Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MEGF6	1953	broad.mit.edu	37	1	3412515	3412515	+	Silent	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3412515G>A	uc001akl.2	-	30	4037	c.3810C>T	c.(3808-3810)TGC>TGT	p.C1270C	MEGF6_uc001akk.2_Silent_p.C1035C	NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor	1270	EGF-like 23.					extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		TCACAGGGTCGCAGGCCGCCC	0.706	Ovarian(73;978 3658)															0.461538	17.148077	17.164877	6	7	KEEP	---	---	---	---	4	3	1	6	-1	capture	Silent	SNP	3412515	3412515	MEGF6	1	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	9375	255
KIAA0467	23334	broad.mit.edu	37	1	43909459	43909459	+	Silent	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43909459C>T	uc001cjk.1	+	47	6582	c.6120C>T	c.(6118-6120)CCC>CCT	p.P2040P	KIAA0467_uc001cjl.1_5'Flank	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	2939						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CCCCCTCACCCGCCCGCAGGT	0.572																0.285714	185.047918	195.085357	70	175	KEEP	---	---	---	---	49	34	91	109	-1	capture	Silent	SNP	43909459	43909459	KIAA0467	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8100	255
BARHL2	343472	broad.mit.edu	37	1	91182336	91182336	+	Silent	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91182336C>T	uc001dns.2	-	1	459	c.417G>A	c.(415-417)ACG>ACA	p.T139T		NM_020063	NP_064447	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	139						nucleus	sequence-specific DNA binding			ovary(1)	1		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		AAAAAGAAGACGTGGAAGTCC	0.512	GBM(199;3561 4100 22440)															0.444444	10.069975	10.097835	4	5	KEEP	---	---	---	---	1	3	3	2	-1	capture	Silent	SNP	91182336	91182336	BARHL2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	1303	255
SLC6A17	388662	broad.mit.edu	37	1	110735165	110735165	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:110735165G>A	uc009wfq.2	+	8	1605	c.1144G>A	c.(1144-1146)GTC>ATC	p.V382I	SLC6A17_uc001dze.1_5'UTR	NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN	solute carrier family 6, member 17	382	Extracellular (Potential).				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity			ovary(1)|pancreas(1)	2		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		TAACACCAACGTCCTGAGCCG	0.537																0.191919	40.467059	49.244849	19	80	KEEP	---	---	---	---	10	11	47	46	-1	capture	Missense_Mutation	SNP	110735165	110735165	SLC6A17	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14572	255
RFX5	5993	broad.mit.edu	37	1	151315095	151315095	+	Nonsense_Mutation	SNP	G	C	C			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151315095G>C	uc001exv.1	-	11	1632	c.1418C>G	c.(1417-1419)TCA>TGA	p.S473*	RFX5_uc001exw.1_Nonsense_Mutation_p.S473*|RFX5_uc009wmr.1_Nonsense_Mutation_p.S473*|RFX5_uc010pcx.1_Nonsense_Mutation_p.S433*	NM_001025603	NP_001020774	P48382	RFX5_HUMAN	regulatory factor X, 5	473						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ACTTCCACCTGACTTTTTTCG	0.547																0.240634	496.886833	539.479633	167	527	KEEP	---	---	---	---	102	88	295	317	-1	capture	Nonsense_Mutation	SNP	151315095	151315095	RFX5	1	G	C	C	C	1	0	0	0	0	0	1	0	0	585	45	5	4	13161	255
IL20	50604	broad.mit.edu	37	1	207039922	207039922	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207039922C>T	uc001her.2	+	3	363	c.319C>T	c.(319-321)CGG>TGG	p.R107W	IL20_uc010pry.1_Missense_Mutation_p.R178W|IL20_uc009xby.2_Missense_Mutation_p.R107W	NM_018724	NP_061194	Q9NYY1	IL20_HUMAN	interleukin 20 precursor	107					positive regulation of keratinocyte differentiation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of inflammatory response	extracellular space	cytokine activity|interleukin-20 receptor binding				0	Breast(84;0.201)			OV - Ovarian serous cystadenocarcinoma(81;0.00459)		TTATACTCTCCGGAAGATCAG	0.512																0.26971	332.140301	355.210559	130	352	KEEP	---	---	---	---	79	65	182	202	-1	capture	Missense_Mutation	SNP	207039922	207039922	IL20	1	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	7590	255
OBSCN	84033	broad.mit.edu	37	1	228557666	228557666	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228557666C>T	uc009xez.1	+	91	20035	c.19991C>T	c.(19990-19992)GCC>GTC	p.A6664V	OBSCN_uc001hsr.1_Missense_Mutation_p.A1293V	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	6664	Protein kinase 1.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				TCCCCATTTGCCGGCGAGAGT	0.632					4006											0.028571	-27.805891	6.435729	4	136	KEEP	---	---	---	---	4	1	79	82	-1	capture	Missense_Mutation	SNP	228557666	228557666	OBSCN	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10717	255
ZP4	57829	broad.mit.edu	37	1	238050155	238050155	+	Missense_Mutation	SNP	C	T	T	rs148891266	byFrequency;by1000genomes	TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:238050155C>T	uc001hym.2	-	6	755	c.755G>A	c.(754-756)CGA>CAA	p.R252Q	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	252	ZP.|Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			ATATACTGCTCGGTCTCCAGT	0.473	NSCLC(166;160 2029 11600 18754 19936)															0.296875	211.303125	220.746433	76	180	KEEP	---	---	---	---	40	45	88	114	-1	capture	Missense_Mutation	SNP	238050155	238050155	ZP4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	18094	255
VIM	7431	broad.mit.edu	37	10	17271903	17271903	+	Missense_Mutation	SNP	T	G	G			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:17271903T>G	uc001iou.2	+	2	895	c.482T>G	c.(481-483)GTG>GGG	p.V161G	uc001iot.1_RNA|VIM_uc001iov.1_Missense_Mutation_p.V161G|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Missense_Mutation_p.V161G|VIM_uc001ioy.1_Missense_Mutation_p.V161G|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Missense_Mutation_p.V161G|VIM_uc001ipc.1_Missense_Mutation_p.V161G	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin	161	Rod.|Coil 1B.				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CGCCGGCAGGTGGACCAGCTA	0.647																0.5	6.495192	6.495192	4	4	KEEP	---	---	---	---	5	5	4	4	-1	capture	Missense_Mutation	SNP	17271903	17271903	VIM	10	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	17048	255
TNKS2	80351	broad.mit.edu	37	10	93579732	93579732	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:93579732G>A	uc001khp.2	+	6	967	c.670G>A	c.(670-672)GTA>ATA	p.V224I		NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related	224	ANK 4.				positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding			kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)				ATATAACAGAGTAAAGATTGT	0.328					718											0.372449	228.022286	230.824603	73	123	KEEP	---	---	---	---	51	33	92	61	-1	capture	Missense_Mutation	SNP	93579732	93579732	TNKS2	10	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	16204	255
MKI67	4288	broad.mit.edu	37	10	129902650	129902650	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:129902650G>A	uc001lke.2	-	13	7649	c.7454C>T	c.(7453-7455)CCC>CTC	p.P2485L	MKI67_uc001lkf.2_Missense_Mutation_p.P2125L|MKI67_uc009yav.1_Missense_Mutation_p.P2060L|MKI67_uc009yaw.1_Missense_Mutation_p.P1635L	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	2485	16 X 122 AA approximate repeats.|13.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTTCACCAGGGGTATCTTGAG	0.473																0.03022	-65.987023	22.145196	11	353	KEEP	---	---	---	---	4	7	239	181	-1	capture	Missense_Mutation	SNP	129902650	129902650	MKI67	10	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	9510	255
MUC5B	727897	broad.mit.edu	37	11	1156635	1156635	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1156635C>T	uc009ycr.1	+	7	778	c.652C>T	c.(652-654)CCC>TCC	p.P218S		NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	214	VWFD 1.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAACGGGATGCCCGTGGTCAG	0.612																0.025316	-32.521037	6.919358	4	154	KEEP	---	---	---	---	2	2	86	95	-1	capture	Missense_Mutation	SNP	1156635	1156635	MUC5B	11	C	T	T	T	1	0	0	0	0	1	0	0	0	326	26	2	2	9889	255
BIRC3	330	broad.mit.edu	37	11	102195409	102195409	+	Missense_Mutation	SNP	T	C	C			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102195409T>C	uc001pgx.2	+	3	391	c.169T>C	c.(169-171)TAC>CAC	p.Y57H		NM_182962	NP_892007	Q13489	BIRC3_HUMAN	baculoviral IAP repeat-containing protein 3	57	BIR 1.				anti-apoptosis|apoptosis|cell surface receptor linked signaling pathway	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|skin(1)	4	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		TGGTTTCTATTACACTGGTGT	0.438					113	T	MALT1	MALT								0.302521	239.621135	247.899517	72	166	KEEP	---	---	---	---	43	36	89	89	-1	capture	Missense_Mutation	SNP	102195409	102195409	BIRC3	11	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	1424	255
ETS1	2113	broad.mit.edu	37	11	128426243	128426243	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:128426243A>G	uc001qej.2	-	3	242	c.157T>C	c.(157-159)TTT>CTT	p.F53L		NM_001143820	NP_001137292	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		TCATCCCAAAAGGGGTAGCAA	0.448																0.020979	-30.108832	6.610646	3	140	KEEP	---	---	---	---	2	1	67	77	-1	capture	Missense_Mutation	SNP	128426243	128426243	ETS1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	5230	255
KCNA5	3741	broad.mit.edu	37	12	5153876	5153876	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5153876C>T	uc001qni.2	+	1	792	c.563C>T	c.(562-564)CCG>CTG	p.P188L		NM_002234	NP_002225	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related	188				RP -> G (in Ref. 1; AAA61276).		Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(2)|breast(2)	4						CTGCGGAGGCCGGTCAACGTC	0.617																0.371795	88.35882	89.483592	29	49	KEEP	---	---	---	---	19	22	48	29	-1	capture	Missense_Mutation	SNP	5153876	5153876	KCNA5	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7928	255
SMARCD1	6602	broad.mit.edu	37	12	50484023	50484023	+	Splice_Site	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:50484023G>A	uc001rvx.3	+	8	1044	c.874_splice	c.e8-1	p.P292_splice	SMARCD1_uc001rvy.3_Splice_Site_p.P292_splice|SMARCD1_uc009zlp.2_Splice_Site_p.P251_splice	NM_003076	NP_003067	Q96GM5	SMRD1_HUMAN	SWI/SNF-related matrix-associated						chromatin-mediated maintenance of transcription|nervous system development|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	protein complex scaffold|transcription coactivator activity			ovary(1)	1						GTTCCCTGCAGCCTCCCCAGT	0.458																0.297778	176.319875	184.558101	67	158	KEEP	---	---	---	---	23	49	83	99	-1	capture	Splice_Site	SNP	50484023	50484023	SMARCD1	12	G	A	A	A	1	0	0	0	0	0	0	1	0	442	34	5	2	14669	255
LACRT	90070	broad.mit.edu	37	12	55025622	55025622	+	Silent	SNP	T	C	C			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55025622T>C	uc001sgi.1	-	4	293	c.255A>G	c.(253-255)AAA>AAG	p.K85K		NM_033277	NP_150593	Q9GZZ8	LACRT_HUMAN	lacritin precursor	85					calcineurin-NFAT signaling pathway|positive regulation of epithelial cell proliferation|positive regulation of NFAT protein import into nucleus|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of secretion|protein localization in Golgi apparatus|tear secretion	extracellular region|stored secretory granule	collagen binding|fibronectin binding|glycoprotein binding|growth factor activity|laminin-1 binding|protein N-terminus binding			central_nervous_system(1)	1						CCACTATGGATTCTAATTTTG	0.468																0.301075	285.095801	294.95352	84	195	KEEP	---	---	---	---	43	47	85	128	-1	capture	Silent	SNP	55025622	55025622	LACRT	12	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	8516	255
MYF5	4617	broad.mit.edu	37	12	81111227	81111227	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:81111227C>T	uc001szg.2	+	1	520	c.385C>T	c.(385-387)CGC>TGC	p.R129C		NM_005593	NP_005584	P13349	MYF5_HUMAN	myogenic factor 5	129	Helix-loop-helix motif.				muscle cell fate commitment|positive regulation of muscle cell differentiation|skeletal muscle tissue development	nucleoplasm	DNA binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(1)	1						GAATGCCATCCGCTACATCGA	0.587																0.281513	182.724909	192.934808	67	171	KEEP	---	---	---	---	35	34	90	106	-1	capture	Missense_Mutation	SNP	81111227	81111227	MYF5	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9937	255
TMEM132D	121256	broad.mit.edu	37	12	129558604	129558604	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:129558604G>A	uc009zyl.1	-	9	3444	c.3116C>T	c.(3115-3117)ACC>ATC	p.T1039I	TMEM132D_uc001uia.2_Missense_Mutation_p.T577I	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	1039	Cytoplasmic (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CCTTTTTGAGGTAGGGGATGT	0.488																0.039648	-36.623627	15.282469	9	218	KEEP	---	---	---	---	4	5	118	116	-1	capture	Missense_Mutation	SNP	129558604	129558604	TMEM132D	12	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	15931	255
HECTD1	25831	broad.mit.edu	37	14	31675061	31675061	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:31675061G>A	uc001wrc.1	-	2	571	c.82C>T	c.(82-84)CTT>TTT	p.L28F	HECTD1_uc001wre.2_RNA	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	28					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		AGCTGTTCAAGGGCTATTAGT	0.428																0.242718	68.522891	74.738925	25	78	KEEP	---	---	---	---	14	14	47	37	-1	capture	Missense_Mutation	SNP	31675061	31675061	HECTD1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	6965	255
ARHGAP5	394	broad.mit.edu	37	14	32561946	32561946	+	Missense_Mutation	SNP	A	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:32561946A>T	uc001wrl.2	+	2	2310	c.2071A>T	c.(2071-2073)ATG>TTG	p.M691L	ARHGAP5_uc001wrm.2_Missense_Mutation_p.M691L|ARHGAP5_uc001wrn.2_Missense_Mutation_p.M691L|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	691					cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGATAAATACATGGCTAATCT	0.358	NSCLC(9;77 350 3443 29227 41353)															0.035294	-13.048486	6.897287	3	82	KEEP	---	---	---	---	0	4	50	40	-1	capture	Missense_Mutation	SNP	32561946	32561946	ARHGAP5	14	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	879	255
DICER1	23405	broad.mit.edu	37	14	95590756	95590756	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95590756G>A	uc001ydw.2	-	9	1335	c.1153C>T	c.(1153-1155)CGC>TGC	p.R385C	DICER1_uc001ydv.2_Missense_Mutation_p.R375C|DICER1_uc001ydx.2_Missense_Mutation_p.R385C	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	385	Required for interaction with PRKRA and TARBP2.				negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TTATATTTGCGTAAGATTTCG	0.378					741	Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				0.01548	-78.723438	7.308308	5	318	KEEP	---	---	---	---	2	3	177	170	-1	capture	Missense_Mutation	SNP	95590756	95590756	DICER1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4479	255
GABRA5	2558	broad.mit.edu	37	15	27128491	27128491	+	Missense_Mutation	SNP	C	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:27128491C>A	uc001zbd.1	+	7	623	c.284C>A	c.(283-285)ACC>AAC	p.T95N	GABRB3_uc001zbb.2_Intron	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	95	Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TAGGAGTACACCATAGACGTG	0.592																0.275862	152.218974	161.396914	56	147	KEEP	---	---	---	---	30	32	89	81	0.516129032258	capture	Missense_Mutation	SNP	27128491	27128491	GABRA5	15	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	6106	255
ALPK3	57538	broad.mit.edu	37	15	85407896	85407896	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85407896G>A	uc002ble.2	+	12	5496	c.5329G>A	c.(5329-5331)GGG>AGG	p.G1777R	ALPK3_uc010upc.1_Missense_Mutation_p.G78R	NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1777	Alpha-type protein kinase.				heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AGACTTGGCAGGTACGAGGGT	0.507				p.G1777R(NCIH1568-Tumor)	343											0.050847	-5.727914	6.883085	3	56	KEEP	---	---	---	---	3	0	28	31	-1	capture	Missense_Mutation	SNP	85407896	85407896	ALPK3	15	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	546	255
SOLH	6650	broad.mit.edu	37	16	601614	601614	+	Silent	SNP	G	A	A	rs143897279	byFrequency	TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:601614G>A	uc002chi.2	+	9	2658	c.2295G>A	c.(2293-2295)CCG>CCA	p.P765P	SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes	765	Calpain catalytic.				proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				AGCTCATGCCGCACGGCAGCA	0.687																0.306931	78.083523	81.442691	31	70	KEEP	---	---	---	---	18	14	48	41	-1	capture	Silent	SNP	601614	601614	SOLH	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14817	255
PLEKHG4	25894	broad.mit.edu	37	16	67318812	67318812	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67318812C>T	uc002eso.3	+	12	4424	c.1889C>T	c.(1888-1890)GCG>GTG	p.A630V	PLEKHG4_uc002esp.3_Missense_Mutation_p.A437V|PLEKHG4_uc002esq.3_Missense_Mutation_p.A630V|PLEKHG4_uc010cef.2_Missense_Mutation_p.A630V|PLEKHG4_uc002ess.3_Missense_Mutation_p.A630V|PLEKHG4_uc010ceg.2_Missense_Mutation_p.A549V	NM_015432	NP_056247	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G	630					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)|pancreas(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		TGGGCCTGGGCGCGGTGCCAG	0.662																0.292683	29.315048	30.875247	12	29	KEEP	---	---	---	---	7	5	16	17	-1	capture	Missense_Mutation	SNP	67318812	67318812	PLEKHG4	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11974	255
ANKRD11	29123	broad.mit.edu	37	16	89341552	89341552	+	Silent	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89341552C>T	uc002fmx.1	-	10	7979	c.7518G>A	c.(7516-7518)AGG>AGA	p.R2506R	ANKRD11_uc002fmy.1_Silent_p.R2506R	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2506						nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CCTCCTGCTGCCTGAACAGCT	0.662																0.090909	1.400373	6.967299	3	30	KEEP	---	---	---	---	1	4	13	23	-1	capture	Silent	SNP	89341552	89341552	ANKRD11	16	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	636	255
CCDC42	146849	broad.mit.edu	37	17	8638565	8638565	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8638565C>T	uc002gln.2	-	6	949	c.722G>A	c.(721-723)CGC>CAC	p.R241H	CCDC42_uc002glo.2_Missense_Mutation_p.R167H	NM_144681	NP_653282	Q96M95	CCD42_HUMAN	coiled-coil domain containing 42 isoform 1	241										ovary(1)	1						GTGCGCCCAGCGAGATTCCTG	0.473																0.086957	0.94045	16.822412	8	84	KEEP	---	---	---	---	5	3	54	40	-1	capture	Missense_Mutation	SNP	8638565	8638565	CCDC42	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2788	255
CDC27	996	broad.mit.edu	37	17	45247352	45247352	+	Missense_Mutation	SNP	T	C	C			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45247352T>C	uc002ild.3	-	4	435	c.308A>G	c.(307-309)CAT>CGT	p.H103R	CDC27_uc002ile.3_Missense_Mutation_p.H103R|CDC27_uc002ilf.3_Missense_Mutation_p.H103R|CDC27_uc010wkp.1_Missense_Mutation_p.H42R|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	103	TPR 1.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						AATATCATCATGGCTTTTCTG	0.308																0.026616	-51.008453	14.1291	7	256	KEEP	---	---	---	---	5	4	150	158	-1	capture	Missense_Mutation	SNP	45247352	45247352	CDC27	17	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	3037	255
ESCO1	114799	broad.mit.edu	37	18	19154087	19154087	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19154087C>T	uc002kth.1	-	4	1652	c.718G>A	c.(718-720)GTG>ATG	p.V240M	ESCO1_uc002kti.1_RNA	NM_052911	NP_443143	Q5FWF5	ESCO1_HUMAN	establishment of cohesion 1 homolog 1	240					cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0						GTTACAGGCACAGGTTTCGTT	0.418																0.253219	281.297286	307.086075	118	348	KEEP	---	---	---	---	75	74	192	225	-1	capture	Missense_Mutation	SNP	19154087	19154087	ESCO1	18	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	5203	255
NETO1	81832	broad.mit.edu	37	18	70450913	70450913	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:70450913G>A	uc002lkw.2	-	7	1152	c.868C>T	c.(868-870)CCT>TCT	p.P290S	NETO1_uc002lkx.1_Missense_Mutation_p.P289S|NETO1_uc002lky.1_Missense_Mutation_p.P290S	NM_138966	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin- and tolloid-like protein 1 isoform 3	290	Extracellular (Potential).				memory|regulation of long-term neuronal synaptic plasticity|visual learning	cell junction|excitatory synapse|extracellular region|integral to membrane|postsynaptic density|postsynaptic membrane	receptor activity			ovary(2)|skin(2)	4		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		AGAATCTTACGTTCTTGAAAG	0.458																0.256983	121.070315	130.650446	46	133	KEEP	---	---	---	---	32	27	65	97	-1	capture	Missense_Mutation	SNP	70450913	70450913	NETO1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10246	255
MUC16	94025	broad.mit.edu	37	19	9088222	9088222	+	Missense_Mutation	SNP	G	A	A	rs145987902	by1000genomes	TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9088222G>A	uc002mkp.2	-	1	3797	c.3593C>T	c.(3592-3594)ACG>ATG	p.T1198M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1198	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CAAGGAAGTCGTGGAAGGTAA	0.473																0.263761	295.230511	317.230453	115	321	KEEP	---	---	---	---	64	55	167	167	-1	capture	Missense_Mutation	SNP	9088222	9088222	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9883	255
COL5A3	50509	broad.mit.edu	37	19	10088375	10088375	+	Silent	SNP	G	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10088375G>T	uc002mmq.1	-	42	3107	c.3021C>A	c.(3019-3021)GGC>GGA	p.G1007G		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	1007	Triple-helical region.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			CACCAGGGGAGCCCTGAGAAC	0.572																0.106383	-0.465221	6.712568	5	42	KEEP	---	---	---	---	1	5	17	28	0.166666666667	capture	Silent	SNP	10088375	10088375	COL5A3	19	G	T	T	T	1	0	0	0	0	0	0	0	1	431	34	4	4	3663	255
CPAMD8	27151	broad.mit.edu	37	19	17039895	17039895	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17039895C>T	uc002nfb.2	-	24	3174	c.3142G>A	c.(3142-3144)GTC>ATC	p.V1048I		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1001						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity	p.V1048I(1)		ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						CCCCCCAGGACGATCTCGATC	0.607					1067											0.25641	49.966081	54.161191	20	58	KEEP	---	---	---	---	9	16	28	34	-1	capture	Missense_Mutation	SNP	17039895	17039895	CPAMD8	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3760	255
UPK1A	11045	broad.mit.edu	37	19	36159540	36159540	+	Missense_Mutation	SNP	G	A	A	rs111275297		TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36159540G>A	uc002oaw.2	+	2	269	c.269G>A	c.(268-270)CGG>CAG	p.R90Q	UPK1A_uc010eeh.2_Missense_Mutation_p.R90Q|uc002oax.1_Missense_Mutation_p.R3W	NM_007000	NP_008931	O00322	UPK1A_HUMAN	uroplakin 1A	90	Cytoplasmic (Potential).				epithelial cell differentiation|protein oligomerization	endoplasmic reticulum|integral to membrane	monosaccharide binding|protein homodimerization activity				0	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGCCGCCGCCGGTCCATGGTC	0.592																0.222222	26.432535	29.621759	10	35	KEEP	---	---	---	---	6	9	24	26	-1	capture	Missense_Mutation	SNP	36159540	36159540	UPK1A	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16889	255
GPR77	27202	broad.mit.edu	37	19	47844750	47844750	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47844750C>T	uc010ela.1	+	2	912	c.694C>T	c.(694-696)CGG>TGG	p.R232W	GPR77_uc002pgk.1_Missense_Mutation_p.R232W	NM_018485	NP_060955	Q9P296	C5ARL_HUMAN	G protein-coupled receptor 77	232	Cytoplasmic (Potential).				chemotaxis	integral to membrane|plasma membrane	C5a anaphylatoxin receptor activity			ovary(1)	1		all_cancers(25;1.72e-06)|all_lung(116;2.15e-05)|all_epithelial(76;3.44e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.0652)|Ovarian(192;0.086)		all cancers(93;0.000129)|OV - Ovarian serous cystadenocarcinoma(262;0.000415)|Epithelial(262;0.0109)|GBM - Glioblastoma multiforme(486;0.0138)		CCGACGCTGCCGGCCGCTGGG	0.672																0.289474	59.127162	62.141591	22	54	KEEP	---	---	---	---	16	27	72	81	-1	capture	Missense_Mutation	SNP	47844750	47844750	GPR77	19	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	6642	255
ELSPBP1	64100	broad.mit.edu	37	19	48519291	48519291	+	Missense_Mutation	SNP	C	T	T	rs145971035		TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48519291C>T	uc002pht.2	+	4	505	c.350C>T	c.(349-351)ACG>ATG	p.T117M		NM_022142	NP_071425	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1 precursor	117	Fibronectin type-II 2.				single fertilization	extracellular region					0		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		TTCTGTGAAACGAATGGTGAG	0.552																0.208791	87.948672	102.23948	38	144	KEEP	---	---	---	---	17	27	79	83	-1	capture	Missense_Mutation	SNP	48519291	48519291	ELSPBP1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5038	255
DKKL1	27120	broad.mit.edu	37	19	49867863	49867863	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49867863G>A	uc002pnk.2	+	2	249	c.35G>A	c.(34-36)CGG>CAG	p.R12Q	TEAD2_uc002pni.2_5'Flank|TEAD2_uc002pnj.2_5'Flank|TEAD2_uc010yao.1_5'Flank|TEAD2_uc010emw.2_5'Flank	NM_014419	NP_055234	Q9UK85	DKKL1_HUMAN	dickkopf-like 1 precursor	12					anatomical structure morphogenesis	extracellular space	protein binding|signal transducer activity				0		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		CCCGCAAGGCGGCATCTGCTG	0.672																0.2	57.189449	68.061656	26	104	KEEP	---	---	---	---	13	18	65	66	-1	capture	Missense_Mutation	SNP	49867863	49867863	DKKL1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4506	255
C19orf75	284369	broad.mit.edu	37	19	51768774	51768774	+	Missense_Mutation	SNP	T	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51768774T>A	uc002pwb.1	+	3	556	c.175T>A	c.(175-177)TCC>ACC	p.S59T	C19orf75_uc010eov.1_Intron|C19orf75_uc010ycw.1_Intron	NM_173635	NP_775906	Q8N7X8	CS075_HUMAN	hypothetical protein LOC284369	59						integral to membrane				ovary(1)|pancreas(1)	2						CCAAGTGACTTCCACCATGCT	0.567																0.283186	77.867693	82.630219	32	81	KEEP	---	---	---	---	18	17	27	61	-1	capture	Missense_Mutation	SNP	51768774	51768774	C19orf75	19	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	1932	255
KCNH7	90134	broad.mit.edu	37	2	163253351	163253351	+	Nonsense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:163253351G>A	uc002uch.1	-	11	2724	c.2512C>T	c.(2512-2514)CGA>TGA	p.R838*		NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	838	Cytoplasmic (Potential).|cNMP.				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	AAGTCTTCTCGCTGAATCTTA	0.383	GBM(196;1492 2208 17507 24132 45496)															0.254098	80.586686	87.26868	31	91	KEEP	---	---	---	---	14	20	44	55	-1	capture	Nonsense_Mutation	SNP	163253351	163253351	KCNH7	2	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	7959	255
TTC21B	79809	broad.mit.edu	37	2	166799848	166799848	+	Missense_Mutation	SNP	G	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:166799848G>T	uc002udk.2	-	5	566	c.433C>A	c.(433-435)CAC>AAC	p.H145N	TTC21B_uc002udl.2_Missense_Mutation_p.H145N|uc002udm.1_Intron	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	145	TPR 2.					cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						TTCAAAACGTGTCCCTGTAAA	0.313																0.181818	28.258091	34.536168	12	54	KEEP	---	---	---	---	8	4	31	28	0.666666666667	capture	Missense_Mutation	SNP	166799848	166799848	TTC21B	2	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	16570	255
SDPR	8436	broad.mit.edu	37	2	192700730	192700730	+	Silent	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192700730G>A	uc002utb.2	-	2	1527	c.1197C>T	c.(1195-1197)TAC>TAT	p.Y399Y		NM_004657	NP_004648	O95810	SDPR_HUMAN	serum deprivation response protein	399						caveola|cytosol	phosphatidylserine binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0647)		Phosphatidylserine(DB00144)	ATGTTAGCGCGTAGCTACCCT	0.612																0.286957	172.247202	181.6188	66	164	KEEP	---	---	---	---	35	34	89	84	-1	capture	Silent	SNP	192700730	192700730	SDPR	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13863	255
KIAA1486	57624	broad.mit.edu	37	2	226447389	226447389	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:226447389C>T	uc002voe.2	+	4	1431	c.1256C>T	c.(1255-1257)ACG>ATG	p.T419M	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Missense_Mutation_p.T189M	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	419	Pro-rich.									ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		CCCCCGTCTACGCTGTACCGA	0.662																0.428571	8.123105	8.154397	3	4	KEEP	---	---	---	---	0	3	3	4	-1	capture	Missense_Mutation	SNP	226447389	226447389	KIAA1486	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8159	255
SIGLEC1	6614	broad.mit.edu	37	20	3674185	3674185	+	Silent	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3674185G>A	uc002wja.2	-	13	3417	c.3417C>T	c.(3415-3417)GTC>GTT	p.V1139V	SIGLEC1_uc002wjb.1_5'Flank|SIGLEC1_uc002wiz.3_Silent_p.V1139V	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	1139	Ig-like C2-type 11.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						CCCTGACTGTGACGTTGGGCA	0.657																0.259259	33.020201	35.85866	14	40	KEEP	---	---	---	---	13	7	17	29	-1	capture	Silent	SNP	3674185	3674185	SIGLEC1	20	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	14198	255
SRC	6714	broad.mit.edu	37	20	36026230	36026230	+	Missense_Mutation	SNP	C	G	G			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36026230C>G	uc002xgx.2	+	9	1281	c.832C>G	c.(832-834)CAG>GAG	p.Q278E	SRC_uc002xgy.2_Missense_Mutation_p.Q278E	NM_005417	NP_005408	P12931	SRC_HUMAN	proto-oncogene tyrosine-protein kinase SRC	278	Protein kinase.|ATP.				axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)	CAAGCTGGGCCAGGGCTGCTT	0.697					463											0.073529	0.417422	13.130327	5	63	KEEP	---	---	---	---	4	1	33	42	-1	capture	Missense_Mutation	SNP	36026230	36026230	SRC	20	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	15026	255
PTPRT	11122	broad.mit.edu	37	20	40713368	40713368	+	Missense_Mutation	SNP	G	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:40713368G>T	uc002xkg.2	-	29	4274	c.4090C>A	c.(4090-4092)CAG>AAG	p.Q1364K	PTPRT_uc010ggj.2_Missense_Mutation_p.Q1383K|PTPRT_uc010ggi.2_Missense_Mutation_p.Q567K	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1364	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TACTGCTCCTGCCACTTCTCC	0.597					646											0.234375	37.290353	41.423161	15	49	KEEP	---	---	---	---	6	9	40	33	0.4	capture	Missense_Mutation	SNP	40713368	40713368	PTPRT	20	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	12707	255
DIDO1	11083	broad.mit.edu	37	20	61511189	61511189	+	Missense_Mutation	SNP	C	T	T	rs143474883		TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61511189C>T	uc002ydr.1	-	16	6383	c.6119G>A	c.(6118-6120)CGC>CAC	p.R2040H	DIDO1_uc002yds.1_Missense_Mutation_p.R2040H	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	2040					apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					CTCCTCCCAGCGGTCCTTCCG	0.741	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)															0.229299	82.045443	92.577526	36	121	KEEP	---	---	---	---	17	24	63	75	-1	capture	Missense_Mutation	SNP	61511189	61511189	DIDO1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4480	255
KRTAP10-12	386685	broad.mit.edu	37	21	46117103	46117103	+	Translation_Start_Site	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46117103C>T	uc002zfw.1	+	1	17	c.-13C>T	c.(-15--11)CACGG>CATGG		C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198699	NP_941972	P60413	KR10C_HUMAN	keratin associated protein 10-12							keratin filament					0						ACCCCCAGCACGGCTGCATCC	0.408																0.25	73.967454	81.710844	34	102	KEEP	---	---	---	---	20	21	67	50	-1	capture	Translation_Start_Site	SNP	46117103	46117103	KRTAP10-12	21	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	8428	255
PRAME	23532	broad.mit.edu	37	22	22891015	22891015	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22891015G>A	uc002zwf.2	-	5	1160	c.1004C>T	c.(1003-1005)TCG>TTG	p.S335L	LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Missense_Mutation_p.S319L|PRAME_uc010gtr.2_Missense_Mutation_p.S335L|PRAME_uc002zwg.2_Missense_Mutation_p.S335L|PRAME_uc002zwh.2_Missense_Mutation_p.S335L|PRAME_uc002zwi.2_Missense_Mutation_p.S335L|PRAME_uc002zwj.2_Missense_Mutation_p.S335L|PRAME_uc002zwk.2_Missense_Mutation_p.S335L	NM_206956	NP_996839	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	335	LRR 1.				apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding			central_nervous_system(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		ATCCCCTTCCGAAAGCCGGCA	0.542	Melanoma(73;1707 1838 15168 27201)				1184											0.273723	195.004142	207.645718	75	199	KEEP	---	---	---	---	39	44	103	118	-1	capture	Missense_Mutation	SNP	22891015	22891015	PRAME	22	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12325	255
ELFN2	114794	broad.mit.edu	37	22	37769438	37769438	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37769438G>A	uc003asq.3	-	3	2923	c.2137C>T	c.(2137-2139)CCC>TCC	p.P713S		NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62	713	Cytoplasmic (Potential).					cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)					TACAGGGCGGGAAAGCTGTGC	0.552																0.130435	3.914931	6.966345	3	20	KEEP	---	---	---	---	3	0	12	10	-1	capture	Missense_Mutation	SNP	37769438	37769438	ELFN2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	5013	255
ENTHD1	150350	broad.mit.edu	37	22	40283672	40283672	+	Silent	SNP	G	A	A	rs146928757		TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:40283672G>A	uc003ayg.2	-	2	332	c.81C>T	c.(79-81)AAC>AAT	p.N27N		NM_152512	NP_689725	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	27	ENTH.							p.N27N(1)		ovary(2)|skin(1)	3	Melanoma(58;0.0749)					CCCAAGGGTCGTTAGAAGTTG	0.398																0.308	210.281526	218.49635	77	173	KEEP	---	---	---	---	33	51	85	103	-1	capture	Silent	SNP	40283672	40283672	ENTHD1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5092	255
CYP2D6	1565	broad.mit.edu	37	22	42523567	42523567	+	Missense_Mutation	SNP	T	C	C	rs61736517		TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42523567T>C	uc003bce.2	-	7	1145	c.1055A>G	c.(1054-1056)CAC>CGC	p.H352R	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_Missense_Mutation_p.H46R|CYP2D6_uc003bcf.2_Missense_Mutation_p.H301R	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	352							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						GTAGGGCATGTGAGCCTGGTC	0.592																0.037313	-24.039572	7.06818	5	129	KEEP	---	---	---	---	6	1	65	86	-1	capture	Missense_Mutation	SNP	42523567	42523567	CYP2D6	22	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	4129	255
ARSA	410	broad.mit.edu	37	22	51063597	51063597	+	Silent	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:51063597G>A	uc003bnb.3	-	9	1753	c.1500C>T	c.(1498-1500)TGC>TGT	p.C500C	ARSA_uc003bna.3_Silent_p.C416C|ARSA_uc003bnc.3_Silent_p.C500C|ARSA_uc003bnd.3_Silent_p.C500C|ARSA_uc003bmz.3_Silent_p.C500C	NM_001085426	NP_001078895	P15289	ARSA_HUMAN	arylsulfatase A isoform a precursor	500						lysosome	arylsulfatase activity|calcium ion binding|cerebroside-sulfatase activity			pancreas(1)|skin(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Micafungin(DB01141)	CTGGGCAATGGCAGCAAGCTG	0.701																0.473684	24.571306	24.582693	9	10	KEEP	---	---	---	---	4	5	6	5	-1	capture	Silent	SNP	51063597	51063597	ARSA	22	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	980	255
SLC9A10	285335	broad.mit.edu	37	3	111901019	111901019	+	Silent	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111901019C>T	uc003dyu.2	-	21	2832	c.2610G>A	c.(2608-2610)CCG>CCA	p.P870P	SLC9A10_uc011bhu.1_Silent_p.P133P|SLC9A10_uc010hqc.2_Silent_p.P822P	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	870	cNMP.				cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						TATCTAGCCACGGAATATGAT	0.219																0.0625	-12.466438	25.842517	12	180	KEEP	---	---	---	---	5	8	107	102	-1	capture	Silent	SNP	111901019	111901019	SLC9A10	3	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	14602	255
UBA5	79876	broad.mit.edu	37	3	132390695	132390695	+	Silent	SNP	T	C	C			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:132390695T>C	uc003epa.3	+	7	896	c.654T>C	c.(652-654)CTT>CTC	p.L218L	NPHP3_uc003eoz.1_Intron|UBA5_uc010htr.2_Silent_p.L162L|UBA5_uc010htt.2_Silent_p.L218L|UBA5_uc003epb.3_Silent_p.L162L	NM_024818	NP_079094	Q9GZZ9	UBA5_HUMAN	ubiquitin-activating enzyme 5 isoform 1	218					protein ufmylation	aggresome|cytoplasm|cytoplasm|nucleus	ATP binding|cofactor binding|metal ion binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding|UFM1 activating enzyme activity			kidney(1)	1						ATATACAGCTTATAATTCCTG	0.368																0.017467	-51.698776	8.46087	4	225	KEEP	---	---	---	---	0	5	126	132	-1	capture	Silent	SNP	132390695	132390695	UBA5	3	T	C	C	C	1	0	0	0	0	0	0	0	1	782	61	3	3	16712	255
PRR23B	389151	broad.mit.edu	37	3	138739151	138739151	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138739151G>A	uc003esy.1	-	1	618	c.353C>T	c.(352-354)TCG>TTG	p.S118L		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	118										breast(1)	1						CCCGGCAGACGAGTCGTGCTG	0.632																0.188119	41.168471	50.362181	19	82	KEEP	---	---	---	---	9	12	47	47	-1	capture	Missense_Mutation	SNP	138739151	138739151	PRR23B	3	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12490	255
B3GALNT1	8706	broad.mit.edu	37	3	160803715	160803715	+	Missense_Mutation	SNP	T	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:160803715T>A	uc003fdv.2	-	5	1247	c.828A>T	c.(826-828)TTA>TTT	p.L276F	B3GALNT1_uc003fdw.2_Missense_Mutation_p.L276F|B3GALNT1_uc003fdx.2_Missense_Mutation_p.L276F|B3GALNT1_uc003fdy.2_Missense_Mutation_p.L276F|B3GALNT1_uc003fdz.2_Missense_Mutation_p.L276F|B3GALNT1_uc003fea.2_Missense_Mutation_p.L276F|B3GALNT1_uc011bpa.1_Intron	NM_033169	NP_149359	O75752	B3GL1_HUMAN	UDP-Gal:betaGlcNAc beta	276	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosylgalactosylglucosylceramide beta-D-acetylgalactosaminyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;4.41e-05)|Lung(72;4.61e-05)			TCACTTTTAATAAATTCAAAC	0.363																0.038462	-11.44021	6.512115	3	75	KEEP	---	---	---	---	2	1	33	42	-1	capture	Missense_Mutation	SNP	160803715	160803715	B3GALNT1	3	T	A	A	A	1	0	0	0	0	1	0	0	0	634	49	4	4	1235	255
MUC4	4585	broad.mit.edu	37	3	195509188	195509188	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195509188G>A	uc011bto.1	-	3	9339	c.8879C>T	c.(8878-8880)CCT>CTT	p.P2960L	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACAGGAAGAGGGGTGGCGTG	0.592																0.666667	6.752011	6.824729	2	1	KEEP	---	---	---	---	0	2	1	3	-1	capture	Missense_Mutation	SNP	195509188	195509188	MUC4	3	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	9888	255
NCBP2	22916	broad.mit.edu	37	3	196664454	196664454	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196664454C>T	uc003fxd.1	-	3	416	c.326G>A	c.(325-327)CGA>CAA	p.R109Q	NCBP2_uc003fxb.1_Missense_Mutation_p.R39Q|NCBP2_uc011btz.1_Missense_Mutation_p.R91Q|NCBP2_uc003fxc.1_RNA|NCBP2_uc003fxe.1_Missense_Mutation_p.R56Q|NCBP2_uc003fxf.2_3'UTR	NM_007362	NP_031388	P52298	NCBP2_HUMAN	nuclear cap binding protein subunit 2, 20kDa	109	RRM.				gene silencing by RNA|histone mRNA metabolic process|mRNA 3'-end processing|mRNA capping|mRNA export from nucleus|ncRNA metabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of RNA export from nucleus|positive regulation of viral transcription|regulation of translational initiation|snRNA export from nucleus|spliceosomal snRNP assembly|termination of RNA polymerase II transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytosol|mRNA cap binding complex|nucleoplasm	nucleotide binding|protein binding|RNA 7-methylguanosine cap binding				0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.42e-24)|all cancers(36;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(49;4.13e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00551)		GCGAATGATTCGGTCATCCAG	0.527																0.316583	173.653156	179.606959	63	136	KEEP	---	---	---	---	33	39	71	77	-1	capture	Missense_Mutation	SNP	196664454	196664454	NCBP2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10119	255
CSN2	1447	broad.mit.edu	37	4	70822070	70822070	+	Nonstop_Mutation	SNP	A	G	G			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70822070A>G	uc003hes.3	-	6	692	c.679T>C	c.(679-681)TAA>CAA	p.*227Q	CSN2_uc003het.3_Nonstop_Mutation_p.*226Q	NM_001891	NP_001882	P05814	CASB_HUMAN	casein beta precursor	227					calcium ion transport	extracellular region	calcium ion binding|enzyme inhibitor activity|transporter activity				0						AAATCTTCTTAGACCTTAAAA	0.269																0.318182	46.136049	47.428034	14	30	KEEP	---	---	---	---	6	9	19	15	-1	capture	Nonstop_Mutation	SNP	70822070	70822070	CSN2	4	A	G	G	G	1	0	0	0	0	0	0	0	0	195	15	5	3	3913	255
ALB	213	broad.mit.edu	37	4	74279142	74279142	+	Missense_Mutation	SNP	C	G	G			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74279142C>G	uc003hgs.3	+	8	922	c.849C>G	c.(847-849)GAC>GAG	p.D283E	ALB_uc003hgw.3_Missense_Mutation_p.D91E|ALB_uc011cbe.1_5'UTR|ALB_uc003hgt.3_Missense_Mutation_p.D283E|ALB_uc010iii.2_Missense_Mutation_p.D168E|ALB_uc003hgu.3_Missense_Mutation_p.D133E|ALB_uc003hgv.3_5'UTR|ALB_uc011cbf.1_Missense_Mutation_p.D173E|ALB_uc010iij.2_RNA|ALB_uc003hgx.3_5'UTR	NM_000477	NP_000468	P02768	ALBU_HUMAN	albumin preproprotein	283	Albumin 2.				bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding			ovary(3)|skin(3)	6	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)	TATAGGCGGACCTTGCCAAGT	0.393																0.282051	104.832094	109.821025	33	84	KEEP	---	---	---	---	14	22	49	47	-1	capture	Missense_Mutation	SNP	74279142	74279142	ALB	4	C	G	G	G	1	0	0	0	0	1	0	0	0	233	18	4	4	486	255
AFM	173	broad.mit.edu	37	4	74354363	74354363	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74354363A>G	uc003hhb.2	+	7	761	c.730A>G	c.(730-732)AGT>GGT	p.S244G		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	244	Albumin 2.				vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGCGATACTCAGTCAAAAATT	0.343																0.271605	119.228879	126.848374	44	118	KEEP	---	---	---	---	21	31	60	71	-1	capture	Missense_Mutation	SNP	74354363	74354363	AFM	4	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	361	255
MMRN1	22915	broad.mit.edu	37	4	90874191	90874191	+	Missense_Mutation	SNP	T	G	G			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:90874191T>G	uc003hst.2	+	8	3380	c.3309T>G	c.(3307-3309)TTT>TTG	p.F1103L	MMRN1_uc010iku.2_Missense_Mutation_p.F406L|MMRN1_uc011cds.1_Missense_Mutation_p.F845L	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	1103	C1q.				cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TGGTGGCATTTTTTGCATCTC	0.338																0.320144	302.985317	310.970181	89	189	KEEP	---	---	---	---	51	56	118	95	-1	capture	Missense_Mutation	SNP	90874191	90874191	MMRN1	4	T	G	G	G	1	0	0	0	0	1	0	0	0	829	64	4	4	9582	255
KLKB1	3818	broad.mit.edu	37	4	187157968	187157968	+	Missense_Mutation	SNP	T	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:187157968T>A	uc003iyy.2	+	5	433	c.362T>A	c.(361-363)ATG>AAG	p.M121K	KLKB1_uc011clc.1_5'UTR|KLKB1_uc011cld.1_Missense_Mutation_p.M83K	NM_000892	NP_000883	P03952	KLKB1_HUMAN	plasma kallikrein B1 precursor	121	Apple 2.				blood coagulation, intrinsic pathway|Factor XII activation|fibrinolysis|plasminogen activation|positive regulation of fibrinolysis	cytoplasm|extracellular space|plasma membrane	serine-type endopeptidase activity			ovary(1)	1		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		GGAGTTGATATGAGAGGAGTC	0.378																0.031447	-27.765885	10.442991	5	154	KEEP	---	---	---	---	4	1	69	106	-1	capture	Missense_Mutation	SNP	187157968	187157968	KLKB1	4	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	8332	255
C5orf32	84418	broad.mit.edu	37	5	139622928	139622928	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:139622928C>T	uc003lfd.2	+	3	464	c.226C>T	c.(226-228)CCA>TCA	p.P76S	C5orf32_uc010jfi.2_RNA	NM_032412	NP_115788	Q9H1C7	CE032_HUMAN	hypothetical protein LOC84418	76											0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGCTAGGACCATCCACCTG	0.582																0.253165	46.158681	50.532957	20	59	KEEP	---	---	---	---	10	13	37	41	-1	capture	Missense_Mutation	SNP	139622928	139622928	C5orf32	5	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	2269	255
SH3TC2	79628	broad.mit.edu	37	5	148417964	148417964	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148417964C>T	uc003lpu.2	-	8	1047	c.895G>A	c.(895-897)GGC>AGC	p.G299S	SH3TC2_uc003lpp.1_RNA|SH3TC2_uc003lps.2_RNA|SH3TC2_uc003lpt.2_5'UTR|SH3TC2_uc010jgx.2_Missense_Mutation_p.G292S|SH3TC2_uc003lpv.1_5'UTR|SH3TC2_uc011dbz.1_Missense_Mutation_p.G184S	NM_024577	NP_078853	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	299	SH3.						binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGACAAAGCCGATGATCTCA	0.473																0.266846	274.76738	292.976679	99	272	KEEP	---	---	---	---	56	51	131	179	-1	capture	Missense_Mutation	SNP	148417964	148417964	SH3TC2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14155	255
OR2J3	442186	broad.mit.edu	37	6	29080039	29080039	+	Silent	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29080039C>T	uc011dll.1	+	1	372	c.372C>T	c.(370-372)GAC>GAT	p.D124D		NM_001005216	NP_001005216	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J,	124	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGTCCTATGACCGTTATGCAG	0.488																0.257407	344.293022	373.086725	139	401	KEEP	---	---	---	---	87	73	226	232	-1	capture	Silent	SNP	29080039	29080039	OR2J3	6	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	10908	255
TNXB	7148	broad.mit.edu	37	6	32041532	32041532	+	Nonsense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32041532G>A	uc003nzl.2	-	12	4775	c.4573C>T	c.(4573-4575)CGA>TGA	p.R1525*		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	1612	Fibronectin type-III 8.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						GTGACCTCTCGCTGGTCTGCC	0.567																0.36	24.667807	25.099281	9	16	KEEP	---	---	---	---	4	6	7	12	-1	capture	Nonsense_Mutation	SNP	32041532	32041532	TNXB	6	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	16229	255
C6orf89	221477	broad.mit.edu	37	6	36891125	36891125	+	Missense_Mutation	SNP	T	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:36891125T>A	uc003omx.2	+	9	1236	c.952T>A	c.(952-954)TAT>AAT	p.Y318N	C6orf89_uc003omv.2_Missense_Mutation_p.Y212N|C6orf89_uc003omw.2_Missense_Mutation_p.Y325N|C6orf89_uc011dtr.1_Missense_Mutation_p.Y212N|C6orf89_uc003omy.2_Missense_Mutation_p.Y152N	NM_152734	NP_689947	Q6UWU4	CF089_HUMAN	hypothetical protein LOC221477	318						integral to membrane				ovary(1)	1						CCCTCAAGGCTATGTCGACAC	0.552																0.333333	61.555586	63.104632	21	42	KEEP	---	---	---	---	13	10	22	27	-1	capture	Missense_Mutation	SNP	36891125	36891125	C6orf89	6	T	A	A	A	1	0	0	0	0	1	0	0	0	689	53	4	4	2350	255
AOAH	313	broad.mit.edu	37	7	36616236	36616236	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:36616236C>T	uc003tfh.3	-	13	1366	c.965G>A	c.(964-966)CGC>CAC	p.R322H	AOAH_uc010kxf.2_Missense_Mutation_p.R322H|AOAH_uc011kba.1_Missense_Mutation_p.R290H	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	322					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						TTTCCATAAGCGAAGGTAAAT	0.303																0.185315	114.622913	141.161696	53	233	KEEP	---	---	---	---	32	30	137	136	-1	capture	Missense_Mutation	SNP	36616236	36616236	AOAH	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	719	255
HECW1	23072	broad.mit.edu	37	7	43484236	43484236	+	Nonsense_Mutation	SNP	G	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43484236G>T	uc003tid.1	+	11	2070	c.1465G>T	c.(1465-1467)GAG>TAG	p.E489*	HECW1_uc011kbi.1_Nonsense_Mutation_p.E489*	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	489	Glu-rich.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						GCCCTTGGAGGAGGAAGCAAC	0.537					944											0.2	9.959913	12.053623	5	20	KEEP	---	---	---	---	3	3	10	17	0.5	capture	Nonsense_Mutation	SNP	43484236	43484236	HECW1	7	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	6968	255
DDC	1644	broad.mit.edu	37	7	50534977	50534977	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50534977G>A	uc003tpf.3	-	13	1263	c.1177C>T	c.(1177-1179)CGC>TGC	p.R393C	DDC_uc010kza.2_Missense_Mutation_p.R308C|DDC_uc003tpg.3_Missense_Mutation_p.R393C	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	393					cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	GGATCCTGGCGCACCAGTGAC	0.433																0.017007	-70.050837	7.415649	5	289	KEEP	---	---	---	---	5	1	153	175	-1	capture	Missense_Mutation	SNP	50534977	50534977	DDC	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4284	255
DDC	1644	broad.mit.edu	37	7	50607722	50607722	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50607722G>A	uc003tpf.3	-	3	292	c.206C>T	c.(205-207)ACG>ATG	p.T69M	DDC_uc010kza.2_Missense_Mutation_p.T69M|DDC_uc003tpg.3_Missense_Mutation_p.T69M	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	69	1.|2 X approximate tandem repeats.				cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	GTGCCAGTGCGTCACCTGCAT	0.647																0.244898	27.789671	30.685505	12	37	KEEP	---	---	---	---	8	4	19	19	-1	capture	Missense_Mutation	SNP	50607722	50607722	DDC	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4284	255
SEMA3D	223117	broad.mit.edu	37	7	84727157	84727157	+	Silent	SNP	T	C	C			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:84727157T>C	uc003uic.2	-	2	316	c.276A>G	c.(274-276)CTA>CTG	p.L92L	SEMA3D_uc010led.2_Silent_p.L92L|SEMA3D_uc010lee.1_Silent_p.L92L	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor	92	Sema.				cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5						CCAGACTGAGTAGAAAGATGT	0.363	Ovarian(63;442 1191 17318 29975 31528)															0.235294	386.409271	422.28994	132	429	KEEP	---	---	---	---	82	62	246	245	-1	capture	Silent	SNP	84727157	84727157	SEMA3D	7	T	C	C	C	1	0	0	0	0	0	0	0	1	730	57	3	3	13920	255
ADAM22	53616	broad.mit.edu	37	7	87774461	87774461	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87774461G>A	uc003ujn.2	+	16	1421	c.1342G>A	c.(1342-1344)GGC>AGC	p.G448S	ADAM22_uc003ujk.1_Missense_Mutation_p.G448S|ADAM22_uc003ujl.1_Missense_Mutation_p.G448S|ADAM22_uc003ujm.2_Missense_Mutation_p.G448S|ADAM22_uc003ujo.2_Missense_Mutation_p.G448S|ADAM22_uc003ujp.1_Missense_Mutation_p.G500S	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22 isoform 1	448	Disintegrin.|Extracellular (Potential).				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TCCTGAGTGTGGCAATGGCTT	0.408					704											0.23494	95.431575	106.106498	39	127	KEEP	---	---	---	---	27	21	70	83	-1	capture	Missense_Mutation	SNP	87774461	87774461	ADAM22	7	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	244	255
ZC3HAV1	56829	broad.mit.edu	37	7	138764823	138764823	+	Silent	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138764823C>T	uc003vun.2	-	4	1252	c.864G>A	c.(862-864)GCG>GCA	p.A288A	ZC3HAV1_uc003vuo.2_5'Flank|ZC3HAV1_uc003vup.2_Silent_p.A288A	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1	288	Nuclear export signal (By similarity).				response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						CGTCCACAGGCGCGTCCTCCA	0.587																0.204268	135.774151	162.381528	67	261	KEEP	---	---	---	---	41	33	124	179	-1	capture	Silent	SNP	138764823	138764823	ZC3HAV1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	17455	255
MKRN1	23608	broad.mit.edu	37	7	140154505	140154505	+	Nonsense_Mutation	SNP	C	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140154505C>A	uc003vvt.2	-	8	1486	c.1261G>T	c.(1261-1263)GAA>TAA	p.E421*	MKRN1_uc003vvs.2_Nonsense_Mutation_p.E357*|MKRN1_uc011krd.1_Nonsense_Mutation_p.E155*	NM_013446	NP_038474	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1 isoform 1	421							ligase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.00956)					TCAATGAGTTCCCAGAAGTGG	0.468																0.145038	28.058441	43.92504	19	112	KEEP	---	---	---	---	12	9	55	80	0.428571428571	capture	Nonsense_Mutation	SNP	140154505	140154505	MKRN1	7	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	9518	255
PIWIL2	55124	broad.mit.edu	37	8	22165552	22165552	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22165552G>A	uc003xbn.2	+	14	1800	c.1652G>A	c.(1651-1653)CGT>CAT	p.R551H	PIWIL2_uc011kzf.1_Missense_Mutation_p.R551H|PIWIL2_uc010ltv.2_Missense_Mutation_p.R551H	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2	551					DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		GAACTGATGCGTTGGGGGCTC	0.453																0.140351	11.86038	18.981202	8	49	KEEP	---	---	---	---	1	8	30	27	-1	capture	Missense_Mutation	SNP	22165552	22165552	PIWIL2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11861	255
ADAM28	10863	broad.mit.edu	37	8	24181517	24181517	+	Splice_Site	SNP	G	A	A	rs138768775		TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24181517G>A	uc003xdy.2	+	9	973	c.890_splice	c.e9+1	p.T297_splice	ADAM28_uc003xdx.2_Splice_Site_p.T297_splice|ADAM28_uc011kzz.1_Splice_Site_p.T64_splice|ADAM28_uc011laa.1_Splice_Site|ADAM28_uc010lua.2_5'Flank	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1						proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		AGTTAATCACGTATGTACAGA	0.423	NSCLC(193;488 2149 22258 34798 40734)				410											0.323944	127.497709	131.405995	46	96	KEEP	---	---	---	---	26	23	59	53	-1	capture	Splice_Site	SNP	24181517	24181517	ADAM28	8	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	5	1	246	255
PTGR1	22949	broad.mit.edu	37	9	114332377	114332377	+	Silent	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114332377G>A	uc004bfh.2	-	9	976	c.873C>T	c.(871-873)GTC>GTT	p.V291V	ZNF483_uc004bfg.2_Intron|PTGR1_uc011lwr.1_Silent_p.V291V|PTGR1_uc004bfi.3_Silent_p.V291V|PTGR1_uc004bfj.3_Silent_p.V168V|PTGR1_uc010mue.2_Silent_p.V291V	NM_012212	NP_036344	Q14914	PTGR1_HUMAN	prostaglandin reductase 1 isoform 1	291					leukotriene metabolic process	cytoplasm	15-oxoprostaglandin 13-oxidase activity|2-alkenal reductase activity|alcohol dehydrogenase (NAD) activity|zinc ion binding				0						TTACCTCTAAGACCCATTTCA	0.303	Ovarian(200;132 2151 7551 19220 46064)															0.25	52.087466	56.405485	19	57	KEEP	---	---	---	---	10	11	19	49	-1	capture	Silent	SNP	114332377	114332377	PTGR1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	418	33	2	2	12648	255
TPRN	286262	broad.mit.edu	37	9	140086667	140086667	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140086667C>T	uc004clt.2	-	3	1934	c.1934G>A	c.(1933-1935)CGG>CAG	p.R645Q	TPRN_uc004clu.2_Intron	NM_173691	NP_775962	Q4KMQ1	TPRN_HUMAN	hypothetical protein LOC286262 isoform 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					sensory perception of sound	stereocilium					0						TGGGCTCGCCCGGGTGTCAGA	0.662																0.272059	95.233622	101.593138	37	99	KEEP	---	---	---	---	17	21	49	61	-1	capture	Missense_Mutation	SNP	140086667	140086667	TPRN	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16304	255
CACNA1B	774	broad.mit.edu	37	9	141012527	141012527	+	Silent	SNP	A	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:141012527A>T	uc004cog.2	+	42	6052	c.5907A>T	c.(5905-5907)GGA>GGT	p.G1969G	CACNA1B_uc004coi.2_Silent_p.G1181G	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	1969	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	GGCGGTCAGGAGCACTGGTGA	0.642																0.333333	17.914767	18.432999	7	14	KEEP	---	---	---	---	3	4	5	11	-1	capture	Silent	SNP	141012527	141012527	CACNA1B	9	A	T	T	T	1	0	0	0	0	0	0	0	1	132	11	4	4	2515	255
IL3RA	3563	broad.mit.edu	37	X	1471117	1471117	+	Silent	SNP	C	T	T	rs142385163	byFrequency	TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1471117C>T	uc004cps.2	+	5	772	c.423C>T	c.(421-423)AAC>AAT	p.N141N	IL3RA_uc011mhd.1_Silent_p.N63N	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor	141	Extracellular (Potential).					integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TGTACTTGAACGTTGCCAAGT	0.647																0.242775	97.661003	108.100363	42	131	KEEP	---	---	---	---	20	23	69	71	-1	capture	Silent	SNP	1471117	1471117	IL3RA	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7618	255
ARSE	415	broad.mit.edu	37	X	2867414	2867414	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2867414G>A	uc004crc.3	-	6	1035	c.785C>T	c.(784-786)ACG>ATG	p.T262M	ARSE_uc011mhi.1_Missense_Mutation_p.T208M|ARSE_uc011mhh.1_Missense_Mutation_p.T287M	NM_000047	NP_000038	P51690	ARSE_HUMAN	arylsulfatase E precursor	262					skeletal system development	Golgi stack	arylsulfatase activity|metal ion binding			ovary(1)|central_nervous_system(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGGCTGCTCCGTGATGGTGTG	0.532																0.171429	57.440387	75.302523	30	145	KEEP	---	---	---	---	18	15	81	85	-1	capture	Missense_Mutation	SNP	2867414	2867414	ARSE	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	983	255
GPR143	4935	broad.mit.edu	37	X	9693807	9693807	+	Silent	SNP	G	C	C			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:9693807G>C	uc004cst.1	-	9	1254	c.1254C>G	c.(1252-1254)CTC>CTG	p.L418L		NM_000273	NP_000264	P51810	GP143_HUMAN	G protein-coupled receptor 143	398	Cytoplasmic (Potential).				calcium-mediated signaling using intracellular calcium source|eye pigment biosynthetic process|melanosome organization|melanosome transport|phosphatidylinositol-mediated signaling|regulation of calcium-mediated signaling|visual perception	apical plasma membrane|Golgi apparatus|integral to membrane|lysosomal membrane|melanosome membrane|membrane fraction	dopamine binding|L-DOPA receptor activity|protein binding|tyrosine binding			ovary(1)	1		Hepatocellular(5;0.000888)				CATGGGTTGGGAGAGCAGGGT	0.473																0.192771	44.366913	51.668428	16	67	KEEP	---	---	---	---	6	10	38	42	-1	capture	Silent	SNP	9693807	9693807	GPR143	23	G	C	C	C	1	0	0	0	0	0	0	0	1	522	41	4	4	6585	255
FRMPD4	9758	broad.mit.edu	37	X	12735884	12735884	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12735884C>T	uc004cuz.1	+	16	3445	c.2939C>T	c.(2938-2940)CCG>CTG	p.P980L	FRMPD4_uc011mij.1_Missense_Mutation_p.P972L	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	980					positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						ACCGACCTCCCGCCCAAAGTT	0.572																0.262238	188.891466	203.524671	75	211	KEEP	---	---	---	---	33	44	101	128	-1	capture	Missense_Mutation	SNP	12735884	12735884	FRMPD4	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6002	255
FTSJ1	24140	broad.mit.edu	37	X	48337447	48337447	+	Missense_Mutation	SNP	A	T	T	rs75296308	byFrequency;by1000genomes	TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48337447A>T	uc004djo.1	+	5	627	c.304A>T	c.(304-306)ATC>TTC	p.I102F	FTSJ1_uc004djl.2_Missense_Mutation_p.I102F|FTSJ1_uc004djm.2_Missense_Mutation_p.I102F|FTSJ1_uc004djn.1_Missense_Mutation_p.I102F|FTSJ1_uc004djp.1_Missense_Mutation_p.I102F|FTSJ1_uc011mlw.1_5'UTR	NM_012280	NP_036412	Q9UET6	RRMJ1_HUMAN	FtsJ homolog 1 isoform a	102					RNA methylation|rRNA processing		methyltransferase activity|nucleic acid binding				0						CAAGGAGATCATCCAGCACTT	0.632																0.209677	129.972357	149.309874	52	196	KEEP	---	---	---	---	33	31	118	122	-1	capture	Missense_Mutation	SNP	48337447	48337447	FTSJ1	23	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	6029	255
PORCN	64840	broad.mit.edu	37	X	48374470	48374470	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48374470G>A	uc010nie.1	+	13	1267	c.1109G>A	c.(1108-1110)CGG>CAG	p.R370Q	PORCN_uc004djr.1_Missense_Mutation_p.R365Q|PORCN_uc004djs.1_Missense_Mutation_p.R359Q|PORCN_uc004djt.1_Missense_Mutation_p.R288Q|PORCN_uc011mlx.1_Missense_Mutation_p.R288Q|PORCN_uc004dju.1_Missense_Mutation_p.R228Q|PORCN_uc004djv.1_Missense_Mutation_p.R370Q|PORCN_uc004djw.1_Missense_Mutation_p.R364Q	NM_203475	NP_982301	Q9H237	PORCN_HUMAN	porcupine isoform D	370	Extracellular (Potential).				Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(2)|central_nervous_system(1)	3						CGCCTGGCTCGGATCCTCAGT	0.627					97											0.215686	52.636954	60.215586	22	80	KEEP	---	---	---	---	13	12	62	45	-1	capture	Missense_Mutation	SNP	48374470	48374470	PORCN	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12160	255
TSR2	90121	broad.mit.edu	37	X	54467162	54467162	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54467162G>A	uc004dte.2	+	2	123	c.121G>A	c.(121-123)GAG>AAG	p.E41K	TSR2_uc004dtf.2_Intron	NM_058163	NP_477511	Q969E8	TSR2_HUMAN	TSR2, 20S rRNA accumulation, homolog	41					rRNA processing		protein binding				0						GCACAGCCAGGAGAAGGCCAA	0.607																0.294872	58.575097	61.525182	23	55	KEEP	---	---	---	---	10	21	42	40	-1	capture	Missense_Mutation	SNP	54467162	54467162	TSR2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	16547	255
ZC3H12B	340554	broad.mit.edu	37	X	64721735	64721735	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:64721735G>A	uc010nko.2	+	5	1133	c.1124G>A	c.(1123-1125)CGT>CAT	p.R375H		NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	375							endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3						CAACCCCAGCGTTCGGTGGCT	0.532																0.255319	28.574871	31.130435	12	35	KEEP	---	---	---	---	7	8	14	23	-1	capture	Missense_Mutation	SNP	64721735	64721735	ZC3H12B	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17442	255
SLC7A3	84889	broad.mit.edu	37	X	70147393	70147393	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70147393C>T	uc004dyn.2	-	7	1282	c.1124G>A	c.(1123-1125)CGG>CAG	p.R375Q	SLC7A3_uc004dyo.2_Missense_Mutation_p.R375Q	NM_032803	NP_116192	Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid	375	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process	integral to membrane|plasma membrane				ovary(1)|kidney(1)	2	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GGTGTGGATCCGAGCAAGTAC	0.577																0.164179	18.503249	25.669057	11	56	KEEP	---	---	---	---	6	6	23	37	-1	capture	Missense_Mutation	SNP	70147393	70147393	SLC7A3	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14590	255
RAB40A	142684	broad.mit.edu	37	X	102755508	102755508	+	Silent	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:102755508G>A	uc004ekk.2	-	3	519	c.177C>T	c.(175-177)GAC>GAT	p.D59D		NM_080879	NP_543155	Q8WXH6	RB40A_HUMAN	RAB40A, member RAS oncogene family	59					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding				0						CCCGCTGGCCGTCCAGCAGGA	0.587																0.262097	156.766492	169.467357	65	183	KEEP	---	---	---	---	44	50	203	223	-1	capture	Silent	SNP	102755508	102755508	RAB40A	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12834	255
NRK	203447	broad.mit.edu	37	X	105179166	105179166	+	Silent	SNP	C	T	T	rs56273831		TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105179166C>T	uc004emd.2	+	21	3807	c.3504C>T	c.(3502-3504)TAC>TAT	p.Y1168Y	NRK_uc010npc.1_Silent_p.Y836Y	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1168							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						TTGCAGTATACGCTGGATTCG	0.383					430								HNSCC(51;0.14)			0.18125	119.548266	150.109955	58	262	KEEP	---	---	---	---	35	36	142	151	-1	capture	Silent	SNP	105179166	105179166	NRK	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10562	255
RNF128	79589	broad.mit.edu	37	X	105970562	105970562	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105970562C>T	uc004eml.2	+	1	669	c.419C>T	c.(418-420)GCG>GTG	p.A140V	RNF128_uc004emk.2_Intron	NM_194463	NP_919445	Q8TEB7	RN128_HUMAN	ring finger protein 128 isoform 1	140	PA.					endomembrane system|integral to membrane|perinuclear region of cytoplasm	zinc ion binding			ovary(1)|central_nervous_system(1)	2						GAGAGAGGGGCGTCTGGAGCC	0.597																0.114583	17.70534	45.674061	22	170	KEEP	---	---	---	---	15	11	87	111	-1	capture	Missense_Mutation	SNP	105970562	105970562	RNF128	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13328	255
DOCK11	139818	broad.mit.edu	37	X	117748686	117748686	+	Missense_Mutation	SNP	T	C	C			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:117748686T>C	uc004eqp.2	+	29	3191	c.3128T>C	c.(3127-3129)ATT>ACT	p.I1043T	DOCK11_uc004eqq.2_Missense_Mutation_p.I809T	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1043					blood coagulation	cytosol	GTP binding			ovary(3)	3						AGAGGATTTATTTTCAATTTA	0.299																0.237852	244.91671	269.535561	93	298	KEEP	---	---	---	---	47	61	170	180	-1	capture	Missense_Mutation	SNP	117748686	117748686	DOCK11	23	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	4642	255
USP26	83844	broad.mit.edu	37	X	132161937	132161937	+	Silent	SNP	G	A	A	rs142413133	byFrequency	TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:132161937G>A	uc010nrm.1	-	6	782	c.312C>T	c.(310-312)AAC>AAT	p.N104N	USP26_uc011mvf.1_Silent_p.N104N	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26	104					protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8	Acute lymphoblastic leukemia(192;0.000127)					GCTGAACCTCGTTTTGATGAA	0.383	NSCLC(104;342 1621 36940 47097 52632)															0.247619	124.992829	137.168672	52	158	KEEP	---	---	---	---	22	34	82	103	-1	capture	Silent	SNP	132161937	132161937	USP26	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16939	255
ZNF75D	7626	broad.mit.edu	37	X	134426220	134426220	+	Silent	SNP	A	G	G			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134426220A>G	uc004eyp.2	-	4	3246	c.591T>C	c.(589-591)CCT>CCC	p.P197P	ZNF75D_uc004eym.2_Intron|ZNF75D_uc004eyn.2_5'UTR|ZNF75D_uc004eyo.2_Intron	NM_007131	NP_009062	P51815	ZN75D_HUMAN	zinc finger protein 75	197					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TTTCATATACAGGCTGGGTTT	0.463																0.204678	167.453698	195.130799	70	272	KEEP	---	---	---	---	40	37	169	193	-1	capture	Silent	SNP	134426220	134426220	ZNF75D	23	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	18011	255
PASD1	139135	broad.mit.edu	37	X	150840069	150840069	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:150840069G>A	uc004fev.3	+	13	1587	c.1255G>A	c.(1255-1257)GTT>ATT	p.V419I		NM_173493	NP_775764	Q8IV76	PASD1_HUMAN	PAS domain containing 1	419						nucleus	signal transducer activity			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ATTACGCCACGTTGTCATTCC	0.498																0.282555	301.347768	318.639104	115	292	KEEP	---	---	---	---	67	75	175	164	-1	capture	Missense_Mutation	SNP	150840069	150840069	PASD1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11374	255
CDC27	996	broad.mit.edu	37	17	45219612	45219612	+	Frame_Shift_Del	DEL	A	-	-			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45219612delA	uc002ild.3	-	11	1488	c.1361delT	c.(1360-1362)CTAfs	p.L454fs	CDC27_uc002ile.3_Frame_Shift_Del_p.L460fs|CDC27_uc002ilf.3_Frame_Shift_Del_p.L454fs|CDC27_uc010wkp.1_Frame_Shift_Del_p.L393fs|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	454					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TGCTTTTTGTAGATTAAAGGC	0.308																0.07			7	99		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	45219612	45219612	CDC27	17	A	-	-	-	1	0	1	0	1	0	0	0	0	195	15	5	5	3037	255
ZNF181	339318	broad.mit.edu	37	19	35232834	35232839	+	In_Frame_Del	DEL	ATATAA	-	-			TCGA-41-3393-01	TCGA-41-3393-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35232834_35232839delATATAA	uc002nvu.3	+	4	2011_2016	c.1548_1553delATATAA	c.(1546-1554)CCATATAAA>CCA	p.YK517del	ZNF181_uc010xsa.1_In_Frame_Del_p.YK516del|ZNF181_uc010xsb.1_In_Frame_Del_p.YK516del|ZNF181_uc010xsc.1_In_Frame_Del_p.YK452del	NM_001029997	NP_001025168	Q2M3W8	ZN181_HUMAN	zinc finger protein 181 isoform 1	517_518	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			GAGAAAAGCCATATAAATGTAATGAG	0.388																0.14			27	172		---	---	---	---						capture_indel	In_Frame_Del	DEL	35232834	35232839	ZNF181	19	ATATAA	-	-	-	1	0	1	0	1	0	0	0	0	93	8	5	5	17629	255
