Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NBPF9	400818	broad.mit.edu	37	1	144825409	144825409	+	Missense_Mutation	SNP	G	A	A	rs558823		TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144825409G>A	uc009wig.1	+	19	2211	c.2135G>A	c.(2134-2136)GGT>GAT	p.G712D	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Missense_Mutation_p.G637D|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Missense_Mutation_p.G513D|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Missense_Mutation_p.G372D	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	712	NBPF 5.					cytoplasm					0						GACTCACTGGGTAGATGGTAT	0.493					20											0.017778	-52.309647	6.69974	4	221	KEEP	---	---	---	---	3	2	129	136	-1	capture	Missense_Mutation	SNP	144825409	144825409	NBPF9	1	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	10106	2
PIGR	5284	broad.mit.edu	37	1	207110686	207110686	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207110686C>T	uc001hez.2	-	4	983	c.799G>A	c.(799-801)GCC>ACC	p.A267T	PIGR_uc009xbz.2_Missense_Mutation_p.A267T	NM_002644	NP_002635	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor precursor	267	Ig-like V-type 3.|Extracellular (Potential).					extracellular region|integral to plasma membrane	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3						AGAAATTTGGCCACGTTTGCC	0.592																0.021053	-42.157308	6.598141	4	186	KEEP	---	---	---	---	2	3	101	122	-1	capture	Missense_Mutation	SNP	207110686	207110686	PIGR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11800	2
LIN9	286826	broad.mit.edu	37	1	226426780	226426780	+	Silent	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:226426780G>A	uc001hqa.2	-	12	1495	c.1185C>T	c.(1183-1185)CCC>CCT	p.P395P	LIN9_uc001hqb.2_Silent_p.P360P|LIN9_uc001hqc.2_Silent_p.P327P|LIN9_uc009xel.1_Silent_p.P360P	NM_173083	NP_775106	Q5TKA1	LIN9_HUMAN	lin-9 homolog	379	Potential.				cell cycle|DNA replication	nucleoplasm					0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		CAATGCTGATGGGCATGGAAT	0.343	Ovarian(197;1696 2974 11248 14117)															0.188312	69.9788	83.984579	29	125	KEEP	---	---	---	---	15	16	83	59	-1	capture	Silent	SNP	226426780	226426780	LIN9	1	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	8733	2
ADARB2	105	broad.mit.edu	37	10	1405297	1405297	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:1405297C>T	uc009xhq.2	-	3	1377	c.1003G>A	c.(1003-1005)GCA>ACA	p.A335T		NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	335	DRBM 2.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		TCCTGCAGTGCGGCCTGCGCG	0.746					191											0.416667	15.072982	15.145704	5	7	KEEP	---	---	---	---	3	3	7	2	-1	capture	Missense_Mutation	SNP	1405297	1405297	ADARB2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	283	2
FGFR2	2263	broad.mit.edu	37	10	123298220	123298220	+	Missense_Mutation	SNP	G	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:123298220G>T	uc010qtk.1	-	6	1281	c.634C>A	c.(634-636)CAG>AAG	p.Q212K	FGFR2_uc010qtg.1_Missense_Mutation_p.Q212K|FGFR2_uc010qth.1_Missense_Mutation_p.Q97K|FGFR2_uc010qti.1_Missense_Mutation_p.Q123K|FGFR2_uc010qtj.1_Missense_Mutation_p.Q212K|FGFR2_uc010qtl.1_Missense_Mutation_p.Q212K|FGFR2_uc010qtm.1_Missense_Mutation_p.Q97K|FGFR2_uc001lfl.3_Missense_Mutation_p.Q212K|FGFR2_uc001lfm.2_Missense_Mutation_p.Q123K|FGFR2_uc001lfn.3_RNA|FGFR2_uc010qtn.1_Missense_Mutation_p.Q231K|FGFR2_uc010qto.1_Missense_Mutation_p.Q116K|FGFR2_uc001lfo.1_Missense_Mutation_p.Q231K|FGFR2_uc010qtp.1_Missense_Mutation_p.Q231K|FGFR2_uc010qtq.1_Missense_Mutation_p.Q231K	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1	212	Ig-like C2-type 2.|Extracellular (Potential).				angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding	p.Q212K(1)		endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	CTCCAGTGCTGGTTTCGTACC	0.418			5		350	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				0.341463	122.212917	124.944681	42	81	KEEP	---	---	---	---	29	21	45	49	0.58	capture	Missense_Mutation	SNP	123298220	123298220	FGFR2	10	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	5812	2
SLC22A9	114571	broad.mit.edu	37	11	63141216	63141216	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63141216C>T	uc001nww.2	+	3	875	c.607C>T	c.(607-609)CGC>TGC	p.R203C	SLC22A9_uc001nwx.2_Intron	NM_080866	NP_543142	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion/cation	203	Extracellular (Potential).				transmembrane transport	integral to membrane				breast(2)|large_intestine(1)	3						CTGCTCACTACGCTTCTTGTC	0.458																0.174497	102.918465	132.711572	52	246	KEEP	---	---	---	---	25	37	141	137	-1	capture	Missense_Mutation	SNP	63141216	63141216	SLC22A9	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14353	2
TSKU	25987	broad.mit.edu	37	11	76506917	76506917	+	Missense_Mutation	SNP	T	G	G			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:76506917T>G	uc001oxt.2	+	2	429	c.257T>G	c.(256-258)TTG>TGG	p.L86W		NM_015516	NP_056331	Q8WUA8	TSK_HUMAN	tsukushin precursor	86	LRR 2.					extracellular region					0	Ovarian(111;0.112)					TACACGACGTTGGCTGGCCTG	0.632																0.166667	22.915094	29.232886	10	50	KEEP	---	---	---	---	8	9	25	35	-1	capture	Missense_Mutation	SNP	76506917	76506917	TSKU	11	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	16510	2
CDKN1B	1027	broad.mit.edu	37	12	12871093	12871093	+	Missense_Mutation	SNP	A	G	G			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:12871093A>G	uc001rat.2	+	1	792	c.320A>G	c.(319-321)CAG>CGG	p.Q107R		NM_004064	NP_004055	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B	107					autophagic cell death|cell cycle arrest|cellular response to lithium ion|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of transcription, DNA-dependent|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process|S phase of mitotic cell cycle	cytosol|endosome|nucleoplasm	cyclin-dependent protein kinase inhibitor activity|protein phosphatase binding|transforming growth factor beta receptor, cytoplasmic mediator activity			ovary(1)|lung(1)	2		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		CAGGAGAGCCAGGATGTCAGC	0.642					63							Multiple_Endocrine_Neoplasia_type_1|Multiple_Endocrine_Neoplasia_type_4				0.028846	-18.364472	7.03009	3	101	KEEP	---	---	---	---	1	3	49	66	-1	capture	Missense_Mutation	SNP	12871093	12871093	CDKN1B	12	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	3129	2
ITGA7	3679	broad.mit.edu	37	12	56078847	56078847	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56078847C>T	uc001shh.2	-	25	3641	c.3421G>A	c.(3421-3423)GCC>ACC	p.A1141T	ITGA7_uc001shg.2_Missense_Mutation_p.A1137T|ITGA7_uc010sps.1_Missense_Mutation_p.A1044T|ITGA7_uc001shf.2_3'UTR|ITGA7_uc009znw.2_Missense_Mutation_p.A384T|ITGA7_uc009znx.2_Missense_Mutation_p.A1018T	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	1181	Cytoplasmic (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						GGAACCTAGGCGGTGCCTGGC	0.697					261											0.238095	10.765712	12.081122	5	16	KEEP	---	---	---	---	4	3	7	15	-1	capture	Missense_Mutation	SNP	56078847	56078847	ITGA7	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7804	2
ANKRD52	283373	broad.mit.edu	37	12	56639298	56639298	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56639298G>A	uc001skm.3	-	21	2357	c.2267C>T	c.(2266-2268)ACG>ATG	p.T756M		NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	756	ANK 22.						protein binding			ovary(2)	2						GTGAATGGGCGTGCGGCCCTT	0.627																0.123457	9.663964	20.999507	10	71	KEEP	---	---	---	---	2	9	36	42	-1	capture	Missense_Mutation	SNP	56639298	56639298	ANKRD52	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	673	2
ACADS	35	broad.mit.edu	37	12	121176680	121176680	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121176680G>A	uc001tza.3	+	8	1109	c.991G>A	c.(991-993)GCT>ACT	p.A331T	ACADS_uc010szl.1_Missense_Mutation_p.A327T|ACADS_uc001tzb.3_Missense_Mutation_p.A212T	NM_000017	NP_000008	P16219	ACADS_HUMAN	short-chain acyl-CoA dehydrogenase precursor	331						mitochondrial matrix	butyryl-CoA dehydrogenase activity			central_nervous_system(2)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)	Lung NSC(355;0.163)			NADH(DB00157)	GACCTGGCGCGCTGCCATGCT	0.637																0.161074	40.983373	57.222533	24	125	KEEP	---	---	---	---	11	19	65	84	-1	capture	Missense_Mutation	SNP	121176680	121176680	ACADS	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	114	2
WDR66	144406	broad.mit.edu	37	12	122437781	122437781	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:122437781G>A	uc009zxk.2	+	20	3308	c.3166G>A	c.(3166-3168)GGT>AGT	p.G1056S		NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	1056							calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		TGAGGTGCTCGGTTATACCAA	0.448	Esophageal Squamous(85;849 1794 49757 52143)															0.160839	46.533757	62.190564	23	120	KEEP	---	---	---	---	15	13	61	81	-1	capture	Missense_Mutation	SNP	122437781	122437781	WDR66	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17198	2
TNFSF11	8600	broad.mit.edu	37	13	43180986	43180986	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:43180986C>T	uc001uyu.2	+	5	1035	c.886C>T	c.(886-888)CCC>TCC	p.P296S	TNFSF11_uc001uyt.2_Missense_Mutation_p.P223S	NM_003701	NP_003692	O14788	TNF11_HUMAN	tumor necrosis factor ligand superfamily, member	296	Extracellular (Potential).				immune response|monocyte chemotaxis|osteoclast differentiation|positive regulation of bone resorption|positive regulation of corticotropin-releasing hormone secretion|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of homotypic cell-cell adhesion|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell activation	cytoplasm|extracellular space|integral to plasma membrane	cytokine activity|receptor activity|tumor necrosis factor receptor binding				0		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)		GGTCTCCAACCCCTCCTTACT	0.418					113											0.291667	178.47857	186.919766	63	153	KEEP	---	---	---	---	29	39	82	91	-1	capture	Missense_Mutation	SNP	43180986	43180986	TNFSF11	13	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	16185	2
RB1	5925	broad.mit.edu	37	13	49033967	49033967	+	Nonsense_Mutation	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49033967C>T	uc001vcb.2	+	20	2270	c.2104C>T	c.(2104-2106)CAA>TAA	p.Q702*		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	702	Pocket; binds T and E1A.|Domain B.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)|p.Q702*(2)|p.Q702K(1)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GCATTTGGACCAAGTAAGAAA	0.343			6	p.Q702*(HT1376-Tumor)	568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.24	43.608363	48.239019	18	57	KEEP	---	---	---	---	4	14	30	31	-1	capture	Nonsense_Mutation	SNP	49033967	49033967	RB1	13	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	12993	2
HCN4	10021	broad.mit.edu	37	15	73614906	73614906	+	Silent	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:73614906C>T	uc002avp.2	-	8	4522	c.3528G>A	c.(3526-3528)GGG>GGA	p.G1176G		NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic	1176	Cytoplasmic (Potential).				blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		GAGGGGGCCCCCCAGAAGAGG	0.602																0.2	11.262876	13.35405	5	20	KEEP	---	---	---	---	2	4	10	15	-1	capture	Silent	SNP	73614906	73614906	HCN4	15	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	6925	2
ACSM5	54988	broad.mit.edu	37	16	20439127	20439127	+	Silent	SNP	G	A	A	rs12922063		TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20439127G>A	uc002dhe.2	+	7	1086	c.939G>A	c.(937-939)CCG>CCA	p.P313P		NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	313					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						CCAAATTCCCGATAACCACCC	0.473																0.116942	95.657438	191.980402	78	589	KEEP	---	---	---	---	49	43	342	362	-1	capture	Silent	SNP	20439127	20439127	ACSM5	16	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	187	2
ITGAD	3681	broad.mit.edu	37	16	31409190	31409190	+	Silent	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31409190G>A	uc002ebv.1	+	5	436	c.387G>A	c.(385-387)TCG>TCA	p.S129S	ITGAD_uc010vfl.1_Silent_p.S129S|ITGAD_uc010cap.1_Silent_p.S129S|ITGAD_uc002ebw.1_5'UTR	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	129	FG-GAP 2.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						TGCTGGGCTCGCGCTGGGAGA	0.642																0.174603	22.485575	28.779741	11	52	KEEP	---	---	---	---	8	8	34	29	-1	capture	Silent	SNP	31409190	31409190	ITGAD	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7807	2
CETP	1071	broad.mit.edu	37	16	57007243	57007243	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57007243G>A	uc002eki.2	+	9	808	c.751G>A	c.(751-753)GGT>AGT	p.G251S	CETP_uc002ekj.2_Intron	NM_000078	NP_000069	P11597	CETP_HUMAN	cholesteryl ester transfer protein, plasma	251					cholesterol homeostasis|cholesterol metabolic process|high-density lipoprotein particle remodeling|lipoprotein metabolic process|low-density lipoprotein particle remodeling|phosphatidylcholine metabolic process|phospholipid homeostasis|receptor-mediated endocytosis|regulation of cholesterol efflux|triglyceride homeostasis|triglyceride metabolic process|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle|vesicle	cholesterol binding|cholesterol transporter activity|phosphatidylcholine binding|phospholipid transporter activity|triglyceride binding			central_nervous_system(1)|skin(1)	2						CTTCCTCCAGGGTCATTTCAT	0.597																0.212329	72.338139	83.524911	31	115	KEEP	---	---	---	---	12	21	65	72	-1	capture	Missense_Mutation	SNP	57007243	57007243	CETP	16	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	3245	2
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	T	T	rs11540652		TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577538C>T	uc002gim.2	-	7	937	c.743G>A	c.(742-744)CGG>CAG	p.R248Q	TP53_uc002gig.1_Missense_Mutation_p.R248Q|TP53_uc002gih.2_Missense_Mutation_p.R248Q|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116Q|TP53_uc010cng.1_Missense_Mutation_p.R116Q|TP53_uc002gii.1_Missense_Mutation_p.R116Q|TP53_uc010cnh.1_Missense_Mutation_p.R248Q|TP53_uc010cni.1_Missense_Mutation_p.R248Q|TP53_uc002gij.2_Missense_Mutation_p.R248Q|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155Q|TP53_uc002gio.2_Missense_Mutation_p.R116Q	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(523)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.R155Q(4)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GATGGGCCTCCGGTTCATGCC	0.572	Pancreas(47;798 1329 9957 10801)	R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIN87_STOMACH)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NIHOVCAR3_OVARY)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(HCC70_BREAST)|R248Q(KYSE150_OESOPHAGUS)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PC14_LUNG)	111	p.R248L(NCIH211-Tumor)|p.R248L(NB4-Tumor)|p.R248L(PC14-Tumor)|p.R248L(KYO1-Tumor)|p.R248L(PCM6-Tumor)|p.R248L(NUDHL1-Tumor)|p.R248L(BL41-Tumor)|p.R248Q(FADU-Tumor)|p.R248L(CI1-Tumor)|p.R248L(SW1463-Tumor)|p.R248L(COLO699-Tumor)|p.R248L(HS683-Tumor)|p.R248*(DB-Tumor)|p.R248L(HCC1143-Tumor)|p.R248L(NCIN87-Tumor)|p.R248A(SF126-Tumor)|p.R248L(PANC02.03-Tumor)|p.R248L(HEC1B-Tumor)|p.R248L(PECAPJ15-Tumor)|p.R248L(LNCAPCLONEFGC-Tumor)|p.R248L(NIHOVCAR3-Tumor)|p.R248L(NUDUL1-Tumor)|p.R248L(ONCODG1-Tumor)|p.R248L(RT112-Tumor)|p.R248L(SF295-Tumor)|p.R248L(P12ICHIKAWA-Tumor)|p.R248L(DND41-Tumor)|p.R248Q(SBC5-Tumor)|p.R248L(KOPN8-Tumor)|p.R248L(KASUMI1-Tumor)|p.R248L(EM2-Tumor)|p.R248L(SKUT1-Tumor)|p.R248L(NCCSTCK140-Tumor)|p.R248L(TE6-Tumor)|p.R248L(MOLM6-Tumor)|p.R248L(SEM-Tumor)|p.R248L(NAMALWA-Tumor)|p.R248L(CA46-Tumor)|p.R248L(639V-Tumor)|p.R248L(SKM1-Tumor)|p.R248Q(NCIH1573-Tumor)|p.R248Q(NCIH1618-Tumor)|p.R248L(HCC70-Tumor)|p.R248L(WSUDLCL2-Tumor)|p.R248L(HEC1A-Tumor)|p.R248L(KYSE150-Tumor)|p.R248L(HSC4-Tumor)|p.R248L(CL40-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.229508	36.123705	40.211897	14	47	KEEP	---	---	---	---	8	11	28	24	-1	capture	Missense_Mutation	SNP	7577538	7577538	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16264	2
NF1	4763	broad.mit.edu	37	17	29586049	29586049	+	Splice_Site	SNP	G	A	A	rs149784315	by1000genomes	TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29586049G>A	uc002hgg.2	+	33	4666	c.4333_splice	c.e33-1	p.I1445_splice	NF1_uc002hgh.2_Splice_Site_p.I1424_splice|NF1_uc002hgi.1_Splice_Site_p.I457_splice	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(4)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTATTGTGTAGATACTTCAGA	0.303				(SNU81-Tumor)	847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.285714	36.281888	38.012812	12	30	KEEP	---	---	---	---	5	8	18	15	-1	capture	Splice_Site	SNP	29586049	29586049	NF1	17	G	A	A	A	1	0	0	0	0	0	0	1	0	429	33	5	2	10263	2
BZRAP1	9256	broad.mit.edu	37	17	56382781	56382781	+	Silent	SNP	C	A	A	rs149705380	byFrequency	TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56382781C>A	uc002ivx.3	-	29	6271	c.5400G>T	c.(5398-5400)GTG>GTT	p.V1800V	BZRAP1_uc002ivv.2_5'Flank|BZRAP1_uc002ivw.2_Silent_p.V32V|BZRAP1_uc010dcs.2_Silent_p.V1740V|BZRAP1_uc010wnt.1_Silent_p.V1791V	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	1800	SH3 3.					mitochondrion	benzodiazepine receptor binding			upper_aerodigestive_tract(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGCCCCCAAACACAGTAATGA	0.587																0.274074	101.93149	108.129937	37	98	KEEP	---	---	---	---	23	19	44	69	0.452380952381	capture	Silent	SNP	56382781	56382781	BZRAP1	17	C	A	A	A	1	0	0	0	0	0	0	0	1	210	17	4	4	1565	2
ITGB4	3691	broad.mit.edu	37	17	73729694	73729694	+	Silent	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73729694C>T	uc002jpg.2	+	13	1765	c.1578C>T	c.(1576-1578)TAC>TAT	p.Y526Y	ITGB4_uc002jph.2_Silent_p.Y526Y|ITGB4_uc010dgo.2_Silent_p.Y526Y|ITGB4_uc002jpi.3_Silent_p.Y526Y|ITGB4_uc010dgp.1_Silent_p.Y526Y|ITGB4_uc002jpj.2_Silent_p.Y526Y|ITGB4_uc010wsh.1_Silent_p.Y81Y	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	526	II.|Extracellular (Potential).|Cysteine-rich tandem repeats.				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GTGTGTGCTACGGCGAAGGCC	0.642					754											0.234234	61.89383	69.067706	26	85	KEEP	---	---	---	---	18	14	64	40	-1	capture	Silent	SNP	73729694	73729694	ITGB4	17	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7820	2
C18orf45	85019	broad.mit.edu	37	18	20889649	20889649	+	Silent	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:20889649C>T	uc002kuf.2	-	14	934	c.825G>A	c.(823-825)ACG>ACA	p.T275T	C18orf45_uc010xaq.1_RNA|C18orf45_uc010xar.1_RNA|C18orf45_uc002kug.2_RNA|C18orf45_uc002kuh.2_RNA|C18orf45_uc002kue.2_RNA	NM_032933	NP_116322	Q24JQ0	CR045_HUMAN	hypothetical protein LOC85019	275	Helical; (Potential).					integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)					CTTACCATCCCGTGGTTGCAC	0.398																0.168675	61.592841	78.849749	28	138	KEEP	---	---	---	---	13	17	81	79	-1	capture	Silent	SNP	20889649	20889649	C18orf45	18	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	1887	2
ZNF99	7652	broad.mit.edu	37	19	22940645	22940645	+	Missense_Mutation	SNP	A	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22940645A>T	uc010xrh.1	-	5	1793	c.1793T>A	c.(1792-1794)TTC>TAC	p.F598Y		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AAGGGCTGAGAAATGGTTAAA	0.368																0.232558	90.507365	101.776975	40	132	KEEP	---	---	---	---	24	17	75	70	-1	capture	Missense_Mutation	SNP	22940645	22940645	ZNF99	19	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	18080	2
KIAA0355	9710	broad.mit.edu	37	19	34819037	34819037	+	Missense_Mutation	SNP	A	G	G			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:34819037A>G	uc002nvd.3	+	6	1944	c.1085A>G	c.(1084-1086)GAC>GGC	p.D362G		NM_014686	NP_055501	O15063	K0355_HUMAN	hypothetical protein LOC9710	362										ovary(1)	1	Esophageal squamous(110;0.162)					TCGGCCGCCGACAATCTGAAA	0.512																0.207792	42.568118	48.649878	16	61	KEEP	---	---	---	---	15	6	43	42	-1	capture	Missense_Mutation	SNP	34819037	34819037	KIAA0355	19	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	8092	2
DPF1	8193	broad.mit.edu	37	19	38713080	38713080	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38713080G>A	uc002ohl.2	-	3	323	c.296C>T	c.(295-297)ACG>ATG	p.T99M	DPF1_uc002ohm.2_Missense_Mutation_p.T99M|DPF1_uc002ohn.2_Missense_Mutation_p.T17M|DPF1_uc010xtu.1_Missense_Mutation_p.T73M|DPF1_uc010xtv.1_Missense_Mutation_p.T73M|DPF1_uc010xtw.1_Missense_Mutation_p.T73M	NM_004647	NP_004638	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1 isoform	99					induction of apoptosis|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nBAF complex	zinc ion binding				0	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GGCGGGGTACGTGTAAATCTG	0.517																0.141414	41.968945	66.529587	28	170	KEEP	---	---	---	---	8	21	90	95	-1	capture	Missense_Mutation	SNP	38713080	38713080	DPF1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4671	2
FAM126B	285172	broad.mit.edu	37	2	201857004	201857004	+	Silent	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201857004C>T	uc002uws.3	-	10	1019	c.831G>A	c.(829-831)TTG>TTA	p.L277L	FAM126B_uc002uwu.2_Silent_p.L195L|FAM126B_uc002uwv.2_Silent_p.L277L	NM_173822	NP_776183	Q8IXS8	F126B_HUMAN	hypothetical protein LOC285172	277						intracellular				ovary(1)	1						AATAACTTACCAATAGTGGTT	0.333																0.025478	-31.221267	7.925592	4	153	KEEP	---	---	---	---	1	4	89	79	-1	capture	Silent	SNP	201857004	201857004	FAM126B	2	C	T	T	T	1	0	0	0	0	0	0	0	1	272	21	2	2	5384	2
IRS1	3667	broad.mit.edu	37	2	227662172	227662172	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227662172G>A	uc002voh.3	-	1	1335	c.1283C>T	c.(1282-1284)TCG>TTG	p.S428L		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	428	Ser-rich.				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity	p.S428L(1)		lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		ATACTCATCCGAGGAGATGAA	0.617					143									OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.167832	45.422004	60.377348	24	119	KEEP	---	---	---	---	20	17	74	89	-1	capture	Missense_Mutation	SNP	227662172	227662172	IRS1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7763	2
TAF4	6874	broad.mit.edu	37	20	60581775	60581775	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60581775C>T	uc002ybs.2	-	7	2014	c.2014G>A	c.(2014-2016)GCG>ACG	p.A672T		NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4	672	TAFH.				interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			ATGAAGGCCGCGGAGTCGGGG	0.662																0.257143	45.18093	48.883001	18	52	KEEP	---	---	---	---	9	13	24	42	-1	capture	Missense_Mutation	SNP	60581775	60581775	TAF4	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15414	2
KRTAP6-3	337968	broad.mit.edu	37	21	31964779	31964779	+	Silent	SNP	C	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31964779C>A	uc002yom.2	+	1	21	c.15C>A	c.(13-15)ACC>ACA	p.T5T		NM_181605	NP_853636			keratin associated protein 6-3												0						CCTCAACAACCAACACCATGT	0.363																0.196078	22.818657	27.210377	10	41	KEEP	---	---	---	---	5	8	30	34	0.615384615385	capture	Silent	SNP	31964779	31964779	KRTAP6-3	21	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	8491	2
FLNB	2317	broad.mit.edu	37	3	58140654	58140654	+	Silent	SNP	T	C	C			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58140654T>C	uc003djj.2	+	40	6936	c.6771T>C	c.(6769-6771)CCT>CCC	p.P2257P	FLNB_uc010hne.2_Silent_p.P2288P|FLNB_uc003djk.2_Silent_p.P2246P|FLNB_uc010hnf.2_Silent_p.P2233P|FLNB_uc003djl.2_Silent_p.P2077P|FLNB_uc003djm.2_Silent_p.P2064P	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2	2257	Interaction with INPPL1.|Filamin 21.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CCCAAGAGCCTGGTATGTATT	0.353				p.P2288fs(MDAPCA2B-Tumor)	676											0.021429	-29.505018	6.340175	3	137	KEEP	---	---	---	---	2	1	74	77	-1	capture	Silent	SNP	58140654	58140654	FLNB	3	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	5878	2
SLC9A10	285335	broad.mit.edu	37	3	111887770	111887770	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111887770C>T	uc003dyu.2	-	25	3413	c.3191G>A	c.(3190-3192)CGA>CAA	p.R1064Q	SLC9A10_uc011bhu.1_Missense_Mutation_p.R327Q|SLC9A10_uc010hqc.2_Missense_Mutation_p.R1016Q	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	1064					cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						ATAAGTTTTTCGTAACAGACA	0.323																0.215768	124.567138	142.535295	52	189	KEEP	---	---	---	---	36	24	107	116	-1	capture	Missense_Mutation	SNP	111887770	111887770	SLC9A10	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14602	2
HLTF	6596	broad.mit.edu	37	3	148804115	148804115	+	Nonsense_Mutation	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148804115C>T	uc003ewq.1	-	1	227	c.9G>A	c.(7-9)TGG>TGA	p.W3*	HLTF_uc003ewr.1_Nonsense_Mutation_p.W3*|HLTF_uc003ews.1_Nonsense_Mutation_p.W3*|HLTF_uc010hve.1_Nonsense_Mutation_p.W3*	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor	3					chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TCTTGAACATCCAGGACATGG	0.652																0.1875	6.814951	8.278403	3	13	KEEP	---	---	---	---	1	2	11	6	-1	capture	Nonsense_Mutation	SNP	148804115	148804115	HLTF	3	C	T	T	T	1	0	0	0	0	0	1	0	0	390	30	5	2	7140	2
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	A	A	rs121913273		TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178936082G>A	uc003fjk.2	+	10	1781	c.1624G>A	c.(1624-1626)GAA>AAA	p.E542K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	542	PI3K helical.		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TCCTCTCTCTGAAATCACTGA	0.333	Colon(199;1504 1750 3362 26421 31210 32040)	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57	p.E542K(SW948-Tumor)|p.E542K(T84-Tumor)|p.E542K(BT483-Tumor)|p.E542K(IM95-Tumor)|p.E542K(SNU601-Tumor)|p.E542K(VMCUB1-Tumor)|p.E542K(NCIH1341-Tumor)|p.E542K(CAL51-Tumor)|p.E542K(HGC27-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.155039	35.608396	50.281305	20	109	KEEP	---	---	---	---	11	12	53	74	-1	capture	Missense_Mutation	SNP	178936082	178936082	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	11816	2
LARP1B	55132	broad.mit.edu	37	4	129003366	129003366	+	Silent	SNP	A	G	G			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:129003366A>G	uc003iga.2	+	5	395	c.264A>G	c.(262-264)TCA>TCG	p.S88S	LARP1B_uc003ifw.1_Intron|LARP1B_uc003ifx.2_Silent_p.S88S|LARP1B_uc003ify.2_Silent_p.S88S|LARP1B_uc003ifz.1_Silent_p.S88S	NM_018078	NP_060548	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family member 2	88							RNA binding				0						TTGTAAGATCAGAGAGTCAAG	0.373																0.028902	-35.193825	7.194775	5	168	KEEP	---	---	---	---	3	2	84	95	-1	capture	Silent	SNP	129003366	129003366	LARP1B	4	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	8549	2
PCDHA1	56147	broad.mit.edu	37	5	140167909	140167909	+	Silent	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140167909G>A	uc003lhb.2	+	1	2034	c.2034G>A	c.(2032-2034)GCG>GCA	p.A678A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Silent_p.A678A	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	678	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCAAAGGCGTCTTCGCGGG	0.662																0.246575	41.513315	45.785247	18	55	KEEP	---	---	---	---	13	11	44	38	-1	capture	Silent	SNP	140167909	140167909	PCDHA1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11422	2
HRH2	3274	broad.mit.edu	37	5	175110363	175110363	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:175110363G>A	uc003mdd.2	+	1	1900	c.127G>A	c.(127-129)GTG>ATG	p.V43M	HRH2_uc003mdc.3_Missense_Mutation_p.V43M	NM_022304	NP_071640	P25021	HRH2_HUMAN	histamine receptor H2 isoform 2	43	Helical; Name=1; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity			ovary(1)	1	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)	CTGTCTGGCCGTGGGCTTGAA	0.587																0.195035	114.568725	138.95072	55	227	KEEP	---	---	---	---	26	41	139	147	-1	capture	Missense_Mutation	SNP	175110363	175110363	HRH2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7281	2
SEMA3C	10512	broad.mit.edu	37	7	80546078	80546078	+	Missense_Mutation	SNP	C	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80546078C>A	uc003uhj.2	-	2	582	c.20G>T	c.(19-21)TGC>TTC	p.C7F	SEMA3C_uc011kgw.1_Missense_Mutation_p.C25F|SEMA3C_uc011kgx.1_5'UTR	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	7					immune response|response to drug	membrane	receptor activity			ovary(1)	1						AACCAACACGCAAATTGTCCG	0.353																0.123077	41.300252	77.461574	32	228	KEEP	---	---	---	---	9	24	123	137	0.727272727273	capture	Missense_Mutation	SNP	80546078	80546078	SEMA3C	7	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	13919	2
PDIA4	9601	broad.mit.edu	37	7	148703125	148703125	+	Silent	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148703125G>A	uc003wff.2	-	8	1434	c.1152C>T	c.(1150-1152)GCC>GCT	p.A384A		NM_004911	NP_004902	P13667	PDIA4_HUMAN	protein disulfide isomerase A4 precursor	384					cell redox homeostasis|glycerol ether metabolic process|protein secretion	endoplasmic reticulum lumen|melanosome	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			lung(5)|ovary(1)	6	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			AGTCCTTGATGGCCGAGTCCT	0.592														OREG0018420	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.136364	13.523523	21.985436	9	57	KEEP	---	---	---	---	5	7	29	35	-1	capture	Silent	SNP	148703125	148703125	PDIA4	7	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	11573	2
ZDHHC2	51201	broad.mit.edu	37	8	17072848	17072848	+	Silent	SNP	A	G	G			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:17072848A>G	uc003wxe.2	+	11	1450	c.1053A>G	c.(1051-1053)AAA>AAG	p.K351K		NM_016353	NP_057437	Q9UIJ5	ZDHC2_HUMAN	zinc finger, DHHC-type containing 2	351						integral to membrane	acyltransferase activity|zinc ion binding				0				Colorectal(111;0.0697)|COAD - Colon adenocarcinoma(73;0.244)		ACCCAGGAAAATGCAAAGCTG	0.403																0.272727	18.441202	19.464755	6	16	KEEP	---	---	---	---	5	1	4	14	-1	capture	Silent	SNP	17072848	17072848	ZDHHC2	8	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	17490	2
FBXO16	157574	broad.mit.edu	37	8	28321322	28321322	+	Missense_Mutation	SNP	G	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:28321322G>T	uc003xgu.2	-	4	247	c.149C>A	c.(148-150)ACA>AAA	p.T50K	ZNF395_uc003xgt.2_5'UTR|FBXO16_uc003xgv.2_Missense_Mutation_p.T37K|FBXO16_uc003xgw.2_Missense_Mutation_p.T37K	NM_172366	NP_758954	Q8IX29	FBX16_HUMAN	F-box only protein 16	50										ovary(1)	1		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.121)|Kidney(114;0.144)|Colorectal(74;0.249)		TTGAGAGTCTGTCCATTTGTC	0.428																0.227273	64.183794	71.731235	25	85	KEEP	---	---	---	---	14	13	51	43	0.518518518519	capture	Missense_Mutation	SNP	28321322	28321322	FBXO16	8	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	5675	2
KIAA0020	9933	broad.mit.edu	37	9	2829854	2829854	+	Missense_Mutation	SNP	C	T	T	rs62534389		TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:2829854C>T	uc003zhp.1	-	8	868	c.772G>A	c.(772-774)GCA>ACA	p.A258T	KIAA0020_uc010mhc.1_Missense_Mutation_p.A257T|KIAA0020_uc003zhq.1_Missense_Mutation_p.A257T	NM_014878	NP_055693	Q15397	K0020_HUMAN	KIAA0020 protein	258	Pumilio 3.|PUM-HD.					endoplasmic reticulum|nucleolus	RNA binding			ovary(1)	1				GBM - Glioblastoma multiforme(50;0.0319)		TCATTGTATGCGTACTCCACG	0.458																0.012887	-97.748196	7.405475	5	383	KEEP	---	---	---	---	3	2	204	218	-1	capture	Missense_Mutation	SNP	2829854	2829854	KIAA0020	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8074	2
C9orf25	203259	broad.mit.edu	37	9	34401054	34401054	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34401054C>T	uc011lok.1	-	6	773	c.466G>A	c.(466-468)GAC>AAC	p.D156N	C9orf25_uc003zuj.2_Missense_Mutation_p.D139N|C9orf25_uc003zuk.2_Missense_Mutation_p.D128N|C9orf25_uc011lol.1_Missense_Mutation_p.D144N|C9orf25_uc003zul.2_Missense_Mutation_p.D127N	NM_147202	NP_671735	Q8IW50	CI025_HUMAN	hypothetical protein LOC203259	156											0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.0858)		AGGTCCTCGTCGTCGGGGATC	0.617																0.19	41.566333	50.552523	19	81	KEEP	---	---	---	---	10	12	45	52	-1	capture	Missense_Mutation	SNP	34401054	34401054	C9orf25	9	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2452	2
FAM75C1	441452	broad.mit.edu	37	9	90537820	90537820	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90537820G>A	uc010mqi.2	+	4	3027	c.2998G>A	c.(2998-3000)GTC>ATC	p.V1000I	FAM75C1_uc004apq.3_Missense_Mutation_p.V983I	NM_001145124	NP_001138596			family with sequence similarity 75, member C1												0						GAATGAAGGCGTCCAGCTACT	0.408																0.230303	89.18859	100.172971	38	127	KEEP	---	---	---	---	16	34	74	98	-1	capture	Missense_Mutation	SNP	90537820	90537820	FAM75C1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5569	2
EGFL7	51162	broad.mit.edu	37	9	139564727	139564727	+	Silent	SNP	C	T	T			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139564727C>T	uc004cid.2	+	7	1427	c.516C>T	c.(514-516)GAC>GAT	p.D172D	EGFL7_uc004cif.2_Silent_p.D172D|EGFL7_uc004cig.2_RNA|EGFL7_uc010nbp.2_Silent_p.D172D|EGFL7_uc004cie.2_Silent_p.D172D|EGFL7_uc004cih.2_Silent_p.D172D|MIR126_hsa-mir-126|MI0000471_5'Flank	NM_201446	NP_958854	Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7	172	EGF-like 2; calcium-binding (Potential).				angiogenesis|vasculogenesis		calcium ion binding			ovary(1)	1	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		TGTCTGCAGACGGTACACTCT	0.677																0.222222	13.636667	15.552763	6	21	KEEP	---	---	---	---	2	5	20	19	-1	capture	Silent	SNP	139564727	139564727	EGFL7	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4919	2
ZNF280C	55609	broad.mit.edu	37	X	129370452	129370452	+	Silent	SNP	G	A	A			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129370452G>A	uc004evm.2	-	7	809	c.655C>T	c.(655-657)CTG>TTG	p.L219L	ZNF280C_uc010nrf.1_Silent_p.L219L	NM_017666	NP_060136	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	219	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)	3						CCTTTTGACAGCATAACTTGG	0.323																0.025641	-22.687146	6.475221	3	114	KEEP	---	---	---	---	3	0	84	47	-1	capture	Silent	SNP	129370452	129370452	ZNF280C	23	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	17696	2
CYR61	3491	broad.mit.edu	37	1	86047880	86047881	+	In_Frame_Ins	INS	-	TGG	TGG			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86047880_86047881insTGG	uc001dle.2	+	3	771_772	c.547_548insTGG	c.(547-549)CTG>CTGGTG	p.183_184insV	CYR61_uc001dlg.2_In_Frame_Ins_p.12_13insV|CYR61_uc009wcp.1_5'Flank	NM_001554	NP_001545	O00622	CYR61_HUMAN	cysteine-rich, angiogenic inducer, 61 precursor	183_184					cell proliferation|chemotaxis|positive regulation of BMP signaling pathway|positive regulation of cell migration|positive regulation of osteoblast differentiation|positive regulation of osteoblast proliferation|positive regulation of protein kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell growth|regulation of ERK1 and ERK2 cascade|wound healing, spreading of cells	extracellular region	heparin binding|insulin-like growth factor binding			central_nervous_system(1)	1				all cancers(265;0.0216)|Epithelial(280;0.0441)		TGGCAAGGAGCTGGGATTCGAT	0.559														OREG0013583	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.17			42	201		---	---	---	---						capture_indel	In_Frame_Ins	INS	86047880	86047881	CYR61	1	-	TGG	TGG	TGG	1	0	1	1	0	0	0	0	0	363	28	5	5	4159	2
GPR19	2842	broad.mit.edu	37	12	12814147	12814155	+	In_Frame_Del	DEL	ATTTGGTGG	-	-	rs61733942		TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:12814147_12814155delATTTGGTGG	uc001rar.3	-	2	1421_1429	c.1228_1236delCCACCAAAT	c.(1228-1236)CCACCAAATdel	p.PPN410del	GPR19_uc001raq.2_In_Frame_Del_p.PPN410del	NM_006143	NP_006134	Q15760	GPR19_HUMAN	G protein-coupled receptor 19	410_412	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		AGACAAAAGTATTTGGTGGATTTGAGTTA	0.340																0.14			15	89		---	---	---	---						capture_indel	In_Frame_Del	DEL	12814147	12814155	GPR19	12	ATTTGGTGG	-	-	-	1	0	1	0	1	0	0	0	0	206	16	5	5	6613	2
PEX11G	92960	broad.mit.edu	37	19	7542216	7542217	+	Frame_Shift_Ins	INS	-	C	C			TCGA-02-0033-01	TCGA-02-0033-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7542216_7542217insC	uc002mgk.1	-	5	606_607	c.597_598insG	c.(595-600)CTGCCCfs	p.L199fs	PEX11G_uc002mgl.1_Frame_Shift_Ins_p.L129fs	NM_080662	NP_542393	Q96HA9	PX11C_HUMAN	peroxisomal biogenesis factor 11 gamma	199_200	Lumenal (Potential).					integral to membrane|peroxisomal membrane					0						ACGCCCCGGGGCAGCCAGTGCA	0.713																0.33			3	6		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	7542216	7542217	PEX11G	19	-	C	C	C	1	0	1	1	0	0	0	0	0	546	42	5	5	11642	2
