Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TNFRSF4	7293	broad.mit.edu	37	1	1149428	1149428	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1149428G>A	uc001ade.2	-	1	85	c.80C>T	c.(79-81)ACG>ATG	p.T27M	TNFRSF4_uc001adf.2_Translation_Start_Site	NM_003327	NP_003318	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily,	27					immune response|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of immunoglobulin secretion|T cell proliferation	integral to plasma membrane	tumor necrosis factor receptor activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GTGGAGCCCCGTCACGGTGCT	0.726					139											0.416667	13.571936	13.64488	5	7	KEEP	---	---	---	---	3	3	3	4	-1	capture	Missense_Mutation	SNP	1149428	1149428	TNFRSF4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16180	256
KAZ	23254	broad.mit.edu	37	1	15370623	15370623	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:15370623C>T	uc001avm.3	+	4	975	c.694C>T	c.(694-696)CGG>TGG	p.R232W	KAZ_uc009vog.1_Missense_Mutation_p.R232W|KAZ_uc010obj.1_Missense_Mutation_p.R232W|KAZ_uc001avo.2_Missense_Mutation_p.R226W|KAZ_uc001avp.2_Missense_Mutation_p.R138W|KAZ_uc001avq.2_Missense_Mutation_p.R138W|KAZ_uc001avr.2_Missense_Mutation_p.R135W	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E	232	Interaction with PPL.|Potential.				keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						CAAGGACAACCGGATGAAGGA	0.677																0.020979	-30.293101	6.413087	3	140	KEEP	---	---	---	---	4	1	74	102	-1	capture	Missense_Mutation	SNP	15370623	15370623	KAZ	1	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	7911	256
ARID1A	8289	broad.mit.edu	37	1	27092731	27092731	+	Missense_Mutation	SNP	A	G	G	rs141432631		TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:27092731A>G	uc001bmv.1	+	9	3125	c.2752A>G	c.(2752-2754)ATG>GTG	p.M918V	ARID1A_uc001bmt.1_Missense_Mutation_p.M918V|ARID1A_uc001bmu.1_Missense_Mutation_p.M918V|ARID1A_uc001bmw.1_Missense_Mutation_p.M535V	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	918					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CTACCCCAATATGAATCAAGG	0.483					478	Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								0.021429	-29.494696	6.343039	3	137	KEEP	---	---	---	---	1	2	78	86	-1	capture	Missense_Mutation	SNP	27092731	27092731	ARID1A	1	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	906	256
FAM159A	348378	broad.mit.edu	37	1	53099192	53099192	+	Silent	SNP	G	C	C			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53099192G>C	uc001cuf.2	+	1	127	c.27G>C	c.(25-27)GTG>GTC	p.V9V	FAM159A_uc001cug.1_RNA|FAM159A_uc001cuh.2_RNA	NM_001042693	NP_001036158	Q6UWV7	F159A_HUMAN	hypothetical protein LOC348378	9						integral to membrane					0						CGAGCTACGTGAGCGCAGAGC	0.617					22											0.181818	5.942971	6.989255	2	9	KEEP	---	---	---	---	2	0	3	8	-1	capture	Silent	SNP	53099192	53099192	FAM159A	1	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	5422	256
WDR63	126820	broad.mit.edu	37	1	85559260	85559260	+	Missense_Mutation	SNP	A	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85559260A>T	uc001dkt.2	+	9	1168	c.977A>T	c.(976-978)CAG>CTG	p.Q326L	WDR63_uc009wcl.2_Missense_Mutation_p.Q287L	NM_145172	NP_660155	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	326										upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		AAAGAGTACCAGTCCTTTACC	0.438																0.239216	160.648687	176.480641	61	194	KEEP	---	---	---	---	37	37	119	113	-1	capture	Missense_Mutation	SNP	85559260	85559260	WDR63	1	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	17195	256
WDR63	126820	broad.mit.edu	37	1	85592202	85592202	+	Silent	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85592202G>A	uc001dkt.2	+	20	2312	c.2121G>A	c.(2119-2121)CCG>CCA	p.P707P	WDR63_uc009wcl.2_Silent_p.P668P	NM_145172	NP_660155	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	707	WD 3.									upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		AGACTGGACCGCTCCTTCAGT	0.423																0.303571	46.45464	48.382477	17	39	KEEP	---	---	---	---	8	12	25	19	-1	capture	Silent	SNP	85592202	85592202	WDR63	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17195	256
NBPF10	100132406	broad.mit.edu	37	1	145367767	145367767	+	Missense_Mutation	SNP	G	A	A	rs77484671		TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145367767G>A	uc001end.3	+	85	10623	c.10588G>A	c.(10588-10590)GAA>AAA	p.E3530K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3455											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		atcaaagaaggaaagaagaag	0.254																0.049383	-10.273523	7.207412	4	77	KEEP	---	---	---	---	1	4	55	50	-1	capture	Missense_Mutation	SNP	145367767	145367767	NBPF10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10100	256
TDRKH	11022	broad.mit.edu	37	1	151748582	151748582	+	Missense_Mutation	SNP	T	C	C			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151748582T>C	uc009wnb.1	-	8	1389	c.1207A>G	c.(1207-1209)AGG>GGG	p.R403G	TDRKH_uc001eyy.2_Missense_Mutation_p.R179G|TDRKH_uc001ezb.3_Missense_Mutation_p.R399G|TDRKH_uc001ezc.3_Missense_Mutation_p.R358G|TDRKH_uc001eza.3_Missense_Mutation_p.R403G|TDRKH_uc001ezd.3_Missense_Mutation_p.R403G|TDRKH_uc010pdn.1_Missense_Mutation_p.R179G	NM_006862	NP_006853	Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing isoform a	403	Tudor.						RNA binding			ovary(1)|pancreas(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTGAGAGCCCTGAGGTCCTTC	0.537																0.038095	-15.3949	8.832919	4	101	KEEP	---	---	---	---	0	4	58	64	-1	capture	Missense_Mutation	SNP	151748582	151748582	TDRKH	1	T	C	C	C	1	0	0	0	0	1	0	0	0	713	55	3	3	15622	256
CR2	1380	broad.mit.edu	37	1	207643227	207643227	+	Nonsense_Mutation	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207643227G>A	uc001hfw.2	+	6	1099	c.1005G>A	c.(1003-1005)TGG>TGA	p.W335*	CR2_uc001hfv.2_Nonsense_Mutation_p.W335*|CR2_uc009xch.2_Nonsense_Mutation_p.W335*|CR2_uc009xci.1_5'Flank	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	335	Sushi 5.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						CTGGGACCTGGAGTGGCCCTG	0.522																0.048193	-11.559294	6.466449	4	79	KEEP	---	---	---	---	3	1	48	34	-1	capture	Nonsense_Mutation	SNP	207643227	207643227	CR2	1	G	A	A	A	1	0	0	0	0	0	1	0	0	533	41	5	2	3807	256
OR1C1	26188	broad.mit.edu	37	1	247920937	247920937	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247920937C>T	uc010pza.1	-	1	772	c.772G>A	c.(772-774)GTC>ATC	p.V258I		NM_012353	NP_036485	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CTGAAATAGACGGCGATGGCT	0.512																0.360825	97.514591	99.161304	35	62	KEEP	---	---	---	---	20	19	33	41	-1	capture	Missense_Mutation	SNP	247920937	247920937	OR1C1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10856	256
HKDC1	80201	broad.mit.edu	37	10	71025477	71025477	+	Silent	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:71025477C>T	uc001jpf.3	+	17	2642	c.2509C>T	c.(2509-2511)CTG>TTG	p.L837L	HKDC1_uc010qje.1_Silent_p.L700L|HKDC1_uc009xqb.2_RNA	NM_025130	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	837					glycolysis	mitochondrion|nucleus	ATP binding|hexokinase activity			ovary(4)|skin(1)	5						CGGTGCTGGCCTGGCCGCTAT	0.642																0.215686	3.134299	7.193452	11	40	KEEP	---	---	---	---	11	8	32	26	-1	capture	Silent	SNP	71025477	71025477	HKDC1	10	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	7118	256
PTEN	5728	broad.mit.edu	37	10	89692905	89692905	+	Missense_Mutation	SNP	G	A	A	rs121913292		TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692905G>A	uc001kfb.2	+	6	1420	c.389G>A	c.(388-390)CGA>CAA	p.R130Q		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	130	Phosphatase tensin-type.		R -> L (in CD and endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> Q (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> G (loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3).	R->M: Does not affect the ability to inhibit AKT/PKB activation.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R130G(65)|p.R130*(61)|p.R130Q(43)|p.R130fs*4(12)|p.R130L(7)|p.R55fs*1(4)|p.R130P(4)|p.K128_R130del(3)|p.Y27_N212>Y(2)|p.?(2)|p.Y27fs*1(2)|p.R130R(1)|p.K128fs*47(1)|p.A121_F145del(1)|p.R130fs*2(1)|p.T131fs*50(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GGAAAGGGACGAACTGGTGTA	0.403		R130Q(MDAPCA2B_PROSTATE)|R130Q(MFE296_ENDOMETRIUM)|R130fs*4(AN3CA_ENDOMETRIUM)|R130Q(JHUEM1_ENDOMETRIUM)	31	p.R130Q(MFE296-Tumor)|p.R130Q(JHUEM1-Tumor)|p.R130Q(SNU81-Tumor)|p.R130Q(639V-Tumor)|p.R130fs(AN3CA-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.714286	409.734255	416.939443	125	50	KEEP	---	---	---	---	59	84	27	32	-1	capture	Missense_Mutation	SNP	89692905	89692905	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12633	256
PDZD7	79955	broad.mit.edu	37	10	102789812	102789812	+	Silent	SNP	G	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:102789812G>T	uc001kso.1	-	2	380	c.165C>A	c.(163-165)CCC>CCA	p.P55P	PDZD7_uc001ksn.2_Silent_p.P55P|SFXN3_uc001ksp.2_5'Flank|SFXN3_uc001ksq.2_5'Flank|SFXN3_uc010qpx.1_5'Flank	NM_024895	NP_079171	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	55						cilium|nucleus	protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		GGATTCCGCGGGGGGGCCCGT	0.662																0.207317	28.933084	35.450744	17	65	KEEP	---	---	---	---	11	10	60	43	0.52380952381	capture	Silent	SNP	102789812	102789812	PDZD7	10	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	11607	256
HPS6	79803	broad.mit.edu	37	10	103827208	103827208	+	Silent	SNP	C	G	G			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:103827208C>G	uc001kuj.2	+	1	2062	c.1977C>G	c.(1975-1977)CTC>CTG	p.L659L		NM_024747	NP_079023	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome-6	659						cytosol|early endosome membrane|endoplasmic reticulum|microsome					0		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		GCCTGGCCCTCGGCCCCTCCA	0.617												Hermansky-Pudlak_syndrome				0.034483	-24.459657	9.894359	5	140	KEEP	---	---	---	---	3	2	68	79	-1	capture	Silent	SNP	103827208	103827208	HPS6	10	C	G	G	G	1	0	0	0	0	0	0	0	1	392	31	4	4	7268	256
KIAA1598	57698	broad.mit.edu	37	10	118728190	118728190	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:118728190C>T	uc009xyw.2	-	3	643	c.145G>A	c.(145-147)GTT>ATT	p.V49I	KIAA1598_uc001lcz.3_Missense_Mutation_p.V49I|KIAA1598_uc010qso.1_5'UTR|KIAA1598_uc010qsp.1_Missense_Mutation_p.V49I|KIAA1598_uc010qsq.1_5'UTR|KIAA1598_uc001lcy.3_Missense_Mutation_p.V19I	NM_001127211	NP_001120683	A0MZ66	SHOT1_HUMAN	shootin1 isoform a	49	Potential.				axon guidance	axon					0				all cancers(201;0.00494)		AGTTTTTTAACGGCTTCATCT	0.323																0.352941	16.042922	16.367968	6	11	KEEP	---	---	---	---	4	3	7	6	-1	capture	Missense_Mutation	SNP	118728190	118728190	KIAA1598	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8168	256
SYCE1	93426	broad.mit.edu	37	10	135370273	135370273	+	Missense_Mutation	SNP	C	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135370273C>A	uc001lno.2	-	8	623	c.518G>T	c.(517-519)TGG>TTG	p.W173L	CYP2E1_uc001lnl.1_3'UTR|SYCE1_uc001lnm.2_Missense_Mutation_p.W45L|SYCE1_uc009ybn.2_Missense_Mutation_p.W173L|SYCE1_uc001lnn.2_Missense_Mutation_p.W137L	NM_001143764	NP_001137236	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	173	Potential.				cell division	central element				ovary(1)	1		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		GTGGAAGTCCCAGAGGTCCTT	0.512																0.181818	5.34364	6.389479	2	9	KEEP	---	---	---	---	2	0	7	6	-1	capture	Missense_Mutation	SNP	135370273	135370273	SYCE1	10	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	15316	256
DENND5A	23258	broad.mit.edu	37	11	9171674	9171674	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:9171674G>A	uc001mhl.2	-	15	2944	c.2689C>T	c.(2689-2691)CTT>TTT	p.L897F	DENND5A_uc001mhk.2_Missense_Mutation_p.L240F|DENND5A_uc010rbw.1_Missense_Mutation_p.L897F|DENND5A_uc010rbx.1_RNA	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1	897	RUN 1.									liver(1)	1						TGTCTGGAAAGTAACTTTTTT	0.517																0.141304	21.520137	32.93403	13	79	KEEP	---	---	---	---	8	6	43	42	-1	capture	Missense_Mutation	SNP	9171674	9171674	DENND5A	11	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	4394	256
OR4C11	219429	broad.mit.edu	37	11	55371464	55371464	+	Missense_Mutation	SNP	C	T	T	rs146220981	byFrequency	TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55371464C>T	uc010rii.1	-	1	386	c.386G>A	c.(385-387)CGT>CAT	p.R129H		NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C,	129	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GGTTGGGTAACGCAAGGGCTT	0.458																0.323944	119.852269	123.732864	46	96	KEEP	---	---	---	---	23	28	47	55	-1	capture	Missense_Mutation	SNP	55371464	55371464	OR4C11	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10949	256
PRG2	5553	broad.mit.edu	37	11	57156544	57156544	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57156544G>A	uc001njz.2	-	2	332	c.305C>T	c.(304-306)CCT>CTT	p.P102L	PRG2_uc001njw.1_RNA|PRG2_uc001njx.1_RNA|PRG2_uc001njy.1_RNA|PRG2_uc001nka.2_Missense_Mutation_p.P102L|PRG2_uc001nkb.2_Missense_Mutation_p.P102L|PRG2_uc001nkd.2_Missense_Mutation_p.P102L|PRG2_uc001nkc.2_Missense_Mutation_p.P102L|PRG2_uc001nke.2_Missense_Mutation_p.P382L	NM_002728	NP_002719	P13727	PRG2_HUMAN	proteoglycan 2 preproprotein	102					defense response to bacterium|immune response	extracellular region|transport vesicle	heparin binding|sugar binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	CTGGCACCCAGGGATGCCCAC	0.532																0.037975	-23.995132	12.491423	6	152	KEEP	---	---	---	---	4	5	73	100	-1	capture	Missense_Mutation	SNP	57156544	57156544	PRG2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	12375	256
PRG2	5553	broad.mit.edu	37	11	57156546	57156546	+	Silent	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57156546G>A	uc001njz.2	-	2	330	c.303C>T	c.(301-303)ATC>ATT	p.I101I	PRG2_uc001njw.1_RNA|PRG2_uc001njx.1_RNA|PRG2_uc001njy.1_RNA|PRG2_uc001nka.2_Silent_p.I101I|PRG2_uc001nkb.2_Silent_p.I101I|PRG2_uc001nkd.2_Silent_p.I101I|PRG2_uc001nkc.2_Silent_p.I101I|PRG2_uc001nke.2_Silent_p.I381I	NM_002728	NP_002719	P13727	PRG2_HUMAN	proteoglycan 2 preproprotein	101					defense response to bacterium|immune response	extracellular region|transport vesicle	heparin binding|sugar binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	GGCACCCAGGGATGCCCACCA	0.537																0.044025	-22.91725	12.490302	7	152	KEEP	---	---	---	---	4	6	71	104	-1	capture	Silent	SNP	57156546	57156546	PRG2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	525	41	2	2	12375	256
MS4A14	84689	broad.mit.edu	37	11	60184319	60184319	+	Silent	SNP	C	T	T	rs147367847	byFrequency	TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60184319C>T	uc001npj.2	+	5	2443	c.1878C>T	c.(1876-1878)GCC>GCT	p.A626A	MS4A14_uc001npi.2_Silent_p.A514A|MS4A14_uc001npn.2_Silent_p.A364A|MS4A14_uc001npk.2_Silent_p.A609A|MS4A14_uc001npl.2_Silent_p.A364A|MS4A14_uc001npm.2_Silent_p.A364A	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	626	Gln-rich.					integral to membrane	receptor activity			breast(1)	1						ATGTTCAAGCCGAAGGACAGC	0.458																0.534483	104.729632	104.789698	31	27	KEEP	---	---	---	---	12	19	12	19	-1	capture	Silent	SNP	60184319	60184319	MS4A14	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9768	256
MEN1	4221	broad.mit.edu	37	11	64572600	64572600	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64572600C>T	uc001obj.2	-	9	1344	c.1271G>A	c.(1270-1272)GGC>GAC	p.G424D	MAP4K2_uc001obh.2_5'Flank|MAP4K2_uc001obi.2_5'Flank|MAP4K2_uc010rnp.1_5'Flank|MEN1_uc001obk.2_Missense_Mutation_p.G424D|MEN1_uc001obl.2_Missense_Mutation_p.G384D|MEN1_uc001obm.2_Missense_Mutation_p.G419D|MEN1_uc001obn.2_Missense_Mutation_p.G424D|MEN1_uc001obo.2_Missense_Mutation_p.G424D|MEN1_uc001obp.2_Missense_Mutation_p.G419D|MEN1_uc001obq.2_Missense_Mutation_p.G424D|MEN1_uc001obr.2_Missense_Mutation_p.G424D	NM_130800	NP_570712	O00255	MEN1_HUMAN	menin isoform 1	424			Missing (in MEN1).		DNA repair|histone lysine methylation|MAPKKK cascade|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of JNK cascade|negative regulation of osteoblast differentiation|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of telomerase activity|negative regulation of transcription from RNA polymerase II promoter|osteoblast development|positive regulation of protein binding|positive regulation of transforming growth factor beta receptor signaling pathway|response to gamma radiation|response to UV|transcription, DNA-dependent	chromatin|cleavage furrow|cytosol|histone methyltransferase complex|nuclear matrix|soluble fraction	double-stranded DNA binding|four-way junction DNA binding|protein binding, bridging|protein N-terminus binding|R-SMAD binding|transcription regulatory region DNA binding|Y-form DNA binding	p.L414_E425del(1)|p.G419fs*26(1)		parathyroid(105)|pancreas(64)|gastrointestinal_tract_(site_indeterminate)(15)|small_intestine(13)|lung(9)|pituitary(7)|NS(7)|adrenal_gland(5)|soft_tissue(4)|central_nervous_system(4)|thymus(2)|stomach(1)|retroperitoneum(1)|skin(1)	238						TTTGCAGATGCCGTCGTAGAA	0.637	Esophageal Squamous(1;83 158 15500 18603 18803 29295)				75	D|Mis|N|F|S		parathyroid tumors|Pancreatic neuroendocrine tumors	parathyroid adenoma|pituitary adenoma|pancreatic islet cell|carcinoid			Hyperparathyroidism_Familial_Isolated|Multiple_Endocrine_Neoplasia_type_1				0.094118	2.934193	17.00844	8	77	KEEP	---	---	---	---	3	6	47	42	-1	capture	Missense_Mutation	SNP	64572600	64572600	MEN1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9385	256
KDM4DL	390245	broad.mit.edu	37	11	94758834	94758834	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94758834A>G	uc010ruf.1	+	1	413	c.113A>G	c.(112-114)CAA>CGA	p.Q38R		NM_001161630	NP_001155102	B2RXH2	KD4DL_HUMAN	lysine (K)-specific demethylase 4D-like	38	JmjN.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						ATGGAGTCCCAAGGCGCACAT	0.463																0.5	6.350008	6.350007	2	2	KEEP	---	---	---	---	1	1	2	0	-1	capture	Missense_Mutation	SNP	94758834	94758834	KDM4DL	11	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	8054	256
ATM	472	broad.mit.edu	37	11	108183214	108183214	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108183214A>G	uc001pkb.1	+	40	6380	c.5995A>G	c.(5995-5997)ATA>GTA	p.I1999V	ATM_uc009yxr.1_Missense_Mutation_p.I1999V|C11orf65_uc010rvx.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.I651V|ATM_uc001pkg.1_Missense_Mutation_p.I356V|ATM_uc009yxt.1_Missense_Mutation_p.I113V	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	1999	FAT.				cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		AGAAACTGGAATAAGTTTACA	0.328					1073	D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			0.027027	-20.372113	7.043978	3	108	KEEP	---	---	---	---	0	3	53	67	-1	capture	Missense_Mutation	SNP	108183214	108183214	ATM	11	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	1100	256
IFLTD1	160492	broad.mit.edu	37	12	25699396	25699396	+	Missense_Mutation	SNP	T	C	C			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:25699396T>C	uc001rgs.2	-	3	490	c.340A>G	c.(340-342)AAG>GAG	p.K114E	IFLTD1_uc001rgt.1_Missense_Mutation_p.K17E|IFLTD1_uc010sji.1_Missense_Mutation_p.K135E|IFLTD1_uc010sjj.1_Missense_Mutation_p.K51E|IFLTD1_uc009zjc.2_Missense_Mutation_p.K135E	NM_152590	NP_689803	Q8N9Z9	ILFT1_HUMAN	intermediate filament tail domain containing 1	114						intermediate filament	structural molecule activity			ovary(2)|central_nervous_system(1)	3	all_lung(3;2.75e-22)|Lung NSC(3;1.77e-21)|all_hematologic(7;0.00656)|Colorectal(261;0.0847)					GTAAGTTTCTTTGAATCACCA	0.373																0.258824	71.418715	75.89161	22	63	KEEP	---	---	---	---	13	10	30	36	-1	capture	Missense_Mutation	SNP	25699396	25699396	IFLTD1	12	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	7455	256
CPNE8	144402	broad.mit.edu	37	12	39268300	39268300	+	Nonsense_Mutation	SNP	T	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:39268300T>A	uc001rls.1	-	2	196	c.112A>T	c.(112-114)AGA>TGA	p.R38*		NM_153634	NP_705898	Q86YQ8	CPNE8_HUMAN	copine VIII	38	C2 1.									pancreas(1)	1	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				AATGTGTCTCTGTCAAGAAGA	0.264																0.367347	58.537698	59.295596	18	31	KEEP	---	---	---	---	10	13	16	26	-1	capture	Nonsense_Mutation	SNP	39268300	39268300	CPNE8	12	T	A	A	A	1	0	0	0	0	0	1	0	0	713	55	5	4	3783	256
DIP2B	57609	broad.mit.edu	37	12	51102260	51102260	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:51102260A>G	uc001rwv.2	+	22	2720	c.2564A>G	c.(2563-2565)TAT>TGT	p.Y855C	DIP2B_uc009zlt.2_Missense_Mutation_p.Y285C	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B	855						nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						TCTGTATTTTATGATGAGCGC	0.448																0.068966	1.344625	6.89524	2	27	KEEP	---	---	---	---	0	2	15	21	-1	capture	Missense_Mutation	SNP	51102260	51102260	DIP2B	12	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	4486	256
SDR9C7	121214	broad.mit.edu	37	12	57324008	57324008	+	Splice_Site	SNP	A	G	G			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57324008A>G	uc010sqw.1	-	2	560	c.560_splice	c.e2+1	p.R187_splice		NM_148897	NP_683695	Q8NEX9	DR9C7_HUMAN	short chain dehydrogenase/reductase family 9C,							cytoplasm	binding|oxidoreductase activity			central_nervous_system(1)	1						GGGCCCAGTTACCTTATGCTG	0.537																0.026217	-51.077262	15.180975	7	260	KEEP	---	---	---	---	5	3	120	165	-1	capture	Splice_Site	SNP	57324008	57324008	SDR9C7	12	A	G	G	G	1	0	0	0	0	0	0	1	0	182	14	5	3	13867	256
TUBA3C	7278	broad.mit.edu	37	13	19748215	19748215	+	Missense_Mutation	SNP	T	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:19748215T>A	uc009zzj.2	-	5	1190	c.1141A>T	c.(1141-1143)ACC>TCC	p.T381S		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	381					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		ATGGCCGTGGTGTTGCTCAGC	0.627																0.195402	38.331791	45.852253	17	70	KEEP	---	---	---	---	8	11	28	47	-1	capture	Missense_Mutation	SNP	19748215	19748215	TUBA3C	13	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	16628	256
AHNAK2	113146	broad.mit.edu	37	14	105413630	105413630	+	Missense_Mutation	SNP	G	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105413630G>T	uc010axc.1	-	7	8278	c.8158C>A	c.(8158-8160)CAC>AAC	p.H2720N	AHNAK2_uc001ypx.2_Missense_Mutation_p.H2620N	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2720						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCGGGAACGTGGCCCTCTGGG	0.602																0.263492	200.404779	216.333911	83	232	KEEP	---	---	---	---	40	44	125	129	0.47619047619	capture	Missense_Mutation	SNP	105413630	105413630	AHNAK2	14	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	415	256
LBXCOR1	390598	broad.mit.edu	37	15	68118619	68118619	+	Silent	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:68118619C>T	uc002aqy.1	+	2	426	c.426C>T	c.(424-426)TGC>TGT	p.C142C		NM_001031807	NP_001026977	P84550	SKOR1_HUMAN	transcriptional corepressor Corl1	151					negative regulation of BMP signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|dendrite|neuronal cell body|nucleus	nucleotide binding|SMAD binding|transcription repressor activity				0						CGCGCCGCTGCGGCATGATCA	0.662																0.065789	-5.287638	9.586571	5	71	KEEP	---	---	---	---	2	3	28	54	-1	capture	Silent	SNP	68118619	68118619	LBXCOR1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	8575	256
ADAMTS7	11173	broad.mit.edu	37	15	79083051	79083051	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:79083051G>A	uc002bej.3	-	6	1200	c.989C>T	c.(988-990)GCC>GTC	p.A330V	ADAMTS7_uc010und.1_Missense_Mutation_p.A330V|ADAMTS7_uc002bek.1_Missense_Mutation_p.A330V	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	330	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						CAGGGGATGGGCATCCCCCTT	0.592																0.027211	-29.434284	6.847474	4	143	KEEP	---	---	---	---	4	0	69	91	-1	capture	Missense_Mutation	SNP	79083051	79083051	ADAMTS7	15	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	271	256
OR4F15	390649	broad.mit.edu	37	15	102358715	102358715	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:102358715G>A	uc010uts.1	+	1	326	c.326G>A	c.(325-327)GGC>GAC	p.G109D		NM_001001674	NP_001001674	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F,	109	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			GCTCTTGGGGGCACTGAGATG	0.458																0.028571	-26.513588	7.727912	4	136	KEEP	---	---	---	---	4	0	66	76	-1	capture	Missense_Mutation	SNP	102358715	102358715	OR4F15	15	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10965	256
SRL	6345	broad.mit.edu	37	16	4242554	4242554	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4242554C>T	uc002cvz.3	-	6	1035	c.1022G>A	c.(1021-1023)CGC>CAC	p.R341H	SRL_uc002cvy.3_RNA	NM_001098814	NP_001092284	Q86TD4	SRCA_HUMAN	sarcalumenin	800						sarcoplasmic reticulum lumen	GTP binding|GTPase activity			ovary(3)|skin(2)	5						GGCGTGGATGCGGACCCGGAT	0.512																0.019126	-85.588318	9.55765	7	359	KEEP	---	---	---	---	3	4	214	270	-1	capture	Missense_Mutation	SNP	4242554	4242554	SRL	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15042	256
ZFP3	124961	broad.mit.edu	37	17	4995064	4995064	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:4995064A>G	uc002gaq.2	+	2	390	c.265A>G	c.(265-267)AAT>GAT	p.N89D		NM_153018	NP_694563	Q96NJ6	ZFP3_HUMAN	zinc finger protein-3	89					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCGGGAGAATAATGAGAGTGA	0.468																0.020833	-18.033509	6.632663	2	94	KEEP	---	---	---	---	0	2	54	51	-1	capture	Missense_Mutation	SNP	4995064	4995064	ZFP3	17	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	17523	256
ZNF287	57336	broad.mit.edu	37	17	16455757	16455757	+	Missense_Mutation	SNP	T	C	C			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:16455757T>C	uc002gqi.2	-	6	2152	c.1699A>G	c.(1699-1701)AAT>GAT	p.N567D		NM_020653	NP_065704	Q9HBT7	ZN287_HUMAN	zinc finger protein 287	560	C2H2-type 8.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		CCACATTCATTACATTTATAA	0.353																0.021898	-28.493522	6.468176	3	134	KEEP	---	---	---	---	1	3	84	67	-1	capture	Missense_Mutation	SNP	16455757	16455757	ZNF287	17	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	17705	256
RAI1	10743	broad.mit.edu	37	17	17697187	17697187	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:17697187G>A	uc002grm.2	+	3	1394	c.925G>A	c.(925-927)GCC>ACC	p.A309T	RAI1_uc002grn.1_Missense_Mutation_p.A309T	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	309	Gln-rich.					cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		CCAAAACCTCGCCAAGTATCA	0.493																0.038674	-29.02919	12.590323	7	174	KEEP	---	---	---	---	4	4	108	90	-1	capture	Missense_Mutation	SNP	17697187	17697187	RAI1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12902	256
KRT37	8688	broad.mit.edu	37	17	39577227	39577227	+	Missense_Mutation	SNP	T	C	C			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39577227T>C	uc002hwp.1	-	7	1300	c.1253A>G	c.(1252-1254)AAT>AGT	p.N418S	uc002hwo.1_Intron	NM_003770	NP_003761	O76014	KRT37_HUMAN	keratin 37	418	Tail.					intermediate filament	structural molecule activity			skin(1)	1		Breast(137;0.000496)				GGAACAGGGATTGCAGGGGAG	0.547																0.362832	143.658927	145.523583	41	72	KEEP	---	---	---	---	24	22	41	35	-1	capture	Missense_Mutation	SNP	39577227	39577227	KRT37	17	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	8394	256
STXBP4	252983	broad.mit.edu	37	17	53237217	53237217	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:53237217G>A	uc002iuf.1	+	18	1814	c.1607G>A	c.(1606-1608)CGC>CAC	p.R536H	STXBP4_uc010dcd.1_Missense_Mutation_p.R514H	NM_178509	NP_848604	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	536						cytoplasm	calcium ion binding			ovary(1)	1						AATCTATCTCGCTCAGAGGAG	0.438																0.142857	27.891166	42.52151	17	102	KEEP	---	---	---	---	7	14	56	69	-1	capture	Missense_Mutation	SNP	53237217	53237217	STXBP4	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15245	256
CBX2	84733	broad.mit.edu	37	17	77758112	77758112	+	Silent	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77758112G>A	uc002jxc.2	+	5	912	c.870G>A	c.(868-870)CTG>CTA	p.L290L		NM_005189	NP_005180	Q14781	CBX2_HUMAN	chromobox homolog 2 isoform 1	290					cell differentiation|chromatin modification|development of primary sexual characteristics|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	PcG protein complex	DNA binding				0			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GGCTGGACCTGAAGGTGAGGA	0.637																0.035714	-13.350475	6.316567	3	81	KEEP	---	---	---	---	1	2	39	53	-1	capture	Silent	SNP	77758112	77758112	CBX2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	2692	256
SPPL2B	56928	broad.mit.edu	37	19	2339146	2339146	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2339146A>G	uc002lvs.2	+	5	618	c.538A>G	c.(538-540)ATC>GTC	p.I180V	SPPL2B_uc010dsw.1_Missense_Mutation_p.I152V|SPPL2B_uc010dsy.1_Missense_Mutation_p.I152V|SPPL2B_uc010dsz.1_Missense_Mutation_p.I180V|SPPL2B_uc002lvr.2_Missense_Mutation_p.I180V|SPPL2B_uc010dta.1_Missense_Mutation_p.I33V|SPPL2B_uc002lvu.2_5'Flank	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN	signal peptide peptidase-like 2B isoform 2	180	Helical; (Potential).					Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CATCATCTTCATCATGGCTGT	0.632																0.35	19.31523	19.713861	7	13	KEEP	---	---	---	---	7	8	15	12	-1	capture	Missense_Mutation	SNP	2339146	2339146	SPPL2B	19	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	14981	256
FBXL12	54850	broad.mit.edu	37	19	9921852	9921852	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9921852C>T	uc002mme.2	-	3	943	c.701G>A	c.(700-702)CGG>CAG	p.R234Q	FBXL12_uc002mmd.2_Missense_Mutation_p.R181Q|FBXL12_uc002mmf.2_Missense_Mutation_p.R181Q|FBXL12_uc002mmg.2_Missense_Mutation_p.R181Q|FBXL12_uc002mmh.2_Missense_Mutation_p.R181Q	NM_017703	NP_060173	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12	234	LRR 6.						protein binding			lung(1)|kidney(1)	2						CACGGTCAGCCGGATCTTGCG	0.667																0.035294	-13.538135	6.399503	3	82	KEEP	---	---	---	---	2	1	47	63	-1	capture	Missense_Mutation	SNP	9921852	9921852	FBXL12	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5654	256
S1PR5	53637	broad.mit.edu	37	19	10625052	10625052	+	Silent	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10625052G>A	uc002mot.1	-	2	693	c.636C>T	c.(634-636)TAC>TAT	p.Y212Y	S1PR5_uc002mou.1_Silent_p.Y212Y	NM_030760	NP_110387	Q9H228	S1PR5_HUMAN	endothelial differentiation, sphingolipid	212	Helical; Name=5; (By similarity).					integral to membrane|plasma membrane	lysosphingolipid and lysophosphatidic acid receptor activity			central_nervous_system(1)|pancreas(1)	2						AGATGCGCGCGTAGAGTGCAC	0.697																0.4375	20.021516	20.076086	7	9	KEEP	---	---	---	---	6	1	4	7	-1	capture	Silent	SNP	10625052	10625052	S1PR5	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13689	256
USHBP1	83878	broad.mit.edu	37	19	17361108	17361108	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17361108C>T	uc002nfs.1	-	13	2151	c.2038G>A	c.(2038-2040)GAA>AAA	p.E680K	USHBP1_uc002nfr.1_Missense_Mutation_p.E306K|USHBP1_uc002nft.1_RNA|USHBP1_uc010xpk.1_Missense_Mutation_p.E616K	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1	680	Potential.						PDZ domain binding			ovary(1)	1						GCAGTGGCTTCGAGCACCGCC	0.657																0.129032	2.475175	6.659346	4	27	KEEP	---	---	---	---	4	9	19	37	-1	capture	Missense_Mutation	SNP	17361108	17361108	USHBP1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16919	256
IRGC	56269	broad.mit.edu	37	19	44223763	44223763	+	Silent	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44223763C>T	uc002oxh.2	+	2	1200	c.1053C>T	c.(1051-1053)TCC>TCT	p.S351S		NM_019612	NP_062558	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	351						membrane	GTP binding|hydrolase activity, acting on acid anhydrides			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(69;0.0435)				CCCAGTCGTCCGACGGCGCCA	0.657	Colon(189;350 2037 11447 13433 38914)															0.291667	36.418138	38.293363	14	34	KEEP	---	---	---	---	13	4	26	14	-1	capture	Silent	SNP	44223763	44223763	IRGC	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7761	256
BCAM	4059	broad.mit.edu	37	19	45322375	45322375	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45322375G>A	uc002ozu.2	+	11	1443	c.1399G>A	c.(1399-1401)GAC>AAC	p.D467N	BCAM_uc002ozt.1_Missense_Mutation_p.D467N	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1	467	Extracellular (Potential).|Ig-like C2-type 3.				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				GAGGGAAGGAGACGAAGTCAC	0.597																0.318021	249.032811	257.372949	90	193	KEEP	---	---	---	---	49	48	87	116	-1	capture	Missense_Mutation	SNP	45322375	45322375	BCAM	19	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	1333	256
RELB	5971	broad.mit.edu	37	19	45515222	45515222	+	Silent	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45515222C>T	uc002paj.1	+	5	318	c.192C>T	c.(190-192)AAC>AAT	p.N64N		NM_006509	NP_006500	Q01201	RELB_HUMAN	reticuloendotheliosis viral oncogene homolog B	64	Leucine-zipper.					nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		TCAAGGAGAACGGCTTCGGCC	0.577																0.358974	37.739308	38.422071	14	25	KEEP	---	---	---	---	13	11	14	15	-1	capture	Silent	SNP	45515222	45515222	RELB	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13112	256
SPATS2L	26010	broad.mit.edu	37	2	201332021	201332021	+	Silent	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201332021C>T	uc002uvn.3	+	10	1208	c.856C>T	c.(856-858)CTG>TTG	p.L286L	SPATS2L_uc010fst.2_Silent_p.L286L|SPATS2L_uc002uvo.3_Silent_p.L226L|SPATS2L_uc002uvp.3_Silent_p.L286L|SPATS2L_uc002uvq.3_Silent_p.L217L|SPATS2L_uc002uvr.3_Silent_p.L286L|SPATS2L_uc010zhc.1_Silent_p.L316L	NM_015535	NP_056350	Q9NUQ6	SPS2L_HUMAN	SPATS2-like protein isoform a	286	Potential.					cytoplasm|nucleolus				ovary(2)|pancreas(1)	3						AGTGGAAATCCTGACTGCTCG	0.438																0.465116	132.39665	132.487314	40	46	KEEP	---	---	---	---	28	16	28	21	-1	capture	Silent	SNP	201332021	201332021	SPATS2L	2	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	14912	256
RAPH1	65059	broad.mit.edu	37	2	204320201	204320201	+	Nonsense_Mutation	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:204320201G>A	uc002vad.2	-	9	1486	c.1261C>T	c.(1261-1263)CGA>TGA	p.R421*	RAPH1_uc002vae.2_Nonsense_Mutation_p.R473*|RAPH1_uc002vaf.2_Nonsense_Mutation_p.R473*	NM_213589	NP_998754	Q70E73	RAPH1_HUMAN	Ras association and pleckstrin homology domains	421	PH.				cell-matrix adhesion|signal transduction	cytoplasm|cytoskeleton|filopodium|lamellipodium|nucleus|plasma membrane				ovary(3)|breast(3)|central_nervous_system(2)|lung(1)|skin(1)	10						CCAGATGCTCGCAAGAGAAAA	0.383																0.033149	-65.615281	20.483477	12	350	KEEP	---	---	---	---	7	9	208	185	-1	capture	Nonsense_Mutation	SNP	204320201	204320201	RAPH1	2	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	12945	256
DGKD	8527	broad.mit.edu	37	2	234344488	234344488	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234344488G>A	uc002vui.1	+	6	623	c.611G>A	c.(610-612)CGC>CAC	p.R204H	DGKD_uc002vuj.1_Missense_Mutation_p.R160H|DGKD_uc010fyh.1_Missense_Mutation_p.R71H|DGKD_uc010fyi.1_5'Flank|DGKD_uc002vuk.1_Missense_Mutation_p.R71H	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	204	Phorbol-ester/DAG-type 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GCCCACAAGCGCTGTGCTGTG	0.507																0.030769	-24.11065	7.260051	4	126	KEEP	---	---	---	---	3	1	79	76	-1	capture	Missense_Mutation	SNP	234344488	234344488	DGKD	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4425	256
COL6A3	1293	broad.mit.edu	37	2	238305417	238305417	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238305417A>G	uc002vwl.2	-	2	329	c.44T>C	c.(43-45)CTC>CCC	p.L15P	COL6A3_uc002vwo.2_Missense_Mutation_p.L15P|COL6A3_uc010znj.1_Missense_Mutation_p.L15P|COL6A3_uc002vwq.2_Missense_Mutation_p.L15P|COL6A3_uc002vwr.2_Missense_Mutation_p.L15P|COL6A3_uc010znk.1_Missense_Mutation_p.L15P	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	15					axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGAGAGAAAGAGGCAAAAGAC	0.423																0.024845	-33.234481	7.153832	4	157	KEEP	---	---	---	---	2	3	88	94	-1	capture	Missense_Mutation	SNP	238305417	238305417	COL6A3	2	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	3666	256
ID1	3397	broad.mit.edu	37	20	30193855	30193855	+	Splice_Site	SNP	G	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30193855G>A	uc002wwg.1	+	2	526	c.427_splice	c.e2-1	p.A143_splice	ID1_uc002wwh.1_3'UTR|hsa-mir-3193|MI0014238_5'Flank	NM_002165	NP_002156	P41134	ID1_HUMAN	inhibitor of DNA binding 1 isoform a						angiogenesis|blood vessel endothelial cell migration|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription by transcription factor localization|transforming growth factor beta receptor signaling pathway	cytoplasm	protein binding			ovary(1)	1	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.99e-05)|all cancers(5;0.000169)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			CGTTTTCACAGGCGGCATGCG	0.652	NSCLC(123;1618 1779 21803 28680 33854)				46											0.058824	-3.118327	7.277907	3	48	KEEP	---	---	---	---	2	1	35	35	-1	capture	Splice_Site	SNP	30193855	30193855	ID1	20	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	7414	256
C21orf63	59271	broad.mit.edu	37	21	33876254	33876254	+	Missense_Mutation	SNP	G	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:33876254G>T	uc002ypr.1	+	7	1288	c.878G>T	c.(877-879)AGC>ATC	p.S293I	C21orf63_uc002yps.1_RNA|C21orf63_uc010glw.1_Missense_Mutation_p.S290I|C21orf63_uc002ypt.1_RNA|C21orf63_uc002ypu.1_Missense_Mutation_p.S198I|C21orf63_uc011adq.1_5'UTR	NM_058187	NP_478067	P58658	CU063_HUMAN	hypothetical protein LOC59271 precursor	293	Extracellular (Potential).					integral to membrane	sugar binding			ovary(2)|pancreas(1)	3						TTCGACCCAAGCGGATCGAAG	0.433																0.035514	-90.656045	34.761768	19	516	KEEP	---	---	---	---	13	13	300	319	0.5	capture	Missense_Mutation	SNP	33876254	33876254	C21orf63	21	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	2112	256
C21orf63	59271	broad.mit.edu	37	21	33876277	33876277	+	Missense_Mutation	SNP	G	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:33876277G>T	uc002ypr.1	+	7	1311	c.901G>T	c.(901-903)GAT>TAT	p.D301Y	C21orf63_uc002yps.1_RNA|C21orf63_uc010glw.1_Missense_Mutation_p.D298Y|C21orf63_uc002ypt.1_RNA|C21orf63_uc002ypu.1_Missense_Mutation_p.D206Y|C21orf63_uc011adq.1_5'UTR	NM_058187	NP_478067	P58658	CU063_HUMAN	hypothetical protein LOC59271 precursor	301	Extracellular (Potential).					integral to membrane	sugar binding			ovary(2)|pancreas(1)	3						TCTGAGGAAAGATGGAATTCT	0.398																0.028623	-111.604826	25.160686	16	543	KEEP	---	---	---	---	11	11	296	345	0.5	capture	Missense_Mutation	SNP	33876277	33876277	C21orf63	21	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	2112	256
NCAPG	64151	broad.mit.edu	37	4	17825349	17825349	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:17825349A>G	uc003gpp.2	+	9	1515	c.1339A>G	c.(1339-1341)AGA>GGA	p.R447G	NCAPG_uc011bxj.1_5'UTR	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G	447	HEAT 7.				cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)		TCTTGTTGAAAGACTACTCCA	0.323																0.029703	-18.067736	6.471331	3	98	KEEP	---	---	---	---	2	1	56	53	-1	capture	Missense_Mutation	SNP	17825349	17825349	NCAPG	4	A	G	G	G	1	0	0	0	0	1	0	0	0	36	3	3	3	10114	256
GC	2638	broad.mit.edu	37	4	72620754	72620754	+	Missense_Mutation	SNP	G	C	C			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:72620754G>C	uc003hge.2	-	9	1258	c.1105C>G	c.(1105-1107)CTA>GTA	p.L369V	GC_uc003hgd.2_Missense_Mutation_p.L247V|GC_uc010iie.2_Missense_Mutation_p.L369V|GC_uc010iif.2_Missense_Mutation_p.L388V	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor	369	Albumin 2.				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)	AGGCTTTTTAGGGTTGGCTCA	0.378																0.359155	160.583085	163.064662	51	91	KEEP	---	---	---	---	22	33	29	75	-1	capture	Missense_Mutation	SNP	72620754	72620754	GC	4	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	6222	256
C4orf22	255119	broad.mit.edu	37	4	81504250	81504250	+	Silent	SNP	G	A	A	rs141410009	by1000genomes	TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:81504250G>A	uc003hmf.2	+	3	295	c.246G>A	c.(244-246)ACG>ACA	p.T82T	C4orf22_uc010ijp.2_Silent_p.T82T	NM_152770	NP_689983	Q6V702	CD022_HUMAN	hypothetical protein LOC255119	82										skin(2)	2						TTTACAGGACGCTAACAAGTG	0.383																0.372881	132.771018	134.445423	44	74	KEEP	---	---	---	---	24	25	46	35	-1	capture	Silent	SNP	81504250	81504250	C4orf22	4	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	2233	256
PRKG2	5593	broad.mit.edu	37	4	82125882	82125882	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:82125882C>T	uc003hmh.2	-	1	334	c.320G>A	c.(319-321)CGG>CAG	p.R107Q	PRKG2_uc011cch.1_Missense_Mutation_p.R107Q	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	107					platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						AGAGGTCTTCCGGTGGACCTC	0.562				p.R107Q(SNU1040-Tumor)	728											0.257282	268.578725	290.567504	106	306	KEEP	---	---	---	---	63	49	164	159	-1	capture	Missense_Mutation	SNP	82125882	82125882	PRKG2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12419	256
ADCY2	108	broad.mit.edu	37	5	7709333	7709333	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:7709333C>T	uc003jdz.1	+	10	1478	c.1411C>T	c.(1411-1413)CGG>TGG	p.R471W	ADCY2_uc011cmo.1_Missense_Mutation_p.R291W	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	471	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						GGGAGAACGACGGAGCCCCCA	0.587																0.191489	36.398188	44.75675	18	76	KEEP	---	---	---	---	8	11	43	52	-1	capture	Missense_Mutation	SNP	7709333	7709333	ADCY2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	294	256
PIK3R1	5295	broad.mit.edu	37	5	67589298	67589298	+	Missense_Mutation	SNP	C	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589298C>A	uc003jva.2	+	10	1846	c.1286C>A	c.(1285-1287)TCC>TAC	p.S429Y	PIK3R1_uc003jvb.2_Missense_Mutation_p.S429Y|PIK3R1_uc003jvc.2_Missense_Mutation_p.S129Y|PIK3R1_uc003jvd.2_Missense_Mutation_p.S159Y|PIK3R1_uc003jve.2_Missense_Mutation_p.S108Y|PIK3R1_uc011crb.1_Missense_Mutation_p.S99Y	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	429					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TATCCAGTATCCAAATACCAA	0.318					370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.403509	64.909863	65.374897	23	34	KEEP	---	---	---	---	7	19	12	27	0.730769230769	capture	Missense_Mutation	SNP	67589298	67589298	PIK3R1	5	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	11821	256
PCDHB12	56124	broad.mit.edu	37	5	140588488	140588488	+	Silent	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140588488C>T	uc003liz.2	+	1	198	c.9C>T	c.(7-9)AAC>AAT	p.N3N	PCDHB12_uc011dak.1_Translation_Start_Site	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	3					homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTATGGAAAACGGAGGGGCAG	0.493																0.184	47.163329	58.865329	23	102	KEEP	---	---	---	---	11	18	63	60	-1	capture	Silent	SNP	140588488	140588488	PCDHB12	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11440	256
FOXI1	2299	broad.mit.edu	37	5	169533358	169533358	+	Missense_Mutation	SNP	G	C	C			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169533358G>C	uc003mai.3	+	1	442	c.397G>C	c.(397-399)GCC>CCC	p.A133P	FOXI1_uc003maj.3_Missense_Mutation_p.A133P	NM_012188	NP_036320	Q12951	FOXI1_HUMAN	forkhead box I1 isoform a	133	Fork-head.				epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(3)|central_nervous_system(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCTCTCATCGCCATGGCCAT	0.642												Pendred_syndrome				0.65	48.177772	48.574332	13	7	KEEP	---	---	---	---	5	8	3	4	-1	capture	Missense_Mutation	SNP	169533358	169533358	FOXI1	5	G	C	C	C	1	0	0	0	0	1	0	0	0	494	38	4	4	5953	256
BEND3	57673	broad.mit.edu	37	6	107391897	107391897	+	Silent	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:107391897C>T	uc003prs.2	-	5	1148	c.498G>A	c.(496-498)TCG>TCA	p.S166S		NM_001080450	NP_001073919	Q5T5X7	BEND3_HUMAN	BEN domain containing 3	166										ovary(3)	3						GCCGCAGTGACGAGGGGCTGT	0.567																0.042735	-18.829133	7.449367	5	112	KEEP	---	---	---	---	5	1	60	80	-1	capture	Silent	SNP	107391897	107391897	BEND3	6	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	1388	256
ANKIB1	54467	broad.mit.edu	37	7	91991520	91991520	+	Missense_Mutation	SNP	T	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:91991520T>A	uc003ulw.2	+	10	1795	c.1419T>A	c.(1417-1419)CAT>CAA	p.H473Q		NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	473	IBR-type; degenerate.						protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GTGAAGCACATGAGCCTTGTG	0.343																0.086957	2.632511	6.603645	2	21	KEEP	---	---	---	---	2	0	12	12	-1	capture	Missense_Mutation	SNP	91991520	91991520	ANKIB1	7	T	A	A	A	1	0	0	0	0	1	0	0	0	660	51	4	4	627	256
PRSS37	136242	broad.mit.edu	37	7	141536273	141536273	+	Missense_Mutation	SNP	G	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141536273G>T	uc003vws.1	-	5	1002	c.630C>A	c.(628-630)TTC>TTA	p.F210L	PRSS37_uc011krk.1_Missense_Mutation_p.F197L|PRSS37_uc011krl.1_Missense_Mutation_p.F209L|PRSS37_uc003vwt.1_Missense_Mutation_p.F197L	NM_001008270	NP_001008271	A4D1T9	PRS37_HUMAN	protease, serine, 37 precursor	210	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			skin(1)	1						CCCCTCCCATGAAGTGCCCCA	0.458																0.033149	-31.920158	11.14216	6	175	KEEP	---	---	---	---	2	5	72	126	0.285714285714	capture	Missense_Mutation	SNP	141536273	141536273	PRSS37	7	G	T	T	T	1	0	0	0	0	1	0	0	0	581	45	4	4	12521	256
DOCK5	80005	broad.mit.edu	37	8	25199986	25199986	+	Missense_Mutation	SNP	G	C	C			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25199986G>C	uc003xeg.2	+	25	2717	c.2580G>C	c.(2578-2580)ATG>ATC	p.M860I	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.M574I|DOCK5_uc003xei.2_Missense_Mutation_p.M430I|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	860						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TTAACTGCATGACCAAGATAG	0.373	Pancreas(145;34 1887 3271 10937 30165)															0.111111	3.935899	6.627438	2	16	KEEP	---	---	---	---	2	0	6	11	-1	capture	Missense_Mutation	SNP	25199986	25199986	DOCK5	8	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	4646	256
POTEA	340441	broad.mit.edu	37	8	43171085	43171085	+	Missense_Mutation	SNP	G	C	C			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:43171085G>C	uc003xpz.1	+	7	999	c.956G>C	c.(955-957)AGT>ACT	p.S319T	POTEA_uc003xqa.1_Missense_Mutation_p.S273T	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	319										ovary(1)	1						CTTAAAGGAAGTGAAAATAGT	0.303																0.045455	-3.1893	6.521174	2	42	KEEP	---	---	---	---	4	0	23	27	-1	capture	Missense_Mutation	SNP	43171085	43171085	POTEA	8	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	12163	256
ADAMTSL1	92949	broad.mit.edu	37	9	18574217	18574217	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:18574217C>T	uc003zne.3	+	4	554	c.427C>T	c.(427-429)CGT>TGT	p.R143C	ADAMTSL1_uc003znb.2_Missense_Mutation_p.R143C|ADAMTSL1_uc003znc.3_Missense_Mutation_p.R143C	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	143						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		AGATGGTACGCGTTGCTATAC	0.438																0.056604	-41.068406	46.57834	24	400	KEEP	---	---	---	---	18	7	202	238	-1	capture	Missense_Mutation	SNP	18574217	18574217	ADAMTSL1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	274	256
IFNW1	3467	broad.mit.edu	37	9	21141168	21141168	+	Silent	SNP	C	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21141168C>T	uc003zol.1	-	1	977	c.402G>A	c.(400-402)GGG>GGA	p.G134G		NM_002177	NP_002168	P05000	IFNW1_HUMAN	interferon, omega 1 precursor	134					cell cycle arrest|defense response|response to virus	extracellular space	cytokine activity|cytokine receptor binding				0				GBM - Glioblastoma multiforme(5;2.35e-185)|Lung(24;2.24e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TGCTAATTGCCCCAGCAGATT	0.527																0.338235	130.184122	133.342826	46	90	KEEP	---	---	---	---	25	24	55	45	-1	capture	Silent	SNP	21141168	21141168	IFNW1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	7477	256
ST6GALNAC4	27090	broad.mit.edu	37	9	130674960	130674960	+	Splice_Site	SNP	C	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130674960C>A	uc004bss.2	-	4	475	c.199_splice	c.e4-1	p.P67_splice	ST6GALNAC4_uc004bst.2_Splice_Site	NM_175039	NP_778204	Q9H4F1	SIA7D_HUMAN	sialyltransferase 7D isoform a						glycolipid metabolic process|protein glycosylation	integral to Golgi membrane|nucleus|soluble fraction	(alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity				0						GGACCAGCGGCTGCAGGGCAG	0.632																0.5625	27.875966	27.930273	9	7	KEEP	---	---	---	---	6	4	6	3	0.4	capture	Splice_Site	SNP	130674960	130674960	ST6GALNAC4	9	C	A	A	A	1	0	0	0	0	0	0	1	0	364	28	5	4	15116	256
ATP11C	286410	broad.mit.edu	37	X	138867417	138867417	+	Missense_Mutation	SNP	C	A	A			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138867417C>A	uc004faz.2	-	16	1742	c.1643G>T	c.(1642-1644)CGA>CTA	p.R548L	ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Missense_Mutation_p.R548L	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	548	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					ACTCATACGTCGCCGGACAGC	0.338																0.048387	-6.729532	6.718468	3	59	KEEP	---	---	---	---	2	1	32	45	0.333333333333	capture	Missense_Mutation	SNP	138867417	138867417	ATP11C	23	C	A	A	A	1	0	0	0	0	1	0	0	0	403	31	4	4	1112	256
HP1BP3	50809	broad.mit.edu	37	1	21106920	21106921	+	Frame_Shift_Ins	INS	-	T	T			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:21106920_21106921insT	uc001bdw.1	-	2	153_154	c.13_14insA	c.(13-15)ACGfs	p.T5fs	HP1BP3_uc001bdv.1_5'UTR|HP1BP3_uc010odh.1_Intron|HP1BP3_uc001bdy.1_Frame_Shift_Ins_p.T5fs|HP1BP3_uc001bdz.2_RNA|HP1BP3_uc001bea.2_Frame_Shift_Ins_p.T5fs|HP1BP3_uc001beb.2_Frame_Shift_Ins_p.T5fs	NM_016287	NP_057371	Q5SSJ5	HP1B3_HUMAN	HP1-BP74	5					nucleosome assembly	nucleosome|nucleus	DNA binding			central_nervous_system(1)|skin(1)	2		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		ACCTTGAGACGTATCAGTCGCC	0.475																0.45			58	72		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	21106920	21106921	HP1BP3	1	-	T	T	T	1	0	1	1	0	0	0	0	0	520	40	5	5	7253	256
RNF19B	127544	broad.mit.edu	37	1	33408041	33408042	+	Frame_Shift_Ins	INS	-	GC	GC			TCGA-41-3915-01	TCGA-41-3915-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:33408041_33408042insGC	uc010oho.1	-	7	1424_1425	c.1424_1425insGC	c.(1423-1425)GCCfs	p.A475fs	RNF19B_uc001bwm.3_Frame_Shift_Ins_p.A474fs|RNF19B_uc010ohp.1_Frame_Shift_Ins_p.A474fs	NM_153341	NP_699172	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B isoform a	475						integral to membrane	ligase activity|protein binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GATTCTTGAGGGCTCTCCAGGC	0.475																0.46			37	43		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	33408041	33408042	RNF19B	1	-	GC	GC	GC	1	0	1	1	0	0	0	0	0	548	43	5	5	13363	256
