Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
AMPD1	270	broad.mit.edu	37	1	115221096	115221096	+	Missense_Mutation	SNP	C	T	T	rs142123340	by1000genomes	TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115221096C>T	uc001efe.1	-	8	1034	c.950G>A	c.(949-951)CGT>CAT	p.R317H	AMPD1_uc001eff.1_Missense_Mutation_p.R313H	NM_000036	NP_000027	P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1 (isoform M)	317					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|large_intestine(1)|skin(1)	4	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CTTAATAAAACGCAGCAGATG	0.368																0.392857	132.27859	133.403292	44	68	KEEP	---	---	---	---	33	14	43	31	-1	capture	Missense_Mutation	SNP	115221096	115221096	AMPD1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	585	242
ASH1L	55870	broad.mit.edu	37	1	155449241	155449241	+	Silent	SNP	G	C	C			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155449241G>C	uc009wqq.2	-	3	3900	c.3420C>G	c.(3418-3420)TCC>TCG	p.S1140S	ASH1L_uc001fkt.2_Silent_p.S1140S|ASH1L_uc009wqr.1_Silent_p.S1140S	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	1140					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TGCCCTGTCTGGAGTGTAAAT	0.478																0.377778	104.426638	105.607053	34	56	KEEP	---	---	---	---	15	22	34	29	-1	capture	Silent	SNP	155449241	155449241	ASH1L	1	G	C	C	C	1	0	0	0	0	0	0	0	1	600	47	4	4	1032	242
SEC16B	89866	broad.mit.edu	37	1	177937026	177937026	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:177937026C>T	uc001gli.1	-	2	181	c.91G>A	c.(91-93)GGA>AGA	p.G31R	SEC16B_uc001glk.1_5'UTR|SEC16B_uc009wwz.1_5'UTR|SEC16B_uc001glj.1_Missense_Mutation_p.G31R|SEC16B_uc001gll.3_Missense_Mutation_p.G31R	NM_033127	NP_149118	Q96JE7	SC16B_HUMAN	leucine zipper transcription regulator 2	31					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane				ovary(3)|central_nervous_system(1)	4						CGATGATGTCCATCTCTCCGA	0.602																0.407407	64.13718	64.542422	22	32	KEEP	---	---	---	---	18	6	20	14	-1	capture	Missense_Mutation	SNP	177937026	177937026	SEC16B	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	13880	242
USH2A	7399	broad.mit.edu	37	1	216595556	216595556	+	Silent	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216595556C>T	uc001hku.1	-	2	510	c.123G>A	c.(121-123)GAG>GAA	p.E41E	USH2A_uc001hkv.2_Silent_p.E41E	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	41	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTCCCACGTTCTCCAGCCTTG	0.473													HNSCC(13;0.011)			0.357143	90.830917	92.339021	30	54	KEEP	---	---	---	---	17	19	38	23	-1	capture	Silent	SNP	216595556	216595556	USH2A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	16918	242
C1orf69	200205	broad.mit.edu	37	1	228362953	228362953	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228362953C>A	uc001hsl.3	+	3	899	c.810C>A	c.(808-810)CAC>CAA	p.H270Q	C1orf69_uc010pvw.1_Missense_Mutation_p.H77Q	NM_001010867	NP_001010867	Q5T440	CAF17_HUMAN	hypothetical protein LOC200205 precursor	270					glycine catabolic process|heme biosynthetic process	mitochondrion	aminomethyltransferase activity				0		Prostate(94;0.0405)				CCCGCACCCACCACATGGGCG	0.652																0.040541	-9.932107	6.881791	3	71	KEEP	---	---	---	---	2	1	55	38	0.333333333333	capture	Missense_Mutation	SNP	228362953	228362953	C1orf69	1	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	2039	242
OBSCN	84033	broad.mit.edu	37	1	228564891	228564891	+	Silent	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228564891G>A	uc009xez.1	+	101	23222	c.23178G>A	c.(23176-23178)CCG>CCA	p.P7726P	OBSCN_uc001hsr.1_Silent_p.P2355P	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	7726	Protein kinase 2.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				TGCGCCACCCGCACCTGGCCC	0.697					4006											0.333333	10.595527	10.890971	4	8	KEEP	---	---	---	---	4	2	3	5	-1	capture	Silent	SNP	228564891	228564891	OBSCN	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10717	242
ZP4	57829	broad.mit.edu	37	1	238048807	238048807	+	Silent	SNP	C	G	G			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:238048807C>G	uc001hym.2	-	8	1044	c.1044G>C	c.(1042-1044)GTG>GTC	p.V348V	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	348	ZP.|Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TGGAGACCTCCACGTAAATGG	0.522	NSCLC(166;160 2029 11600 18754 19936)															0.367816	95.474634	96.811988	32	55	KEEP	---	---	---	---	19	15	31	28	-1	capture	Silent	SNP	238048807	238048807	ZP4	1	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	18094	242
KIAA1462	57608	broad.mit.edu	37	10	30336587	30336587	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:30336587G>A	uc001iux.2	-	1	214	c.155C>T	c.(154-156)GCG>GTG	p.A52V	KIAA1462_uc001iuy.2_Missense_Mutation_p.A52V|KIAA1462_uc001iuz.2_5'UTR|KIAA1462_uc009xle.1_Missense_Mutation_p.A52V	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	52										ovary(4)	4						TGCGAGGGCCGCAGGGCCATC	0.677																0.627907	176.465806	177.701439	54	32	KEEP	---	---	---	---	33	25	24	10	-1	capture	Missense_Mutation	SNP	30336587	30336587	KIAA1462	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8156	242
LRDD	55367	broad.mit.edu	37	11	800341	800341	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:800341G>A	uc001lro.1	-	13	2294	c.2152C>T	c.(2152-2154)CGG>TGG	p.R718W	SLC25A22_uc009yci.2_5'Flank|SLC25A22_uc001lrj.2_5'Flank|LRDD_uc009yck.1_Intron|LRDD_uc001lrk.1_Intron|LRDD_uc001lrl.1_Missense_Mutation_p.R561W|LRDD_uc001lrm.1_Missense_Mutation_p.R405W|LRDD_uc001lrn.1_Missense_Mutation_p.R561W|LRDD_uc001lrp.1_Intron	NM_145886	NP_665893	Q9HB75	PIDD_HUMAN	leucine rich repeat and death domain containing	718					apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACCTGGCCCCGCACAGCCTGA	0.627																0.049383	-10.467059	7.005831	4	77	KEEP	---	---	---	---	0	4	41	51	-1	capture	Missense_Mutation	SNP	800341	800341	LRDD	11	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	8852	242
OR51T1	401665	broad.mit.edu	37	11	4904033	4904033	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4904033C>T	uc010qyp.1	+	1	985	c.985C>T	c.(985-987)CGC>TGC	p.R329C		NM_001004759	NP_001004759	Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T,	302	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAAGACAATCCGCCAGGCTAT	0.488																0.330275	106.473822	109.251194	36	73	KEEP	---	---	---	---	20	18	43	32	-1	capture	Missense_Mutation	SNP	4904033	4904033	OR51T1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11010	242
OR52H1	390067	broad.mit.edu	37	11	5565836	5565836	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5565836C>A	uc010qzh.1	-	1	918	c.918G>T	c.(916-918)CAG>CAT	p.Q306H	HBG2_uc001mak.1_Intron	NM_001005289	NP_001005289	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H,	306	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TATCTCTGATCTGCTTGGTCT	0.403																0.072917	-3.558042	14.460522	7	89	KEEP	---	---	---	---	5	3	50	43	0.375	capture	Missense_Mutation	SNP	5565836	5565836	OR52H1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	11023	242
TRIM22	10346	broad.mit.edu	37	11	5730417	5730417	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5730417G>A	uc001mbr.2	+	8	1313	c.1036G>A	c.(1036-1038)GGC>AGC	p.G346S	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron|TRIM22_uc009yes.2_Missense_Mutation_p.G342S|TRIM22_uc010qzm.1_Missense_Mutation_p.G174S|TRIM22_uc009yeu.2_Missense_Mutation_p.G157S|OR56B1_uc001mbs.1_Intron|OR56B1_uc009yev.1_Intron	NM_006074	NP_006065	Q8IYM9	TRI22_HUMAN	tripartite motif-containing 22	346	B30.2/SPRY.				immune response|interspecies interaction between organisms|protein trimerization|response to virus	Cajal body|Golgi apparatus|nuclear speck	ligase activity|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding				0		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		TGGTGTCTTCGGCTGCCAATA	0.408	GBM(104;491 2336 5222)															0.336	116.105107	119.082553	42	83	KEEP	---	---	---	---	25	20	65	32	-1	capture	Missense_Mutation	SNP	5730417	5730417	TRIM22	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16379	242
MPEG1	219972	broad.mit.edu	37	11	58978683	58978683	+	Silent	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58978683C>T	uc001nnu.3	-	1	1812	c.1656G>A	c.(1654-1656)CCG>CCA	p.P552P		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	552	Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				TTTTCAGAGACGGTGCCCCTA	0.567																0.107843	9.253178	24.808103	11	91	KEEP	---	---	---	---	7	4	52	46	-1	capture	Silent	SNP	58978683	58978683	MPEG1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	9635	242
KRTAP5-9	3846	broad.mit.edu	37	11	71260048	71260048	+	Silent	SNP	T	C	C			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71260048T>C	uc001oqs.1	+	1	583	c.345T>C	c.(343-345)TGT>TGC	p.C115C		NM_005553	NP_005544	P26371	KRA59_HUMAN	keratin associated protein 5-9	115	8 X 4 AA repeats of C-C-X-P.				epidermis development	keratin filament					0						GTAAGCCCTGTTGCTCCTCCT	0.622																0.333333	223.489748	228.651006	70	140	KEEP	---	---	---	---	38	40	83	64	-1	capture	Silent	SNP	71260048	71260048	KRTAP5-9	11	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	8488	242
SIK3	23387	broad.mit.edu	37	11	116732043	116732043	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:116732043C>T	uc001ppy.2	-	18	2090	c.2054G>A	c.(2053-2055)AGG>AAG	p.R685K	SIK3_uc001ppz.2_Missense_Mutation_p.R584K|SIK3_uc001pqa.2_Missense_Mutation_p.R685K|SIK3_uc001ppw.2_Missense_Mutation_p.R102K|SIK3_uc001ppx.2_Intron|SIK3_uc001pqb.2_5'UTR	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	685	Gln-rich.					cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						ACTGGGCTGCCTGAAGAGATG	0.493					634									OREG0003492	type=REGULATORY REGION|Gene=BC035583|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.345794	115.84018	118.08792	37	70	KEEP	---	---	---	---	29	16	52	27	-1	capture	Missense_Mutation	SNP	116732043	116732043	SIK3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	14212	242
TMPRSS4	56649	broad.mit.edu	37	11	117985628	117985628	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:117985628C>T	uc010rxo.1	+	10	1286	c.995C>T	c.(994-996)ACG>ATG	p.T332M	TMPRSS4_uc010rxp.1_Missense_Mutation_p.T327M|TMPRSS4_uc010rxq.1_Missense_Mutation_p.T185M|TMPRSS4_uc010rxr.1_Missense_Mutation_p.T307M|TMPRSS4_uc010rxs.1_Missense_Mutation_p.T292M|TMPRSS4_uc009yzu.2_RNA|TMPRSS4_uc010rxt.1_Missense_Mutation_p.T307M	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4 isoform 1	332	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		TGGGGCTTTACGAAGCAGAAT	0.572																0.285714	10.994679	11.571262	4	10	KEEP	---	---	---	---	4	0	5	7	-1	capture	Missense_Mutation	SNP	117985628	117985628	TMPRSS4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16132	242
TECTA	7007	broad.mit.edu	37	11	121037459	121037459	+	Silent	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:121037459C>T	uc010rzo.1	+	17	5556	c.5556C>T	c.(5554-5556)AAC>AAT	p.N1852N		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	1852	ZP.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		AGATCAACAACACCAAAGGGA	0.498																0.268657	42.012739	45.255129	18	49	KEEP	---	---	---	---	6	13	27	26	-1	capture	Silent	SNP	121037459	121037459	TECTA	11	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	15632	242
CLEC12A	160364	broad.mit.edu	37	12	10132026	10132026	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10132026G>T	uc001qwr.3	+	3	470	c.282G>T	c.(280-282)ATG>ATT	p.M94I	CLEC12A_uc001qwq.2_Missense_Mutation_p.M104I|CLEC12A_uc001qws.3_Missense_Mutation_p.M61I|CLEC12A_uc001qwt.2_Missense_Mutation_p.M23I	NM_138337	NP_612210	Q5QGZ9	CL12A_HUMAN	myeloid inhibitory C-type lectin-like receptor	94	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity|sugar binding			skin(1)	1						TACAACTGATGAGTAACATGA	0.363	Melanoma(197;1487 2125 16611 22221 34855)															0.444444	61.093341	61.214519	20	25	KEEP	---	---	---	---	8	13	14	16	0.380952380952	capture	Missense_Mutation	SNP	10132026	10132026	CLEC12A	12	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	3462	242
ITGB7	3695	broad.mit.edu	37	12	53590523	53590523	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53590523C>T	uc009zmv.2	-	5	727	c.656G>A	c.(655-657)CGG>CAG	p.R219Q	ITGB7_uc001scc.2_Missense_Mutation_p.R219Q|ITGB7_uc010snz.1_RNA|ITGB7_uc010soa.1_3'UTR	NM_000889	NP_000880	P26010	ITB7_HUMAN	integrin, beta 7 precursor	219	VWFA.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|regulation of immune response	integrin complex	identical protein binding|metal ion binding|receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|breast(1)	8						GCGCTCCAGCCGGGTGGGGCA	0.617																0.307692	22.190494	23.047526	8	18	KEEP	---	---	---	---	8	1	10	13	-1	capture	Missense_Mutation	SNP	53590523	53590523	ITGB7	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7823	242
ACACB	32	broad.mit.edu	37	12	109609642	109609642	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109609642G>A	uc001tob.2	+	5	1077	c.958G>A	c.(958-960)GTC>ATC	p.V320I	ACACB_uc001toc.2_Missense_Mutation_p.V320I	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	320	Biotin carboxylation.				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	TTACGTCCCCGTCCCAGGAGG	0.502					1843											0.122807	9.807672	17.724957	7	50	KEEP	---	---	---	---	5	3	35	22	-1	capture	Missense_Mutation	SNP	109609642	109609642	ACACB	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	107	242
KCTD12	115207	broad.mit.edu	37	13	77459429	77459429	+	Silent	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:77459429G>A	uc010aeu.1	-	1	1112	c.855C>T	c.(853-855)TCC>TCT	p.S285S	KCTD12_uc001vka.1_Silent_p.S285S	NM_138444	NP_612453	Q96CX2	KCD12_HUMAN	potassium channel tetramerisation domain	285						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(1)	1		Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.0499)		AGCCCGACTCGGACAGCTTGT	0.637														OREG0022449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.222222	15.936943	17.852287	6	21	KEEP	---	---	---	---	3	3	17	6	-1	capture	Silent	SNP	77459429	77459429	KCTD12	13	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8021	242
KCNH5	27133	broad.mit.edu	37	14	63447809	63447809	+	Silent	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:63447809C>T	uc001xfx.2	-	6	774	c.723G>A	c.(721-723)AAG>AAA	p.K241K	KCNH5_uc001xfy.2_Silent_p.K241K|KCNH5_uc001xfz.1_Silent_p.K183K|KCNH5_uc001xga.2_Silent_p.K183K	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	241	Extracellular (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TGTTGTTCTGCTTTGTTTTGA	0.398																0.350877	56.98193	58.100486	20	37	KEEP	---	---	---	---	13	10	26	26	-1	capture	Silent	SNP	63447809	63447809	KCNH5	14	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	7957	242
KIAA1409	57578	broad.mit.edu	37	14	94052956	94052956	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94052956A>G	uc001ybv.1	+	18	2370	c.2287A>G	c.(2287-2289)ACC>GCC	p.T763A	KIAA1409_uc001ybs.1_Missense_Mutation_p.T763A	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	940						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		AAAGAATGATACCGAAAGAAA	0.338					1186											0.385714	94.816355	95.61514	27	43	KEEP	---	---	---	---	23	6	31	16	-1	capture	Missense_Mutation	SNP	94052956	94052956	KIAA1409	14	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	8152	242
SERPINA9	327657	broad.mit.edu	37	14	94933658	94933658	+	Silent	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94933658G>A	uc001ydf.2	-	3	905	c.744C>T	c.(742-744)GGC>GGT	p.G248G	SERPINA9_uc001yde.2_Silent_p.G148G|SERPINA9_uc010avc.2_Silent_p.G99G|SERPINA9_uc001ydg.2_Silent_p.G212G|SERPINA9_uc001ydh.1_Silent_p.G248G|SERPINA9_uc001ydi.1_Silent_p.G212G	NM_175739	NP_783866	Q86WD7	SPA9_HUMAN	serine (or cysteine) proteinase inhibitor, clade	230					regulation of proteolysis	cytoplasm|extracellular region|membrane	serine-type endopeptidase inhibitor activity			lung(1)|central_nervous_system(1)	2		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		TGACCTGCTCGCCCACCAGGA	0.473																0.476923	95.627742	95.657221	31	34	KEEP	---	---	---	---	16	18	26	9	-1	capture	Silent	SNP	94933658	94933658	SERPINA9	14	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13988	242
TMCO5A	145942	broad.mit.edu	37	15	38239874	38239874	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:38239874G>C	uc001zjw.2	+	10	748	c.645G>C	c.(643-645)AAG>AAC	p.K215N	TMCO5A_uc001zjv.1_Missense_Mutation_p.K215N	NM_152453	NP_689666	Q8N6Q1	TMC5A_HUMAN	transmembrane and coiled-coil domains 5A	215						integral to membrane				central_nervous_system(1)	1						CTACCCAAAAGACAGCAAGAT	0.318																0.118644	24.160021	41.016774	14	104	KEEP	---	---	---	---	10	7	62	62	-1	capture	Missense_Mutation	SNP	38239874	38239874	TMCO5A	15	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	15884	242
SRRM2	23524	broad.mit.edu	37	16	2812739	2812739	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2812739C>T	uc002crk.2	+	11	2759	c.2210C>T	c.(2209-2211)TCT>TTT	p.S737F	SRRM2_uc002crj.1_Missense_Mutation_p.S641F|SRRM2_uc002crl.1_Missense_Mutation_p.S737F|SRRM2_uc010bsu.1_Missense_Mutation_p.S641F	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	737	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						TCCAGAACATCTCAAAGAAGA	0.448																0.042373	-16.431296	10.103313	5	113	KEEP	---	---	---	---	3	2	62	54	-1	capture	Missense_Mutation	SNP	2812739	2812739	SRRM2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	15061	242
VPS53	55275	broad.mit.edu	37	17	440383	440383	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:440383G>A	uc002frn.2	-	18	2047	c.1900C>T	c.(1900-1902)CAG>TAG	p.Q634*	VPS53_uc002frk.2_Nonsense_Mutation_p.Q153*|VPS53_uc010cjo.1_Nonsense_Mutation_p.Q634*|VPS53_uc002frl.2_RNA|VPS53_uc002frm.2_Nonsense_Mutation_p.Q605*|VPS53_uc002fro.2_Nonsense_Mutation_p.Q436*|VPS53_uc010cjp.1_Nonsense_Mutation_p.Q357*	NM_018289	NP_060759	Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 isoform 2	634					protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		TAGGGGCTCTGGTCACCAACG	0.547																0.340426	49.5855	50.643434	16	31	KEEP	---	---	---	---	10	7	23	12	-1	capture	Nonsense_Mutation	SNP	440383	440383	VPS53	17	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	17097	242
GSDMB	55876	broad.mit.edu	37	17	38062400	38062400	+	Silent	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38062400G>A	uc010cwj.2	-	7	857	c.852C>T	c.(850-852)CTC>CTT	p.L284L	GSDMB_uc010cwi.2_Silent_p.L31L|GSDMB_uc010cwk.2_RNA|GSDMB_uc010cwl.2_RNA|GSDMB_uc010cwm.2_RNA|GSDMB_uc002htg.2_Silent_p.L262L|GSDMB_uc002hth.2_Silent_p.L271L|GSDMB_uc010wem.1_Silent_p.L275L	NM_001042471	NP_001035936	Q8TAX9	GSDMB_HUMAN	gasdermin B isoform 1	279						cytoplasm				breast(1)|pancreas(1)	2						CCTCCTTGCCGAGGCACTTAG	0.522																0.390625	149.719685	151.061414	50	78	KEEP	---	---	---	---	30	21	51	33	-1	capture	Silent	SNP	38062400	38062400	GSDMB	17	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	6749	242
ITGA3	3675	broad.mit.edu	37	17	48156217	48156217	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48156217G>A	uc010dbl.2	+	19	2791	c.2327G>A	c.(2326-2328)GGG>GAG	p.G776E	ITGA3_uc010dbm.2_Missense_Mutation_p.G776E	NM_002204	NP_002195	P26006	ITA3_HUMAN	integrin alpha 3 isoform a precursor	776	Extracellular (Potential).				blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|leukocyte migration	cell surface|integrin complex	protein binding|receptor activity			ovary(2)|pancreas(1)	3						AGCTTCTTTGGGGGGACAGTG	0.582																0.343195	170.095199	173.767625	58	111	KEEP	---	---	---	---	43	21	76	56	-1	capture	Missense_Mutation	SNP	48156217	48156217	ITGA3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	7800	242
ANKRD40	91369	broad.mit.edu	37	17	48776813	48776813	+	Missense_Mutation	SNP	G	A	A	rs148279576		TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48776813G>A	uc002iso.2	-	3	980	c.725C>T	c.(724-726)GCG>GTG	p.A242V		NM_052855	NP_443087	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40	242	Pro-rich.										0			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			GAATGCTGGCGCTGGTCCTGC	0.522																0.493333	217.312251	217.318349	74	76	KEEP	---	---	---	---	57	26	57	29	-1	capture	Missense_Mutation	SNP	48776813	48776813	ANKRD40	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	665	242
COIL	8161	broad.mit.edu	37	17	55027963	55027963	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:55027963G>T	uc002iuu.2	-	2	671	c.640C>A	c.(640-642)CAG>AAG	p.Q214K		NM_004645	NP_004636	P38432	COIL_HUMAN	coilin	214						Cajal body|nucleolus	protein C-terminus binding			ovary(1)	1	Breast(9;6.15e-08)					CTACATCTCTGATTGGCCCAG	0.403																0.412088	218.466429	219.70072	75	107	KEEP	---	---	---	---	54	27	68	48	0.666666666667	capture	Missense_Mutation	SNP	55027963	55027963	COIL	17	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	3630	242
ABCA9	10350	broad.mit.edu	37	17	66981088	66981088	+	Silent	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:66981088C>T	uc002jhu.2	-	34	4460	c.4317G>A	c.(4315-4317)CCG>CCA	p.P1439P	ABCA9_uc010dez.2_Silent_p.P1401P	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	1439	ABC transporter 2.				transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					GCACCACTGACGGGTTCCCCA	0.587																0.398374	141.752499	142.862452	49	74	KEEP	---	---	---	---	28	26	45	44	-1	capture	Silent	SNP	66981088	66981088	ABCA9	17	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	39	242
SETBP1	26040	broad.mit.edu	37	18	42529847	42529847	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:42529847C>G	uc010dni.2	+	4	838	c.542C>G	c.(541-543)GCT>GGT	p.A181G		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	181						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CACCCTTAGGCTTACGAGAGG	0.398												Schinzel-Giedion_syndrome				0.423077	75.941455	76.209994	22	30	KEEP	---	---	---	---	15	8	16	16	-1	capture	Missense_Mutation	SNP	42529847	42529847	SETBP1	18	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	14022	242
SLC14A1	6563	broad.mit.edu	37	18	43310353	43310353	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:43310353C>T	uc010xcn.1	+	4	387	c.68C>T	c.(67-69)TCG>TTG	p.S23L	SLC14A1_uc010dnk.2_Missense_Mutation_p.S79L|SLC14A1_uc002lbf.3_Missense_Mutation_p.S23L|SLC14A1_uc002lbg.3_RNA|SLC14A1_uc010xco.1_Intron|SLC14A1_uc002lbh.3_Intron|SLC14A1_uc002lbi.3_Intron|SLC14A1_uc002lbj.3_Missense_Mutation_p.S79L|SLC14A1_uc002lbk.3_Missense_Mutation_p.S23L	NM_001146036	NP_001139508	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter),	23						integral to plasma membrane	urea transmembrane transporter activity			central_nervous_system(1)|pancreas(1)	2						AACCAGGTTTCGCCATGTCAA	0.507					201											0.346535	95.875122	97.98343	35	66	KEEP	---	---	---	---	27	10	44	28	-1	capture	Missense_Mutation	SNP	43310353	43310353	SLC14A1	18	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14289	242
LRRC8E	80131	broad.mit.edu	37	19	7965735	7965735	+	Silent	SNP	G	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7965735G>T	uc002mir.2	+	3	2429	c.2328G>T	c.(2326-2328)CTG>CTT	p.L776L		NM_025061	NP_079337	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member	776						integral to membrane				lung(1)|pancreas(1)	2						CGGGGCTCCTGGTGGAAGACA	0.597																0.313043	99.546685	103.131244	36	79	KEEP	---	---	---	---	17	20	51	38	0.459459459459	capture	Silent	SNP	7965735	7965735	LRRC8E	19	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	8940	242
MUC16	94025	broad.mit.edu	37	19	9072143	9072143	+	Silent	SNP	T	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9072143T>A	uc002mkp.2	-	3	15507	c.15303A>T	c.(15301-15303)TCA>TCT	p.S5101S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5103	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTATCTTATCTGAGGTGCTGC	0.423																0.268908	171.689763	183.163798	64	174	KEEP	---	---	---	---	33	36	120	75	-1	capture	Silent	SNP	9072143	9072143	MUC16	19	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	9883	242
DTNB	1838	broad.mit.edu	37	2	25674485	25674485	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:25674485G>A	uc002rgh.2	-	12	1439	c.1189C>T	c.(1189-1191)CGA>TGA	p.R397*	DTNB_uc002rgg.2_Nonsense_Mutation_p.R26*|DTNB_uc010yko.1_Nonsense_Mutation_p.R340*|DTNB_uc010ykp.1_Nonsense_Mutation_p.R193*|DTNB_uc002rgo.2_Nonsense_Mutation_p.R188*|DTNB_uc002rgi.2_Nonsense_Mutation_p.R397*|DTNB_uc002rgj.2_Nonsense_Mutation_p.R397*|DTNB_uc002rgk.2_Nonsense_Mutation_p.R367*|DTNB_uc002rgl.2_Nonsense_Mutation_p.R367*|DTNB_uc002rgq.2_Nonsense_Mutation_p.R397*|DTNB_uc002rgm.2_Nonsense_Mutation_p.R367*|DTNB_uc002rgn.2_Nonsense_Mutation_p.R193*|DTNB_uc002rgr.1_Nonsense_Mutation_p.R386*|DTNB_uc010ykq.1_Nonsense_Mutation_p.R250*	NM_021907	NP_068707	O60941	DTNB_HUMAN	dystrobrevin, beta isoform 1	397						cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCATCCAGTCGGCTAGGACTG	0.468																0.466667	22.92504	22.939402	7	8	KEEP	---	---	---	---	3	4	7	2	-1	capture	Nonsense_Mutation	SNP	25674485	25674485	DTNB	2	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	4744	242
DUSP11	8446	broad.mit.edu	37	2	74007043	74007043	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74007043C>A	uc002sjp.2	-	1	242	c.200G>T	c.(199-201)CGC>CTC	p.R67L	DUSP11_uc002sjq.3_Missense_Mutation_p.R67L	NM_003584	NP_003575	O75319	DUS11_HUMAN	dual specificity phosphatase 11	20					RNA processing	nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity|RNA binding			skin(1)	1						GGCTGAGGAGCGTCCTGAAAA	0.617														OREG0014714	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.291667	67.084734	70.881592	28	68	KEEP	---	---	---	---	19	14	37	33	0.424242424242	capture	Missense_Mutation	SNP	74007043	74007043	DUSP11	2	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	4766	242
MAP4K4	9448	broad.mit.edu	37	2	102483026	102483026	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102483026C>T	uc002tbg.2	+	18	2162	c.2107C>T	c.(2107-2109)CGC>TGC	p.R703C	MAP4K4_uc002tbc.2_Missense_Mutation_p.R781C|MAP4K4_uc002tbd.2_Missense_Mutation_p.R673C|MAP4K4_uc002tbe.2_Missense_Mutation_p.R619C|MAP4K4_uc002tbf.2_Missense_Mutation_p.R673C|MAP4K4_uc010yvy.1_Missense_Mutation_p.R696C|MAP4K4_uc002tbh.2_Missense_Mutation_p.R618C|MAP4K4_uc002tbi.2_Missense_Mutation_p.R503C|MAP4K4_uc010yvz.1_Missense_Mutation_p.R676C|MAP4K4_uc002tbk.2_Missense_Mutation_p.R158C|MAP4K4_uc002tbl.2_Translation_Start_Site	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	703					intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						CTCCGGGGAACGCTTCAGAGT	0.532					483											0.294118	67.644586	70.867304	25	60	KEEP	---	---	---	---	13	13	40	24	-1	capture	Missense_Mutation	SNP	102483026	102483026	MAP4K4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9176	242
ZAK	51776	broad.mit.edu	37	2	174131422	174131422	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:174131422G>A	uc002uhz.2	+	20	2547	c.2347G>A	c.(2347-2349)GCC>ACC	p.A783T	uc002uib.2_Intron	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1	783					activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)			GCCATCTCCCGCCAAAACCAA	0.473					532											0.588235	29.951071	30.066311	10	7	KEEP	---	---	---	---	3	7	2	5	-1	capture	Missense_Mutation	SNP	174131422	174131422	ZAK	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17393	242
MYO1B	4430	broad.mit.edu	37	2	192261188	192261188	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192261188G>A	uc010fsg.2	+	21	2515	c.2260G>A	c.(2260-2262)GCC>ACC	p.A754T	MYO1B_uc002usq.2_Missense_Mutation_p.A754T|MYO1B_uc002usr.2_Missense_Mutation_p.A754T|MYO1B_uc002usu.2_Missense_Mutation_p.A28T	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1	754	IQ 3.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			AAAGAGTTCCGCCTTAGTAAT	0.373																0.438202	234.319177	234.912389	78	100	KEEP	---	---	---	---	45	47	71	52	-1	capture	Missense_Mutation	SNP	192261188	192261188	MYO1B	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9979	242
CRKL	1399	broad.mit.edu	37	22	21272527	21272527	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21272527C>T	uc002ztf.2	+	1	814	c.305C>T	c.(304-306)GCG>GTG	p.A102V	CRKL_uc002ztg.1_RNA	NM_005207	NP_005198	P46109	CRKL_HUMAN	v-crk sarcoma virus CT10 oncogene homolog	102	SH2.				JNK cascade|Ras protein signal transduction	cytosol	protein tyrosine kinase activity|SH3/SH2 adaptor activity|signal transducer activity				0	all_cancers(11;1.16e-25)|all_epithelial(7;3.37e-24)|Lung NSC(8;7.25e-16)|all_lung(8;1.37e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.176)			ATCGAGCCTGCGCCCAGGTAC	0.607	Pancreas(85;3 1441 23889 42519 42763)				67											0.090909	1.317232	6.869146	3	30	KEEP	---	---	---	---	0	3	21	15	-1	capture	Missense_Mutation	SNP	21272527	21272527	CRKL	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3850	242
MTMR3	8897	broad.mit.edu	37	22	30413988	30413988	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30413988A>G	uc003agv.3	+	16	2075	c.1747A>G	c.(1747-1749)ACC>GCC	p.T583A	MTMR3_uc003agu.3_Missense_Mutation_p.T583A|MTMR3_uc003agw.3_Missense_Mutation_p.T583A	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c	583					phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CCCATCCCCAACCACCCCTGT	0.632																0.362205	142.721795	144.840716	46	81	KEEP	---	---	---	---	34	22	41	54	-1	capture	Missense_Mutation	SNP	30413988	30413988	MTMR3	22	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	9855	242
SLC5A4	6527	broad.mit.edu	37	22	32626981	32626981	+	Missense_Mutation	SNP	G	A	A	rs150200210		TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32626981G>A	uc003ami.2	-	10	1105	c.1103C>T	c.(1102-1104)ACG>ATG	p.T368M		NM_014227	NP_055042	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (low affinity glucose	368	Extracellular (Potential).				carbohydrate transport|sodium ion transport	integral to membrane	symporter activity				0						CAGCACCATCGTGGGGTATGC	0.537																0.073171	-0.606597	7.072284	3	38	KEEP	---	---	---	---	3	1	21	20	-1	capture	Missense_Mutation	SNP	32626981	32626981	SLC5A4	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14559	242
MKL1	57591	broad.mit.edu	37	22	40814904	40814904	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:40814904C>T	uc003ayv.1	-	9	1745	c.1538G>A	c.(1537-1539)GGG>GAG	p.G513E	MKL1_uc003ayw.1_Missense_Mutation_p.G513E|MKL1_uc010gye.1_Missense_Mutation_p.G513E|MKL1_uc010gyf.1_Missense_Mutation_p.G463E	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein	513					positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						CGCCCGCCCCCCAGGGCTCAG	0.672					210	T	RBM15	acute megakaryocytic leukemia								0.393939	82.647088	83.293203	26	40	KEEP	---	---	---	---	23	12	33	17	-1	capture	Missense_Mutation	SNP	40814904	40814904	MKL1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	9513	242
TEF	7008	broad.mit.edu	37	22	41790269	41790269	+	Silent	SNP	C	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:41790269C>A	uc003azy.2	+	3	731	c.645C>A	c.(643-645)CCC>CCA	p.P215P	TEF_uc003azx.2_Silent_p.P185P|TEF_uc011apa.1_Silent_p.P220P	NM_003216	NP_003207	Q10587	TEF_HUMAN	thyrotrophic embryonic factor isoform 1	215	Pro-rich (proline/acidic region (PAR)).				rhythmic process	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						ACCTGAAGCCCCAGCCTATGA	0.547																0.313433	54.868595	56.934666	21	46	KEEP	---	---	---	---	16	15	28	23	0.483870967742	capture	Silent	SNP	41790269	41790269	TEF	22	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	15635	242
ZNF385D	79750	broad.mit.edu	37	3	21792472	21792472	+	Translation_Start_Site	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:21792472G>A	uc003cce.2	-	1	345	c.-63C>T	c.(-65--61)TACGT>TATGT		ZNF385D_uc010hfb.1_Intron	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5						AGGCTGGCACGTAGAGCAGAG	0.557																0.112903	6.877066	16.0509	7	55	KEEP	---	---	---	---	5	2	31	26	-1	capture	Translation_Start_Site	SNP	21792472	21792472	ZNF385D	3	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	17758	242
SUCLG2	8801	broad.mit.edu	37	3	67570993	67570993	+	Silent	SNP	G	C	C			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:67570993G>C	uc003dna.3	-	5	511	c.483C>G	c.(481-483)TCC>TCG	p.S161S	SUCLG2_uc010hob.2_Silent_p.S42S	NM_003848	NP_003839	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming beta subunit	161	ATP-grasp.				succinyl-CoA metabolic process|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|GTP binding|succinate-CoA ligase (GDP-forming) activity			central_nervous_system(1)|skin(1)	2		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	GGCCATTGCAGGACCGGTCCA	0.502																0.04878	-20.045676	15.451132	8	156	KEEP	---	---	---	---	1	8	95	81	-1	capture	Silent	SNP	67570993	67570993	SUCLG2	3	G	C	C	C	1	0	0	0	0	0	0	0	1	444	35	4	4	15255	242
IFT122	55764	broad.mit.edu	37	3	129214370	129214370	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:129214370G>A	uc003emm.2	+	18	2334	c.2128G>A	c.(2128-2130)GCC>ACC	p.A710T	IFT122_uc003eml.2_Missense_Mutation_p.A761T|IFT122_uc003emn.2_Missense_Mutation_p.A651T|IFT122_uc003emo.2_Missense_Mutation_p.A599T|IFT122_uc003emp.2_Missense_Mutation_p.A560T|IFT122_uc010htc.2_Missense_Mutation_p.A702T|IFT122_uc011bky.1_Missense_Mutation_p.A501T|IFT122_uc003emq.2_Missense_Mutation_p.A550T|IFT122_uc003emr.2_Missense_Mutation_p.A462T|IFT122_uc011bla.1_Missense_Mutation_p.A483T|IFT122_uc010hte.2_Intron|IFT122_uc003ems.2_Missense_Mutation_p.A91T|IFT122_uc011bkx.1_Missense_Mutation_p.A550T|IFT122_uc010htd.1_Missense_Mutation_p.A189T	NM_052989	NP_443715	Q9HBG6	IF122_HUMAN	WD repeat domain 10 isoform 2	710					camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2						CCATGAGGCCGCCAAACTGTA	0.512																0.036036	-18.496536	7.439074	4	107	KEEP	---	---	---	---	0	4	63	50	-1	capture	Missense_Mutation	SNP	129214370	129214370	IFT122	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7480	242
GRK7	131890	broad.mit.edu	37	3	141497201	141497201	+	Silent	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:141497201C>T	uc011bnd.1	+	1	159	c.75C>T	c.(73-75)TGC>TGT	p.C25C		NM_139209	NP_631948	Q8WTQ7	GRK7_HUMAN	G-protein-coupled receptor kinase 7 precursor	25					visual perception	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						CCTCGGACTGCGACAGCAAAG	0.701					174											0.341463	72.821801	74.668183	28	54	KEEP	---	---	---	---	19	14	31	31	-1	capture	Silent	SNP	141497201	141497201	GRK7	3	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	6727	242
TM4SF1	4071	broad.mit.edu	37	3	149093335	149093335	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:149093335C>G	uc003exb.1	-	3	542	c.308G>C	c.(307-309)GGA>GCA	p.G103A	TM4SF1_uc003exc.1_Missense_Mutation_p.G14A	NM_014220	NP_055035	P30408	T4S1_HUMAN	transmembrane 4 superfamily member 1	103	Helical; (Probable).					integral to plasma membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GTAGCCAGATCCTGCAATTCC	0.507																0.465517	91.716649	91.776966	27	31	KEEP	---	---	---	---	17	13	19	19	-1	capture	Missense_Mutation	SNP	149093335	149093335	TM4SF1	3	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	15851	242
ADAMTS3	9508	broad.mit.edu	37	4	73184402	73184402	+	Missense_Mutation	SNP	C	G	G	rs80237783		TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:73184402C>G	uc003hgk.1	-	10	1409	c.1372G>C	c.(1372-1374)GAT>CAT	p.D458H		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	458	Peptidase M12B.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAAGGGTCATCAAGGAGACAG	0.343	NSCLC(168;1941 2048 2918 13048 43078)															0.441176	106.442861	106.647727	30	38	KEEP	---	---	---	---	14	18	22	23	-1	capture	Missense_Mutation	SNP	73184402	73184402	ADAMTS3	4	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	267	242
MRPL1	65008	broad.mit.edu	37	4	78804480	78804480	+	Silent	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:78804480C>T	uc003hku.2	+	3	426	c.228C>T	c.(226-228)CCC>CCT	p.P76P	MRPL1_uc010iji.1_5'UTR	NM_020236	NP_064621	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1 precursor	76							RNA binding				0						AAGCATATCCCTATATGGAAG	0.323																0.348485	72.70483	74.042186	23	43	KEEP	---	---	---	---	13	10	19	30	-1	capture	Silent	SNP	78804480	78804480	MRPL1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	9684	242
UNC5C	8633	broad.mit.edu	37	4	96090460	96090460	+	Silent	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:96090460G>A	uc003htp.1	-	16	2875	c.2721C>T	c.(2719-2721)AGC>AGT	p.S907S	uc003hto.2_5'Flank	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	907	Cytoplasmic (Potential).|Death.				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CTGCCAGCATGCTCAGGTTTC	0.483																0.431034	214.187916	214.911405	75	99	KEEP	---	---	---	---	48	32	64	44	-1	capture	Silent	SNP	96090460	96090460	UNC5C	4	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	16875	242
NAF1	92345	broad.mit.edu	37	4	164054388	164054388	+	Silent	SNP	A	G	G			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:164054388A>G	uc003iqj.2	-	7	1145	c.951T>C	c.(949-951)GAT>GAC	p.D317D	NAF1_uc010iqw.1_Silent_p.D317D	NM_138386	NP_612395	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 homolog isoform a	317					rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding			ovary(2)	2	all_hematologic(180;0.166)	Prostate(90;0.109)				TCTCTTTTTCATCATCACTAA	0.333																0.467532	121.196657	121.267053	36	41	KEEP	---	---	---	---	27	10	25	19	-1	capture	Silent	SNP	164054388	164054388	NAF1	4	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	10050	242
ODZ3	55714	broad.mit.edu	37	4	183574978	183574978	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:183574978T>C	uc003ivd.1	+	5	1080	c.1043T>C	c.(1042-1044)TTT>TCT	p.F348S		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	348	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		AATGACACATTTGAGAATGGA	0.418																0.443038	121.119974	121.342447	35	44	KEEP	---	---	---	---	21	17	22	22	-1	capture	Missense_Mutation	SNP	183574978	183574978	ODZ3	4	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	10741	242
SH3RF2	153769	broad.mit.edu	37	5	145393517	145393517	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:145393517C>T	uc003lnt.2	+	5	1190	c.952C>T	c.(952-954)CGC>TGC	p.R318C	SH3RF2_uc011dbl.1_Missense_Mutation_p.R318C	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	318							ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCTTCAGGGCGCCATATGGT	0.577																0.412371	231.552096	232.855258	80	114	KEEP	---	---	---	---	52	38	60	69	-1	capture	Missense_Mutation	SNP	145393517	145393517	SH3RF2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14152	242
NKAIN2	154215	broad.mit.edu	37	6	124979424	124979424	+	Silent	SNP	T	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:124979424T>A	uc003pzo.2	+	4	643	c.366T>A	c.(364-366)CCT>CCA	p.P122P	NKAIN2_uc003pzn.1_Silent_p.P122P|NKAIN2_uc003pzp.2_Silent_p.P121P|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Silent_p.P32P	NM_001040214	NP_001035304	Q5VXU1	NKAI2_HUMAN	T-cell lymphoma breakpoint-associated target 1	122						integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)		CAGTGACACCTGCCCCAGACT	0.502																0.324324	107.466601	110.504294	36	75	KEEP	---	---	---	---	18	23	44	36	-1	capture	Silent	SNP	124979424	124979424	NKAIN2	6	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	10343	242
NOX3	50508	broad.mit.edu	37	6	155743923	155743923	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:155743923C>T	uc003qqm.2	-	10	1316	c.1213G>A	c.(1213-1215)GTT>ATT	p.V405I		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	405	Helical; (Potential).						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		CCCGCGGCAACGCACACACAC	0.537																0.272727	115.495733	123.183396	45	120	KEEP	---	---	---	---	28	24	69	69	-1	capture	Missense_Mutation	SNP	155743923	155743923	NOX3	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10464	242
PLG	5340	broad.mit.edu	37	6	161134138	161134138	+	Silent	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161134138C>T	uc003qtm.3	+	5	591	c.528C>T	c.(526-528)TGC>TGT	p.C176C		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	176	Kringle 1.				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ATGACTACTGCGACATTCTTG	0.473																0.349398	171.103797	174.424328	58	108	KEEP	---	---	---	---	31	32	67	57	-1	capture	Silent	SNP	161134138	161134138	PLG	6	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	11989	242
TBX20	57057	broad.mit.edu	37	7	35242129	35242129	+	Silent	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:35242129C>T	uc011kas.1	-	8	1268	c.1257G>A	c.(1255-1257)CCG>CCA	p.P419P		NM_001077653	NP_001071121	Q9UMR3	TBX20_HUMAN	T-box transcription factor TBX20	419						nucleus	DNA binding			central_nervous_system(1)	1						GATGGTATCGCGGCATGTGGA	0.522																0.171429	10.526958	14.101131	6	29	KEEP	---	---	---	---	4	2	20	17	-1	capture	Silent	SNP	35242129	35242129	TBX20	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15543	242
NPC1L1	29881	broad.mit.edu	37	7	44560418	44560418	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44560418C>T	uc003tlb.2	-	14	3138	c.3082G>A	c.(3082-3084)GGC>AGC	p.G1028S	NPC1L1_uc003tlc.2_Missense_Mutation_p.G1028S|NPC1L1_uc011kbw.1_Missense_Mutation_p.G982S|NPC1L1_uc003tla.2_Missense_Mutation_p.G31S	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	1028	Cytoplasmic (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5					Ezetimibe(DB00973)	GCTGCCAGGCCGCTGCAAGAA	0.572																0.160584	45.263174	60.284144	22	115	KEEP	---	---	---	---	16	7	57	64	-1	capture	Missense_Mutation	SNP	44560418	44560418	NPC1L1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10478	242
CACNA2D1	781	broad.mit.edu	37	7	81594957	81594957	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:81594957C>T	uc003uhr.1	-	32	2783	c.2527G>A	c.(2527-2529)GAT>AAT	p.D843N	CACNA2D1_uc011kgy.1_Missense_Mutation_p.D55N	NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	855	Extracellular (Potential).					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	AACCCACCATCATCCAGAATC	0.368																0.088542	4.21796	37.082055	17	175	KEEP	---	---	---	---	10	10	122	83	-1	capture	Missense_Mutation	SNP	81594957	81594957	CACNA2D1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	2524	242
ZNF804B	219578	broad.mit.edu	37	7	88965893	88965893	+	Silent	SNP	A	G	G			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:88965893A>G	uc011khi.1	+	4	4135	c.3597A>G	c.(3595-3597)CCA>CCG	p.P1199P		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1199						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AGACAGTTCCAGTTCACCAGC	0.502													HNSCC(36;0.09)			0.035714	-26.898879	12.432453	6	162	KEEP	---	---	---	---	4	3	90	80	-1	capture	Silent	SNP	88965893	88965893	ZNF804B	7	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	18047	242
MUC17	140453	broad.mit.edu	37	7	100680859	100680859	+	Silent	SNP	G	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100680859G>A	uc003uxp.1	+	3	6215	c.6162G>A	c.(6160-6162)ACG>ACA	p.T2054T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2054	Extracellular (Potential).|32.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TCAGCACTACGCTTGTGGTCA	0.493																0.320988	216.18965	223.093601	78	165	KEEP	---	---	---	---	45	40	96	77	-1	capture	Silent	SNP	100680859	100680859	MUC17	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9884	242
TFEC	22797	broad.mit.edu	37	7	115590932	115590932	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:115590932C>T	uc003vhj.1	-	6	695	c.511G>A	c.(511-513)GAT>AAT	p.D171N	TFEC_uc003vhk.1_Missense_Mutation_p.D142N|TFEC_uc003vhl.3_Missense_Mutation_p.D142N|TFEC_uc011kmw.1_Missense_Mutation_p.D261N	NM_012252	NP_036384	O14948	TFEC_HUMAN	transcription factor EC isoform a	171	Helix-loop-helix motif.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)			ACTCACGGATCATTAGACTTT	0.323																0.188406	27.930725	34.203869	13	56	KEEP	---	---	---	---	7	7	46	26	-1	capture	Missense_Mutation	SNP	115590932	115590932	TFEC	7	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	15687	242
CDKN2A	1029	broad.mit.edu	37	9	21971029	21971029	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21971029C>T	uc003zpk.2	-	2	541	c.329G>A	c.(328-330)TGG>TAG	p.W110*	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Silent_p.L165L	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	110	ANK 4.				cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.W110*(38)|p.?(13)|p.H83fs*2(2)|p.W110fs*9(1)|p.D105fs*8(1)|p.A68fs*3(1)|p.R107fs*33(1)|p.W110fs*36(1)|p.W110C(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CAGACGGCCCCAGGCATCGCG	0.731			17		76							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			0.541667	38.274247	38.310332	13	11	KEEP	---	---	---	---	9	6	8	4	-1	capture	Nonsense_Mutation	SNP	21971029	21971029	CDKN2A	9	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	3130	242
IKBKAP	8518	broad.mit.edu	37	9	111659518	111659518	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:111659518C>A	uc004bdm.3	-	23	2931	c.2411G>T	c.(2410-2412)AGT>ATT	p.S804I	IKBKAP_uc004bdl.2_Missense_Mutation_p.S455I|IKBKAP_uc011lwc.1_Missense_Mutation_p.S690I|IKBKAP_uc010mtq.2_Missense_Mutation_p.S455I	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	804					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						CAGGTAGACACTGCTGGTAAC	0.463																0.357143	129.634438	131.901771	45	81	KEEP	---	---	---	---	22	25	56	32	0.531914893617	capture	Missense_Mutation	SNP	111659518	111659518	IKBKAP	9	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	7534	242
EHMT1	79813	broad.mit.edu	37	9	140638536	140638536	+	Silent	SNP	C	A	A			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140638536C>A	uc011mfc.1	+	6	1201	c.1164C>A	c.(1162-1164)GCC>GCA	p.A388A	EHMT1_uc004coa.2_Silent_p.A388A|EHMT1_uc004cob.1_Silent_p.A357A	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	388					DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CTGATCGCGCCCAGAAGGTAT	0.567																0.047619	-7.366986	6.300009	3	60	KEEP	---	---	---	---	2	1	38	27	0.333333333333	capture	Silent	SNP	140638536	140638536	EHMT1	9	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	4938	242
OTUD6A	139562	broad.mit.edu	37	X	69283226	69283226	+	Silent	SNP	C	G	G			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69283226C>G	uc004dxu.1	+	1	886	c.852C>G	c.(850-852)CTC>CTG	p.L284L		NM_207320	NP_997203	Q7L8S5	OTU6A_HUMAN	OTU domain containing 6A	284										lung(1)|skin(1)	2						GGGGCGTGCTCCCGCGTCTCC	0.607																1	43.947224	43.946735	11	0	KEEP	---	---	---	---	5	11	0	0	-1	capture	Silent	SNP	69283226	69283226	OTUD6A	23	C	G	G	G	1	0	0	0	0	0	0	0	1	379	30	4	4	11220	242
GLUD2	2747	broad.mit.edu	37	X	120181603	120181603	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:120181603C>T	uc004eto.2	+	1	142	c.65C>T	c.(64-66)GCG>GTG	p.A22V		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2 precursor	22					glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)	CTGGGCTCCGCGGCCAACCAC	0.786																0.916667	69.541829	73.069428	22	2	KEEP	---	---	---	---	12	16	2	0	-1	capture	Missense_Mutation	SNP	120181603	120181603	GLUD2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6413	242
UBE2U	148581	broad.mit.edu	37	1	64707415	64707418	+	Splice_Site	DEL	AAGT	-	-			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:64707415_64707418delAAGT	uc001dbn.1	+	8	921	c.677_splice	c.e8+1	p.K226_splice		NM_152489	NP_689702	Q5VVX9	UBE2U_HUMAN	ubiquitin-conjugating enzyme E2U (putative)								ATP binding|protein binding|ubiquitin-protein ligase activity				0						ATGGAATTTAAAGTAAGAAATATG	0.304																0.23			10	34		---	---	---	---						capture_indel	Splice_Site	DEL	64707415	64707418	UBE2U	1	AAGT	-	-	-	1	0	1	0	1	0	0	1	0	13	1	5	5	16756	242
BCL10	8915	broad.mit.edu	37	1	85736511	85736511	+	Frame_Shift_Del	DEL	T	-	-			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85736511delT	uc001dkz.2	-	3	841	c.136delA	c.(136-138)ATAfs	p.I46fs		NM_003921	NP_003912	O95999	BCL10_HUMAN	B-cell CLL/lymphoma 10	46	CARD.			I->A: Abolishes cell death-inducing capability.	apoptosis|cellular response to mechanical stimulus|innate immune response|interleukin-6 biosynthetic process|lymphotoxin A biosynthetic process|negative regulation of mature B cell apoptosis|neural tube closure|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 biosynthetic process|positive regulation of mast cell cytokine production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of transcription, DNA-dependent|protein homooligomerization|response to molecule of bacterial origin|T cell receptor signaling pathway	CBM complex|cytosol|lysosome|membrane raft|nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protease binding|protein C-terminus binding|protein kinase B binding|protein self-association|transcription coactivator activity|ubiquitin binding|ubiquitin protein ligase binding			lung(2)	2				all cancers(265;0.0114)|Epithelial(280;0.0311)		CTACTGAGTATTTTTTTTGCA	0.343	NSCLC(34;993 1034 12176 32621 50182)				22	T	IGH@	MALT 								0.03			7	203		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	85736511	85736511	BCL10	1	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	1351	242
NCAM1	4684	broad.mit.edu	37	11	113103495	113103496	+	Frame_Shift_Ins	INS	-	CATTGGGC	CATTGGGC			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113103495_113103496insCATTGGGC	uc009yyq.1	+	13	1899_1900	c.1205_1206insCATTGGGC	c.(1204-1206)CGCfs	p.R402fs		NM_001076682	NP_001070150	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1 isoform 3	494	Ig-like C2-type 5.|Extracellular (Potential).				axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GCAGTGAACCGCATTGGGCAGG	0.510					700											0.14			17	104		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	113103495	113103496	NCAM1	11	-	CATTGGGC	CATTGGGC	CATTGGGC	1	0	1	1	0	0	0	0	0	494	38	5	5	10109	242
XPO4	64328	broad.mit.edu	37	13	21362729	21362729	+	Frame_Shift_Del	DEL	G	-	-			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:21362729delG	uc001unq.3	-	20	2979	c.2943delC	c.(2941-2943)TACfs	p.Y981fs		NM_022459	NP_071904	Q9C0E2	XPO4_HUMAN	exportin 4	981					protein transport	cytoplasm|nucleus	protein binding			large_intestine(1)|ovary(1)|kidney(1)	3		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		TGATTAATTTGTAGTACTGAT	0.299					353											0.34			45	86		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	21362729	21362729	XPO4	13	G	-	-	-	1	0	1	0	1	0	0	0	0	620	48	5	5	17327	242
SF3A2	8175	broad.mit.edu	37	19	2248259	2248260	+	Frame_Shift_Ins	INS	-	G	G			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2248259_2248260insG	uc002lvg.2	+	9	1231_1232	c.1109_1110insG	c.(1108-1110)GCGfs	p.A370fs	AMH_uc002lvh.2_5'Flank|hsa-mir-4321|MI0015852_5'Flank	NM_007165	NP_009096	Q15428	SF3A2_HUMAN	splicing factor 3a, subunit 2	370	Pro-rich.				nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex	nucleic acid binding|zinc ion binding				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCCATCAGCGGGGGTTCACC	0.748																0.40			4	6		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	2248259	2248260	SF3A2	19	-	G	G	G	1	0	1	1	0	0	0	0	0	351	27	5	5	14040	242
FRK	2444	broad.mit.edu	37	6	116265439	116265439	+	Frame_Shift_Del	DEL	C	-	-			TCGA-32-2638-01	TCGA-32-2638-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:116265439delC	uc003pwi.1	-	6	1555	c.1108delG	c.(1108-1110)GTAfs	p.V370fs		NM_002031	NP_002022	P42685	FRK_HUMAN	fyn-related kinase	370	Protein kinase.				negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|lung(3)	6		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)		AAATCTGCTACTTTGTAGATA	0.388					355											0.36			53	95		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	116265439	116265439	FRK	6	C	-	-	-	1	0	1	0	1	0	0	0	0	260	20	5	5	5991	242
