Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA0090	23065	broad.mit.edu	37	1	19565777	19565777	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19565777G>A	uc001bbo.2	-	9	1017	c.974C>T	c.(973-975)GCC>GTC	p.A325V	KIAA0090_uc001bbp.2_Missense_Mutation_p.A325V|KIAA0090_uc001bbq.2_Missense_Mutation_p.A325V|KIAA0090_uc001bbr.2_Missense_Mutation_p.A303V	NM_015047	NP_055862	Q8N766	K0090_HUMAN	hypothetical protein LOC23065 precursor	325	Extracellular (Potential).					integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)		CCCAGTGGTGGCAAAGCTCAC	0.542	GBM(4;72 124 25802 30195)															0.04	-18.820676	9.677425	5	120	KEEP	---	---	---	---	4	2	76	71	-1	capture	Missense_Mutation	SNP	19565777	19565777	KIAA0090	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	8075	250
PLA2G2F	64600	broad.mit.edu	37	1	20470022	20470022	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:20470022G>A	uc009vpp.1	+	3	351	c.253G>A	c.(253-255)GTG>ATG	p.V85M		NM_022819	NP_073730	Q9BZM2	PA2GF_HUMAN	phospholipase A2, group IIF	42					lipid catabolic process|phospholipid metabolic process	extracellular region	calcium ion binding|phospholipase A2 activity			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.000524)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		CCTGTCCTTCGTGGGCTACGG	0.637																0.308943	104.513148	108.509245	38	85	KEEP	---	---	---	---	21	23	41	52	-1	capture	Missense_Mutation	SNP	20470022	20470022	PLA2G2F	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11902	250
SPTA1	6708	broad.mit.edu	37	1	158626392	158626392	+	Missense_Mutation	SNP	T	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158626392T>A	uc001fst.1	-	20	3059	c.2860A>T	c.(2860-2862)AGT>TGT	p.S954C		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	954	Spectrin 10.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GCTTTCATACTGTCTCCAAAT	0.408																0.302932	278.958701	289.600214	93	214	KEEP	---	---	---	---	57	55	141	105	-1	capture	Missense_Mutation	SNP	158626392	158626392	SPTA1	1	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	15008	250
LY9	4063	broad.mit.edu	37	1	160793477	160793477	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160793477A>G	uc001fwu.2	+	8	1771	c.1721A>G	c.(1720-1722)GAC>GGC	p.D574G	LY9_uc001fwv.2_Missense_Mutation_p.D560G|LY9_uc001fww.2_Missense_Mutation_p.D484G|LY9_uc001fwx.2_Missense_Mutation_p.D484G|LY9_uc001fwy.1_Missense_Mutation_p.D372G|LY9_uc001fwz.2_Missense_Mutation_p.D212G	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	574	Cytoplasmic (Potential).				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GCTGGACATGACCCAGCCCCT	0.537																0.177994	125.975493	156.436502	55	254	KEEP	---	---	---	---	28	35	137	155	-1	capture	Missense_Mutation	SNP	160793477	160793477	LY9	1	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	9016	250
CEP350	9857	broad.mit.edu	37	1	179972355	179972355	+	Silent	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179972355G>A	uc001gnt.2	+	7	1448	c.1065G>A	c.(1063-1065)GTG>GTA	p.V355V	CEP350_uc009wxl.2_Silent_p.V354V|CEP350_uc001gnu.2_Silent_p.V189V	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	355						centrosome|nucleus|spindle				ovary(4)	4						ATGGGAAAGTGTGGCAGGAGG	0.373																0.448276	39.570824	39.63853	13	16	KEEP	---	---	---	---	8	12	18	6	-1	capture	Silent	SNP	179972355	179972355	CEP350	1	G	A	A	A	1	0	0	0	0	0	0	0	1	613	48	2	2	3222	250
LARP4B	23185	broad.mit.edu	37	10	882389	882389	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:882389C>T	uc001ifs.1	-	7	745	c.704G>A	c.(703-705)CGC>CAC	p.R235H		NM_015155	NP_055970	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	235	HTH La-type RNA-binding.						nucleotide binding|RNA binding			ovary(2)|central_nervous_system(1)	3						TACTATGCAGCGATTTTGATT	0.353																0.03252	-22.310653	7.059757	4	119	KEEP	---	---	---	---	3	1	66	73	-1	capture	Missense_Mutation	SNP	882389	882389	LARP4B	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8551	250
CDH23	64072	broad.mit.edu	37	10	73462359	73462359	+	Silent	SNP	T	C	C			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:73462359T>C	uc001jrx.3	+	23	3018	c.2641T>C	c.(2641-2643)TTG>CTG	p.L881L	CDH23_uc001jry.2_Silent_p.L497L|CDH23_uc001jrz.2_Silent_p.L497L	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	881	Cadherin 8.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						TGTGAACCTCTTGGATCTCAA	0.577																0.018868	-45.596722	9.593417	4	208	KEEP	---	---	---	---	0	4	111	114	-1	capture	Silent	SNP	73462359	73462359	CDH23	10	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	3079	250
PTEN	5728	broad.mit.edu	37	10	89717672	89717672	+	Nonsense_Mutation	SNP	C	T	T	rs121909219		TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717672C>T	uc001kfb.2	+	8	1728	c.697C>T	c.(697-699)CGA>TGA	p.R233*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	233	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R233*(61)|p.R233fs*10(4)|p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.R233fs*12(1)|p.R233fs*20(1)|p.R233fs*25(1)|p.R233fs*23(1)|p.R233R(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGGACCCACACGACGGGAAGA	0.423		R233*(JHUEM1_ENDOMETRIUM)|R233*(SW1783_CENTRAL_NERVOUS_SYSTEM)|R233*(NCIH1155_LUNG)|R233*(SF295_CENTRAL_NERVOUS_SYSTEM)|R233*(HEC59_ENDOMETRIUM)	31	p.R233*(JHUEM1-Tumor)|p.R233*(SW1783-Tumor)|p.R233*(SF295-Tumor)|p.T232fs(P31FUJ-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.701031	222.624295	226.125349	68	29	KEEP	---	---	---	---	47	29	22	9	-1	capture	Nonsense_Mutation	SNP	89717672	89717672	PTEN	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	12633	250
CALHM2	51063	broad.mit.edu	37	10	105209447	105209447	+	Silent	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105209447G>A	uc001kwz.2	-	2	638	c.252C>T	c.(250-252)GCC>GCT	p.A84A	CALHM2_uc001kxa.2_Silent_p.A84A|CALHM2_uc001kxc.2_Silent_p.A84A|CALHM2_uc001kxb.2_Silent_p.A84A|CALHM2_uc001kxd.1_Silent_p.A84A	NM_015916	NP_057000	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2	84						integral to membrane				skin(1)	1						GCTGGCACTCGGCCACGAGGT	0.647																0.602564	160.046835	160.767917	47	31	KEEP	---	---	---	---	32	22	11	22	-1	capture	Silent	SNP	105209447	105209447	CALHM2	10	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2559	250
JAKMIP3	282973	broad.mit.edu	37	10	133954043	133954043	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:133954043C>T	uc001lkx.3	+	9	1433	c.1433C>T	c.(1432-1434)ACG>ATG	p.T478M		NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		ACAGACAGGACGGACCAGACC	0.607																0.64	52.206315	52.637866	16	9	KEEP	---	---	---	---	4	12	7	2	-1	capture	Missense_Mutation	SNP	133954043	133954043	JAKMIP3	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7865	250
EIF3M	10480	broad.mit.edu	37	11	32615446	32615446	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:32615446G>A	uc001mtu.2	+	6	611	c.568G>A	c.(568-570)GGA>AGA	p.G190R	EIF3M_uc010ref.1_Missense_Mutation_p.G58R	NM_006360	NP_006351	Q7L2H7	EIF3M_HUMAN	eukaryotic translation initiation factor 3,	190						eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)|breast(1)|skin(1)	3	Breast(20;0.109)					GGAATTGCTCGGAAGTTACAC	0.378																0.410714	152.132718	152.911919	46	66	KEEP	---	---	---	---	30	30	43	42	-1	capture	Missense_Mutation	SNP	32615446	32615446	EIF3M	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4978	250
MS4A14	84689	broad.mit.edu	37	11	60183725	60183725	+	Silent	SNP	T	C	C			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60183725T>C	uc001npj.2	+	5	1849	c.1284T>C	c.(1282-1284)CCT>CCC	p.P428P	MS4A14_uc001npi.2_Silent_p.P316P|MS4A14_uc001npn.2_Silent_p.P166P|MS4A14_uc001npk.2_Silent_p.P411P|MS4A14_uc001npl.2_Silent_p.P166P|MS4A14_uc001npm.2_Silent_p.P166P	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	428	Gln-rich.					integral to membrane	receptor activity			breast(1)	1						TGCAGTTCCCTGAAATACAAC	0.274																0.025424	-23.084744	6.365553	3	115	KEEP	---	---	---	---	1	3	63	72	-1	capture	Silent	SNP	60183725	60183725	MS4A14	11	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	9768	250
HEPHL1	341208	broad.mit.edu	37	11	93796724	93796724	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:93796724G>T	uc001pep.2	+	3	623	c.466G>T	c.(466-468)GTT>TTT	p.V156F		NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	156	Plastocyanin-like 1.|Extracellular (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				TGATGACATGGTTCCTCCTGG	0.418																0.292683	30.681013	32.260481	12	29	KEEP	---	---	---	---	6	6	16	13	0.5	capture	Missense_Mutation	SNP	93796724	93796724	HEPHL1	11	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	6981	250
PIWIL4	143689	broad.mit.edu	37	11	94335056	94335056	+	Silent	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94335056C>T	uc001pfa.2	+	12	1687	c.1476C>T	c.(1474-1476)AGC>AGT	p.S492S	PIWIL4_uc010rue.1_RNA|PIWIL4_uc009ywk.1_RNA	NM_152431	NP_689644	Q7Z3Z4	PIWL4_HUMAN	piwi-like 4	492					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|meiosis|multicellular organismal development|piRNA metabolic process|regulation of translation|spermatogenesis	nucleus|piP-body	piRNA binding			skin(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTTTATGTAGCGACAGAACTG	0.423																0.338028	272.012183	278.601303	96	188	KEEP	---	---	---	---	57	46	100	95	-1	capture	Silent	SNP	94335056	94335056	PIWIL4	11	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	11863	250
ANO2	57101	broad.mit.edu	37	12	5908716	5908716	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5908716G>A	uc001qnm.2	-	10	1072	c.1000C>T	c.(1000-1002)CGC>TGC	p.R334C		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	339	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						ACTCCATAGCGCGCCCATTCT	0.423																0.269231	37.360637	39.838612	14	38	KEEP	---	---	---	---	8	8	24	20	-1	capture	Missense_Mutation	SNP	5908716	5908716	ANO2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	691	250
VWF	7450	broad.mit.edu	37	12	6128359	6128359	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6128359C>T	uc001qnn.1	-	28	4475	c.4225G>A	c.(4225-4227)GTC>ATC	p.V1409I	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1409	VWFA 1; binding site for platelet glycoprotein Ib.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	ATCACAATGACCTTCTTCTTC	0.607																0.382353	151.188116	152.830966	52	84	KEEP	---	---	---	---	31	27	55	39	-1	capture	Missense_Mutation	SNP	6128359	6128359	VWF	12	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	17128	250
ELK3	2004	broad.mit.edu	37	12	96641080	96641080	+	Silent	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:96641080C>T	uc001teo.1	+	3	849	c.570C>T	c.(568-570)ACC>ACT	p.T190T		NM_005230	NP_005221	P41970	ELK3_HUMAN	ELK3 protein	190					negative regulation of transcription, DNA-dependent|signal transduction	mitochondrion	protein binding|purine-rich negative regulatory element binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	all_cancers(2;0.00173)					CCAATAAAACCGACAAGCACG	0.622																0.358621	160.261315	162.812905	52	93	KEEP	---	---	---	---	31	31	50	55	-1	capture	Silent	SNP	96641080	96641080	ELK3	12	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5015	250
UGGT2	55757	broad.mit.edu	37	13	96648323	96648323	+	Missense_Mutation	SNP	T	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:96648323T>A	uc001vmt.2	-	7	994	c.824A>T	c.(823-825)AAA>ATA	p.K275I	UGGT2_uc010afo.2_RNA|UGGT2_uc001vmv.2_Missense_Mutation_p.K275I|UGGT2_uc010afp.2_Missense_Mutation_p.K275I	NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	275					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						TTACTTTAGTTTCCCAAAGAG	0.313																0.028986	-40.038426	10.484358	6	201	KEEP	---	---	---	---	3	5	118	115	-1	capture	Missense_Mutation	SNP	96648323	96648323	UGGT2	13	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	16824	250
C14orf135	64430	broad.mit.edu	37	14	60582118	60582118	+	Missense_Mutation	SNP	C	G	G			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:60582118C>G	uc001xer.3	+	3	1116	c.594C>G	c.(592-594)TTC>TTG	p.F198L	C14orf135_uc001xeq.2_Missense_Mutation_p.F198L|C14orf135_uc010apm.2_5'Flank	NM_022495	NP_071940	Q63HM2	CN135_HUMAN	hepatitis C virus F protein-binding protein 2	432						integral to membrane				ovary(2)	2		Myeloproliferative disorder(585;0.163)		OV - Ovarian serous cystadenocarcinoma(108;0.127)		TGACTGTATTCTTTGAGAAGC	0.343																0.017794	-64.198191	9.50454	5	276	KEEP	---	---	---	---	2	3	162	135	-1	capture	Missense_Mutation	SNP	60582118	60582118	C14orf135	14	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	1731	250
SLC28A1	9154	broad.mit.edu	37	15	85478399	85478399	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85478399G>A	uc002blg.2	+	14	1559	c.1357G>A	c.(1357-1359)GTG>ATG	p.V453M	SLC28A1_uc010bnb.2_Missense_Mutation_p.V453M|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Missense_Mutation_p.V453M|SLC28A1_uc010upg.1_Missense_Mutation_p.V453M	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1	453					nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GGGAGACATGGTGGACATCCA	0.592																0.407767	120.9279	121.694102	42	61	KEEP	---	---	---	---	29	15	34	31	-1	capture	Missense_Mutation	SNP	85478399	85478399	SLC28A1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	14423	250
MFGE8	4240	broad.mit.edu	37	15	89453040	89453040	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89453040C>T	uc002bng.3	-	2	301	c.188G>A	c.(187-189)GGC>GAC	p.G63D	MFGE8_uc002bnf.3_5'UTR|MFGE8_uc002bnh.3_Missense_Mutation_p.G63D|MFGE8_uc010bnn.2_Missense_Mutation_p.G55D|MFGE8_uc010upq.1_Intron|MFGE8_uc010upr.1_Missense_Mutation_p.G63D|MFGE8_uc010bno.2_Intron	NM_005928	NP_005919	Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein isoform a	63	EGF-like.				angiogenesis|cell adhesion|interspecies interaction between organisms|single fertilization					ovary(1)	1	Lung NSC(78;0.0392)|all_lung(78;0.077)					ACAGTGGTTGCCCGCGTAGCC	0.572																0.02381	-35.735658	6.613744	4	164	KEEP	---	---	---	---	2	2	84	103	-1	capture	Missense_Mutation	SNP	89453040	89453040	MFGE8	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9432	250
APOB48R	55911	broad.mit.edu	37	16	28507386	28507386	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28507386G>A	uc002dqb.1	+	2	1034	c.1024G>A	c.(1024-1026)GGC>AGC	p.G342S	uc010vct.1_Intron|APOB48R_uc010byg.1_5'UTR	NM_018690	NP_061160	Q0VD83	APOBR_HUMAN	apolipoprotein B48 receptor	342	Glu-rich.				cholesterol metabolic process|lipid transport	chylomicron|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle					0						GATAGCCTCAGGCGGGGAGGC	0.721																0.5	19.449855	19.449855	6	6	KEEP	---	---	---	---	4	4	7	3	-1	capture	Missense_Mutation	SNP	28507386	28507386	APOB48R	16	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	779	250
ALDOA	226	broad.mit.edu	37	16	30080984	30080984	+	Silent	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30080984C>T	uc002dvw.2	+	10	1917	c.789C>T	c.(787-789)CCC>CCT	p.P263P	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|ALDOA_uc002dvx.2_Silent_p.P263P|ALDOA_uc002dvy.2_Silent_p.P263P|ALDOA_uc002dvz.2_Silent_p.P263P|ALDOA_uc002dwa.3_Silent_p.P263P|ALDOA_uc002dwb.1_Silent_p.P263P|ALDOA_uc002dwc.2_Silent_p.P263P|ALDOA_uc010veg.1_Silent_p.P317P|ALDOA_uc002dwd.2_Silent_p.P267P	NM_184043	NP_908932	P04075	ALDOA_HUMAN	fructose-bisphosphate aldolase A	263					actin filament organization|ATP biosynthetic process|fructose 1,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|muscle cell homeostasis|platelet activation|platelet degranulation|protein homotetramerization|regulation of cell shape|striated muscle contraction	actin cytoskeleton|cytosol|extracellular vesicular exosome|I band|platelet alpha granule lumen	actin binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding|tubulin binding			lung(1)	1						CAGTGCCCCCCGCTGTCACTG	0.562																0.351852	55.000536	56.04929	19	35	KEEP	---	---	---	---	6	13	15	23	-1	capture	Silent	SNP	30080984	30080984	ALDOA	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	507	250
ABR	29	broad.mit.edu	37	17	914060	914060	+	Silent	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:914060G>A	uc002fsd.2	-	20	2255	c.2145C>T	c.(2143-2145)AAC>AAT	p.N715N	ABR_uc002fse.2_Silent_p.N669N|ABR_uc010vqf.1_Silent_p.N166N|ABR_uc010vqg.1_Silent_p.N497N|ABR_uc002fsg.2_Silent_p.N678N|ABR_uc002fsh.1_Silent_p.N323N|ABR_uc002fsf.2_Silent_p.N252N	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related	715	Rho-GAP.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CGGCGATGGCGTTGATGTCCA	0.637	Esophageal Squamous(197;2016 2115 4129 29033 46447)															0.266234	104.314589	111.911896	41	113	KEEP	---	---	---	---	22	22	59	65	-1	capture	Silent	SNP	914060	914060	ABR	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	99	250
MNT	4335	broad.mit.edu	37	17	2290511	2290511	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:2290511G>A	uc002fur.2	-	6	1685	c.1433C>T	c.(1432-1434)GCG>GTG	p.A478V		NM_020310	NP_064706	Q99583	MNT_HUMAN	MAX binding protein	478					multicellular organismal development|negative regulation of cell proliferation|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			skin(1)	1				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		CAGTTGCACCGCAGGGCTGGG	0.667																0.5	9.124593	9.124593	3	3	KEEP	---	---	---	---	2	1	3	2	-1	capture	Missense_Mutation	SNP	2290511	2290511	MNT	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9590	250
KCNJ12	3768	broad.mit.edu	37	17	21319073	21319073	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21319073C>T	uc002gyv.1	+	3	1124	c.419C>T	c.(418-420)ACG>ATG	p.T140M		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	140					blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	TCCATCGAGACGCAGACCACC	0.667													Prostate(3;0.18)			0.236842	20.357381	22.762048	9	29	KEEP	---	---	---	---	4	9	23	26	-1	capture	Missense_Mutation	SNP	21319073	21319073	KCNJ12	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7968	250
COL1A1	1277	broad.mit.edu	37	17	48268238	48268238	+	Silent	SNP	G	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48268238G>T	uc002iqm.2	-	33	2409	c.2283C>A	c.(2281-2283)GGC>GGA	p.G761G		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	761	Triple-helical region.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	GACCACGGACGCCATCTTTGC	0.587					504	T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						0.414286	88.052611	88.503801	29	41	KEEP	---	---	---	---	16	20	20	28	0.444444444444	capture	Silent	SNP	48268238	48268238	COL1A1	17	G	T	T	T	1	0	0	0	0	0	0	0	1	483	38	4	4	3642	250
GPR142	350383	broad.mit.edu	37	17	72367987	72367987	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72367987G>A	uc010wqy.1	+	4	637	c.637G>A	c.(637-639)GCG>ACG	p.A213T	GPR142_uc010wqx.1_Missense_Mutation_p.A125T	NM_181790	NP_861455	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	213	Helical; Name=2; (Potential).					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CATCGTGTTCGCGGGCTTCCT	0.652																0.369565	45.168943	45.853921	17	29	KEEP	---	---	---	---	10	10	17	18	-1	capture	Missense_Mutation	SNP	72367987	72367987	GPR142	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6584	250
MCART2	147407	broad.mit.edu	37	18	29339972	29339972	+	Missense_Mutation	SNP	C	G	G			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29339972C>G	uc002kxa.2	-	1	872	c.653G>C	c.(652-654)GGA>GCA	p.G218A		NM_001034172	NP_001029344	Q3SY17	MCAR2_HUMAN	mitochondrial carrier triple repeat 2	218	Helical; Name=5; (Potential).|Solcar 3.				transport	integral to membrane|mitochondrial inner membrane				skin(1)	1			OV - Ovarian serous cystadenocarcinoma(10;0.0539)			CAATAGACCTCCACCGATAAA	0.458																0.035088	-17.188703	9.585819	4	110	KEEP	---	---	---	---	3	1	65	58	-1	capture	Missense_Mutation	SNP	29339972	29339972	MCART2	18	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	9283	250
SLC14A2	8170	broad.mit.edu	37	18	43205722	43205722	+	Silent	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:43205722C>T	uc010dnj.2	+	4	546	c.225C>T	c.(223-225)GAC>GAT	p.D75D	SLC14A2_uc002lbb.2_Silent_p.D75D|SLC14A2_uc002lbe.2_Silent_p.D75D	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	75						apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						AAAGGAAAGACGACGGGGTGG	0.517																0.32	42.180119	43.620742	16	34	KEEP	---	---	---	---	8	8	27	10	-1	capture	Silent	SNP	43205722	43205722	SLC14A2	18	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14290	250
DUS3L	56931	broad.mit.edu	37	19	5785666	5785666	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5785666C>T	uc002mdc.2	-	11	1796	c.1699G>A	c.(1699-1701)GGC>AGC	p.G567S	PRR22_uc002mdb.1_5'Flank|PRR22_uc010xiv.1_5'Flank|DUS3L_uc002mdd.2_Missense_Mutation_p.G325S|DUS3L_uc010duk.2_Missense_Mutation_p.G232S	NM_020175	NP_064560	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like isoform 1	567					tRNA processing		flavin adenine dinucleotide binding|nucleic acid binding|tRNA dihydrouridine synthase activity|zinc ion binding				0						TTCTCCACGCCCTGCGTGTCC	0.706																0.333333	41.271022	42.287386	14	28	KEEP	---	---	---	---	9	12	15	23	-1	capture	Missense_Mutation	SNP	5785666	5785666	DUS3L	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	4762	250
CD209	30835	broad.mit.edu	37	19	7809880	7809880	+	Missense_Mutation	SNP	C	T	T	rs139712001	byFrequency	TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7809880C>T	uc002mht.2	-	5	914	c.847G>A	c.(847-849)GCC>ACC	p.A283T	CD209_uc010xju.1_Missense_Mutation_p.A122T|CD209_uc010dvp.2_Missense_Mutation_p.A259T|CD209_uc002mhr.2_Missense_Mutation_p.A259T|CD209_uc002mhs.2_Missense_Mutation_p.A213T|CD209_uc002mhu.2_Missense_Mutation_p.A191T|CD209_uc010dvq.2_Missense_Mutation_p.A283T|CD209_uc002mhq.2_Missense_Mutation_p.A283T|CD209_uc002mhv.2_Missense_Mutation_p.A259T|CD209_uc002mhx.2_Missense_Mutation_p.A239T|CD209_uc002mhw.2_Missense_Mutation_p.A147T|CD209_uc010dvr.2_Intron	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	283	Extracellular (Probable).|C-type lectin.				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						TCTTTGCAGGCGGTGATGGAG	0.582																0.27027	72.269166	77.581647	30	81	KEEP	---	---	---	---	15	17	44	52	-1	capture	Missense_Mutation	SNP	7809880	7809880	CD209	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2955	250
ARMC6	93436	broad.mit.edu	37	19	19166113	19166113	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19166113G>T	uc002nld.2	+	7	1411	c.1063G>T	c.(1063-1065)GCA>TCA	p.A355S	ARMC6_uc002nlc.2_Missense_Mutation_p.A330S|ARMC6_uc010xql.1_Missense_Mutation_p.A262S|ARMC6_uc002nle.2_Missense_Mutation_p.A330S|ARMC6_uc010xqm.1_Missense_Mutation_p.A355S	NM_033415	NP_219483	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6	355	ARM 3.						protein binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)			GCGAGCCATCGCAGGCAACGA	0.627																0.206349	64.883867	74.951807	26	100	KEEP	---	---	---	---	13	18	58	57	0.41935483871	capture	Missense_Mutation	SNP	19166113	19166113	ARMC6	19	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	948	250
PSG8	440533	broad.mit.edu	37	19	43259170	43259170	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43259170G>A	uc002ouo.2	-	4	1056	c.958C>T	c.(958-960)CGC>TGC	p.R320C	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_Intron|PSG8_uc002oui.2_Missense_Mutation_p.R159C|PSG8_uc002ouh.2_Missense_Mutation_p.R320C|PSG8_uc010ein.2_Missense_Mutation_p.R198C|PSG8_uc002ouj.3_Missense_Mutation_p.R102C|PSG8_uc002ouk.3_Missense_Mutation_p.R159C|PSG8_uc002oul.3_Missense_Mutation_p.R320C|PSG8_uc002oum.3_Missense_Mutation_p.R227C|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Missense_Mutation_p.R227C	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	320	Ig-like C2-type 2.					extracellular region					0		Prostate(69;0.00899)				GGGTAACTGCGGATGCCACCA	0.483																0.446078	283.702142	284.218107	91	113	KEEP	---	---	---	---	49	49	80	62	-1	capture	Missense_Mutation	SNP	43259170	43259170	PSG8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12556	250
FAM71E1	112703	broad.mit.edu	37	19	50978584	50978584	+	Silent	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50978584G>A	uc002psh.2	-	3	895	c.537C>T	c.(535-537)TTC>TTT	p.F179F	FAM71E1_uc002psg.2_Silent_p.F163F|FAM71E1_uc002psi.2_RNA|C19orf63_uc002psj.2_5'Flank|C19orf63_uc002psk.2_5'Flank|C19orf63_uc002psl.2_5'Flank	NM_138411	NP_612420	Q6IPT2	F71E1_HUMAN	hypothetical protein LOC112703	179										breast(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.0077)|GBM - Glioblastoma multiforme(134;0.026)		GCAGTTACCCGAAGAGTTGCA	0.672																0.225806	15.612376	17.750957	7	24	KEEP	---	---	---	---	3	6	21	9	-1	capture	Silent	SNP	50978584	50978584	FAM71E1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	5559	250
SRBD1	55133	broad.mit.edu	37	2	45773870	45773870	+	Splice_Site	SNP	C	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:45773870C>A	uc002rus.2	-	14	1950	c.1874_splice	c.e14+1	p.C625_splice	SRBD1_uc010yoc.1_Splice_Site_p.C144_splice	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			AATAGCCTTACCAGTAAACAA	0.378																0.4	131.480886	132.355377	40	60	KEEP	---	---	---	---	15	25	35	28	0.625	capture	Splice_Site	SNP	45773870	45773870	SRBD1	2	C	A	A	A	1	0	0	0	0	0	0	1	0	234	18	5	4	15025	250
CRYGD	1421	broad.mit.edu	37	2	208986472	208986472	+	Missense_Mutation	SNP	G	C	C			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:208986472G>C	uc002vcn.3	-	3	566	c.450C>G	c.(448-450)GAC>GAG	p.D150E		NM_006891	NP_008822	P07320	CRGD_HUMAN	crystallin, gamma D	150	Beta/gamma crystallin 'Greek key' 4.				cellular response to reactive oxygen species|visual perception	soluble fraction	protein binding|structural constituent of eye lens				0				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		AGCGCCTATAGTCCCCTGGCA	0.542																0.252033	92.67594	99.537949	31	92	KEEP	---	---	---	---	17	16	51	45	-1	capture	Missense_Mutation	SNP	208986472	208986472	CRYGD	2	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	3882	250
JAG1	182	broad.mit.edu	37	20	10653470	10653470	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:10653470C>T	uc002wnw.2	-	2	782	c.266G>A	c.(265-267)GGG>GAG	p.G89E		NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor	89	Extracellular (Potential).				angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						GCAGGGCCCCCCGGCCGTGAC	0.667					587							Alagille_Syndrome				0.284483	86.539249	91.369134	33	83	KEEP	---	---	---	---	20	19	48	44	-1	capture	Missense_Mutation	SNP	10653470	10653470	JAG1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7857	250
MACROD2	140733	broad.mit.edu	37	20	15210608	15210608	+	Silent	SNP	A	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:15210608A>T	uc002wou.2	+	6	705	c.441A>T	c.(439-441)CCA>CCT	p.P147P	MACROD2_uc002wot.2_Silent_p.P147P|MACROD2_uc002woz.2_5'UTR	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1	147	Macro.										0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CTGTAGGGCCAATAGCCAGGG	0.353																0.041958	-20.474879	11.75988	6	137	KEEP	---	---	---	---	6	3	80	71	-1	capture	Silent	SNP	15210608	15210608	MACROD2	20	A	T	T	T	1	0	0	0	0	0	0	0	1	54	5	4	4	9061	250
C22orf43	51233	broad.mit.edu	37	22	23974205	23974205	+	Silent	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:23974205C>T	uc002zxf.2	-	1	283	c.6G>A	c.(4-6)GGG>GGA	p.G2G		NM_016449	NP_057533	Q6PGQ1	CV043_HUMAN	hypothetical protein LOC51233	2										skin(1)	1						TCAGTATATTCCCCATGGGGC	0.547																0.410256	90.576946	91.12485	32	46	KEEP	---	---	---	---	20	21	29	27	-1	capture	Silent	SNP	23974205	23974205	C22orf43	22	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	2130	250
CHEK2	11200	broad.mit.edu	37	22	29091840	29091841	+	Missense_Mutation	DNP	TG	CA	CA	rs142470496;rs146546850	byFrequency;byFrequency	TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29091840_29091841TG>CA	uc003adu.1	-	11	1188_1189	c.1116_1117CA>TG	c.(1114-1119)TCCAAG>TCTGAG	p.K373E	CHEK2_uc003ads.1_Missense_Mutation_p.K152E|CHEK2_uc010gvh.1_Missense_Mutation_p.K282E|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.K416E|CHEK2_uc003adv.1_Missense_Mutation_p.K344E|CHEK2_uc003adw.1_Missense_Mutation_p.K373E|CHEK2_uc003adx.1_Missense_Mutation_p.K152E|CHEK2_uc003ady.1_Missense_Mutation_p.K373E|CHEK2_uc003adz.1_Missense_Mutation_p.K177E	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	373	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.K373E(2)|p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCCAAAATCTTGGAGTGCCCAA	0.416					268	F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				0.03	-17.365066	6.88463	3	97	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	29091840	29091841	CHEK2	22	TG	CA	CA	CA	1	0	0	0	0	1	0	0	0	819	63	3	3	3301	250
SF3A1	10291	broad.mit.edu	37	22	30738319	30738319	+	Nonsense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30738319C>T	uc003ahl.2	-	6	879	c.747G>A	c.(745-747)TGG>TGA	p.W249*		NM_005877	NP_005868	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa isoform 1	249					nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding			ovary(3)|large_intestine(1)|pancreas(1)	5						GGAATTTGGCCCATTCCACTC	0.458																0.464286	39.270257	39.301551	13	15	KEEP	---	---	---	---	10	3	9	6	-1	capture	Nonsense_Mutation	SNP	30738319	30738319	SF3A1	22	C	T	T	T	1	0	0	0	0	0	1	0	0	286	22	5	2	14039	250
FAM118A	55007	broad.mit.edu	37	22	45723798	45723798	+	Missense_Mutation	SNP	C	T	T	rs140683394		TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:45723798C>T	uc003bfz.3	+	5	992	c.376C>T	c.(376-378)CGG>TGG	p.R126W	FAM118A_uc003bga.3_Missense_Mutation_p.R126W|uc011aqp.1_5'Flank|uc011aqq.1_5'Flank|FAM118A_uc011aqr.1_5'Flank	NM_001104595	NP_001098065	Q9NWS6	F118A_HUMAN	hypothetical protein LOC55007	126						integral to membrane					0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		GCAGCACATCCGGAGTCCTGT	0.592				p.R126W(ISTMES1-Tumor)	952											0.393443	73.489756	74.095141	24	37	KEEP	---	---	---	---	12	16	25	15	-1	capture	Missense_Mutation	SNP	45723798	45723798	FAM118A	22	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	5365	250
CCR4	1233	broad.mit.edu	37	3	32995888	32995888	+	Missense_Mutation	SNP	T	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:32995888T>A	uc003cfg.1	+	2	1142	c.974T>A	c.(973-975)CTT>CAT	p.L325H		NM_005508	NP_005499	P51679	CCR4_HUMAN	chemokine (C-C motif) receptor 4	325	Cytoplasmic (Potential).				chemotaxis|elevation of cytosolic calcium ion concentration|immune response|inflammatory response	integral to plasma membrane				lung(1)	1						TGCAGGGGCCTTTTTGTGCTC	0.478					38											0.416667	140.78857	141.524412	50	70	KEEP	---	---	---	---	19	34	33	49	-1	capture	Missense_Mutation	SNP	32995888	32995888	CCR4	3	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	2914	250
DCP1A	55802	broad.mit.edu	37	3	53376299	53376299	+	Splice_Site	SNP	C	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53376299C>A	uc003dgs.3	-	3	270	c.177_splice	c.e3-1	p.R59_splice	DCP1A_uc003dgt.3_Splice_Site	NM_018403	NP_060873	Q9NPI6	DCP1A_HUMAN	DCP1 decapping enzyme homolog A						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus	hydrolase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		GGAAGCTGACCTTAGATTTAA	0.294																0.363636	22.892915	23.253299	8	14	KEEP	---	---	---	---	4	6	8	9	0.6	capture	Splice_Site	SNP	53376299	53376299	DCP1A	3	C	A	A	A	1	0	0	0	0	0	0	1	0	312	24	5	4	4257	250
CD96	10225	broad.mit.edu	37	3	111356983	111356983	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111356983G>A	uc003dxw.2	+	13	1663	c.1493G>A	c.(1492-1494)GGA>GAA	p.G498E	CD96_uc003dxx.2_Missense_Mutation_p.G482E|CD96_uc010hpy.1_Missense_Mutation_p.G481E	NM_198196	NP_937839	P40200	TACT_HUMAN	CD96 antigen isoform 1 precursor	498	Extracellular (Potential).|Pro/Ser/Thr-rich.				cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3						ACTGCCAATGGATCTACGAAA	0.348												Opitz_Trigonocephaly_syndrome				0.345455	168.222016	171.703412	57	108	KEEP	---	---	---	---	29	45	59	87	-1	capture	Missense_Mutation	SNP	111356983	111356983	CD96	3	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	3019	250
HPS3	84343	broad.mit.edu	37	3	148857895	148857895	+	Missense_Mutation	SNP	A	C	C			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148857895A>C	uc003ewu.1	+	2	462	c.322A>C	c.(322-324)ATG>CTG	p.M108L	HPS3_uc003ewt.1_Missense_Mutation_p.M108L|HPS3_uc011bnq.1_Intron	NM_032383	NP_115759	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3 protein	108						cytoplasm				ovary(5)|large_intestine(1)	6			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GTGTATCCGAATGATTGGGCA	0.423												Hermansky-Pudlak_syndrome				0.341969	222.191938	226.450653	66	127	KEEP	---	---	---	---	26	48	73	68	-1	capture	Missense_Mutation	SNP	148857895	148857895	HPS3	3	A	C	C	C	1	0	0	0	0	1	0	0	0	52	4	4	4	7265	250
CPN2	1370	broad.mit.edu	37	3	194062087	194062087	+	Missense_Mutation	SNP	G	A	A	rs142681810		TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:194062087G>A	uc003fts.2	-	2	1435	c.1345C>T	c.(1345-1347)CGG>TGG	p.R449W		NM_001080513	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	449					protein stabilization	extracellular region	enzyme regulator activity			ovary(5)	5	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		AAGTGGTCCCGGGTGACGGGA	0.647																0.375839	171.363986	173.379463	56	93	KEEP	---	---	---	---	33	34	56	58	-1	capture	Missense_Mutation	SNP	194062087	194062087	CPN2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	3775	250
TLR1	7096	broad.mit.edu	37	4	38798601	38798601	+	Nonsense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:38798601G>A	uc003gtl.2	-	4	2126	c.1852C>T	c.(1852-1854)CAG>TAG	p.Q618*		NM_003263	NP_003254	Q15399	TLR1_HUMAN	toll-like receptor 1 precursor	618	Cytoplasmic (Potential).				cellular response to triacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|inflammatory response|innate immune response|macrophage activation|positive regulation of interleukin-6 biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	integral to plasma membrane|phagocytic vesicle membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	protein heterodimerization activity|transmembrane receptor activity			lung(2)|skin(2)|prostate(1)	5						CGCCGGGTCTGGGTCCACTGG	0.522	GBM(5;216 373 40795 46382)															0.378531	199.573515	201.868037	67	110	KEEP	---	---	---	---	42	33	63	65	-1	capture	Nonsense_Mutation	SNP	38798601	38798601	TLR1	4	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	15834	250
CCDC158	339965	broad.mit.edu	37	4	77288529	77288529	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77288529C>T	uc003hkb.3	-	11	1901	c.1748G>A	c.(1747-1749)CGA>CAA	p.R583Q		NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	583	Potential.									skin(3)|ovary(2)|pancreas(1)	6						TCCAGCAGTTCGTCCATGCTG	0.458																0.407895	187.425345	188.550806	62	90	KEEP	---	---	---	---	39	23	45	46	-1	capture	Missense_Mutation	SNP	77288529	77288529	CCDC158	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2764	250
PPA2	27068	broad.mit.edu	37	4	106317427	106317427	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:106317427C>T	uc003hxl.2	-	9	868	c.848G>A	c.(847-849)TGT>TAT	p.C283Y	PPA2_uc003hxm.2_Missense_Mutation_p.C265Y|PPA2_uc003hxn.2_Missense_Mutation_p.C254Y|PPA2_uc003hxo.2_Missense_Mutation_p.C181Y|PPA2_uc003hxp.2_Missense_Mutation_p.C117Y|PPA2_uc003hxq.2_Missense_Mutation_p.C190Y|PPA2_uc003hxr.2_Missense_Mutation_p.C190Y	NM_176869	NP_789845	Q9H2U2	IPYR2_HUMAN	inorganic pyrophosphatase 2 isoform 1 precursor	283					diphosphate metabolic process|tRNA aminoacylation for protein translation	mitochondrial matrix	inorganic diphosphatase activity|magnesium ion binding			pancreas(1)	1		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)		TCCTCCATTACACTTCTTCAT	0.294																0.363158	196.314982	199.448958	69	121	KEEP	---	---	---	---	40	35	65	69	-1	capture	Missense_Mutation	SNP	106317427	106317427	PPA2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	12188	250
FNIP1	96459	broad.mit.edu	37	5	131039794	131039794	+	Silent	SNP	T	C	C			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131039794T>C	uc003kvs.1	-	10	1222	c.1080A>G	c.(1078-1080)GAA>GAG	p.E360E	RAPGEF6_uc003kvp.1_Intron|FNIP1_uc003kvt.1_Silent_p.E332E|FNIP1_uc010jdm.1_Silent_p.E315E|FNIP1_uc003kvu.2_Silent_p.E360E	NM_133372	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1 isoform 1	360					regulation of protein phosphorylation	cytoplasm	protein binding			pancreas(1)|skin(1)	2		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		TCATGTGGCTTTCAAAGAGAG	0.269																0.036145	-12.849672	6.531012	3	80	KEEP	---	---	---	---	1	3	51	36	-1	capture	Silent	SNP	131039794	131039794	FNIP1	5	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	5919	250
PCDHGA7	56108	broad.mit.edu	37	5	140763059	140763059	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140763059G>A	uc003lka.1	+	1	593	c.593G>A	c.(592-594)CGG>CAG	p.R198Q	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003ljz.1_Missense_Mutation_p.R198Q	NM_018920	NP_061743	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7 isoform 1	198	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCTGGAGCGGGTGCTGGAC	0.622																0.387097	36.494062	36.83994	12	19	KEEP	---	---	---	---	5	9	12	11	-1	capture	Missense_Mutation	SNP	140763059	140763059	PCDHGA7	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11462	250
HLA-E	3133	broad.mit.edu	37	6	30458930	30458930	+	Silent	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30458930C>T	uc003nqg.2	+	4	665	c.627C>T	c.(625-627)CAC>CAT	p.H209H	HLA-E_uc011dmg.1_RNA|HLA-E_uc011dmh.1_Silent_p.H250H	NM_005516	NP_005507	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	209	Ig-like C1-type.|Alpha-3.|Extracellular (Potential).				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			central_nervous_system(4)|ovary(1)	5						CAAAGACACACGTGACTCACC	0.582																0.380488	225.304483	227.871283	78	127	KEEP	---	---	---	---	55	40	64	81	-1	capture	Silent	SNP	30458930	30458930	HLA-E	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7135	250
DST	667	broad.mit.edu	37	6	56357035	56357035	+	Missense_Mutation	SNP	C	G	G			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56357035C>G	uc003pdf.2	-	79	14418	c.14390G>C	c.(14389-14391)AGA>ACA	p.R4797T	DST_uc003pcz.3_Missense_Mutation_p.R4619T|DST_uc011dxj.1_Missense_Mutation_p.R4648T|DST_uc011dxk.1_Missense_Mutation_p.R4659T|DST_uc003pcy.3_Missense_Mutation_p.R4293T|DST_uc003pda.3_5'UTR	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	6705	Spectrin 18.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTGCTTGGCTCTCTTCCTTGC	0.373					2498											0.402062	142.708503	143.521526	39	58	KEEP	---	---	---	---	22	22	29	33	-1	capture	Missense_Mutation	SNP	56357035	56357035	DST	6	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	4738	250
COL19A1	1310	broad.mit.edu	37	6	70878104	70878104	+	Silent	SNP	T	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:70878104T>A	uc003pfc.1	+	39	2655	c.2538T>A	c.(2536-2538)CCT>CCA	p.P846P		NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	846	Triple-helical region 5 (COL5).				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						CACCCGGTCCTCCTGTAAGTA	0.328																0.428571	98.861102	99.204101	33	44	KEEP	---	---	---	---	22	16	20	30	-1	capture	Silent	SNP	70878104	70878104	COL19A1	6	T	A	A	A	1	0	0	0	0	0	0	0	1	691	54	4	4	3641	250
C6orf182	285753	broad.mit.edu	37	6	109481832	109481832	+	Silent	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:109481832C>T	uc010kdk.2	+	12	1651	c.1074C>T	c.(1072-1074)GAC>GAT	p.D358D	C6orf182_uc003psx.3_Silent_p.D358D|C6orf182_uc010kdl.2_Silent_p.D358D|C6orf182_uc003psy.3_Silent_p.D358D	NM_001083535	NP_001077004	Q8IYX8	CE57L_HUMAN	hypothetical protein LOC285753	358	Potential.					microtubule|microtubule organizing center					0		all_cancers(87;4.45e-07)|Acute lymphoblastic leukemia(125;2.15e-10)|all_hematologic(75;3.25e-08)|all_epithelial(87;0.000254)|Colorectal(196;0.0293)|all_lung(197;0.11)		BRCA - Breast invasive adenocarcinoma(108;0.00123)|Epithelial(106;0.0022)|all cancers(137;0.00405)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)		CAGTCTGTGACGACATAGAAT	0.343																0.568627	185.463136	185.882397	58	44	KEEP	---	---	---	---	38	23	23	24	-1	capture	Silent	SNP	109481832	109481832	C6orf182	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2323	250
TBP	6908	broad.mit.edu	37	6	170878836	170878836	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:170878836G>T	uc003qxt.2	+	6	1046	c.814G>T	c.(814-816)GGC>TGC	p.G272C	TBP_uc003qxu.2_Missense_Mutation_p.G272C|TBP_uc011ehf.1_Missense_Mutation_p.G252C	NM_003194	NP_003185	P20226	TBP_HUMAN	TATA box binding protein	272	2.				cell death|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription from RNA polymerase III promoter|viral reproduction	transcription factor TFIIA complex|transcription factor TFIID complex	repressing transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		AAGGTTAGAAGGCCTTGTGCT	0.368																0.267606	49.189759	52.654466	19	52	KEEP	---	---	---	---	8	11	29	30	0.421052631579	capture	Missense_Mutation	SNP	170878836	170878836	TBP	6	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	15531	250
C7orf65	401335	broad.mit.edu	37	7	47698751	47698751	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:47698751G>T	uc010kyp.1	+	3	416	c.381G>T	c.(379-381)AAG>AAT	p.K127N		NM_001123065	NP_001116537	Q6ZTY9	CG065_HUMAN	hypothetical protein LOC401335	127											0						ACCCCTGGAAGGATGCTCAGG	0.552																0.172897	74.3334	95.96728	37	177	KEEP	---	---	---	---	22	18	101	94	0.55	capture	Missense_Mutation	SNP	47698751	47698751	C7orf65	7	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	2388	250
PPP1R3A	5506	broad.mit.edu	37	7	113558904	113558904	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:113558904C>T	uc010ljy.1	-	1	179	c.148G>A	c.(148-150)GAA>AAA	p.E50K		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	50					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						TATATGTCTTCAGAAGAATCA	0.388					235											0.184906	100.002417	124.689442	49	216	KEEP	---	---	---	---	31	21	94	136	-1	capture	Missense_Mutation	SNP	113558904	113558904	PPP1R3A	7	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	12272	250
ANKRD7	56311	broad.mit.edu	37	7	117864828	117864828	+	Translation_Start_Site	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117864828C>T	uc003vji.2	+	1	117	c.-56C>T	c.(-58--54)GACGG>GATGG			NM_019644	NP_062618	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7						male gonad development						0						GCAGGGCGGACGGCTAGGAGT	0.602																0.222222	42.04819	48.441262	20	70	KEEP	---	---	---	---	10	10	37	37	-1	capture	Translation_Start_Site	SNP	117864828	117864828	ANKRD7	7	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	681	250
TBXAS1	6916	broad.mit.edu	37	7	139655361	139655361	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139655361C>T	uc011kqv.1	+	8	948	c.784C>T	c.(784-786)CGT>TGT	p.R262C	TBXAS1_uc003vvh.2_Missense_Mutation_p.R216C|TBXAS1_uc010lne.2_Missense_Mutation_p.R148C|TBXAS1_uc011kqu.1_Missense_Mutation_p.R167C|TBXAS1_uc003vvi.2_Missense_Mutation_p.R216C|TBXAS1_uc003vvj.2_Missense_Mutation_p.R216C|TBXAS1_uc011kqw.1_Missense_Mutation_p.R196C	NM_001130966	NP_001124438	P24557	THAS_HUMAN	thromboxane A synthase 1, platelet isoform	215	Cytoplasmic (Potential).				hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)					ACACTGCAAGCGTTTCTTCGA	0.577																0.186992	93.100069	115.68508	46	200	KEEP	---	---	---	---	30	19	109	111	-1	capture	Missense_Mutation	SNP	139655361	139655361	TBXAS1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15551	250
TACC1	6867	broad.mit.edu	37	8	38677275	38677275	+	Silent	SNP	T	C	C			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:38677275T>C	uc010lwp.2	+	3	892	c.513T>C	c.(511-513)GCT>GCC	p.A171A	TACC1_uc011lby.1_5'UTR|TACC1_uc003xma.2_Intron|TACC1_uc003xlz.2_5'UTR|TACC1_uc003xmc.3_5'UTR|TACC1_uc011lbz.1_Silent_p.A187A|TACC1_uc003xmb.3_Silent_p.A126A|TACC1_uc003xme.1_Intron|TACC1_uc003xmd.1_Intron|TACC1_uc010lwo.1_Intron|TACC1_uc003xmf.3_Intron|TACC1_uc011lca.1_Silent_p.A171A|TACC1_uc011lcb.1_5'UTR|TACC1_uc011lcc.1_5'UTR|TACC1_uc011lcd.1_RNA|TACC1_uc003xmh.3_5'UTR|TACC1_uc010lwq.2_5'UTR	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing	171	Interaction with TDRD7.				cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			CAAAAGCAGCTCATGGCTGTG	0.532																0.019417	-44.784017	8.646564	4	202	KEEP	---	---	---	---	2	2	125	130	-1	capture	Silent	SNP	38677275	38677275	TACC1	8	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	15389	250
KANK1	23189	broad.mit.edu	37	9	732407	732407	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:732407G>T	uc003zgl.1	+	10	3684	c.3035G>T	c.(3034-3036)AGC>ATC	p.S1012I	KANK1_uc003zgm.2_3'UTR|KANK1_uc003zgn.1_Missense_Mutation_p.S1012I|KANK1_uc003zgs.1_Missense_Mutation_p.S854I|KANK1_uc010mgx.1_5'UTR|KANK1_uc010mgy.1_5'UTR|KANK1_uc003zgt.1_5'Flank	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a	1012					negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		GATGATTCCAGCTCAGATGAA	0.458																0.310345	97.350712	101.071055	36	80	KEEP	---	---	---	---	18	22	41	41	0.45	capture	Missense_Mutation	SNP	732407	732407	KANK1	9	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	7899	250
STXBP1	6812	broad.mit.edu	37	9	130444743	130444743	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130444743C>T	uc004brl.2	+	18	1803	c.1606C>T	c.(1606-1608)CGC>TGC	p.R536C	STXBP1_uc004brk.2_Missense_Mutation_p.R536C	NM_001032221	NP_001027392	P61764	STXB1_HUMAN	syntaxin binding protein 1 isoform b	536					axon target recognition|energy reserve metabolic process|glutamate secretion|negative regulation of synaptic transmission, GABAergic|neurotransmitter secretion|platelet aggregation|platelet degranulation|protein transport|regulation of insulin secretion|regulation of synaptic vesicle priming|synaptic vesicle maturation|vesicle docking involved in exocytosis	cytosol|mitochondrion|plasma membrane|platelet alpha granule|protein complex	identical protein binding|syntaxin-1 binding|syntaxin-2 binding			skin(1)	1						CAGTGGCCCCCGCCTCATCAT	0.562																0.030612	-17.26313	6.409649	3	95	KEEP	---	---	---	---	3	0	69	57	-1	capture	Missense_Mutation	SNP	130444743	130444743	STXBP1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15242	250
MAP2K1	5604	broad.mit.edu	37	15	66679706	66679706	+	Frame_Shift_Del	DEL	G	-	-			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:66679706delG	uc010bhq.2	+	1	496	c.21delG	c.(19-21)ACGfs	p.T7fs		NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	7					activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						AGAAGCCGACGCCCATCCAGC	0.697					667							Cardiofaciocutaneous_syndrome				0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	66679706	66679706	MAP2K1	15	G	-	-	-	1	0	1	0	1	0	0	0	0	483	38	5	5	9150	250
KIAA0182	23199	broad.mit.edu	37	16	85701868	85701868	+	Frame_Shift_Del	DEL	C	-	-			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:85701868delC	uc002fix.2	+	14	3327	c.3253delC	c.(3253-3255)CCCfs	p.P1085fs	KIAA0182_uc002fiw.2_Frame_Shift_Del_p.P981fs|KIAA0182_uc002fiy.2_Frame_Shift_Del_p.P1012fs|KIAA0182_uc002fiz.2_Frame_Shift_Del_p.P227fs|KIAA0182_uc010cho.2_Frame_Shift_Del_p.P265fs	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1	1085							protein binding			large_intestine(3)|ovary(1)|skin(1)	5						GCAGCAGGAGCCCCCCACTGC	0.483																0.35			56	103		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	85701868	85701868	KIAA0182	16	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	8081	250
GCC2	9648	broad.mit.edu	37	2	109087883	109087884	+	Frame_Shift_Ins	INS	-	A	A			TCGA-41-2571-01	TCGA-41-2571-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:109087883_109087884insA	uc002tec.2	+	6	2252_2253	c.2098_2099insA	c.(2098-2100)GAAfs	p.E700fs	GCC2_uc002ted.2_Frame_Shift_Ins_p.E599fs	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	700	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						ACTCAGTTCAGAAAAAAAACAG	0.307																0.02			7	374		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	109087883	109087884	GCC2	2	-	A	A	A	1	0	1	1	0	0	0	0	0	429	33	5	5	6226	250
