-32.813554	6.821669	3	150	KEEP	---	---	---	---	2	1	82	91	-1	capture	Missense_Mutation	SNP	12187275	12187275	ZNF844	19	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	18066	229
TNPO2	30000	broad.mit.edu	37	19	12817567	12817567	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12817567G>T	uc002muo.2	-	13	1498	c.1313C>A	c.(1312-1314)CCG>CAG	p.P438Q	TNPO2_uc002mup.2_Missense_Mutation_p.P530Q|TNPO2_uc002muq.2_Missense_Mutation_p.P438Q|TNPO2_uc002mur.2_Missense_Mutation_p.P438Q|SNORD41_uc002mut.1_5'Flank	NM_001136196	NP_001129668	O14787	TNPO2_HUMAN	transportin 2 (importin 3, karyopherin beta 2b)	438	HEAT 7.				intracellular protein transport	cytoplasm|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			ovary(1)	1						GATCAGGTGCGGGATCAGCTC	0.632																0.096774	1.500367	6.553214	3	28	KEEP	---	---	---	---	1	2	8	27	0.333333333333	capture	Missense_Mutation	SNP	12817567	12817567	TNPO2	19	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	16219	229
ZNF676	163223	broad.mit.edu	37	19	22363820	22363820	+	Silent	SNP	A	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22363820A>T	uc002nqs.1	-	3	1017	c.699T>A	c.(697-699)GCT>GCA	p.A233A		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	233	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				ATCGATTAAAAGCTTTGCCAC	0.358																0.118919	24.614221	51.005384	22	163	KEEP	---	---	---	---	8	16	100	95	-1	capture	Silent	SNP	22363820	22363820	ZNF676	19	A	T	T	T	1	0	0	0	0	0	0	0	1	28	3	4	4	17961	229
RYR1	6261	broad.mit.edu	37	19	38983254	38983254	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38983254G>A	uc002oit.2	+	38	6382	c.6252G>A	c.(6250-6252)CGG>CGA	p.R2084R	RYR1_uc002oiu.2_Silent_p.R2084R	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2084	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	AGGAGGAGCGGTCAGCAGAGG	0.627																0.054545	-5.122275	6.37962	3	52	KEEP	---	---	---	---	1	2	31	23	-1	capture	Silent	SNP	38983254	38983254	RYR1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	561	44	2	2	13660	229
ZNF284	342909	broad.mit.edu	37	19	44589943	44589943	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44589943G>A	uc002oyg.1	+	5	528	c.312G>A	c.(310-312)TGG>TGA	p.W104*	ZNF284_uc010ejd.2_RNA	NM_001037813	NP_001032902	Q2VY69	ZN284_HUMAN	zinc finger protein 284	104					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0435)				AGCAAATCTGGGAACAAACTG	0.468																0.024	-24.294224	7.187801	3	122	KEEP	---	---	---	---	0	3	56	69	-1	capture	Nonsense_Mutation	SNP	44589943	44589943	ZNF284	19	G	A	A	A	1	0	0	0	0	0	1	0	0	559	43	5	2	17701	229
ZNF528	84436	broad.mit.edu	37	19	52918709	52918709	+	Missense_Mutation	SNP	A	C	C			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52918709A>C	uc002pzh.2	+	7	1030	c.604A>C	c.(604-606)ACT>CCT	p.T202P	ZNF528_uc002pzi.2_5'UTR	NM_032423	NP_115799	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	202					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		TGCAAGCCTTACTAACCAAGT	0.398																0.102564	23.86226	54.553848	20	175	KEEP	---	---	---	---	12	9	102	96	-1	capture	Missense_Mutation	SNP	52918709	52918709	ZNF528	19	A	C	C	C	1	0	0	0	0	1	0	0	0	182	14	4	4	17848	229
NLRP12	91662	broad.mit.edu	37	19	54314485	54314485	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54314485C>T	uc002qch.3	-	3	648	c.428G>A	c.(427-429)CGC>CAC	p.R143H	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.R143H|NLRP12_uc002qcj.3_Missense_Mutation_p.R143H|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.R143H	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	143					negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GCGCGCATTGCGGTCTTCCAT	0.567																0.135762	54.161964	93.009308	41	261	KEEP	---	---	---	---	20	26	150	185	-1	capture	Missense_Mutation	SNP	54314485	54314485	NLRP12	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10381	229
ZNF416	55659	broad.mit.edu	37	19	58084494	58084494	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58084494G>A	uc002qpf.2	-	4	949	c.778C>T	c.(778-780)CTG>TTG	p.L260L	ZNF547_uc002qpm.3_Intron	NM_017879	NP_060349	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	260	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		ACTCTTTGCAGCTGAACAAGG	0.458																0.012953	-96.701541	7.915442	5	381	KEEP	---	---	---	---	2	3	166	238	-1	capture	Silent	SNP	58084494	58084494	ZNF416	19	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	17773	229
E2F6	1876	broad.mit.edu	37	2	11587770	11587770	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:11587770G>A	uc002rbh.2	-	6	1074	c.782C>T	c.(781-783)CCA>CTA	p.P261L	E2F6_uc002rbe.2_Missense_Mutation_p.P186L|E2F6_uc002rbf.2_Missense_Mutation_p.P229L|E2F6_uc002rbg.2_Missense_Mutation_p.P186L|E2F6_uc002rbi.2_Missense_Mutation_p.P186L|E2F6_uc010yjl.1_RNA	NM_198256	NP_937987	O75461	E2F6_HUMAN	E2F transcription factor 6	261	Transcription repression.				negative regulation of transcription from RNA polymerase II promoter	MLL1 complex|transcription factor complex	DNA binding|transcription corepressor activity			skin(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.114)|OV - Ovarian serous cystadenocarcinoma(76;0.168)		AGGGCCTTCTGGATGAGTGCT	0.398																0.197917	127.594582	152.077882	57	231	KEEP	---	---	---	---	39	29	148	140	-1	capture	Missense_Mutation	SNP	11587770	11587770	E2F6	2	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	4826	229
MAP4K3	8491	broad.mit.edu	37	2	39509673	39509673	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:39509673G>A	uc002rro.2	-	22	1701	c.1610C>T	c.(1609-1611)CCT>CTT	p.P537L	MAP4K3_uc002rrp.2_Missense_Mutation_p.P516L|MAP4K3_uc010yns.1_Missense_Mutation_p.P90L	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase	537					JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				AGGTGTTGGAGGAAGACCATT	0.323					525											0.149533	30.039794	42.635137	16	91	KEEP	---	---	---	---	8	11	46	70	-1	capture	Missense_Mutation	SNP	39509673	39509673	MAP4K3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	9175	229
PPM1B	5495	broad.mit.edu	37	2	44428594	44428594	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:44428594A>G	uc002rtt.2	+	2	684	c.256A>G	c.(256-258)AGG>GGG	p.R86G	PPM1B_uc002rts.2_Missense_Mutation_p.R86G|PPM1B_uc002rtu.2_Missense_Mutation_p.R86G|PPM1B_uc002rtv.2_Intron|PPM1B_uc002rtw.2_Missense_Mutation_p.R86G|PPM1B_uc002rtx.2_Missense_Mutation_p.R86G	NM_002706	NP_002697	O75688	PPM1B_HUMAN	protein phosphatase 1B isoform 1	86					protein dephosphorylation	protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity			kidney(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CGAAGACTTTAGGGCAGCTGG	0.383																0.021505	-38.562532	9.024312	4	182	KEEP	---	---	---	---	3	1	97	102	-1	capture	Missense_Mutation	SNP	44428594	44428594	PPM1B	2	A	G	G	G	1	0	0	0	0	1	0	0	0	192	15	3	3	12237	229
POU3F3	5455	broad.mit.edu	37	2	105473303	105473303	+	Silent	SNP	C	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:105473303C>G	uc010ywg.1	+	1	1335	c.1335C>G	c.(1333-1335)CTC>CTG	p.L445L		NM_006236	NP_006227	P20264	PO3F3_HUMAN	POU class 3 homeobox 3	445	Homeobox.				metanephric ascending thin limb development|metanephric DCT cell differentiation|metanephric macula densa development|metanephric thick ascending limb development|negative regulation of apoptosis|positive regulation of cell proliferation	nucleus	sequence-specific DNA binding			ovary(1)	1						GCCTGCAGCTCGAGAAGGAGG	0.642																0.034483	-12.144311	8.365248	3	84	KEEP	---	---	---	---	0	4	50	54	-1	capture	Silent	SNP	105473303	105473303	POU3F3	2	C	G	G	G	1	0	0	0	0	0	0	0	1	392	31	4	4	12177	229
MERTK	10461	broad.mit.edu	37	2	112786347	112786347	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:112786347G>A	uc002thk.1	+	19	3028	c.2906G>A	c.(2905-2907)TGG>TAG	p.W969*	MERTK_uc002thl.1_Nonsense_Mutation_p.W793*	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	969	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						GGGGTCTCCTGGTCCCATTCG	0.527					602											0.036585	-12.644119	6.447589	3	79	KEEP	---	---	---	---	0	3	38	50	-1	capture	Nonsense_Mutation	SNP	112786347	112786347	MERTK	2	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	9392	229
MCM6	4175	broad.mit.edu	37	2	136627932	136627932	+	Splice_Site	SNP	C	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:136627932C>G	uc002tuw.2	-	3	331	c.255_splice	c.e3-1	p.R85_splice		NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	AGGGTAAACTCTGAAAAACAA	0.428	Ovarian(196;141 2104 8848 24991 25939)															0.276119	225.535072	237.626284	74	194	KEEP	---	---	---	---	45	34	101	99	-1	capture	Splice_Site	SNP	136627932	136627932	MCM6	2	C	G	G	G	1	0	0	0	0	0	0	1	0	416	32	5	4	9304	229
ACVR1C	130399	broad.mit.edu	37	2	158412763	158412763	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:158412763G>A	uc002tzk.3	-	3	629	c.386C>T	c.(385-387)GCG>GTG	p.A129V	ACVR1C_uc002tzl.3_Intron|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Missense_Mutation_p.A79V	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1	129	Helical; (Potential).				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7						TGTCAGCATCGCAGCTATGGA	0.478					127											0.210526	53.763164	62.582081	24	90	KEEP	---	---	---	---	10	16	40	57	-1	capture	Missense_Mutation	SNP	158412763	158412763	ACVR1C	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	222	229
FAP	2191	broad.mit.edu	37	2	163070563	163070563	+	Missense_Mutation	SNP	A	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:163070563A>T	uc002ucd.2	-	11	1095	c.887T>A	c.(886-888)CTC>CAC	p.L296H	FAP_uc010zct.1_Missense_Mutation_p.L271H|FAP_uc010fpd.2_Intron|FAP_uc010fpe.1_Missense_Mutation_p.L263H	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	296	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						AACCCACGTGAGCCAACTGAA	0.368																0.260417	130.85791	140.838012	50	142	KEEP	---	---	---	---	20	33	66	93	-1	capture	Missense_Mutation	SNP	163070563	163070563	FAP	2	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	5619	229
LRP2	4036	broad.mit.edu	37	2	170115593	170115593	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170115593G>A	uc002ues.2	-	17	2668	c.2455C>T	c.(2455-2457)CGC>TGC	p.R819C	LRP2_uc010zdf.1_Missense_Mutation_p.R682C	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	819	LDL-receptor class B 7.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ACTACTGTGCGTCTCGTTTTA	0.398					2055											0.061047	-27.807156	41.416103	21	323	KEEP	---	---	---	---	11	11	169	205	-1	capture	Missense_Mutation	SNP	170115593	170115593	LRP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8872	229
COL3A1	1281	broad.mit.edu	37	2	189867049	189867049	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:189867049C>G	uc002uqj.1	+	35	2534	c.2417C>G	c.(2416-2418)CCA>CGA	p.P806R		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	806	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	ACTGGCCCTCCAGGACCTGCT	0.438					1079											0.028846	-18.439402	6.936993	3	101	KEEP	---	---	---	---	0	3	57	62	-1	capture	Missense_Mutation	SNP	189867049	189867049	COL3A1	2	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	3653	229
MARCH4	57574	broad.mit.edu	37	2	217234856	217234856	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:217234856C>T	uc002vgb.2	-	1	1895	c.128G>A	c.(127-129)CGC>CAC	p.R43H		NM_020814	NP_065865	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4	43						Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		GAAGAGCATGCGGCAGCGGCA	0.652																0.227273	11.562507	13.065198	5	17	KEEP	---	---	---	---	4	3	9	11	-1	capture	Missense_Mutation	SNP	217234856	217234856	MARCH4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9216	229
DIS3L2	129563	broad.mit.edu	37	2	233194556	233194556	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233194556G>C	uc010fxz.2	+	15	2049	c.1773G>C	c.(1771-1773)ATG>ATC	p.M591I	DIS3L2_uc002vsm.3_Intron|DIS3L2_uc002vso.2_RNA	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.	591							exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		TGGCCAACATGGCAGTGGCCC	0.657																0.1	3.234147	6.430866	2	18	KEEP	---	---	---	---	0	2	10	12	-1	capture	Missense_Mutation	SNP	233194556	233194556	DIS3L2	2	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	4495	229
KCNB1	3745	broad.mit.edu	37	20	48098748	48098748	+	Silent	SNP	G	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:48098748G>T	uc002xur.1	-	1	434	c.270C>A	c.(268-270)GGC>GGA	p.G90G	KCNB1_uc002xus.1_Silent_p.G90G	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related	90	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			AGGTGAAGGCGCCCGGGTGGC	0.607																0.065217	-9.712029	8.317591	6	86	KEEP	---	---	---	---	3	4	51	48	0.428571428571	capture	Silent	SNP	48098748	48098748	KCNB1	20	G	T	T	T	1	0	0	0	0	0	0	0	1	483	38	4	4	7934	229
TRPM2	7226	broad.mit.edu	37	21	45786765	45786765	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45786765G>A	uc002zet.1	+	5	765	c.552G>A	c.(550-552)CCG>CCA	p.P184P	TRPM2_uc002zeu.1_Silent_p.P184P|TRPM2_uc002zew.1_Silent_p.P184P|TRPM2_uc010gpt.1_Silent_p.P184P|TRPM2_uc002zex.1_5'Flank	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	184	Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						ACATGAAGCCGCGGCTGAAGA	0.637																0.22619	41.87802	47.664091	19	65	KEEP	---	---	---	---	12	12	40	38	-1	capture	Silent	SNP	45786765	45786765	TRPM2	21	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	16469	229
LZTR1	8216	broad.mit.edu	37	22	21343151	21343151	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21343151G>A	uc002zto.2	+	6	686	c.583G>A	c.(583-585)GGC>AGC	p.G195S	LZTR1_uc002ztn.2_Missense_Mutation_p.G154S|LZTR1_uc011ahy.1_Missense_Mutation_p.G176S|LZTR1_uc010gsr.1_Missense_Mutation_p.G66S	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	195	Kelch 3.				anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			TGGCTATGACGGCAACGCCAG	0.637				p.G195S(PF382-Tumor)	1299											0.19171	83.257549	100.32498	37	156	KEEP	---	---	---	---	24	20	75	96	-1	capture	Missense_Mutation	SNP	21343151	21343151	LZTR1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9052	229
ITIH4	3700	broad.mit.edu	37	3	52857940	52857940	+	Missense_Mutation	SNP	C	T	T	rs141154056	byFrequency	TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52857940C>T	uc003dfz.2	-	10	1288	c.1252G>A	c.(1252-1254)GGT>AGT	p.G418S	ITIH4_uc011bel.1_Missense_Mutation_p.G148S|ITIH4_uc003dfy.2_Missense_Mutation_p.G282S|ITIH4_uc011bem.1_Missense_Mutation_p.G418S|ITIH4_uc011ben.1_Missense_Mutation_p.G418S	NM_002218	NP_002209	Q14624	ITIH4_HUMAN	inter-alpha (globulin) inhibitor H4	418	VWFA.				acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		ACGTCGAAACCGAAGCCCAGG	0.612																0.169014	21.539491	28.93362	12	59	KEEP	---	---	---	---	9	7	27	47	-1	capture	Missense_Mutation	SNP	52857940	52857940	ITIH4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7829	229
IL17RB	55540	broad.mit.edu	37	3	53891662	53891662	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53891662C>T	uc003dha.2	+	8	731	c.692C>T	c.(691-693)ACG>ATG	p.T231M		NM_018725	NP_061195	Q9NRM6	I17RB_HUMAN	interleukin 17B receptor precursor	231	Extracellular (Potential).				defense response|regulation of cell growth	extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		AAGAAACAAACGCGAGCTTCA	0.373																0.238636	50.527764	56.020209	21	67	KEEP	---	---	---	---	10	13	46	31	-1	capture	Missense_Mutation	SNP	53891662	53891662	IL17RB	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7563	229
PTPRG	5793	broad.mit.edu	37	3	61975388	61975388	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:61975388C>T	uc003dlb.2	+	3	999	c.280C>T	c.(280-282)CGT>TGT	p.R94C	PTPRG_uc003dlc.2_Missense_Mutation_p.R94C	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	94	Extracellular (Potential).|Alpha-carbonic anhydrase.				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CCAGTATGCGCGTGTTGGGGA	0.488																0.230216	65.877146	75.20961	32	107	KEEP	---	---	---	---	18	15	59	65	-1	capture	Missense_Mutation	SNP	61975388	61975388	PTPRG	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12697	229
C3orf30	152405	broad.mit.edu	37	3	118865302	118865302	+	Missense_Mutation	SNP	G	A	A	rs138666071		TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:118865302G>A	uc003ecb.1	+	1	306	c.266G>A	c.(265-267)CGC>CAC	p.R89H	IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Missense_Mutation_p.R89H	NM_152539	NP_689752	Q96M34	CC030_HUMAN	hypothetical protein LOC152405	89										ovary(2)	2				GBM - Glioblastoma multiforme(114;0.222)		CAGGCTGGCCGCAGAGCATCC	0.502																0.322581	54.577378	56.310751	20	42	KEEP	---	---	---	---	7	13	17	32	-1	capture	Missense_Mutation	SNP	118865302	118865302	C3orf30	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2200	229
OTOL1	131149	broad.mit.edu	37	3	161221595	161221595	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:161221595G>C	uc011bpb.1	+	4	1299	c.1299G>C	c.(1297-1299)TTG>TTC	p.L433F		NM_001080440	NP_001073909	A6NHN0	OTOL1_HUMAN	otolin-1 precursor	433	C1q.					collagen					0						TCGTCATCTTGAAATTAAGTG	0.468																0.272727	57.220981	60.293248	18	48	KEEP	---	---	---	---	9	9	27	25	-1	capture	Missense_Mutation	SNP	161221595	161221595	OTOL1	3	G	C	C	C	1	0	0	0	0	1	0	0	0	581	45	4	4	11208	229
TP63	8626	broad.mit.edu	37	3	189604307	189604307	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:189604307C>T	uc003fry.2	+	11	1563	c.1474C>T	c.(1474-1476)CCT>TCT	p.P492S	TP63_uc003frz.2_Missense_Mutation_p.P492S|TP63_uc010hzc.1_Missense_Mutation_p.P492S|TP63_uc003fsc.2_Missense_Mutation_p.P398S|TP63_uc003fsd.2_Missense_Mutation_p.P398S|TP63_uc010hzd.1_Missense_Mutation_p.P313S	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	492					anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CGCCCTCACTCCTACAACCAT	0.498					423							Hay-Wells_syndrome	HNSCC(45;0.13)			0.208696	53.33039	62.372298	24	91	KEEP	---	---	---	---	13	12	55	55	-1	capture	Missense_Mutation	SNP	189604307	189604307	TP63	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	16275	229
FGFRL1	53834	broad.mit.edu	37	4	1019042	1019042	+	Silent	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1019042C>T	uc003gce.2	+	7	1583	c.1422C>T	c.(1420-1422)CTC>CTT	p.L474L	FGFRL1_uc003gcf.2_Silent_p.L474L|FGFRL1_uc003gcg.2_Silent_p.L474L|FGFRL1_uc010ibo.2_Silent_p.L474L	NM_021923	NP_068742	Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	474	Cytoplasmic (Potential).				regulation of cell growth	integral to membrane|plasma membrane	fibroblast growth factor receptor activity|heparin binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			ACCCCAAACTCTacacagaca	0.473																0.263158	13.0655	14.029951	5	14	KEEP	---	---	---	---	3	3	6	11	-1	capture	Silent	SNP	1019042	1019042	FGFRL1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	405	32	2	2	5815	229
CNGA1	1259	broad.mit.edu	37	4	47945299	47945299	+	Silent	SNP	T	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:47945299T>A	uc003gxt.3	-	8	614	c.348A>T	c.(346-348)TCA>TCT	p.S116S	uc003gxr.1_Intron|CNGA1_uc003gxu.2_Silent_p.S185S|CNGA1_uc003gxv.1_Silent_p.S116S	NM_000087	NP_000078	P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1 isoform	116	Cytoplasmic (Potential).				response to stimulus|visual perception	integral to plasma membrane	cGMP binding|ion channel activity	p.S116*(1)		ovary(2)	2						TTTTATCATCTGACTTGCTGA	0.189																0.285714	6.047292	6.335593	2	5	KEEP	---	---	---	---	0	2	3	2	-1	capture	Silent	SNP	47945299	47945299	CNGA1	4	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	3561	229
UGT2B28	54490	broad.mit.edu	37	4	70160416	70160416	+	Silent	SNP	G	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70160416G>T	uc003hej.2	+	6	1481	c.1479G>T	c.(1477-1479)GTG>GTT	p.V493V	UGT2B28_uc010ihr.2_3'UTR	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	493					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	CTTTGGATGTGATTGGGTTTC	0.463																0.183333	61.95139	78.91238	33	147	KEEP	---	---	---	---	23	14	74	108	0.621621621622	capture	Silent	SNP	70160416	70160416	UGT2B28	4	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	16842	229
NAAA	27163	broad.mit.edu	37	4	76836138	76836138	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:76836138G>A	uc003hjb.2	-	10	1063	c.999C>T	c.(997-999)AAC>AAT	p.N333N	NAAA_uc003hja.2_Intron	NM_014435	NP_055250	Q02083	NAAA_HUMAN	N-acylethanolamine acid amidase isoform 1	333					lipid metabolic process	lysosome	hydrolase activity			skin(1)	1						AAATTGTGAAGCTGAAAATTA	0.408																0.199029	81.537883	98.925171	41	165	KEEP	---	---	---	---	17	30	71	111	-1	capture	Silent	SNP	76836138	76836138	NAAA	4	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	10037	229
SHROOM3	57619	broad.mit.edu	37	4	77661454	77661454	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77661454C>A	uc011cbx.1	+	5	3081	c.2128C>A	c.(2128-2130)CCT>ACT	p.P710T	SHROOM3_uc011cbz.1_Missense_Mutation_p.P534T|SHROOM3_uc003hkf.1_Missense_Mutation_p.P585T|SHROOM3_uc003hkg.2_Missense_Mutation_p.P488T	NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein	710					apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			GAAAGCCGCTCCTGACCTCGG	0.667																0.254167	136.140296	149.321784	61	179	KEEP	---	---	---	---	44	46	113	128	0.511111111111	capture	Missense_Mutation	SNP	77661454	77661454	SHROOM3	4	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	14188	229
SEC24B	10427	broad.mit.edu	37	4	110437770	110437770	+	Nonsense_Mutation	SNP	C	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110437770C>A	uc003hzk.2	+	11	2155	c.2100C>A	c.(2098-2100)TGC>TGA	p.C700*	SEC24B_uc003hzl.2_Nonsense_Mutation_p.C665*|SEC24B_uc011cfp.1_Nonsense_Mutation_p.C730*|SEC24B_uc011cfq.1_Nonsense_Mutation_p.C699*|SEC24B_uc011cfr.1_Nonsense_Mutation_p.C664*	NM_006323	NP_006314	O95487	SC24B_HUMAN	SEC24 (S. cerevisiae) homolog B isoform a	700					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|transporter activity|zinc ion binding			ovary(2)|large_intestine(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		CAATTTTGTGCCAGTCACTCC	0.318																0.043478	-8.811569	6.577147	3	66	KEEP	---	---	---	---	2	1	39	32	0.333333333333	capture	Nonsense_Mutation	SNP	110437770	110437770	SEC24B	4	C	A	A	A	1	0	0	0	0	0	1	0	0	337	26	5	4	13888	229
LYSMD3	116068	broad.mit.edu	37	5	89821101	89821101	+	Silent	SNP	T	C	C			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89821101T>C	uc003kjr.2	-	2	154	c.6A>G	c.(4-6)GCA>GCG	p.A2A	LYSMD3_uc010jaz.1_Silent_p.A2A|LYSMD3_uc003kjs.1_Silent_p.A2A	NM_198273	NP_938014	Q7Z3D4	LYSM3_HUMAN	LysM, putative peptidoglycan-binding, domain	2	Extracellular (Potential).				cell wall macromolecule catabolic process	integral to membrane					0		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-31)|Epithelial(54;5.22e-26)|all cancers(79;2.42e-22)		GATGCCTCCCTGCCATAATGT	0.403																0.1	9.444778	22.225557	8	72	KEEP	---	---	---	---	13	12	49	71	-1	capture	Silent	SNP	89821101	89821101	LYSMD3	5	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	9041	229
SLC27A6	28965	broad.mit.edu	37	5	128359401	128359401	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:128359401A>G	uc003kuy.2	+	7	1649	c.1253A>G	c.(1252-1254)AAA>AGA	p.K418R	SLC27A6_uc003kuz.2_Missense_Mutation_p.K418R	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid	418					long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		CATGTGAAAAAAGGTAAGACT	0.274																0.21875	39.617774	44.280238	14	50	KEEP	---	---	---	---	7	10	26	32	-1	capture	Missense_Mutation	SNP	128359401	128359401	SLC27A6	5	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	14422	229
DOCK2	1794	broad.mit.edu	37	5	169097547	169097547	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169097547G>A	uc003maf.2	+	4	250	c.170G>A	c.(169-171)GGC>GAC	p.G57D	DOCK2_uc011der.1_RNA	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	57	SH3.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ttCCAACAGGGCATTTTTCCT	0.328																0.027523	-18.757944	8.068871	3	106	KEEP	---	---	---	---	2	1	70	48	-1	capture	Missense_Mutation	SNP	169097547	169097547	DOCK2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4643	229
C6orf114	85411	broad.mit.edu	37	6	13470477	13470477	+	Silent	SNP	C	T	T	rs150464914		TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:13470477C>T	uc003nav.2	-	2	559	c.36G>A	c.(34-36)CCG>CCA	p.P12P	GFOD1_uc003nas.1_Intron|GFOD1_uc003nat.1_Intron|C6orf114_uc003nau.2_RNA	NM_033069	NP_149060			hypothetical protein LOC85411												0	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0504)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.147)			GGGCAATTGCCGGCTCATGAA	0.572																0.056604	-4.0156	6.927174	3	50	KEEP	---	---	---	---	2	1	23	35	-1	capture	Silent	SNP	13470477	13470477	C6orf114	6	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	2298	229
ZNF76	7629	broad.mit.edu	37	6	35261624	35261624	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35261624G>A	uc003oki.1	+	12	1631	c.1426G>A	c.(1426-1428)GCC>ACC	p.A476T	ZNF76_uc003okj.1_Intron	NM_003427	NP_003418	P36508	ZNF76_HUMAN	zinc finger protein 76 (expressed in testis)	476					regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAGTCCTGATGCCGACCTGGC	0.627	Esophageal Squamous(52;92 1039 20612 23956 34676)															0.19403	44.967782	56.683916	26	108	KEEP	---	---	---	---	19	14	54	76	-1	capture	Missense_Mutation	SNP	35261624	35261624	ZNF76	6	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	18012	229
DNAH8	1769	broad.mit.edu	37	6	38998047	38998047	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38998047C>G	uc003ooe.1	+	91	13952	c.13352C>G	c.(13351-13353)CCT>CGT	p.P4451R		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TATGTGTGTCCTATTTACAAG	0.507				p.P4451H(SNU81-Tumor)	2979											0.01676	-39.746282	7.51475	3	176	KEEP	---	---	---	---	1	2	87	121	-1	capture	Missense_Mutation	SNP	38998047	38998047	DNAH8	6	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	4563	229
COL10A1	1300	broad.mit.edu	37	6	116442546	116442546	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:116442546G>T	uc003pwm.2	-	3	829	c.733C>A	c.(733-735)CCA>ACA	p.P245T	NT5DC1_uc003pwj.2_Intron|NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Intron	NM_000493	NP_000484	Q03692	COAA1_HUMAN	type X collagen alpha 1 precursor	245	Triple-helical region.				skeletal system development	collagen	metal ion binding			central_nervous_system(1)	1		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		GGGCCAATTGGTCCCATTTCT	0.597																0.242718	62.731428	68.942818	25	78	KEEP	---	---	---	---	12	16	40	51	0.428571428571	capture	Missense_Mutation	SNP	116442546	116442546	COL10A1	6	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	3631	229
CRHR2	1395	broad.mit.edu	37	7	30695576	30695576	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30695576C>T	uc003tbn.2	-	9	1128	c.884G>A	c.(883-885)CGC>CAC	p.R295H	CRHR2_uc010kvw.1_Missense_Mutation_p.R295H|CRHR2_uc010kvx.1_Missense_Mutation_p.R294H|CRHR2_uc010kvy.1_Missense_Mutation_p.R131H|CRHR2_uc003tbo.2_Missense_Mutation_p.R281H|CRHR2_uc003tbp.2_Missense_Mutation_p.R322H	NM_001883	NP_001874	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	295	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(2)|ovary(1)|skin(1)	4						GGTGGACGCGCGTAACTTTGT	0.552																0.166667	67.872526	90.547507	36	180	KEEP	---	---	---	---	18	26	100	105	-1	capture	Missense_Mutation	SNP	30695576	30695576	CRHR2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3837	229
GTF2IRD1	9569	broad.mit.edu	37	7	74004217	74004217	+	Silent	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:74004217C>T	uc003uaq.2	+	23	2796	c.2403C>T	c.(2401-2403)ATC>ATT	p.I801I	GTF2IRD1_uc010lbq.2_Silent_p.I818I|GTF2IRD1_uc003uap.2_Silent_p.I786I|GTF2IRD1_uc003uar.1_Silent_p.I786I	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1	801	GTF2I-like 5.					nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						AGAAGGTGATCCTGCGGGAGC	0.592																0.109756	8.218605	20.579022	9	73	KEEP	---	---	---	---	6	3	45	56	-1	capture	Silent	SNP	74004217	74004217	GTF2IRD1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	382	30	2	2	6797	229
CTTNBP2	83992	broad.mit.edu	37	7	117400762	117400762	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117400762C>A	uc003vjf.2	-	10	2991	c.2899G>T	c.(2899-2901)GCT>TCT	p.A967S		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	967										ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		ATTTTAAGAGCATCTGTTAGA	0.284																0.021164	-41.383494	7.109227	4	185	KEEP	---	---	---	---	2	2	89	117	0.5	capture	Missense_Mutation	SNP	117400762	117400762	CTTNBP2	7	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	4006	229
FLNC	2318	broad.mit.edu	37	7	128489530	128489530	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128489530C>G	uc003vnz.3	+	30	5306	c.5097C>G	c.(5095-5097)GAC>GAG	p.D1699E	FLNC_uc003voa.3_Missense_Mutation_p.D1699E	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1699	Filamin 15.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						AGAACCATGACGGTACCTTTG	0.612					892											0.028846	-18.862833	6.532626	3	101	KEEP	---	---	---	---	3	1	50	64	-1	capture	Missense_Mutation	SNP	128489530	128489530	FLNC	7	C	G	G	G	1	0	0	0	0	1	0	0	0	246	19	4	4	5879	229
MEST	4232	broad.mit.edu	37	7	130140656	130140656	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:130140656C>G	uc003vqg.2	+	9	891	c.674C>G	c.(673-675)ACT>AGT	p.T225S	MEST_uc003vqc.2_Missense_Mutation_p.T216S|MEST_uc003vqd.2_Intron|MEST_uc003vqf.2_Missense_Mutation_p.T216S|MEST_uc011kph.1_Missense_Mutation_p.T211S|MEST_uc010lmg.2_Missense_Mutation_p.T225S	NM_002402	NP_002393	Q5EB52	MEST_HUMAN	mesoderm specific transcript isoform a	225					mesoderm development	endoplasmic reticulum membrane|integral to membrane	hydrolase activity|protein binding			ovary(2)	2	Melanoma(18;0.0435)					GGGCCGTATACTCGGCCCTCT	0.428	Colon(126;2182 2305 6517 35181)															0.054054	-1.282771	6.47557	2	35	KEEP	---	---	---	---	0	2	10	34	-1	capture	Missense_Mutation	SNP	130140656	130140656	MEST	7	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	9396	229
BPGM	669	broad.mit.edu	37	7	134346605	134346605	+	Nonsense_Mutation	SNP	A	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134346605A>T	uc003vrv.2	+	3	887	c.346A>T	c.(346-348)AGA>TGA	p.R116*	BPGM_uc003vrw.2_Nonsense_Mutation_p.R116*|BPGM_uc003vrx.2_Nonsense_Mutation_p.R116*	NM_199186	NP_954655	P07738	PMGE_HUMAN	bisphosphoglycerate mutase	116					glycolysis|respiratory gaseous exchange		2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity|phosphoglycerate mutase activity				0						GAGGCTCTGGAGAAGAAGCTA	0.493																0.266667	66.850164	72.016394	28	77	KEEP	---	---	---	---	19	14	35	49	-1	capture	Nonsense_Mutation	SNP	134346605	134346605	BPGM	7	A	T	T	T	1	0	0	0	0	0	1	0	0	140	11	5	4	1476	229
CNTNAP2	26047	broad.mit.edu	37	7	147336290	147336290	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:147336290G>A	uc003weu.1	+	13	2506	c.1990G>A	c.(1990-1992)GTT>ATT	p.V664I		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	664	Extracellular (Potential).|Fibrinogen C-terminal.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GACACAGCTCGTTTACAGCGC	0.498													HNSCC(39;0.1)			0.22695	71.821628	81.476256	32	109	KEEP	---	---	---	---	15	17	60	57	-1	capture	Missense_Mutation	SNP	147336290	147336290	CNTNAP2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3612	229
DPYSL2	1808	broad.mit.edu	37	8	26510765	26510765	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:26510765G>A	uc003xfb.1	+	13	1829	c.1479G>A	c.(1477-1479)GGG>GGA	p.G493G	DPYSL2_uc003xfa.2_Silent_p.G598G|DPYSL2_uc010luk.1_RNA|DPYSL2_uc011lah.1_Silent_p.G457G	NM_001386	NP_001377	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	493					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		AGCTGAGAGGGGTTCCTCGTG	0.602																0.22113	214.832511	243.969898	90	317	KEEP	---	---	---	---	54	53	180	187	-1	capture	Silent	SNP	26510765	26510765	DPYSL2	8	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	4702	229
FBXL6	26233	broad.mit.edu	37	8	145579316	145579316	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145579316C>G	uc003zcb.2	-	9	1520	c.1495G>C	c.(1495-1497)GGC>CGC	p.G499R	C8ORFK29_uc011llb.1_5'Flank|C8ORFK29_uc010mfw.2_5'Flank|C8ORFK29_uc003zby.3_5'Flank|FBXL6_uc003zbz.2_Missense_Mutation_p.G226R|FBXL6_uc003zca.2_Missense_Mutation_p.G493R|FBXL6_uc010mfx.2_Missense_Mutation_p.G260R|GPR172A_uc003zcc.1_5'Flank|GPR172A_uc003zcd.1_5'Flank|GPR172A_uc003zce.1_5'Flank|GPR172A_uc010mfy.1_5'Flank|GPR172A_uc003zcf.1_5'Flank|GPR172A_uc011llc.1_5'Flank	NM_012162	NP_036294	Q8N531	FBXL6_HUMAN	F-box and leucine-rich repeat protein 6 isoform	499	LRR 11.				proteolysis		ubiquitin-protein ligase activity			ovary(1)|lung(1)	2	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			TAGAGCAGGCCCGGGCAGCTG	0.657																0.046512	-3.00149	6.346195	2	41	KEEP	---	---	---	---	0	2	28	17	-1	capture	Missense_Mutation	SNP	145579316	145579316	FBXL6	8	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	5669	229
IFT74	80173	broad.mit.edu	37	9	26984346	26984346	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:26984346G>C	uc010mja.2	+	5	524	c.397G>C	c.(397-399)GAA>CAA	p.E133Q	IFT74_uc010mjb.2_Missense_Mutation_p.E133Q|IFT74_uc003zqf.3_Missense_Mutation_p.E133Q|IFT74_uc003zqg.3_Missense_Mutation_p.E133Q	NM_001099223	NP_001092693	Q96LB3	IFT74_HUMAN	coiled-coil domain containing 2 isoform a	133	Potential.					cytoplasmic membrane-bounded vesicle|intraflagellar transport particle B|microtubule-based flagellum				skin(1)	1		all_neural(11;2.36e-10)		Lung(218;1.4e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)		TTTGTCATATGAAAAGAGGTG	0.264																0.071429	1.526027	6.825349	2	26	KEEP	---	---	---	---	2	0	16	16	-1	capture	Missense_Mutation	SNP	26984346	26984346	IFT74	9	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	7488	229
GAPVD1	26130	broad.mit.edu	37	9	128069702	128069702	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:128069702C>A	uc010mwx.2	+	7	1453	c.1127C>A	c.(1126-1128)GCC>GAC	p.A376D	GAPVD1_uc004bpo.2_Missense_Mutation_p.A376D|GAPVD1_uc011lzs.1_Missense_Mutation_p.A376D|GAPVD1_uc004bpp.2_Missense_Mutation_p.A376D|GAPVD1_uc004bpq.2_Missense_Mutation_p.A376D|GAPVD1_uc004bpr.2_Missense_Mutation_p.A376D|GAPVD1_uc004bps.2_Missense_Mutation_p.A376D|GAPVD1_uc010mwy.1_Missense_Mutation_p.A235D	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	376					endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						AGCTGTGTTGCCGCTTTCCTT	0.408																0.056604	-4.622304	6.327874	3	50	KEEP	---	---	---	---	2	1	30	33	0.333333333333	capture	Missense_Mutation	SNP	128069702	128069702	GAPVD1	9	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	6179	229
SLC2A6	11182	broad.mit.edu	37	9	136338317	136338317	+	Silent	SNP	G	A	A			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136338317G>A	uc004cee.2	-	9	1373	c.1278C>T	c.(1276-1278)CCC>CCT	p.P426P	SLC2A6_uc004cef.2_Silent_p.P364P|SLC2A6_uc004ceg.2_Silent_p.P403P	NM_017585	NP_060055	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose	426	Cytoplasmic (Potential).					integral to membrane|plasma membrane	D-glucose transmembrane transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		GGGCACGCAGGGGCAGGACCT	0.672																0.192308	10.759568	13.058775	5	21	KEEP	---	---	---	---	4	1	14	7	-1	capture	Silent	SNP	136338317	136338317	SLC2A6	9	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	14441	229
SYTL5	94122	broad.mit.edu	37	X	37955451	37955451	+	Silent	SNP	C	T	T			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37955451C>T	uc004ddu.2	+	10	1560	c.1026C>T	c.(1024-1026)AGC>AGT	p.S342S	SYTL5_uc004ddv.2_Silent_p.S342S|SYTL5_uc004ddx.2_Silent_p.S342S	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	342					intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						ATACTGTAAGCATAAGAAGCA	0.413																0.388889	111.1834	112.363243	42	66	KEEP	---	---	---	---	30	26	35	46	-1	capture	Silent	SNP	37955451	37955451	SYTL5	23	C	T	T	T	1	0	0	0	0	0	0	0	1	324	25	2	2	15374	229
TAOK3	51347	broad.mit.edu	37	12	118639103	118639103	+	Frame_Shift_Del	DEL	C	-	-			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118639103delC	uc001twx.2	-	12	1280	c.985delG	c.(985-987)GAAfs	p.E329fs	TAOK3_uc001tww.2_Frame_Shift_Del_p.E159fs|TAOK3_uc001twy.3_Frame_Shift_Del_p.E329fs	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	329					MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GAACCTACTTCCTCATCCTCC	0.234					500											0.21			27	99		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	118639103	118639103	TAOK3	12	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	15437	229
CCDC102B	79839	broad.mit.edu	37	18	66504203	66504204	+	In_Frame_Ins	INS	-	TAT	TAT			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:66504203_66504204insTAT	uc002lkk.2	+	4	426_427	c.203_204insTAT	c.(202-204)GAT>GATATT	p.69_70insI	CCDC102B_uc002lki.2_In_Frame_Ins_p.69_70insI|CCDC102B_uc002lkj.1_In_Frame_Ins_p.69_70insI	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	69_70										ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				AACAAATGGGATATTTGTGAAG	0.505																0.16			53	284		---	---	---	---						capture_indel	In_Frame_Ins	INS	66504203	66504204	CCDC102B	18	-	TAT	TAT	TAT	1	0	1	1	0	0	0	0	0	156	12	5	5	2711	229
TIMM50	92609	broad.mit.edu	37	19	39972604	39972604	+	Frame_Shift_Del	DEL	A	-	-			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39972604delA	uc002olu.1	+	2	632	c.499delA	c.(499-501)AAAfs	p.K167fs	TIMM50_uc002olt.1_RNA	NM_001001563	NP_001001563	Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50	64	Mitochondrial matrix (Potential).				mitochondrial membrane organization|protein transport|release of cytochrome c from mitochondria|transmembrane transport	integral to membrane|mitochondrial inner membrane presequence translocase complex|nuclear speck	interleukin-2 receptor binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|ribonucleoprotein binding|RNA binding			ovary(1)	1	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CAGCTATGCCAAAAAAGTTGC	0.607																0.01			7	495		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	39972604	39972604	TIMM50	19	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	15798	229
PCDH7	5099	broad.mit.edu	37	4	30725505	30725505	+	Frame_Shift_Del	DEL	G	-	-			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:30725505delG	uc003gsk.1	+	1	3469	c.2461delG	c.(2461-2463)GTGfs	p.V821fs	PCDH7_uc011bxw.1_Frame_Shift_Del_p.V774fs|PCDH7_uc011bxx.1_Frame_Shift_Del_p.V821fs	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	821	Extracellular (Potential).|Cadherin 7.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						GGTGGTGCAAGTGAATGACAG	0.483																0.32			16	34		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	30725505	30725505	PCDH7	4	G	-	-	-	1	0	1	0	1	0	0	0	0	468	36	5	5	11419	229
PHF1	5252	broad.mit.edu	37	6	33382871	33382871	+	Frame_Shift_Del	DEL	C	-	-			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33382871delC	uc003oeh.2	+	12	1425	c.1189delC	c.(1189-1191)CCCfs	p.P397fs	PHF1_uc011drh.1_RNA|PHF1_uc003oei.2_Frame_Shift_Del_p.A393fs|PHF1_uc010jux.2_Frame_Shift_Del_p.P197fs	NM_024165	NP_077084	O43189	PHF1_HUMAN	PHD finger protein 1 isoform b	397					chromatin modification	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(999;0.0443)				GCGCAATCAGCCCGAGCCCCA	0.677														OREG0017346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.24			19	61		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	33382871	33382871	PHF1	6	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	11723	229
PRKDC	5591	broad.mit.edu	37	8	48746799	48746799	+	Frame_Shift_Del	DEL	T	-	-			TCGA-32-1977-01	TCGA-32-1977-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:48746799delT	uc003xqi.2	-	60	8167	c.8110delA	c.(8110-8112)AGGfs	p.R2704fs	PRKDC_uc003xqj.2_Frame_Shift_Del_p.R2704fs|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	2704	KIP-binding.				cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				AGGCCCAGCCTTTTTTTCCCA	0.498	Esophageal Squamous(79;1091 1253 12329 31680 40677)				1566						NHEJ					0.01			7	923		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	48746799	48746799	PRKDC	8	T	-	-	-	1	0	1	0	1	0	0	0	0	726	56	5	5	12417	229
