Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CROCC	9696	broad.mit.edu	37	1	17281847	17281847	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17281847C>T	uc001azt.2	+	24	3575	c.3506C>T	c.(3505-3507)GCC>GTC	p.A1169V	CROCC_uc001azu.2_Missense_Mutation_p.A472V	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	1169	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CTGGAGGATGCCCGTGACGGG	0.711																0.071429	-1.594968	6.34204	3	39	KEEP	---	---	---	---	1	2	17	24	-1	capture	Missense_Mutation	SNP	17281847	17281847	CROCC	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3858	260
GLIS1	148979	broad.mit.edu	37	1	54060541	54060541	+	Missense_Mutation	SNP	C	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:54060541C>A	uc001cvr.1	-	3	602	c.35G>T	c.(34-36)TGT>TTT	p.C12F		NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1	12					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						CGGGCCCCGACAGTGGGCAGA	0.657																0.35	20.418747	20.815894	7	13	KEEP	---	---	---	---	6	4	10	8	0.4	capture	Missense_Mutation	SNP	54060541	54060541	GLIS1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	6381	260
RSBN1	54665	broad.mit.edu	37	1	114354435	114354435	+	Silent	SNP	G	C	C			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114354435G>C	uc001edq.2	-	1	636	c.600C>G	c.(598-600)CCC>CCG	p.P200P	RSBN1_uc001edr.2_RNA	NM_018364	NP_060834	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	200						nucleus				ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GATCACCATCGGGGCCGCGGT	0.637																0.44	65.139842	65.29711	22	28	KEEP	---	---	---	---	10	15	18	16	-1	capture	Silent	SNP	114354435	114354435	RSBN1	1	G	C	C	C	1	0	0	0	0	0	0	0	1	496	39	4	4	13588	260
F5	2153	broad.mit.edu	37	1	169510453	169510453	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169510453G>A	uc001ggg.1	-	13	4020	c.3875C>T	c.(3874-3876)ACA>ATA	p.T1292I		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	1292	2-12.|B.|35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	AGAGAGGTTTGTCTGGCTGAA	0.522																0.409692	510.401199	513.649411	186	268	KEEP	---	---	---	---	109	99	173	133	-1	capture	Missense_Mutation	SNP	169510453	169510453	F5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	5302	260
OR2T10	127069	broad.mit.edu	37	1	248756796	248756796	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248756796T>C	uc010pzn.1	-	1	274	c.274A>G	c.(274-276)ATC>GTC	p.I92V		NM_001004693	NP_001004693	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T,	92	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGACCGAGATGGTCTTGTCT	0.507																0.3	25.966573	27.036812	9	21	KEEP	---	---	---	---	5	5	15	7	-1	capture	Missense_Mutation	SNP	248756796	248756796	OR2T10	1	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	10921	260
ST8SIA6	338596	broad.mit.edu	37	10	17363244	17363244	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:17363244G>A	uc001ipd.2	-	8	830	c.830C>T	c.(829-831)ACG>ATG	p.T277M	ST8SIA6_uc010qce.1_RNA	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide	277	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						AGAGGTACCCGTGTTGGCCCT	0.418																0.623656	182.565748	183.812348	58	35	KEEP	---	---	---	---	31	34	19	19	-1	capture	Missense_Mutation	SNP	17363244	17363244	ST8SIA6	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15126	260
OR10A3	26496	broad.mit.edu	37	11	7960683	7960683	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7960683G>A	uc010rbi.1	-	1	385	c.385C>T	c.(385-387)CCT>TCT	p.P129S		NM_001003745	NP_001003745	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A,	129	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TAGTTCAGAGGATGGCAAATT	0.438																0.367647	69.912986	70.976455	25	43	KEEP	---	---	---	---	15	12	28	19	-1	capture	Missense_Mutation	SNP	7960683	7960683	OR10A3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10795	260
ELP4	26610	broad.mit.edu	37	11	31531364	31531364	+	Silent	SNP	C	G	G			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:31531364C>G	uc001mtb.2	+	1	68	c.33C>G	c.(31-33)GCC>GCG	p.A11A	IMMP1L_uc001msy.1_5'Flank|IMMP1L_uc001msz.1_5'Flank|ELP4_uc001mta.1_RNA|ELP4_uc001mtc.2_Silent_p.A11A|ELP4_uc010rdz.1_Silent_p.A11A|IMMP1L_uc009yjo.2_5'Flank|IMMP1L_uc009yjp.2_5'Flank	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog	11					histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)					GTAGTGTTGCCGCGAGTACTG	0.587																0.210526	23.689707	28.095209	12	45	KEEP	---	---	---	---	5	7	22	28	-1	capture	Silent	SNP	31531364	31531364	ELP4	11	C	G	G	G	1	0	0	0	0	0	0	0	1	288	23	4	4	5037	260
KAT5	10524	broad.mit.edu	37	11	65486084	65486084	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65486084G>A	uc001ofi.2	+	12	1439	c.1189G>A	c.(1189-1191)GGG>AGG	p.G397R	KAT5_uc001ofj.2_Missense_Mutation_p.G345R|KAT5_uc001ofk.2_Missense_Mutation_p.G430R|KAT5_uc010roo.1_Missense_Mutation_p.G378R|KAT5_uc001ofl.2_Missense_Mutation_p.G186R|RNASEH2C_uc001ofm.2_RNA|RNASEH2C_uc001ofn.2_3'UTR	NM_006388	NP_006379	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5 isoform 2	397					androgen receptor signaling pathway|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|double-strand break repair|interspecies interaction between organisms|negative regulation of interleukin-2 production|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nucleolus|perinuclear region of cytoplasm|Piccolo NuA4 histone acetyltransferase complex	androgen receptor binding|histone acetyltransferase activity|metal ion binding|repressing transcription factor binding|transcription coactivator activity				0						CAAAGTGGAAGGGAAAACAGG	0.468																0.08134	3.600031	40.920222	17	192	KEEP	---	---	---	---	11	7	113	103	-1	capture	Missense_Mutation	SNP	65486084	65486084	KAT5	11	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	7906	260
KRT75	9119	broad.mit.edu	37	12	52824357	52824357	+	Missense_Mutation	SNP	G	A	A	rs2232397	byFrequency	TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52824357G>A	uc001saj.2	-	5	1025	c.1003C>T	c.(1003-1005)CGG>TGG	p.R335W		NM_004693	NP_004684	O95678	K2C75_HUMAN	keratin 75	335	Coil 2.|Rod.					keratin filament	structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.192)		GCCTCGGCCCGGCTGCGGTTG	0.547																0.19883	73.445434	87.90031	34	137	KEEP	---	---	---	---	20	19	66	88	-1	capture	Missense_Mutation	SNP	52824357	52824357	KRT75	12	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	8408	260
ACTR6	64431	broad.mit.edu	37	12	100601474	100601474	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100601474G>A	uc001thb.1	+	4	345	c.289G>A	c.(289-291)GAA>AAA	p.E97K	ACTR6_uc010svh.1_Missense_Mutation_p.E97K|ACTR6_uc001thc.1_5'UTR|ACTR6_uc001thd.1_Missense_Mutation_p.E97K|ACTR6_uc009ztu.1_5'UTR|ACTR6_uc001the.1_Missense_Mutation_p.E15K|ACTR6_uc001thf.1_Missense_Mutation_p.E15K|uc001thg.1_Intron	NM_022496	NP_071941	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog	97						cytoplasm|cytoskeleton				ovary(1)	1						TATTATCACTGAACCATACTT	0.244																0.384615	68.455345	69.21546	25	40	KEEP	---	---	---	---	13	12	22	20	-1	capture	Missense_Mutation	SNP	100601474	100601474	ACTR6	12	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	216	260
SYCP3	50511	broad.mit.edu	37	12	102128812	102128812	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:102128812G>T	uc001tiq.2	-	5	378	c.246C>A	c.(244-246)AAC>AAA	p.N82K	SYCP3_uc001tir.2_Missense_Mutation_p.N82K|SYCP3_uc001tis.2_Missense_Mutation_p.N82K	NM_153694	NP_710161	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	82					cell division|male meiosis I|spermatogenesis, exchange of chromosomal proteins	nucleus	DNA binding				0						GAAGAGCCTTGTTAATGTCAA	0.308																0.373134	75.124248	76.083036	25	42	KEEP	---	---	---	---	12	14	15	31	0.461538461538	capture	Missense_Mutation	SNP	102128812	102128812	SYCP3	12	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	15322	260
EIF2B1	1967	broad.mit.edu	37	12	124111633	124111633	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:124111633C>T	uc001ufm.2	-	5	583	c.440G>A	c.(439-441)CGA>CAA	p.R147Q	EIF2B1_uc001ufn.2_Missense_Mutation_p.R147Q|EIF2B1_uc010tat.1_Missense_Mutation_p.R147Q	NM_001414	NP_001405	Q14232	EI2BA_HUMAN	eukaryotic translation initiation factor 2B,	147					cellular response to stimulus|oligodendrocyte development|regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex|membrane fraction|plasma membrane	protein binding|translation initiation factor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.67e-05)|Epithelial(86;0.000353)|all cancers(50;0.00489)		TACACTAAATCGCTTCTTGGC	0.502																0.079646	-0.607937	19.764125	9	104	KEEP	---	---	---	---	3	8	55	68	-1	capture	Missense_Mutation	SNP	124111633	124111633	EIF2B1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4955	260
TMEM62	80021	broad.mit.edu	37	15	43476674	43476674	+	Missense_Mutation	SNP	C	T	T	rs146146981	byFrequency	TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43476674C>T	uc001zqr.2	+	14	2101	c.1822C>T	c.(1822-1824)CGG>TGG	p.R608W	TMEM62_uc010bda.2_Missense_Mutation_p.R443W|TMEM62_uc001zqt.2_Missense_Mutation_p.R177W|CCNDBP1_uc001zqu.2_5'Flank|CCNDBP1_uc001zqv.2_5'Flank|CCNDBP1_uc010bdc.2_5'Flank|CCNDBP1_uc010bdb.2_5'Flank|CCNDBP1_uc010udl.1_5'Flank|CCNDBP1_uc001zqw.2_5'Flank|CCNDBP1_uc001zqx.2_5'Flank|CCNDBP1_uc010bdd.2_5'Flank|CCNDBP1_uc001zqy.2_5'Flank	NM_024956	NP_079232	Q0P6H9	TMM62_HUMAN	transmembrane protein 62	608	Helical; (Potential).					integral to membrane				ovary(1)|breast(1)	2		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		CTCCCCTTTGCGGACCTGGTT	0.448																0.019305	-59.439381	7.785481	5	254	KEEP	---	---	---	---	4	2	160	124	-1	capture	Missense_Mutation	SNP	43476674	43476674	TMEM62	15	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	16072	260
MYO5A	4644	broad.mit.edu	37	15	52681529	52681529	+	Missense_Mutation	SNP	T	G	G			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:52681529T>G	uc002aby.2	-	13	1818	c.1574A>C	c.(1573-1575)CAA>CCA	p.Q525P	MYO5A_uc002abx.3_Missense_Mutation_p.Q525P|MYO5A_uc010uge.1_Missense_Mutation_p.Q394P	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1	525	Myosin head-like.				actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GTACAATTTTTGGGCCCAGGT	0.378																0.043478	-8.533296	6.875349	3	66	KEEP	---	---	---	---	1	2	31	41	-1	capture	Missense_Mutation	SNP	52681529	52681529	MYO5A	15	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	9988	260
TMC3	342125	broad.mit.edu	37	15	81625404	81625404	+	Missense_Mutation	SNP	A	C	C			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:81625404A>C	uc002bgo.1	-	22	2659	c.2659T>G	c.(2659-2661)TAC>GAC	p.Y887D	TMC3_uc010blr.1_RNA	NM_001080532	NP_001074001	Q7Z5M5	TMC3_HUMAN	transmembrane channel-like 3	887	Cytoplasmic (Potential).					integral to membrane				ovary(1)|liver(1)	2						ATGACATAGTATCTGGGGGCG	0.473																0.427481	193.094661	193.692096	56	75	KEEP	---	---	---	---	37	24	48	33	-1	capture	Missense_Mutation	SNP	81625404	81625404	TMC3	15	A	C	C	C	1	0	0	0	0	1	0	0	0	208	16	4	4	15871	260
TP53	7157	broad.mit.edu	37	17	7578211	7578211	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578211C>T	uc002gim.2	-	6	832	c.638G>A	c.(637-639)CGA>CAA	p.R213Q	TP53_uc002gig.1_Missense_Mutation_p.R213Q|TP53_uc002gih.2_Missense_Mutation_p.R213Q|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R81Q|TP53_uc010cng.1_Missense_Mutation_p.R81Q|TP53_uc002gii.1_Missense_Mutation_p.R81Q|TP53_uc010cnh.1_Missense_Mutation_p.R213Q|TP53_uc010cni.1_Missense_Mutation_p.R213Q|TP53_uc002gij.2_Missense_Mutation_p.R213Q|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.R120Q|TP53_uc002gio.2_Missense_Mutation_p.R81Q|TP53_uc010vug.1_Missense_Mutation_p.R174Q	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	213	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R213*(182)|p.R213L(25)|p.R213Q(22)|p.R213fs*34(10)|p.0?(7)|p.R213P(5)|p.R213G(2)|p.K164_P219del(1)|p.D208_V216delDRNTFRHSV(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R213*33(1)|p.D208fs*1(1)|p.R213>L(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CACACTATGTCGAAAAGTGTT	0.532	Pancreas(47;798 1329 9957 10801)		111	p.R213L(HT55-Tumor)|p.R213Q(AN3CA-Tumor)|p.R213Q(RAJI-Tumor)|p.R213Q(U138MG-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.807692	136.375655	140.972093	42	10	KEEP	---	---	---	---	24	23	3	8	-1	capture	Missense_Mutation	SNP	7578211	7578211	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16264	260
INSR	3643	broad.mit.edu	37	19	7120678	7120678	+	Silent	SNP	T	C	C			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7120678T>C	uc002mgd.1	-	20	3721	c.3612A>G	c.(3610-3612)GCA>GCG	p.A1204A	INSR_uc002mge.1_Silent_p.A1192A	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	1204	Protein kinase.|Cytoplasmic (Potential).				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GGGACTCCGGTGCCATCCACC	0.522					649											0.46	69.219755	69.289197	23	27	KEEP	---	---	---	---	9	15	12	18	-1	capture	Silent	SNP	7120678	7120678	INSR	19	T	C	C	C	1	0	0	0	0	0	0	0	1	756	59	3	3	7696	260
PNPLA6	10908	broad.mit.edu	37	19	7622102	7622102	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7622102T>C	uc010xjq.1	+	29	3554	c.3359T>C	c.(3358-3360)CTG>CCG	p.L1120P	PNPLA6_uc002mgq.1_Missense_Mutation_p.L1072P|PNPLA6_uc010xjp.1_Missense_Mutation_p.L1045P|PNPLA6_uc002mgr.1_Missense_Mutation_p.L1072P|PNPLA6_uc002mgs.2_Missense_Mutation_p.L1110P|PNPLA6_uc002mgt.1_RNA	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b	1111	Patatin.|Cytoplasmic (Potential).				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3						TCGGGCTACCTGCCCCCGCTG	0.662																0.333333	50.120664	51.51564	19	38	KEEP	---	---	---	---	12	8	23	17	-1	capture	Missense_Mutation	SNP	7622102	7622102	PNPLA6	19	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	12072	260
SLC1A6	6511	broad.mit.edu	37	19	15061033	15061033	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15061033G>A	uc002naa.1	-	9	1677	c.1669C>T	c.(1669-1671)CGG>TGG	p.R557W	SLC1A6_uc010dzu.1_Missense_Mutation_p.R479W|SLC1A6_uc010xod.1_Missense_Mutation_p.R493W	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	557					synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)	TTGCCTCCCCGTCCCCGGGAT	0.647																0.3	22.462286	23.535222	9	21	KEEP	---	---	---	---	5	5	12	14	-1	capture	Missense_Mutation	SNP	15061033	15061033	SLC1A6	19	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	14329	260
FFAR3	2865	broad.mit.edu	37	19	35850547	35850547	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35850547G>T	uc002nzd.2	+	2	830	c.755G>T	c.(754-756)GGT>GTT	p.G252V	FFAR3_uc010xsu.1_Intron	NM_005304	NP_005295	O14843	FFAR3_HUMAN	free fatty acid receptor 3	252	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity|lipid binding				0	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			TATATCTGCGGTGAAAGCCCG	0.607	Esophageal Squamous(185;1742 2042 21963 24215 27871)															0.271795	138.485319	147.644095	53	142	KEEP	---	---	---	---	31	30	90	84	0.508196721311	capture	Missense_Mutation	SNP	35850547	35850547	FFAR3	19	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	5775	260
DPRX	503834	broad.mit.edu	37	19	54140039	54140039	+	Nonsense_Mutation	SNP	C	T	T	rs150237904		TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54140039C>T	uc002qcf.1	+	3	424	c.373C>T	c.(373-375)CGA>TGA	p.R125*		NM_001012728	NP_001012746	A6NFQ7	DPRX_HUMAN	divergent-paired related homeobox	125						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.013)		CACGGGTCATCGAGTCCCCTC	0.567																0.462069	198.714658	198.895587	67	78	KEEP	---	---	---	---	34	39	34	53	-1	capture	Nonsense_Mutation	SNP	54140039	54140039	DPRX	19	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	4693	260
C2orf39	92749	broad.mit.edu	37	2	26637295	26637295	+	Missense_Mutation	SNP	G	A	A	rs148643291	by1000genomes	TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:26637295G>A	uc002rhg.2	+	2	313	c.239G>A	c.(238-240)CGA>CAA	p.R80Q	C2orf39_uc010eym.1_RNA	NM_145038	NP_659475	Q96MC2	CC164_HUMAN	hypothetical protein LOC92749	80											0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGAAAGCCGATTGGTATGA	0.448																0.282609	33.353521	35.307857	13	33	KEEP	---	---	---	---	7	6	18	16	-1	capture	Missense_Mutation	SNP	26637295	26637295	C2orf39	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2144	260
LRP2	4036	broad.mit.edu	37	2	170163790	170163790	+	Splice_Site	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170163790C>T	uc002ues.2	-	4	640	c.427_splice	c.e4+1	p.Q143_splice	LRP2_uc010zdf.1_Splice_Site_p.Q143_splice	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	AACAGACTCACGGCAGTCATT	0.438					2055											0.382716	82.489743	83.471058	31	50	KEEP	---	---	---	---	15	17	34	22	-1	capture	Splice_Site	SNP	170163790	170163790	LRP2	2	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	8872	260
ICA1L	130026	broad.mit.edu	37	2	203650727	203650727	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:203650727C>G	uc002uzh.1	-	13	1411	c.1247G>C	c.(1246-1248)TGG>TCG	p.W416S	ICA1L_uc002uzi.1_Missense_Mutation_p.W416S	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1	416											0						TTGGGAGACCCAGTCTGGGAT	0.358																0.333333	138.297284	141.463194	43	86	KEEP	---	---	---	---	24	28	54	48	-1	capture	Missense_Mutation	SNP	203650727	203650727	ICA1L	2	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	7403	260
C20orf114	92747	broad.mit.edu	37	20	31878893	31878893	+	Missense_Mutation	SNP	C	T	T	rs149436006	byFrequency	TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31878893C>T	uc002wyw.1	+	5	657	c.496C>T	c.(496-498)CGC>TGC	p.R166C	C20orf114_uc010gej.1_Missense_Mutation_p.R166C	NM_033197	NP_149974	Q8TDL5	LPLC1_HUMAN	LPLUNC1 protein precursor	166						extracellular space	lipid binding			central_nervous_system(2)|skin(2)	4						TGGGAGCCTGCGCATCCAACT	0.507																0.096774	1.80405	6.853137	3	28	KEEP	---	---	---	---	0	4	16	17	-1	capture	Missense_Mutation	SNP	31878893	31878893	C20orf114	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2064	260
TRIOBP	11078	broad.mit.edu	37	22	38120288	38120288	+	Silent	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38120288C>T	uc003atr.2	+	7	1996	c.1725C>T	c.(1723-1725)CCC>CCT	p.P575P	TRIOBP_uc003atu.2_Silent_p.P403P|TRIOBP_uc003atq.1_Silent_p.P575P|TRIOBP_uc003ats.1_Silent_p.P403P	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	575					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GAGACAACCCCAGAACATCCT	0.582																0.113821	26.006979	62.220492	28	218	KEEP	---	---	---	---	21	20	133	163	-1	capture	Silent	SNP	38120288	38120288	TRIOBP	22	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	16436	260
DOCK3	1795	broad.mit.edu	37	3	51315131	51315131	+	Silent	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:51315131C>T	uc011bds.1	+	26	2792	c.2769C>T	c.(2767-2769)CAC>CAT	p.H923H		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	923						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GCAAATCGCACGCTCAGGAGG	0.552					1034											0.34375	30.016685	30.706093	11	21	KEEP	---	---	---	---	6	6	12	10	-1	capture	Silent	SNP	51315131	51315131	DOCK3	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4644	260
FHIT	2272	broad.mit.edu	37	3	59999845	59999845	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:59999845C>T	uc003dkx.3	-	6	508	c.137G>A	c.(136-138)CGC>CAC	p.R46H	FHIT_uc003dky.2_Missense_Mutation_p.R46H|FHIT_uc010hnn.1_Missense_Mutation_p.R46H	NM_002012	NP_002003	P49789	FHIT_HUMAN	fragile histidine triad gene	46	HIT.				nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)		GTCATGGAAGCGCTCCACTGG	0.542					312	T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				0.052632	-8.654347	7.411657	4	72	KEEP	---	---	---	---	2	2	45	41	-1	capture	Missense_Mutation	SNP	59999845	59999845	FHIT	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5823	260
ZBED2	79413	broad.mit.edu	37	3	111312907	111312907	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111312907G>A	uc003dxy.2	-	2	1027	c.142C>T	c.(142-144)CAC>TAC	p.H48Y	CD96_uc003dxv.2_Intron|CD96_uc003dxw.2_Intron|CD96_uc003dxx.2_Intron|CD96_uc010hpy.1_Intron	NM_024508	NP_078784	Q9BTP6	ZBED2_HUMAN	zinc finger, BED domain containing 2	48							DNA binding|metal ion binding			skin(1)	1						CCCTTGTTGTGGGGCATTGGA	0.552																0.127907	15.472808	27.072144	11	75	KEEP	---	---	---	---	6	5	36	45	-1	capture	Missense_Mutation	SNP	111312907	111312907	ZBED2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	17399	260
C3orf15	89876	broad.mit.edu	37	3	119462849	119462849	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:119462849G>A	uc003ede.3	+	14	1785	c.1708G>A	c.(1708-1710)GGA>AGA	p.G570R	C3orf15_uc010hqz.2_Missense_Mutation_p.G508R|C3orf15_uc011bjd.1_Missense_Mutation_p.G444R|C3orf15_uc011bje.1_Missense_Mutation_p.G550R	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha	406	Potential.					mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		CCATTTGGCCGGACTGGAAGG	0.453																0.433962	70.122541	70.322802	23	30	KEEP	---	---	---	---	13	12	21	12	-1	capture	Missense_Mutation	SNP	119462849	119462849	C3orf15	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2189	260
MECOM	2122	broad.mit.edu	37	3	168833248	168833248	+	Silent	SNP	G	A	A	rs140021434		TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:168833248G>A	uc003ffi.3	-	7	2117	c.1848C>T	c.(1846-1848)AAC>AAT	p.N616N	MECOM_uc010hwk.1_Silent_p.N639N|MECOM_uc003ffj.3_Silent_p.N681N|MECOM_uc011bpi.1_Silent_p.N617N|MECOM_uc003ffn.3_Silent_p.N616N|MECOM_uc003ffk.2_Silent_p.N616N|MECOM_uc003ffl.2_Silent_p.N776N|MECOM_uc011bpj.1_Silent_p.N804N|MECOM_uc011bpk.1_Silent_p.N606N|MECOM_uc010hwn.2_Silent_p.N804N	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	616					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						TTGATTCGACGTTGCTTCCTT	0.488					646											0.432836	81.032933	81.301465	29	38	KEEP	---	---	---	---	20	12	22	19	-1	capture	Silent	SNP	168833248	168833248	MECOM	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9335	260
JAKMIP1	152789	broad.mit.edu	37	4	6062187	6062187	+	Silent	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:6062187G>A	uc003giu.3	-	11	1884	c.1608C>T	c.(1606-1608)ATC>ATT	p.I536I	JAKMIP1_uc010idb.1_Silent_p.I536I|JAKMIP1_uc010idc.1_Silent_p.I351I|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Silent_p.I371I|JAKMIP1_uc003giv.3_Silent_p.I536I|JAKMIP1_uc010ide.2_Silent_p.I536I	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	536	Mediates interaction with TYK2 and GABBR1.|Potential.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						CCAAATCTTCGATTTTGGCCT	0.532																0.372642	225.968108	228.989564	79	133	KEEP	---	---	---	---	36	54	79	73	-1	capture	Silent	SNP	6062187	6062187	JAKMIP1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	7863	260
ABLIM2	84448	broad.mit.edu	37	4	8089918	8089918	+	Silent	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:8089918C>T	uc003gko.2	-	4	575	c.432G>A	c.(430-432)GCG>GCA	p.A144A	ABLIM2_uc003gkj.3_Silent_p.A144A|ABLIM2_uc003gkm.3_Silent_p.A144A|ABLIM2_uc003gkp.2_Silent_p.A144A|ABLIM2_uc003gkq.2_Silent_p.A144A|ABLIM2_uc003gkr.2_Silent_p.A144A|ABLIM2_uc003gks.3_Silent_p.A144A|ABLIM2_uc011bwl.1_Silent_p.A149A	NM_001130084	NP_001123556	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	144					axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3						GGGACAGGTGCGCGCTGCTGC	0.632																0.37037	26.741275	27.140587	10	17	KEEP	---	---	---	---	5	5	13	7	-1	capture	Silent	SNP	8089918	8089918	ABLIM2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	95	260
SORBS2	8470	broad.mit.edu	37	4	186545046	186545046	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:186545046G>A	uc003iyl.2	-	13	2383	c.1525C>T	c.(1525-1527)CGC>TGC	p.R509C	SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Missense_Mutation_p.R609C|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Missense_Mutation_p.R413C|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Missense_Mutation_p.R623C|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2	509						actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		TCGGAGATGCGTGTGGGCACC	0.572	Esophageal Squamous(153;41 2433 9491 36028)															0.442308	133.233889	133.535678	46	58	KEEP	---	---	---	---	28	26	29	36	-1	capture	Missense_Mutation	SNP	186545046	186545046	SORBS2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14820	260
TMEM174	134288	broad.mit.edu	37	5	72469563	72469563	+	Missense_Mutation	SNP	G	A	A	rs138671212		TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:72469563G>A	uc010izc.2	+	1	541	c.493G>A	c.(493-495)GGC>AGC	p.G165S		NM_153217	NP_694949	Q8WUU8	TM174_HUMAN	transmembrane protein 174	165						integral to membrane				ovary(1)	1		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		GAGCCCCTGCGGCCTCATAAC	0.547																0.050633	-10.271109	6.691384	4	75	KEEP	---	---	---	---	2	2	41	48	-1	capture	Missense_Mutation	SNP	72469563	72469563	TMEM174	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15973	260
HTR4	3360	broad.mit.edu	37	5	147830788	147830788	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:147830788G>A	uc003lpj.1	-	7	1288	c.1124C>T	c.(1123-1125)CCC>CTC	p.P375L	HTR4_uc010jgu.1_RNA|HTR4_uc003lpi.1_3'UTR	NM_001040169	NP_001035259	Q13639	5HT4R_HUMAN	serotonin 5-HT4 receptor isoform a	Error:Variant_position_missing_in_Q13639_after_alignment					G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)	ATTGTGTATGGGCAGTTTCTC	0.468	GBM(120;370 1604 14007 17804 41573)															0.39577	407.286194	410.423	131	200	KEEP	---	---	---	---	83	81	126	112	-1	capture	Missense_Mutation	SNP	147830788	147830788	HTR4	5	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	7374	260
PDGFRB	5159	broad.mit.edu	37	5	149501489	149501489	+	Silent	SNP	G	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149501489G>T	uc003lro.2	-	16	2767	c.2298C>A	c.(2296-2298)ATC>ATA	p.I766I	PDGFRB_uc010jhd.2_Silent_p.I605I	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	766	Cytoplasmic (Potential).|Protein kinase.				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGGAGGACTCGATGTCTGCAT	0.532					880	T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								0.170455	30.369733	39.409873	15	73	KEEP	---	---	---	---	10	7	43	38	0.588235294118	capture	Silent	SNP	149501489	149501489	PDGFRB	5	G	T	T	T	1	0	0	0	0	0	0	0	1	473	37	4	4	11565	260
KIF13A	63971	broad.mit.edu	37	6	17805708	17805708	+	Nonsense_Mutation	SNP	C	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17805708C>A	uc003ncg.3	-	19	2407	c.2302G>T	c.(2302-2304)GAG>TAG	p.E768*	KIF13A_uc003ncf.2_Nonsense_Mutation_p.E768*|KIF13A_uc003nch.3_Nonsense_Mutation_p.E768*|KIF13A_uc003nci.3_Nonsense_Mutation_p.E768*	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	768	Potential.				cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TCTTTTACCTCAGGAACTTTT	0.303																0.173913	22.95324	29.882397	12	57	KEEP	---	---	---	---	8	7	39	27	0.466666666667	capture	Nonsense_Mutation	SNP	17805708	17805708	KIF13A	6	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	8196	260
MPP6	51678	broad.mit.edu	37	7	24727093	24727093	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:24727093C>T	uc003swx.2	+	13	1782	c.1483C>T	c.(1483-1485)CGG>TGG	p.R495W	MPP6_uc003swy.2_Missense_Mutation_p.R495W|MPP6_uc010kur.2_Missense_Mutation_p.R163W	NM_016447	NP_057531	Q9NZW5	MPP6_HUMAN	membrane protein, palmitoylated 6	495	Guanylate kinase-like.				protein complex assembly		protein binding				0						TGAAAGTGCACGGATTCAGAG	0.348																0.163158	53.106666	73.595828	31	159	KEEP	---	---	---	---	16	17	84	89	-1	capture	Missense_Mutation	SNP	24727093	24727093	MPP6	7	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	9650	260
AOAH	313	broad.mit.edu	37	7	36571798	36571798	+	Silent	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:36571798G>A	uc003tfh.3	-	18	1781	c.1380C>T	c.(1378-1380)CAC>CAT	p.H460H	AOAH_uc010kxf.2_Silent_p.H460H|AOAH_uc011kba.1_Silent_p.H428H	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	460					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						ACATCCAGCCGTGGCAGGGGC	0.512																0.268966	97.062002	104.046842	39	106	KEEP	---	---	---	---	23	20	53	68	-1	capture	Silent	SNP	36571798	36571798	AOAH	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	719	260
VSTM2A	222008	broad.mit.edu	37	7	54617588	54617588	+	Missense_Mutation	SNP	A	G	G			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:54617588A>G	uc010kzf.2	+	4	764	c.359A>G	c.(358-360)AAG>AGG	p.K120R	VSTM2A_uc010kze.2_Missense_Mutation_p.K120R|VSTM2A_uc003tqc.3_Missense_Mutation_p.K120R	NM_182546	NP_872352	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2	120	Ig-like V-type.					extracellular region					0			STAD - Stomach adenocarcinoma(5;0.0525)			GTGAGGAAAAAGGATGAAGGC	0.443																0.006787	-240.540964	9.879219	6	878	KEEP	---	---	---	---	3	1	496	500	-1	capture	Missense_Mutation	SNP	54617588	54617588	VSTM2A	7	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	17111	260
CCT6A	908	broad.mit.edu	37	7	56127280	56127280	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:56127280G>A	uc003trl.1	+	9	1176	c.1012G>A	c.(1012-1014)GAC>AAC	p.D338N	PSPH_uc003trj.2_Intron|CCT6A_uc003trm.1_Missense_Mutation_p.D293N|CCT6A_uc011kcu.1_Missense_Mutation_p.D307N|SNORA15_uc003trn.1_5'Flank	NM_001762	NP_001753	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A isoform	338					'de novo' posttranslational protein folding	cytosol	ATP binding|unfolded protein binding			upper_aerodigestive_tract(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TTCTTTTGACGACCTAAGTCC	0.398																0.008986	-208.500705	8.55679	7	772	KEEP	---	---	---	---	7	1	451	481	-1	capture	Missense_Mutation	SNP	56127280	56127280	CCT6A	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2928	260
OCM2	4951	broad.mit.edu	37	7	97617753	97617753	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:97617753C>T	uc003upc.2	-	2	169	c.169G>A	c.(169-171)GGG>AGG	p.G57R		NM_006188	NP_006179	P0CE71	OCM2_HUMAN	oncomodulin-like	57	EF-hand 1.|1 (Potential).						calcium ion binding				0						TCCAGATACCCGCTCTGGTCG	0.537																0.317647	151.901761	156.921497	54	116	KEEP	---	---	---	---	33	26	54	66	-1	capture	Missense_Mutation	SNP	97617753	97617753	OCM2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10727	260
GPC2	221914	broad.mit.edu	37	7	99773980	99773980	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99773980G>A	uc003utv.2	-	2	343	c.175C>T	c.(175-177)CTC>TTC	p.L59F	GPC2_uc010lgr.2_RNA|GPC2_uc003utw.1_Missense_Mutation_p.L59F|STAG3_uc010lgs.1_5'Flank|STAG3_uc003utx.1_5'Flank|STAG3_uc011kjk.1_5'Flank	NM_152742	NP_689955	Q8N158	GPC2_HUMAN	glypican 2 precursor	59						anchored to membrane|endoplasmic reticulum|extracellular space|plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			breast(1)|pancreas(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAGACCCGGAGGTGCTCACCT	0.567																0.317073	114.17784	117.839135	39	84	KEEP	---	---	---	---	28	19	50	51	-1	capture	Missense_Mutation	SNP	99773980	99773980	GPC2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	6532	260
PILRB	29990	broad.mit.edu	37	7	99955938	99955938	+	Silent	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99955938C>T	uc003uuk.2	+	15	2509	c.13C>T	c.(13-15)CTG>TTG	p.L5L	PILRB_uc003uul.2_Silent_p.L5L|PILRB_uc003uum.1_RNA|PILRB_uc003uun.2_Silent_p.L5L	NM_013440	NP_038468	Q9UKJ0	PILRB_HUMAN	paired immunoglobulin-like type 2 receptor beta	5					activation of transmembrane receptor protein tyrosine kinase activity	integral to plasma membrane	protein binding|receptor activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGGTCGGCCCCTGCTGCTGCC	0.667																0.256983	123.88108	133.454638	46	133	KEEP	---	---	---	---	27	28	90	72	-1	capture	Silent	SNP	99955938	99955938	PILRB	7	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	11829	260
WDR86	349136	broad.mit.edu	37	7	151097266	151097266	+	Silent	SNP	G	A	A			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151097266G>A	uc003wkb.2	-	2	674	c.225C>T	c.(223-225)GCC>GCT	p.A75A	WDR86_uc003wka.2_Silent_p.A33A|WDR86_uc011kvk.1_Silent_p.A75A|WDR86_uc003wkc.2_5'UTR	NM_198285	NP_938026	Q86TI4	WDR86_HUMAN	WD repeat domain 86	75	WD 2.										0			OV - Ovarian serous cystadenocarcinoma(82;0.00419)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGTGCAGTCGGCGCTGCATG	0.607																0.333333	27.53787	28.276956	10	20	KEEP	---	---	---	---	5	7	11	10	-1	capture	Silent	SNP	151097266	151097266	WDR86	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17215	260
PIWIL2	55124	broad.mit.edu	37	8	22211836	22211836	+	Missense_Mutation	SNP	A	G	G			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22211836A>G	uc003xbn.2	+	22	2858	c.2710A>G	c.(2710-2712)ACG>GCG	p.T904A	PIWIL2_uc011kzf.1_Intron|PIWIL2_uc010ltv.2_Missense_Mutation_p.T904A|PIWIL2_uc003xbo.2_Missense_Mutation_p.T58A	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2	904	Piwi.				DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		TGGCATTCCTACGCATTATGT	0.448																0.336634	106.023982	108.405888	34	67	KEEP	---	---	---	---	15	29	35	41	-1	capture	Missense_Mutation	SNP	22211836	22211836	PIWIL2	8	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	11861	260
COL14A1	7373	broad.mit.edu	37	8	121160106	121160106	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:121160106C>T	uc003yox.2	+	2	290	c.25C>T	c.(25-27)CGG>TGG	p.R9W		NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	9					cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GCGCAAGATGCGGTACTGGTT	0.423					1131											0.45	49.433376	49.521779	18	22	KEEP	---	---	---	---	10	9	13	11	-1	capture	Missense_Mutation	SNP	121160106	121160106	COL14A1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	3636	260
PTPRD	5789	broad.mit.edu	37	9	8341178	8341178	+	Missense_Mutation	SNP	G	C	C			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:8341178G>C	uc003zkk.2	-	40	5749	c.5038C>G	c.(5038-5040)CCA>GCA	p.P1680A	PTPRD_uc003zkp.2_Missense_Mutation_p.P1274A|PTPRD_uc003zkq.2_Missense_Mutation_p.P1273A|PTPRD_uc003zkr.2_Missense_Mutation_p.P1264A|PTPRD_uc003zks.2_Missense_Mutation_p.P1273A|PTPRD_uc003zkl.2_Missense_Mutation_p.P1671A|PTPRD_uc003zkm.2_Missense_Mutation_p.P1667A|PTPRD_uc003zkn.2_Missense_Mutation_p.P1269A|PTPRD_uc003zko.2_Missense_Mutation_p.P1270A	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1680	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GATTCATATGGCATAATATTA	0.393					1253								TSP Lung(15;0.13)			0.316832	204.520371	210.550729	64	138	KEEP	---	---	---	---	38	32	78	78	-1	capture	Missense_Mutation	SNP	8341178	8341178	PTPRD	9	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	12694	260
PTPRD	5789	broad.mit.edu	37	9	8341203	8341203	+	Missense_Mutation	SNP	G	C	C			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:8341203G>C	uc003zkk.2	-	40	5724	c.5013C>G	c.(5011-5013)TTC>TTG	p.F1671L	PTPRD_uc003zkp.2_Missense_Mutation_p.F1265L|PTPRD_uc003zkq.2_Missense_Mutation_p.F1264L|PTPRD_uc003zkr.2_Missense_Mutation_p.F1255L|PTPRD_uc003zks.2_Missense_Mutation_p.F1264L|PTPRD_uc003zkl.2_Missense_Mutation_p.F1662L|PTPRD_uc003zkm.2_Missense_Mutation_p.F1658L|PTPRD_uc003zkn.2_Missense_Mutation_p.F1260L|PTPRD_uc003zko.2_Missense_Mutation_p.F1261L	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1671	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GGCGATTTTTGAATTTATTAC	0.388					1253								TSP Lung(15;0.13)			0.280851	214.450659	224.593384	66	169	KEEP	---	---	---	---	42	35	104	106	-1	capture	Missense_Mutation	SNP	8341203	8341203	PTPRD	9	G	C	C	C	1	0	0	0	0	1	0	0	0	581	45	4	4	12694	260
TRAF1	7185	broad.mit.edu	37	9	123673632	123673632	+	Missense_Mutation	SNP	C	T	T	rs149705933		TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:123673632C>T	uc004bku.1	-	6	1437	c.865G>A	c.(865-867)GTC>ATC	p.V289I	TRAF1_uc011lyg.1_Missense_Mutation_p.V167I|TRAF1_uc010mvl.1_Missense_Mutation_p.V289I	NM_005658	NP_005649	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	289	MATH.				apoptosis|positive regulation of NF-kappaB transcription factor activity|protein complex assembly|regulation of apoptosis|signal transduction	cytoplasm	protein binding|zinc ion binding	p.V289I(1)		skin(2)|ovary(1)	3						AAGAGGCTGACGGTCCTGCCA	0.612																0.195122	16.182063	19.731887	8	33	KEEP	---	---	---	---	3	7	19	19	-1	capture	Missense_Mutation	SNP	123673632	123673632	TRAF1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16320	260
SATL1	340562	broad.mit.edu	37	X	84363108	84363108	+	Silent	SNP	C	T	T			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:84363108C>T	uc011mqx.1	-	1	867	c.867G>A	c.(865-867)GTG>GTA	p.V289V	SATL1_uc004een.2_Silent_p.V289V	NM_001163541	NP_001157013	Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	102	Gln-rich.						N-acetyltransferase activity			breast(2)	2						GTTTCATGTCCACTTGGTTCA	0.463																0.166667	22.087933	29.037152	11	55	KEEP	---	---	---	---	1	12	38	26	-1	capture	Silent	SNP	84363108	84363108	SATL1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	13747	260
RANBP10	57610	broad.mit.edu	37	16	67840366	67840366	+	Frame_Shift_Del	DEL	C	-	-			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67840366delC	uc002eud.2	-	1	190	c.74delG	c.(73-75)GGCfs	p.G25fs	RANBP10_uc010ceo.2_5'UTR|RANBP10_uc010vju.1_Frame_Shift_Del_p.G25fs|RANBP10_uc010vjv.1_5'UTR|RANBP10_uc010vjx.1_Frame_Shift_Del_p.G25fs|RANBP10_uc010vjy.1_5'UTR|TSNAXIP1_uc010cep.2_5'Flank|TSNAXIP1_uc010vjz.1_5'Flank|TSNAXIP1_uc002euf.3_5'Flank|TSNAXIP1_uc010vka.1_5'Flank|TSNAXIP1_uc010vkb.1_5'Flank|TSNAXIP1_uc002eug.3_5'Flank|TSNAXIP1_uc002euh.3_5'Flank|TSNAXIP1_uc002eui.3_5'Flank|TSNAXIP1_uc002euj.2_5'Flank	NM_020850	NP_065901	Q6VN20	RBP10_HUMAN	RAN binding protein 10	25										ovary(1)	1		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		CGGCAGCCCGCCCCCAGCGCC	0.711																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	67840366	67840366	RANBP10	16	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	12921	260
PIK3R1	5295	broad.mit.edu	37	5	67589601	67589602	+	In_Frame_Ins	INS	-	GTT	GTT			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589601_67589602insGTT	uc003jva.2	+	11	1924_1925	c.1364_1365insGTT	c.(1363-1365)CAG>CAGTTG	p.455_456insL	PIK3R1_uc003jvb.2_In_Frame_Ins_p.455_456insL|PIK3R1_uc003jvc.2_In_Frame_Ins_p.155_156insL|PIK3R1_uc003jvd.2_In_Frame_Ins_p.185_186insL|PIK3R1_uc003jve.2_In_Frame_Ins_p.134_135insL|PIK3R1_uc011crb.1_In_Frame_Ins_p.125_126insL	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	455_456					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.D434_Q475del(2)|p.T454_Q455>Q(1)|p.Y452_Q455>SGGSRIK(1)|p.?(1)|p.F456_R461del(1)|p.T454_D464del(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TATAACACTCAGTTTCAAGAAA	0.287					370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.39			34	54		---	---	---	---						capture_indel	In_Frame_Ins	INS	67589601	67589602	PIK3R1	5	-	GTT	GTT	GTT	1	0	1	1	0	0	0	0	0	91	7	5	5	11821	260
SUMF2	25870	broad.mit.edu	37	7	56141892	56141892	+	Frame_Shift_Del	DEL	A	-	-			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:56141892delA	uc003trv.2	+	4	453	c.422delA	c.(421-423)GAAfs	p.E141fs	PSPH_uc003trj.2_Intron|SUMF2_uc011kcv.1_RNA|SUMF2_uc011kcw.1_Frame_Shift_Del_p.E141fs|SUMF2_uc011kcx.1_Frame_Shift_Del_p.E141fs|SUMF2_uc003trt.2_Frame_Shift_Del_p.E34fs|SUMF2_uc011kcy.1_Intron|SUMF2_uc011kcz.1_Intron|SUMF2_uc003tru.2_RNA|SUMF2_uc011kda.1_Intron|SUMF2_uc003trx.2_Intron	NM_001130069	NP_001123541	Q8NBJ7	SUMF2_HUMAN	sulfatase modifying factor 2 isoform e	122						endoplasmic reticulum lumen	metal ion binding			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTTCCAGTGGAAAAGGCATTT	0.562														OREG0018081	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.00			7	1908		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	56141892	56141892	SUMF2	7	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	15274	260
SLC2A8	29988	broad.mit.edu	37	9	130165020	130165020	+	Frame_Shift_Del	DEL	C	-	-			TCGA-74-6573-01	TCGA-74-6573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130165020delC	uc004bqu.2	+	5	756	c.711delC	c.(709-711)ATCfs	p.I237fs	SLC2A8_uc010mxj.2_Frame_Shift_Del_p.I237fs|SLC2A8_uc004bqv.2_5'Flank	NM_014580	NP_055395	Q9NY64	GTR8_HUMAN	solute carrier family 2 (facilitated glucose	237	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to plasma membrane	D-glucose transmembrane transporter activity			ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2						ACCCCCCCATCGGGGCTGAGC	0.677																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	130165020	130165020	SLC2A8	9	C	-	-	-	1	0	1	0	1	0	0	0	0	395	31	5	5	14443	260
