Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
HMGB4	127540	broad.mit.edu	37	1	34330273	34330273	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:34330273C>T	uc001bxp.2	+	2	2224	c.481C>T	c.(481-483)CGT>TGT	p.R161C	CSMD2_uc001bxm.1_Intron|CSMD2_uc001bxn.1_Intron|HMGB4_uc001bxq.2_Missense_Mutation_p.R87C	NM_145205	NP_660206	Q8WW32	HMGB4_HUMAN	HMG2 like isoform 1	161						nucleus	DNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TGAACTCTACCGTAAACAATG	0.478																0.340426	47.384641	48.442961	16	31	KEEP	---	---	---	---	11	7	17	18	-1	capture	Missense_Mutation	SNP	34330273	34330273	HMGB4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7153	289
STK40	83931	broad.mit.edu	37	1	36820904	36820904	+	Missense_Mutation	SNP	T	C	C			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:36820904T>C	uc001cak.1	-	6	880	c.473A>G	c.(472-474)AAC>AGC	p.N158S	STK40_uc001cal.1_Missense_Mutation_p.N163S|STK40_uc001cam.1_Missense_Mutation_p.N158S|STK40_uc009vva.1_Missense_Mutation_p.N158S|STK40_uc001can.1_Missense_Mutation_p.N158S	NM_032017	NP_114406	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	158	Protein kinase.					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)				GTGCTGCAGGTTGATGAGGTC	0.562					230											0.443548	377.664066	378.358859	110	138	KEEP	---	---	---	---	55	74	72	87	-1	capture	Missense_Mutation	SNP	36820904	36820904	STK40	1	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	15197	289
IFI44L	10964	broad.mit.edu	37	1	79094655	79094655	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:79094655C>T	uc010oro.1	+	3	677	c.498C>T	c.(496-498)GAC>GAT	p.D166D	IFI44L_uc010orp.1_Translation_Start_Site|IFI44L_uc010orq.1_Intron	NM_006820	NP_006811	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	166						cytoplasm					0						ATAACCTAGACGACATAAAGA	0.294																0.416667	61.294622	61.584726	20	28	KEEP	---	---	---	---	9	14	9	22	-1	capture	Silent	SNP	79094655	79094655	IFI44L	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7443	289
OR6N1	128372	broad.mit.edu	37	1	158735944	158735944	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158735944C>T	uc010piq.1	-	1	529	c.529G>A	c.(529-531)GTC>ATC	p.V177I		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	177	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					TCACAAAAGACGTGCTGAATG	0.473																0.393939	116.57986	117.559906	39	60	KEEP	---	---	---	---	16	27	32	34	-1	capture	Missense_Mutation	SNP	158735944	158735944	OR6N1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11110	289
USH2A	7399	broad.mit.edu	37	1	216419959	216419959	+	Missense_Mutation	SNP	C	T	T	rs146916397	byFrequency	TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216419959C>T	uc001hku.1	-	13	3164	c.2777G>A	c.(2776-2778)CGT>CAT	p.R926H	USH2A_uc001hkv.2_Missense_Mutation_p.R926H	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	926	Laminin EGF-like 8.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCTTCCTTGACGATTAGGCAC	0.423													HNSCC(13;0.011)			0.387755	113.531157	114.611798	38	60	KEEP	---	---	---	---	13	31	26	43	-1	capture	Missense_Mutation	SNP	216419959	216419959	USH2A	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16918	289
PTEN	5728	broad.mit.edu	37	10	89711891	89711891	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89711891G>A	uc001kfb.2	+	7	1540	c.509G>A	c.(508-510)AGT>AAT	p.S170N		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	170	Phosphatase tensin-type.		S -> N (loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|S -> R (in BZS; severely reduced protein phosphatase activity; loss of phosphatase activity towards Ins(1,3,4,5)P4).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.V166fs*17(3)|p.?(3)|p.G165fs*9(3)|p.S170N(3)|p.S170I(3)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.V166fs*10(1)|p.G165_K342del(1)|p.G165_*404del(1)|p.S170fs*13(1)|p.S170G(1)|p.S170fs*8(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		ACTATTCCCAGTCAGAGGCGC	0.353			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.802632	207.440336	213.892195	61	15	KEEP	---	---	---	---	35	29	6	11	-1	capture	Missense_Mutation	SNP	89711891	89711891	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	12633	289
CELF1	10658	broad.mit.edu	37	11	47496959	47496959	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:47496959G>A	uc001nfl.2	-	10	1128	c.1118C>T	c.(1117-1119)GCG>GTG	p.A373V	CELF1_uc001nfm.2_Missense_Mutation_p.A370V|CELF1_uc001nfn.2_Missense_Mutation_p.A369V|CELF1_uc001nfo.1_Missense_Mutation_p.A399V|CELF1_uc010rhm.1_Missense_Mutation_p.A372V|CELF1_uc001nfp.2_Missense_Mutation_p.A401V|CELF1_uc001nfq.1_Missense_Mutation_p.A373V|CELF1_uc001nfr.1_Missense_Mutation_p.A373V	NM_001025596	NP_001020767	Q92879	CELF1_HUMAN	CUG triplet repeat, RNA-binding protein 1	373					embryo development|mRNA splice site selection|regulation of RNA splicing|RNA interference	cytoplasm|nucleus|ribonucleoprotein complex	BRE binding|mRNA binding|nucleotide binding|translation repressor activity, nucleic acid binding			central_nervous_system(2)|ovary(1)	3						AGTGGGGAGCGCAGCAGCAGC	0.577	Pancreas(163;1949 1966 9906 43218 43785)															0.052632	-9.225651	6.826832	4	72	KEEP	---	---	---	---	1	4	44	38	-1	capture	Missense_Mutation	SNP	47496959	47496959	CELF1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3183	289
ANO1	55107	broad.mit.edu	37	11	70009414	70009414	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:70009414G>A	uc001opj.2	+	19	2223	c.1918G>A	c.(1918-1920)GTG>ATG	p.V640M	ANO1_uc001opk.1_Missense_Mutation_p.V582M|ANO1_uc001opl.1_RNA|ANO1_uc010rqk.1_Missense_Mutation_p.V349M	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	640	Extracellular (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						GGGCGACTACGTGTACATTTT	0.527																0.324324	32.385448	33.399842	12	25	KEEP	---	---	---	---	5	9	9	24	-1	capture	Missense_Mutation	SNP	70009414	70009414	ANO1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	689	289
NFRKB	4798	broad.mit.edu	37	11	129762715	129762715	+	Missense_Mutation	SNP	A	C	C			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:129762715A>C	uc001qfi.2	-	3	231	c.30T>G	c.(28-30)GAT>GAG	p.D10E	NFRKB_uc001qfg.2_Missense_Mutation_p.D23E|NFRKB_uc001qfh.2_Missense_Mutation_p.D33E|NFRKB_uc010sbw.1_Missense_Mutation_p.D10E	NM_001143835	NP_001137307	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	10					DNA recombination|DNA repair|inflammatory response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Ino80 complex	DNA binding|protease binding			ovary(3)	3	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		GTTCCAGAGGATCTGTCAGCA	0.522																0.066667	-0.402858	8.346125	3	42	KEEP	---	---	---	---	2	1	29	24	-1	capture	Missense_Mutation	SNP	129762715	129762715	NFRKB	11	A	C	C	C	1	0	0	0	0	1	0	0	0	154	12	4	4	10291	289
CACNA1C	775	broad.mit.edu	37	12	2602399	2602399	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:2602399G>A	uc009zdu.1	+	7	1273	c.960G>A	c.(958-960)ACG>ACA	p.T320T	CACNA1C_uc009zdv.1_Silent_p.T317T|CACNA1C_uc001qkb.2_Silent_p.T320T|CACNA1C_uc001qkc.2_Silent_p.T320T|CACNA1C_uc001qke.2_Silent_p.T320T|CACNA1C_uc001qkf.2_Silent_p.T320T|CACNA1C_uc001qjz.2_Silent_p.T320T|CACNA1C_uc001qkd.2_Silent_p.T320T|CACNA1C_uc001qkg.2_Silent_p.T320T|CACNA1C_uc009zdw.1_Silent_p.T320T|CACNA1C_uc001qkh.2_Silent_p.T320T|CACNA1C_uc001qkl.2_Silent_p.T320T|CACNA1C_uc001qkn.2_Silent_p.T320T|CACNA1C_uc001qko.2_Silent_p.T320T|CACNA1C_uc001qkp.2_Silent_p.T320T|CACNA1C_uc001qkr.2_Silent_p.T320T|CACNA1C_uc001qku.2_Silent_p.T320T|CACNA1C_uc001qkq.2_Silent_p.T320T|CACNA1C_uc001qks.2_Silent_p.T320T|CACNA1C_uc001qkt.2_Silent_p.T320T|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_Silent_p.T56T|CACNA1C_uc001qkj.1_Silent_p.T56T|CACNA1C_uc001qkk.1_Silent_p.T56T|CACNA1C_uc001qkm.1_Silent_p.T56T	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	320	I.|Extracellular (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CGCTGGAAACGGGCCACGGGC	0.607																0.413043	112.071575	112.691555	38	54	KEEP	---	---	---	---	15	27	32	37	-1	capture	Silent	SNP	2602399	2602399	CACNA1C	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2516	289
CCDC41	51134	broad.mit.edu	37	12	94761893	94761893	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:94761893C>T	uc001tdd.2	-	10	1719	c.1133G>A	c.(1132-1134)CGT>CAT	p.R378H	CCDC41_uc001tde.2_Missense_Mutation_p.R378H|CCDC41_uc009zsw.1_RNA	NM_016122	NP_057206	Q9Y592	CCD41_HUMAN	NY-REN-58 antigen	370	Potential.										0						TTGTACTTTACGTATTAATTC	0.333																0.325	36.661686	37.748457	13	27	KEEP	---	---	---	---	6	9	10	18	-1	capture	Missense_Mutation	SNP	94761893	94761893	CCDC41	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2787	289
STAB2	55576	broad.mit.edu	37	12	104102273	104102273	+	Missense_Mutation	SNP	G	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104102273G>T	uc001tjw.2	+	39	4433	c.4247G>T	c.(4246-4248)TGT>TTT	p.C1416F		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	1416	Extracellular (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GATGGCTCCTGTGACTGTGAT	0.478																0.310811	69.797738	72.156674	23	51	KEEP	---	---	---	---	14	12	38	21	0.538461538462	capture	Missense_Mutation	SNP	104102273	104102273	STAB2	12	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	15128	289
PCID2	55795	broad.mit.edu	37	13	113852564	113852564	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113852564C>T	uc010tju.1	-	3	222	c.141G>A	c.(139-141)GAG>GAA	p.E47E	PCID2_uc010tjv.1_Silent_p.E47E|PCID2_uc010tjw.1_Silent_p.E47E|PCID2_uc001vte.2_5'UTR|PCID2_uc001vtd.2_5'UTR|PCID2_uc001vtf.2_5'UTR|PCID2_uc001vtg.1_RNA	NM_001127203	NP_001120675	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	47					negative regulation of apoptosis|negative regulation of cysteine-type endopeptidase activity|positive regulation of mitotic cell cycle spindle assembly checkpoint|positive regulation of transcription, DNA-dependent|regulation of mRNA stability|spleen development		protein binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			GACACTTCTCCTCTGGAGAGG	0.358																0.413793	114.234308	114.809922	36	51	KEEP	---	---	---	---	22	16	25	34	-1	capture	Silent	SNP	113852564	113852564	PCID2	13	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	11482	289
LRFN5	145581	broad.mit.edu	37	14	42356780	42356780	+	Missense_Mutation	SNP	A	G	G			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:42356780A>G	uc001wvm.2	+	3	2150	c.952A>G	c.(952-954)ATT>GTT	p.I318V	LRFN5_uc010ana.2_Missense_Mutation_p.I318V	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	318	Extracellular (Potential).|Ig-like.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGAGCCTGCAATTCACTGGAT	0.463													HNSCC(30;0.082)			0.305556	107.144289	110.780617	33	75	KEEP	---	---	---	---	12	25	34	50	-1	capture	Missense_Mutation	SNP	42356780	42356780	LRFN5	14	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	8857	289
NDN	4692	broad.mit.edu	37	15	23931738	23931738	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:23931738G>A	uc001ywk.2	-	1	713	c.627C>T	c.(625-627)GCC>GCT	p.A209A		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	209	MAGE.				negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CGTTCCAGACGGCGCTCTCTC	0.632												Prader-Willi_syndrome				0.470588	50.799435	50.824767	16	18	KEEP	---	---	---	---	8	9	10	12	-1	capture	Silent	SNP	23931738	23931738	NDN	15	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10154	289
ACSM1	116285	broad.mit.edu	37	16	20651783	20651783	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20651783C>T	uc002dhm.1	-	7	1184	c.1116G>A	c.(1114-1116)ACG>ACA	p.T372T	ACSM1_uc002dhn.1_Intron|ACSM1_uc010bwg.1_Silent_p.T372T	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member	372					benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)|skin(1)	2						caCCACCTACCGTTTCCGACT	0.313																0.295455	39.957428	41.604367	13	31	KEEP	---	---	---	---	10	4	17	18	-1	capture	Silent	SNP	20651783	20651783	ACSM1	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	182	289
SCNN1B	6338	broad.mit.edu	37	16	23387159	23387159	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23387159G>A	uc002dln.2	+	8	1429	c.1253G>A	c.(1252-1254)CGG>CAG	p.R418Q		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	418	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	TGCAACAACCGGGACTTCCCA	0.612																0.466667	67.404852	67.444293	21	24	KEEP	---	---	---	---	6	20	10	16	-1	capture	Missense_Mutation	SNP	23387159	23387159	SCNN1B	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13821	289
PKD1L2	114780	broad.mit.edu	37	16	81181775	81181775	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81181775G>A	uc002fgh.1	-	29	4941	c.4941C>T	c.(4939-4941)GAC>GAT	p.D1647D	PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	1647	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TCAGAAGGCCGTCCTCCATGG	0.642																0.26087	12.935877	14.130178	6	17	KEEP	---	---	---	---	2	4	8	11	-1	capture	Silent	SNP	81181775	81181775	PKD1L2	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11868	289
MTHFSD	64779	broad.mit.edu	37	16	86585659	86585659	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:86585659C>T	uc002fjn.2	-	3	268	c.217G>A	c.(217-219)GTT>ATT	p.V73I	MTHFSD_uc010voo.1_Missense_Mutation_p.V53I|MTHFSD_uc002fjo.2_Intron|MTHFSD_uc002fjm.2_Missense_Mutation_p.V72I|MTHFSD_uc010vop.1_5'UTR|MTHFSD_uc010voq.1_Intron|MTHFSD_uc010vor.1_Intron|MTHFSD_uc002fjp.2_Missense_Mutation_p.V53I	NM_001159377	NP_001152849	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain	73					folic acid-containing compound biosynthetic process		5-formyltetrahydrofolate cyclo-ligase activity|ATP binding|RNA binding				0						AGCAGCCGAACGCCTTCCAGT	0.537																0.248619	107.98781	118.393075	45	136	KEEP	---	---	---	---	26	26	77	78	-1	capture	Missense_Mutation	SNP	86585659	86585659	MTHFSD	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9843	289
GLP2R	9340	broad.mit.edu	37	17	9783793	9783793	+	Missense_Mutation	SNP	T	G	G			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:9783793T>G	uc002gmd.1	+	11	1244	c.1244T>G	c.(1243-1245)CTT>CGT	p.L415R		NM_004246	NP_004237	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor precursor	415	Extracellular (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				lung(2)|ovary(1)	3					Glucagon recombinant(DB00040)	TTTGCAAAACTTATACGACTT	0.393																0.034722	-26.518351	7.88972	5	139	KEEP	---	---	---	---	2	5	59	85	-1	capture	Missense_Mutation	SNP	9783793	9783793	GLP2R	17	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	6389	289
KRTAP4-11	653240	broad.mit.edu	37	17	39274206	39274206	+	Missense_Mutation	SNP	C	T	T	rs79388709		TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274206C>T	uc002hvz.2	-	1	401	c.362G>A	c.(361-363)AGA>AAA	p.R121K		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	121	20.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcactggggtctgcagcagct	0.100																0.185185	9.855329	12.371063	5	22	KEEP	---	---	---	---	2	4	8	20	-1	capture	Missense_Mutation	SNP	39274206	39274206	KRTAP4-11	17	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	8469	289
PRKCA	5578	broad.mit.edu	37	17	64299034	64299034	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:64299034G>A	uc002jfp.1	+	1	109	c.65G>A	c.(64-66)CGC>CAC	p.R22H	PRKCA_uc002jfo.1_5'UTR	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	22					activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	CGCTTCGCCCGCAAAGGGGCG	0.642					554											0.115385	3.112345	6.895664	3	23	KEEP	---	---	---	---	1	2	13	15	-1	capture	Missense_Mutation	SNP	64299034	64299034	PRKCA	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12403	289
LAMA1	284217	broad.mit.edu	37	18	6956725	6956725	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:6956725G>A	uc002knm.2	-	56	8098	c.8004C>T	c.(8002-8004)GTC>GTT	p.V2668V	LAMA1_uc002knk.2_5'Flank|LAMA1_uc002knl.2_Silent_p.V121V|LAMA1_uc010wzj.1_Silent_p.V2144V	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2668	Laminin G-like 3.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGTCCAGGTCGACTTGCTCAT	0.512					1597											0.392857	64.600946	65.174139	22	34	KEEP	---	---	---	---	15	8	17	21	-1	capture	Silent	SNP	6956725	6956725	LAMA1	18	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	8525	289
SETBP1	26040	broad.mit.edu	37	18	42532158	42532158	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:42532158C>T	uc010dni.2	+	4	3149	c.2853C>T	c.(2851-2853)CTC>CTT	p.L951L		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	951						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GCGATGACCTCCAGTTTCTGG	0.502												Schinzel-Giedion_syndrome				0.507937	101.999336	102.002753	32	31	KEEP	---	---	---	---	13	22	19	14	-1	capture	Silent	SNP	42532158	42532158	SETBP1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	14022	289
FBN3	84467	broad.mit.edu	37	19	8130913	8130913	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8130913G>A	uc002mjf.2	-	63	8341	c.8320C>T	c.(8320-8322)CGG>TGG	p.R2774W	FBN3_uc002mje.2_Missense_Mutation_p.R570W	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	2774						proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						ACCTCCAGCCGGTAGGTTCCA	0.677																0.652174	98.560732	99.500387	30	16	KEEP	---	---	---	---	17	20	12	11	-1	capture	Missense_Mutation	SNP	8130913	8130913	FBN3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	5650	289
ZNF536	9745	broad.mit.edu	37	19	30934790	30934790	+	Silent	SNP	C	T	T	rs144245375		TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:30934790C>T	uc002nsu.1	+	2	459	c.321C>T	c.(319-321)AAC>AAT	p.N107N	ZNF536_uc010edd.1_Silent_p.N107N	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	107					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					AGTTCCTCAACGGGCAGAACC	0.652																0.444444	34.094084	34.167003	12	15	KEEP	---	---	---	---	4	8	3	14	-1	capture	Silent	SNP	30934790	30934790	ZNF536	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17853	289
PDCD2L	84306	broad.mit.edu	37	19	34895691	34895691	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:34895691C>T	uc002nvj.2	+	2	279	c.246C>T	c.(244-246)TGC>TGT	p.C82C		NM_032346	NP_115722	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	82						cytoplasm				ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			CGTGCGCCTGCCCCGGCTGTA	0.721																0.4	11.343541	11.416327	4	6	KEEP	---	---	---	---	4	2	3	3	-1	capture	Silent	SNP	34895691	34895691	PDCD2L	19	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	11523	289
RYR1	6261	broad.mit.edu	37	19	38990276	38990276	+	Silent	SNP	C	T	T	rs138617219		TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38990276C>T	uc002oit.2	+	44	7159	c.7029C>T	c.(7027-7029)GGC>GGT	p.G2343G	RYR1_uc002oiu.2_Silent_p.G2343G|RYR1_uc002oiv.1_5'UTR	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2343	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GGTGGCCAGGCGAGAGCGTGG	0.667																0.321429	23.51013	24.280189	9	19	KEEP	---	---	---	---	6	5	8	12	-1	capture	Silent	SNP	38990276	38990276	RYR1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	13660	289
NLRP12	91662	broad.mit.edu	37	19	54312898	54312898	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54312898G>A	uc002qch.3	-	3	2235	c.2015C>T	c.(2014-2016)GCG>GTG	p.A672V	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.A672V|NLRP12_uc002qcj.3_Missense_Mutation_p.A672V|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.A672V	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	672					negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TTCCCCGTCCGCGCTGTAGGT	0.622																0.323529	29.714308	30.653646	11	23	KEEP	---	---	---	---	8	3	7	18	-1	capture	Missense_Mutation	SNP	54312898	54312898	NLRP12	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10381	289
AFF3	3899	broad.mit.edu	37	2	100209854	100209854	+	Missense_Mutation	SNP	G	C	C	rs56151323		TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:100209854G>C	uc002tag.2	-	14	2505	c.2269C>G	c.(2269-2271)CTA>GTA	p.L757V	AFF3_uc002taf.2_Missense_Mutation_p.L782V|AFF3_uc010fiq.1_Missense_Mutation_p.L757V|AFF3_uc010yvr.1_Missense_Mutation_p.L910V|AFF3_uc002tah.1_Missense_Mutation_p.L782V	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	757					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						CTGTCCTTTAGAGGGGAGAGA	0.572					693											0.373134	84.758575	85.705618	25	42	KEEP	---	---	---	---	13	13	24	20	-1	capture	Missense_Mutation	SNP	100209854	100209854	AFF3	2	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	358	289
SCN9A	6335	broad.mit.edu	37	2	167162345	167162345	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167162345G>A	uc010fpl.2	-	5	894	c.553C>T	c.(553-555)CGT>TGT	p.R185C	SCN9A_uc002udr.1_Missense_Mutation_p.R56C|SCN9A_uc002uds.1_Missense_Mutation_p.R56C|SCN9A_uc002udt.1_Missense_Mutation_p.R56C	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	185	I.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	CACGGGTCACGAAGAAAAGTG	0.378																0.32	46.783208	48.222069	16	34	KEEP	---	---	---	---	12	6	19	23	-1	capture	Missense_Mutation	SNP	167162345	167162345	SCN9A	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13818	289
XIRP2	129446	broad.mit.edu	37	2	168100110	168100110	+	Silent	SNP	C	T	T	rs76149079	byFrequency;by1000genomes	TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:168100110C>T	uc002udx.2	+	8	2226	c.2208C>T	c.(2206-2208)TTC>TTT	p.F736F	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.F561F|XIRP2_uc010fpq.2_Silent_p.F514F|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	561	Xin 6.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TAAAATGTTTCGAAACTCAAC	0.368																0.509434	87.990899	87.997327	27	26	KEEP	---	---	---	---	12	15	10	18	-1	capture	Silent	SNP	168100110	168100110	XIRP2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	17311	289
LRP2	4036	broad.mit.edu	37	2	170145548	170145548	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170145548G>A	uc002ues.2	-	9	1243	c.1030C>T	c.(1030-1032)CGT>TGT	p.R344C	LRP2_uc010zdf.1_Missense_Mutation_p.R344C	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	344	EGF-like 1.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ACACAGGTACGGCTGTCATTG	0.522					2055											0.431579	130.724029	131.097185	41	54	KEEP	---	---	---	---	19	27	20	43	-1	capture	Missense_Mutation	SNP	170145548	170145548	LRP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8872	289
TTN	7273	broad.mit.edu	37	2	179498195	179498195	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179498195G>A	uc010zfg.1	-	181	35411	c.35187C>T	c.(35185-35187)GGC>GGT	p.G11729G	TTN_uc010zfh.1_Silent_p.G5424G|TTN_uc010zfi.1_Silent_p.G5357G|TTN_uc010zfj.1_Silent_p.G5232G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12656							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACACATATTCGCCTTTATCTT	0.428				p.G11729G(NCIH2110-Tumor)	8722											0.578947	99.165649	99.473902	33	24	KEEP	---	---	---	---	10	26	7	19	-1	capture	Silent	SNP	179498195	179498195	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	16617	289
MPP4	58538	broad.mit.edu	37	2	202545627	202545627	+	Missense_Mutation	SNP	T	G	G			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202545627T>G	uc002uyk.3	-	10	1071	c.863A>C	c.(862-864)CAG>CCG	p.Q288P	MPP4_uc010ftj.2_Missense_Mutation_p.Q288P|MPP4_uc010zhq.1_Missense_Mutation_p.Q288P|MPP4_uc010zhr.1_Missense_Mutation_p.Q288P|MPP4_uc010zhs.1_Missense_Mutation_p.Q244P|MPP4_uc002uyj.3_Missense_Mutation_p.Q244P|MPP4_uc010zht.1_Missense_Mutation_p.Q261P|MPP4_uc002uyl.3_RNA|MPP4_uc010ftk.2_Missense_Mutation_p.Q275P|MPP4_uc002uym.1_Missense_Mutation_p.Q257P|MPP4_uc002uyn.2_Missense_Mutation_p.Q244P	NM_033066	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4	288	SH3.					cytoplasm	protein binding				0						TTTTCGGGCCTGCCACCAGAG	0.582														OREG0015145	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.517241	45.322934	45.330328	15	14	KEEP	---	---	---	---	7	9	5	9	-1	capture	Missense_Mutation	SNP	202545627	202545627	MPP4	2	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	9648	289
PAX3	5077	broad.mit.edu	37	2	223066892	223066892	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:223066892G>A	uc010fwo.2	-	8	1557	c.1191C>T	c.(1189-1191)ACC>ACT	p.T397T	PAX3_uc002vmt.1_Silent_p.T397T|PAX3_uc002vmy.1_Silent_p.T396T|PAX3_uc002vmv.1_Silent_p.T397T|PAX3_uc002vmw.1_Intron|PAX3_uc002vmx.1_Intron	NM_181457	NP_852122	P23760	PAX3_HUMAN	paired box 3 isoform PAX3	397					apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CACCGTGGTTGGTCAGGAGTC	0.537					141	T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						0.272727	7.518965	8.032064	3	8	KEEP	---	---	---	---	2	1	1	7	-1	capture	Silent	SNP	223066892	223066892	PAX3	2	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	11383	289
MYH9	4627	broad.mit.edu	37	22	36714329	36714329	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:36714329C>T	uc003apg.2	-	11	1381	c.1150G>A	c.(1150-1152)GAT>AAT	p.D384N	MYH9_uc003aph.1_Missense_Mutation_p.D248N	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	384	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						CTGGTGAAATCGGTCACATTG	0.502					1624	T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				0.425926	277.834993	278.851356	92	124	KEEP	---	---	---	---	50	51	65	80	-1	capture	Missense_Mutation	SNP	36714329	36714329	MYH9	22	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9952	289
CELSR1	9620	broad.mit.edu	37	22	46829324	46829324	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46829324C>T	uc003bhw.1	-	5	4577	c.4577G>A	c.(4576-4578)CGG>CAG	p.R1526Q		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	1526	Extracellular (Potential).|Laminin G-like 1.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		AGAGTGCCACCGCCCGTCACT	0.612																0.166667	8.985631	11.513028	4	20	KEEP	---	---	---	---	1	3	11	14	-1	capture	Missense_Mutation	SNP	46829324	46829324	CELSR1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3189	289
CRELD1	78987	broad.mit.edu	37	3	9976243	9976243	+	Missense_Mutation	SNP	C	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9976243C>A	uc003bug.2	+	2	239	c.121C>A	c.(121-123)CCT>ACT	p.P41T	CIDEC_uc003bto.2_Intron|CRELD1_uc003buf.2_Missense_Mutation_p.P41T|CRELD1_uc003buh.2_Missense_Mutation_p.P41T|CRELD1_uc003bui.2_Missense_Mutation_p.P41T|CRELD1_uc003buj.2_RNA	NM_001077415	NP_001070883	Q96HD1	CREL1_HUMAN	cysteine-rich with EGF-like domains 1 isoform 3	41	Pro-rich.|Extracellular (Potential).				cardiac septum development|endocardial cushion development	integral to membrane	calcium ion binding			ovary(1)	1						TTCTCCCCCGCCTCAGCCCCA	0.582																0.324324	29.474829	30.494969	12	25	KEEP	---	---	---	---	4	9	10	17	0.692307692308	capture	Missense_Mutation	SNP	9976243	9976243	CRELD1	3	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	3831	289
STXBP5L	9515	broad.mit.edu	37	3	120976169	120976169	+	Missense_Mutation	SNP	T	G	G			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:120976169T>G	uc003eec.3	+	17	1961	c.1821T>G	c.(1819-1821)ATT>ATG	p.I607M	STXBP5L_uc011bji.1_Missense_Mutation_p.I607M	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	607	WD 9.				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		AGGACAGTATTCCATGCCTCA	0.368																0.336735	111.746653	114.056474	33	65	KEEP	---	---	---	---	21	16	31	43	-1	capture	Missense_Mutation	SNP	120976169	120976169	STXBP5L	3	T	G	G	G	1	0	0	0	0	1	0	0	0	796	62	4	4	15247	289
TP63	8626	broad.mit.edu	37	3	189456442	189456442	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:189456442C>T	uc003fry.2	+	3	292	c.203C>T	c.(202-204)TCA>TTA	p.S68L	TP63_uc003frx.2_Missense_Mutation_p.S68L|TP63_uc003frz.2_Missense_Mutation_p.S68L|TP63_uc010hzc.1_Missense_Mutation_p.S68L	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	68	Transcription activation.				anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CCTATATGTTCAGTTCAGCCC	0.408					423							Hay-Wells_syndrome	HNSCC(45;0.13)			0.060241	-6.298735	10.485854	5	78	KEEP	---	---	---	---	3	2	34	58	-1	capture	Missense_Mutation	SNP	189456442	189456442	TP63	3	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	16275	289
ANAPC4	29945	broad.mit.edu	37	4	25416009	25416009	+	Splice_Site	SNP	T	C	C			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:25416009T>C	uc003gro.2	+	23	1814	c.1685_splice	c.e23+2	p.S562_splice	ANAPC4_uc003grp.2_Splice_Site_p.S448_splice|ANAPC4_uc003grq.2_Splice_Site_p.S15_splice	NM_013367	NP_037499	Q9UJX5	APC4_HUMAN	anaphase-promoting complex subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5		Breast(46;0.0503)				TACCAGAAGGTAATTCTGTTT	0.294																0.384615	51.632224	52.081423	15	24	KEEP	---	---	---	---	6	12	18	12	-1	capture	Splice_Site	SNP	25416009	25416009	ANAPC4	4	T	C	C	C	1	0	0	0	0	0	0	1	0	741	57	5	3	601	289
NIPAL1	152519	broad.mit.edu	37	4	48027184	48027184	+	Missense_Mutation	SNP	T	C	C			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48027184T>C	uc003gxw.2	+	2	212	c.146T>C	c.(145-147)CTG>CCG	p.L49P		NM_207330	NP_997213	Q6NVV3	NIPA3_HUMAN	NIPA-like domain containing 1	49	Extracellular (Potential).					integral to membrane					0						TACACGGACCTGAATTACAGC	0.438																0.036585	-11.832583	7.245011	3	79	KEEP	---	---	---	---	1	2	35	52	-1	capture	Missense_Mutation	SNP	48027184	48027184	NIPAL1	4	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	10331	289
KDR	3791	broad.mit.edu	37	4	55946311	55946311	+	Missense_Mutation	SNP	T	G	G	rs66480054		TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55946311T>G	uc003has.2	-	30	4170	c.3868A>C	c.(3868-3870)AGC>CGC	p.S1290R	KDR_uc003hat.1_Missense_Mutation_p.S1290R	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	1290	Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	GACTCCCTGCTTTTGCTGGGC	0.507					1022	Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			0.408451	97.460491	97.980662	29	42	KEEP	---	---	---	---	12	18	21	23	-1	capture	Missense_Mutation	SNP	55946311	55946311	KDR	4	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	8061	289
FRG1	2483	broad.mit.edu	37	4	190878609	190878609	+	Silent	SNP	G	C	C			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:190878609G>C	uc003izs.2	+	6	680	c.489G>C	c.(487-489)GGG>GGC	p.G163G		NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1	163					rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ATGAAGCAGGGGACATAGAAG	0.378																0.050847	-5.326916	7.283135	3	56	KEEP	---	---	---	---	3	1	52	78	-1	capture	Silent	SNP	190878609	190878609	FRG1	4	G	C	C	C	1	0	0	0	0	0	0	0	1	548	43	4	4	5989	289
CARD6	84674	broad.mit.edu	37	5	40853460	40853460	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:40853460G>A	uc003jmg.2	+	3	2101	c.2026G>A	c.(2026-2028)GCT>ACT	p.A676T		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	676					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						AGAAAACATGGCTGGGACAGC	0.493																0.456522	188.352977	188.585794	63	75	KEEP	---	---	---	---	35	32	40	42	-1	capture	Missense_Mutation	SNP	40853460	40853460	CARD6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	2626	289
TREM1	54210	broad.mit.edu	37	6	41254356	41254356	+	Missense_Mutation	SNP	A	G	G			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41254356A>G	uc003oqf.1	-	1	102	c.38T>C	c.(37-39)CTC>CCC	p.L13P	TREM1_uc003oqg.1_Missense_Mutation_p.L13P	NM_018643	NP_061113	Q9NP99	TREM1_HUMAN	triggering receptor expressed on myeloid cells 1	13					blood coagulation|humoral immune response|intracellular signal transduction|leukocyte migration	extracellular region|integral to membrane|intracellular|plasma membrane	receptor activity			breast(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)				Glutathione(DB00143)	TGAGACAAAGAGCATCCACAG	0.587																0.041667	-9.136784	7.117902	3	69	KEEP	---	---	---	---	2	2	35	51	-1	capture	Missense_Mutation	SNP	41254356	41254356	TREM1	6	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	16353	289
BVES	11149	broad.mit.edu	37	6	105577294	105577294	+	Missense_Mutation	SNP	T	C	C			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:105577294T>C	uc003pqw.2	-	3	468	c.311A>G	c.(310-312)AAC>AGC	p.N104S	BVES_uc003pqx.2_Missense_Mutation_p.N104S|BVES_uc003pqy.2_Missense_Mutation_p.N104S	NM_147147	NP_671488	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance isoform 5	104	Helical; (Potential).				epithelial cell-cell adhesion|muscle organ development|positive regulation of locomotion|positive regulation of receptor recycling|regulation of Cdc42 GTPase activity|regulation of cell shape|regulation of Rac GTPase activity|substrate adhesion-dependent cell spreading|vesicle-mediated transport	integral to membrane|lateral plasma membrane|tight junction	structural molecule activity				0		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				ATGCAAAATGTTGACACCCAA	0.363																0.431373	77.84563	78.054448	22	29	KEEP	---	---	---	---	11	12	10	20	-1	capture	Missense_Mutation	SNP	105577294	105577294	BVES	6	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	1563	289
EGFR	1956	broad.mit.edu	37	7	55221710	55221710	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221710C>T	uc003tqk.2	+	7	1000	c.754C>T	c.(754-756)CGC>TGC	p.R252C	EGFR_uc003tqh.2_Missense_Mutation_p.R252C|EGFR_uc003tqi.2_Missense_Mutation_p.R252C|EGFR_uc003tqj.2_Missense_Mutation_p.R252C|EGFR_uc010kzg.1_Missense_Mutation_p.R207C|EGFR_uc011kco.1_Missense_Mutation_p.R199C|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	252	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.R252C(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	ATAGGTCTGCCGCAAATTCCG	0.582			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.098751	75.442205	217.251405	87	794	KEEP	---	---	---	---	33	67	372	525	-1	capture	Missense_Mutation	SNP	55221710	55221710	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4922	289
MCM7	4176	broad.mit.edu	37	7	99691889	99691889	+	Silent	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99691889G>A	uc003usw.1	-	13	2265	c.1755C>T	c.(1753-1755)TAC>TAT	p.Y585Y	MCM7_uc003usv.1_Silent_p.Y409Y|MCM7_uc003usx.1_Silent_p.Y409Y|uc003usy.1_5'Flank|MIR25_hsa-mir-25|MI0000082_5'Flank|uc003usz.1_5'Flank|MIR93_hsa-mir-93|MI0000095_5'Flank|uc003uta.1_5'Flank|MIR106B_hsa-mir-106b|MI0000734_5'Flank	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	585	Interaction with ATRIP.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)	TCATCTCCACGTATGCTGCTG	0.577																0.272727	83.126525	88.757683	33	88	KEEP	---	---	---	---	19	19	44	51	-1	capture	Silent	SNP	99691889	99691889	MCM7	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9305	289
FBXL13	222235	broad.mit.edu	37	7	102669857	102669857	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:102669857C>T	uc003vaq.2	-	3	436	c.9G>A	c.(7-9)CCG>CCA	p.P3P	FBXL13_uc010lir.1_Silent_p.P3P|FBXL13_uc003var.2_RNA|FBXL13_uc003vas.2_Silent_p.P3P|FBXL13_uc003vav.2_RNA	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform	3											0						TCATCAATTCCGGAGTCATCT	0.294																0.137931	6.680476	10.356868	4	25	KEEP	---	---	---	---	0	4	10	20	-1	capture	Silent	SNP	102669857	102669857	FBXL13	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5655	289
RELN	5649	broad.mit.edu	37	7	103234169	103234169	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103234169C>T	uc003vca.2	-	27	4032	c.3872G>A	c.(3871-3873)CGA>CAA	p.R1291Q	RELN_uc010liz.2_Missense_Mutation_p.R1291Q	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1291					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGTCAAATCTCGAGTTACTGC	0.393	NSCLC(146;835 1944 15585 22231 52158)															0.215116	89.984706	102.867021	37	135	KEEP	---	---	---	---	20	23	75	81	-1	capture	Missense_Mutation	SNP	103234169	103234169	RELN	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13115	289
NOBOX	135935	broad.mit.edu	37	7	144098554	144098554	+	Silent	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:144098554C>T	uc011kue.1	-	4	429	c.429G>A	c.(427-429)CCG>CCA	p.P143P		NM_001080413	NP_001073882	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	143					cell differentiation|oogenesis	nucleus	sequence-specific DNA binding			ovary(1)	1	Melanoma(164;0.14)					AGACTGCTGGCGGCTTCTTCT	0.652																0.25	30.909061	34.104705	14	42	KEEP	---	---	---	---	7	12	22	30	-1	capture	Silent	SNP	144098554	144098554	NOBOX	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	10419	289
C9orf66	157983	broad.mit.edu	37	9	215042	215042	+	Missense_Mutation	SNP	C	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:215042C>A	uc003zge.3	-	1	852	c.355G>T	c.(355-357)GGG>TGG	p.G119W	DOCK8_uc011lls.1_Intron|DOCK8_uc003zgf.2_Intron	NM_152569	NP_689782	Q5T8R8	CI066_HUMAN	hypothetical protein LOC157983	119										central_nervous_system(1)	1	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		AAGACGCCCCCCGCGGCGCGC	0.731																0.7	20.118846	20.473367	7	3	KEEP	---	---	---	---	3	4	2	3	0.571428571429	capture	Missense_Mutation	SNP	215042	215042	C9orf66	9	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	2466	289
FREM1	158326	broad.mit.edu	37	9	14848723	14848723	+	Missense_Mutation	SNP	T	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:14848723T>A	uc003zlm.2	-	7	1791	c.1201A>T	c.(1201-1203)ACA>TCA	p.T401S	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	401	CSPG 2.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		ATGTGGACTGTCATAGGTGCA	0.448																0.738095	101.842534	104.006177	31	11	KEEP	---	---	---	---	10	24	3	9	-1	capture	Missense_Mutation	SNP	14848723	14848723	FREM1	9	T	A	A	A	1	0	0	0	0	1	0	0	0	754	58	4	4	5987	289
OR13F1	138805	broad.mit.edu	37	9	107267210	107267210	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107267210G>A	uc011lvm.1	+	1	667	c.667G>A	c.(667-669)GCC>ACC	p.A223T		NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F,	223	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)|skin(1)	3						ATTTATCCTCGCCAGTATCCT	0.478																0.417178	191.750785	192.729368	68	95	KEEP	---	---	---	---	30	43	41	64	-1	capture	Missense_Mutation	SNP	107267210	107267210	OR13F1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10845	289
ANGPTL2	23452	broad.mit.edu	37	9	129854001	129854001	+	Nonsense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:129854001C>T	uc004bqr.1	-	4	1730	c.1230G>A	c.(1228-1230)TGG>TGA	p.W410*	RALGPS1_uc004bqo.1_Intron|RALGPS1_uc011mab.1_Intron|RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron|ANGPTL2_uc010mxg.1_Nonsense_Mutation_p.W108*	NM_012098	NP_036230	Q9UKU9	ANGL2_HUMAN	angiopoietin-like 2 precursor	410	Fibrinogen C-terminal.				multicellular organismal development|signal transduction	extracellular space	receptor binding				0						TGCCGTTGTGCCATGTAAAGG	0.532																0.020243	-55.306497	8.385199	5	242	KEEP	---	---	---	---	1	5	100	166	-1	capture	Nonsense_Mutation	SNP	129854001	129854001	ANGPTL2	9	C	T	T	T	1	0	0	0	0	0	1	0	0	338	26	5	2	611	289
SETX	23064	broad.mit.edu	37	9	135202099	135202099	+	Missense_Mutation	SNP	T	C	C			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135202099T>C	uc004cbk.2	-	10	5069	c.4886A>G	c.(4885-4887)AAG>AGG	p.K1629R	SETX_uc004cbj.2_Missense_Mutation_p.K1248R|SETX_uc010mzt.2_Missense_Mutation_p.K1248R	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	1629					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		CTGTATCCCCTTTGACTTATT	0.398																0.0375	-11.625956	6.879233	3	77	KEEP	---	---	---	---	1	2	39	49	-1	capture	Missense_Mutation	SNP	135202099	135202099	SETX	9	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	14034	289
RALGDS	5900	broad.mit.edu	37	9	135975714	135975714	+	Missense_Mutation	SNP	T	C	C			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135975714T>C	uc004cco.2	-	17	2530	c.2510A>G	c.(2509-2511)AAC>AGC	p.N837S	RALGDS_uc004cct.1_5'Flank|RALGDS_uc004ccn.2_Missense_Mutation_p.N25S|RALGDS_uc004ccp.2_RNA|RALGDS_uc004ccq.2_Missense_Mutation_p.N825S|RALGDS_uc004ccr.2_Missense_Mutation_p.N836S|RALGDS_uc011mcv.1_Missense_Mutation_p.N808S|RALGDS_uc004ccs.2_Missense_Mutation_p.N782S|RALGDS_uc011mcw.1_Missense_Mutation_p.N908S|RALGDS_uc004ccv.1_3'UTR|RALGDS_uc004ccu.1_3'UTR	NM_006266	NP_006257	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	837	Ras-associating.				nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity			large_intestine(1)|lung(1)|ovary(1)	3				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		CTCCTCCAGGTTGTGTTTGTC	0.592	Melanoma(189;762 2088 15384 21931 52515)				815	T	CIITA	PMBL|Hodgkin Lymphona|								0.365269	214.110545	216.743642	61	106	KEEP	---	---	---	---	27	43	49	66	-1	capture	Missense_Mutation	SNP	135975714	135975714	RALGDS	9	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	12911	289
STAG2	10735	broad.mit.edu	37	X	123171416	123171416	+	Nonsense_Mutation	SNP	C	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123171416C>T	uc004etz.3	+	5	667	c.328C>T	c.(328-330)CGA>TGA	p.R110*	STAG2_uc004eua.2_Nonsense_Mutation_p.R110*|STAG2_uc004eub.2_Nonsense_Mutation_p.R110*|STAG2_uc004euc.2_Nonsense_Mutation_p.R110*|STAG2_uc004eud.2_Nonsense_Mutation_p.R110*|STAG2_uc004eue.2_Nonsense_Mutation_p.R110*	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	110					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						CAAGCATGACCGAGATATAGC	0.323																0.9	127.431137	133.854481	36	4	KEEP	---	---	---	---	22	25	3	1	-1	capture	Nonsense_Mutation	SNP	123171416	123171416	STAG2	23	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	15133	289
CTPS	1503	broad.mit.edu	37	1	41461704	41461705	+	Frame_Shift_Ins	INS	-	A	A			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:41461704_41461705insA	uc001cgk.3	+	8	1344_1345	c.836_837insA	c.(835-837)AGAfs	p.R279fs	CTPS_uc010ojo.1_Frame_Shift_Ins_p.R48fs|CTPS_uc010ojp.1_Frame_Shift_Ins_p.R286fs|CTPS_uc001cgl.3_Frame_Shift_Ins_p.R279fs|CTPS_uc010ojq.1_Frame_Shift_Ins_p.R123fs|CTPS_uc009vwe.2_5'UTR	NM_001905	NP_001896	P17812	PYRG1_HUMAN	CTP synthase	279					CTP biosynthetic process|glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|response to drug	cytosol	ATP binding|CTP synthase activity|protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)			L-Glutamine(DB00130)	AGGCAGCCAAGAAAAATGCTGA	0.475																0.45			25	30		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	41461704	41461705	CTPS	1	-	A	A	A	1	0	1	1	0	0	0	0	0	429	33	5	5	3985	289
OR2L2	26246	broad.mit.edu	37	1	248202093	248202094	+	Frame_Shift_Ins	INS	-	T	T			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248202093_248202094insT	uc001idw.2	+	1	620_621	c.524_525insT	c.(523-525)CATfs	p.H175fs	OR2L13_uc001ids.2_Intron	NM_001004686	NP_001004686	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L,	175	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GCCATCAATCATTTTTTCTGTG	0.431																0.36			76	137		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	248202093	248202094	OR2L2	1	-	T	T	T	1	0	1	1	0	0	0	0	0	104	8	5	5	10911	289
C12orf42	374470	broad.mit.edu	37	12	103695960	103695960	+	Frame_Shift_Del	DEL	G	-	-			TCGA-81-5910-01	TCGA-81-5910-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:103695960delG	uc001tjt.2	-	6	1097	c.1009delC	c.(1009-1011)CGCfs	p.R337fs	C12orf42_uc001tjs.2_Intron|C12orf42_uc009zuf.1_Frame_Shift_Del_p.R337fs|C12orf42_uc001tju.2_Frame_Shift_Del_p.R242fs	NM_198521	NP_940923	Q96LP6	CL042_HUMAN	hypothetical protein LOC374470	337										ovary(1)|central_nervous_system(1)	2						CGGGTTGGGCGGGGGGGTGCT	0.587																0.05			7	124		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	103695960	103695960	C12orf42	12	G	-	-	-	1	0	1	0	1	0	0	0	0	507	39	5	5	1674	289
