Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CPSF3L	54973	broad.mit.edu	37	1	1248063	1248063	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1248063G>A	uc001aee.1	-	13	1370	c.1312C>T	c.(1312-1314)CCG>TCG	p.P438S	CPSF3L_uc009vjy.1_RNA|CPSF3L_uc001aef.1_Missense_Mutation_p.P444S|CPSF3L_uc009vjz.1_Missense_Mutation_p.P416S|CPSF3L_uc010nyj.1_Missense_Mutation_p.P409S|CPSF3L_uc001aeg.1_Missense_Mutation_p.P314S|CPSF3L_uc001aeh.1_Missense_Mutation_p.P337S|CPSF3L_uc001aei.1_Missense_Mutation_p.P340S|CPSF3L_uc001aej.1_Missense_Mutation_p.P265S|CPSF3L_uc001aek.1_Missense_Mutation_p.P180S	NM_017871	NP_060341	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor	438						Golgi apparatus|nucleus	hydrolase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		CCATTGGCCGGCATGTAGCAG	0.716																0.044444	-13.062194	6.914555	4	86	KEEP	---	---	---	---	3	1	56	43	-1	capture	Missense_Mutation	SNP	1248063	1248063	CPSF3L	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3792	11
KIF17	57576	broad.mit.edu	37	1	21014370	21014370	+	Silent	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:21014370G>A	uc001bdr.3	-	8	1567	c.1449C>T	c.(1447-1449)AGC>AGT	p.S483S	KIF17_uc001bdp.3_5'Flank|KIF17_uc001bdq.3_5'Flank|KIF17_uc009vpx.2_Intron|KIF17_uc001bds.3_Silent_p.S483S	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	483					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GGTACTCAGCGCTGCTGGCAA	0.532																0.274194	84.398916	90.093477	34	90	KEEP	---	---	---	---	17	23	67	38	-1	capture	Silent	SNP	21014370	21014370	KIF17	1	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	8201	11
FOXJ3	22887	broad.mit.edu	37	1	42744223	42744223	+	Silent	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:42744223C>T	uc001che.2	-	5	477	c.165G>A	c.(163-165)AAG>AAA	p.K55K	FOXJ3_uc001chf.2_Silent_p.K55K|FOXJ3_uc001chg.2_Silent_p.K55K|FOXJ3_uc001chh.1_Silent_p.K55K	NM_014947	NP_055762	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	55					embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTGCATTCTTCTTAGAAATTC	0.453																0.272109	213.761894	227.532177	80	214	KEEP	---	---	---	---	63	21	145	84	-1	capture	Silent	SNP	42744223	42744223	FOXJ3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	5957	11
IGSF3	3321	broad.mit.edu	37	1	117159063	117159063	+	Silent	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117159063C>T	uc001egr.1	-	3	765	c.60G>A	c.(58-60)CAG>CAA	p.Q20Q	IGSF3_uc001egq.1_Silent_p.Q20Q	NM_001007237	NP_001007238	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3 isoform 2	20	Ig-like C2-type 1.|Extracellular (Potential).					integral to membrane				ovary(2)	2	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TGACCTGCCGCTGTGCTGACA	0.527																0.27907	29.377918	31.268218	12	31	KEEP	---	---	---	---	12	5	31	25	-1	capture	Silent	SNP	117159063	117159063	IGSF3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	7525	11
FLG	2312	broad.mit.edu	37	1	152275657	152275657	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152275657G>T	uc001ezu.1	-	3	11741	c.11705C>A	c.(11704-11706)CCC>CAC	p.P3902H		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3902	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGAGGATCCGGGGTGTCTGGA	0.512												Ichthyosis				0.330827	111.745474	115.12344	44	89	KEEP	---	---	---	---	22	22	57	36	0.5	capture	Missense_Mutation	SNP	152275657	152275657	FLG	1	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	5867	11
SELE	6401	broad.mit.edu	37	1	169698774	169698774	+	Silent	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169698774G>A	uc001ggm.3	-	6	913	c.756C>T	c.(754-756)TTC>TTT	p.F252F	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	252	Sushi 2.|Extracellular (Potential).				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)					AACATTCCACGAACCCATTGG	0.428																0.256983	115.367156	124.950051	46	133	KEEP	---	---	---	---	37	15	87	66	-1	capture	Silent	SNP	169698774	169698774	SELE	1	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	13906	11
CCNY	219771	broad.mit.edu	37	10	35819172	35819172	+	Splice_Site	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:35819172G>A	uc001iyw.3	+	7	759	c.579_splice	c.e7+1	p.L193_splice	CCNY_uc001iyu.3_Splice_Site_p.L139_splice|CCNY_uc001iyv.3_Splice_Site_p.L139_splice|CCNY_uc001iyx.3_Splice_Site_p.L139_splice|CCNY_uc009xmb.2_Splice_Site_p.L168_splice|CCNY_uc010qet.1_Splice_Site_p.L60_splice	NM_145012	NP_659449	Q8ND76	CCNY_HUMAN	cyclin Y isoform 1						cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0						CGTCACCCTGGTGAGTGCCCT	0.577																0.531915	72.674708	72.717071	25	22	KEEP	---	---	---	---	18	10	11	11	-1	capture	Splice_Site	SNP	35819172	35819172	CCNY	10	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	2907	11
PTEN	5728	broad.mit.edu	37	10	89720679	89720679	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720679C>T	uc001kfb.2	+	9	1861	c.830C>T	c.(829-831)ACA>ATA	p.T277I		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	277	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.D268_F279>VGQNVSLLGKYI(2)|p.G165_*404del(1)|p.G165_K342del(1)|p.T277I(1)|p.W274_F341del(1)|p.T277fs*13(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGGGTAAATACATTCTTCATA	0.259			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.522727	63.215665	63.235053	23	21	KEEP	---	---	---	---	14	12	19	11	-1	capture	Missense_Mutation	SNP	89720679	89720679	PTEN	10	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	12633	11
HPS6	79803	broad.mit.edu	37	10	103827534	103827534	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:103827534C>T	uc001kuj.2	+	1	2388	c.2303C>T	c.(2302-2304)CCC>CTC	p.P768L		NM_024747	NP_079023	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome-6	768						cytosol|early endosome membrane|endoplasmic reticulum|microsome					0		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		AGCACTCCACCCCCGACTCCA	0.592												Hermansky-Pudlak_syndrome				0.243902	47.663266	52.564855	20	62	KEEP	---	---	---	---	14	7	36	38	-1	capture	Missense_Mutation	SNP	103827534	103827534	HPS6	10	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7268	11
KRTAP5-4	387267	broad.mit.edu	37	11	1643000	1643000	+	Silent	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1643000C>T	uc009ycy.1	-	3	549	c.462G>A	c.(460-462)AAG>AAA	p.K154K		NM_001012709	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	168	9 X 4 AA repeats of C-C-X-P.					keratin filament					0		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CACAGCCCCCCTTGGAGCCCC	0.682																0.140351	1.637557	9.090717	8	49	KEEP	---	---	---	---	3	6	50	116	-1	capture	Silent	SNP	1643000	1643000	KRTAP5-4	11	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	8483	11
NAP1L4	4676	broad.mit.edu	37	11	2975821	2975821	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:2975821C>T	uc001lxc.2	-	12	1112	c.971G>A	c.(970-972)CGT>CAT	p.R324H	NAP1L4_uc001lxb.2_5'Flank|NAP1L4_uc009ydt.2_RNA|NAP1L4_uc010qxm.1_Missense_Mutation_p.R324H|NAP1L4_uc010qxn.1_Missense_Mutation_p.R324H	NM_005969	NP_005960	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4	324					nucleosome assembly	chromatin assembly complex|cytoplasm	unfolded protein binding			ovary(1)	1		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		TATCCGCTCACGGAAAAAGTG	0.473																0.376238	105.633285	106.987679	38	63	KEEP	---	---	---	---	21	18	32	38	-1	capture	Missense_Mutation	SNP	2975821	2975821	NAP1L4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10067	11
OR52K1	390036	broad.mit.edu	37	11	4510426	4510426	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4510426G>C	uc001lza.1	+	1	296	c.296G>C	c.(295-297)TGT>TCT	p.C99S		NM_001005171	NP_001005171	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K,	99	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		TTCTTTGCCTGTCTGGTCCAG	0.502																0.273973	60.969712	64.328298	20	53	KEEP	---	---	---	---	15	5	37	18	-1	capture	Missense_Mutation	SNP	4510426	4510426	OR52K1	11	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	11027	11
HTR3A	3359	broad.mit.edu	37	11	113856764	113856764	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113856764G>A	uc010rxb.1	+	6	823	c.590G>A	c.(589-591)CGC>CAC	p.R197H	HTR3A_uc010rxa.1_Missense_Mutation_p.R197H|HTR3A_uc009yyx.2_Intron|HTR3A_uc010rxc.1_Missense_Mutation_p.R176H	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	191	Extracellular (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	TCTTTGTGGCGCTTGCCAGAA	0.522																0.327751	366.629175	377.628757	137	281	KEEP	---	---	---	---	103	53	193	107	-1	capture	Missense_Mutation	SNP	113856764	113856764	HTR3A	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7369	11
AMICA1	120425	broad.mit.edu	37	11	118074267	118074267	+	Silent	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118074267G>A	uc001psk.2	-	6	822	c.648C>T	c.(646-648)GAC>GAT	p.D216D	AMICA1_uc001psg.2_Silent_p.D26D|AMICA1_uc001psh.2_Silent_p.D177D|AMICA1_uc009yzw.1_RNA|AMICA1_uc001psi.2_Silent_p.D206D|AMICA1_uc001psj.2_Silent_p.D205D|AMICA1_uc010rxw.1_Silent_p.D177D|AMICA1_uc010rxx.1_Silent_p.D216D|AMICA1_uc001psl.1_Silent_p.D172D	NM_001098526	NP_001091996	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen	216	Ig-like V-type 2.|Extracellular (Potential).				blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	cell junction|integral to membrane				ovary(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TGATGGAACCGTCATTGCGGA	0.512																0.293729	231.483178	243.00651	89	214	KEEP	---	---	---	---	56	41	144	95	-1	capture	Silent	SNP	118074267	118074267	AMICA1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	574	11
LPAR5	57121	broad.mit.edu	37	12	6729601	6729601	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6729601G>A	uc009zer.2	-	2	1095	c.814C>T	c.(814-816)CGC>TGC	p.R272C	LPAR5_uc001qps.2_Missense_Mutation_p.R272C|LPAR5_uc010sff.1_Missense_Mutation_p.R272C	NM_001142961	NP_001136433	Q9H1C0	LPAR5_HUMAN	lysophosphatidic acid receptor 5	272	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2						ACGCGATCGCGGGCAGGCACG	0.667	NSCLC(74;891 2312 37538)															0.3	7.520767	7.87837	3	7	KEEP	---	---	---	---	6	1	5	6	-1	capture	Missense_Mutation	SNP	6729601	6729601	LPAR5	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8824	11
PTPN6	5777	broad.mit.edu	37	12	7069104	7069104	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7069104G>A	uc001qsb.2	+	12	1618	c.1376G>A	c.(1375-1377)CGC>CAC	p.R459H	PTPN6_uc001qsa.1_Missense_Mutation_p.R461H|PTPN6_uc010sfr.1_Missense_Mutation_p.R420H|PTPN6_uc009zfl.1_Missense_Mutation_p.R459H|PTPN6_uc010sfs.1_Missense_Mutation_p.R447H	NM_002831	NP_002822	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type	459	Tyrosine-protein phosphatase.|Substrate binding (By similarity).				apoptosis|cell junction assembly|G-protein coupled receptor protein signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|negative regulation of peptidyl-tyrosine phosphorylation|platelet activation|positive regulation of cell proliferation|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of G1/S transition of mitotic cell cycle|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol|membrane|nucleus	protein binding|protein tyrosine phosphatase activity			breast(1)	1						GGCATCGGCCGCACAGGCACC	0.672																0.267943	135.752033	145.887595	56	153	KEEP	---	---	---	---	42	28	126	75	-1	capture	Missense_Mutation	SNP	7069104	7069104	PTPN6	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12687	11
KLRC3	3823	broad.mit.edu	37	12	10573119	10573119	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10573119C>A	uc001qyf.2	-	1	76	c.31G>T	c.(31-33)GTG>TTG	p.V11L	KLRC3_uc001qyh.2_Intron|KLRC3_uc001qyi.1_Missense_Mutation_p.V11L|KLRC3_uc010shc.1_Missense_Mutation_p.V11L|KLRC3_uc010shd.1_Missense_Mutation_p.V11L	NM_002261	NP_002252	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C,	11	Cytoplasmic (Potential).				cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|skin(1)	3						GCCAGACTCACTTCTGAGAAG	0.423																0.117647	10.383973	22.605804	10	75	KEEP	---	---	---	---	28	7	109	27	0.2	capture	Missense_Mutation	SNP	10573119	10573119	KLRC3	12	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	8337	11
KLRC3	3823	broad.mit.edu	37	12	10588555	10588555	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10588555C>A	uc001qyh.2	-	1	38	c.31G>T	c.(31-33)GTG>TTG	p.V11L	KLRC2_uc010she.1_Missense_Mutation_p.V11L|KLRC2_uc001qyk.2_Missense_Mutation_p.V11L	NM_002261	NP_002252	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C,	11	Cytoplasmic (Potential).				cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|skin(1)	3						GCCAGACTCACTTCTGAGAAG	0.423																0.103139	36.49677	106.48213	46	400	KEEP	---	---	---	---	38	23	323	160	0.377049180328	capture	Missense_Mutation	SNP	10588555	10588555	KLRC3	12	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	8337	11
ADAMTS20	80070	broad.mit.edu	37	12	43944924	43944924	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:43944924G>A	uc010skx.1	-	2	241	c.241C>T	c.(241-243)CGC>TGC	p.R81C		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	81						proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GCAGTGAAGCGATAGTGGGTT	0.617					2149											0.25	46.385241	50.707014	19	57	KEEP	---	---	---	---	13	7	39	25	-1	capture	Missense_Mutation	SNP	43944924	43944924	ADAMTS20	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	266	11
TTC8	123016	broad.mit.edu	37	14	89336533	89336533	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:89336533G>T	uc010ath.2	+	11	1222	c.1088G>T	c.(1087-1089)CGG>CTG	p.R363L	TTC8_uc001xxl.2_Missense_Mutation_p.R108L|TTC8_uc010ati.2_Missense_Mutation_p.R149L|TTC8_uc001xxm.2_Missense_Mutation_p.R307L|TTC8_uc010atj.2_Missense_Mutation_p.R82L|TTC8_uc001xxi.2_Missense_Mutation_p.R347L|TTC8_uc001xxj.2_Missense_Mutation_p.R337L|TTC8_uc001xxk.2_Missense_Mutation_p.R307L	NM_198309	NP_938051	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8 isoform B	373	TPR 5.				cilium assembly|establishment of anatomical structure orientation|sensory processing	BBSome|centrosome|cilium membrane|microtubule basal body	protein binding				0						ATAGCTCTCCGGTTTTACAGG	0.358												Bardet-Biedl_syndrome				0.27381	191.479166	203.085855	69	183	KEEP	---	---	---	---	44	39	127	81	0.530120481928	capture	Missense_Mutation	SNP	89336533	89336533	TTC8	14	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	16596	11
DIO3	1735	broad.mit.edu	37	14	102028704	102028704	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:102028704C>T	uc010txq.1	+	2	1017	c.793C>T	c.(793-795)CGC>TGC	p.R265C	DIO3OS_uc001ykd.1_5'Flank|uc001yke.2_5'Flank|uc001ykf.2_5'Flank|uc001ykg.2_5'Flank|uc001ykh.3_5'Flank|MIR1247_hsa-mir-1247|MI0006382_5'Flank	NM_001362	NP_001353	P55073	IOD3_HUMAN	deiodinase, iodothyronine, type III	265	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process	endosome membrane|integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|thyroxine 5-deiodinase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(303;0.185)				TTGGTTGGAACGCTATGATGA	0.592																0.31	84.39556	87.607445	31	69	KEEP	---	---	---	---	19	14	41	34	-1	capture	Missense_Mutation	SNP	102028704	102028704	DIO3	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4484	11
SEPT12	124404	broad.mit.edu	37	16	4836007	4836007	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4836007G>A	uc002cxq.2	-	3	407	c.266C>T	c.(265-267)ACG>ATG	p.T89M	SEPT12_uc002cxr.2_Missense_Mutation_p.T89M|SEPT12_uc010bty.2_RNA|uc002cxt.2_5'Flank	NM_144605	NP_653206	Q8IYM1	SEP12_HUMAN	septin 12 isoform 2	89		GTP (By similarity).			cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity			skin(1)	1						CAGCTGCAGCGTCTGGGGTGT	0.512																0.261905	27.908747	30.061287	11	31	KEEP	---	---	---	---	8	4	19	14	-1	capture	Missense_Mutation	SNP	4836007	4836007	SEPT12	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13955	11
ZNF768	79724	broad.mit.edu	37	16	30535933	30535933	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30535933C>T	uc002dyk.3	-	2	1704	c.1528G>A	c.(1528-1530)GAG>AAG	p.E510K	ZNF768_uc010vex.1_Missense_Mutation_p.E479K|uc002dyl.1_5'Flank|ZNF768_uc010vew.1_Missense_Mutation_p.E479K	NM_024671	NP_078947	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	510					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	DNA binding|zinc ion binding				0						TAAGGCCGCTCGCCACTGTGG	0.701																0.223881	36.097796	40.787471	15	52	KEEP	---	---	---	---	4	11	30	28	-1	capture	Missense_Mutation	SNP	30535933	30535933	ZNF768	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	18018	11
CAMKK1	84254	broad.mit.edu	37	17	3779601	3779601	+	Silent	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3779601G>A	uc002fwt.2	-	10	1006	c.912C>T	c.(910-912)GAC>GAT	p.D304D	CAMKK1_uc002fwu.2_Silent_p.D304D|CAMKK1_uc002fwv.2_Silent_p.D342D	NM_172206	NP_757343	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase 1	304	Protein kinase.				synaptic transmission	cytosol|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)	1				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		ACAGCTGAGCGTCGTTCCCCT	0.612					485											0.269231	72.05581	77.052994	28	76	KEEP	---	---	---	---	19	12	43	39	-1	capture	Silent	SNP	3779601	3779601	CAMKK1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	2582	11
NF1	4763	broad.mit.edu	37	17	29662002	29662002	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29662002C>T	uc002hgg.2	+	40	6292	c.5959C>T	c.(5959-5961)CAG>TAG	p.Q1987*	NF1_uc002hgh.2_Nonsense_Mutation_p.Q1966*|NF1_uc010cso.2_Nonsense_Mutation_p.Q175*|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1987					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.Q1987*(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CAATGAAAAACAGATGTACCC	0.348					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.296296	79.761534	83.768017	32	76	KEEP	---	---	---	---	21	15	50	35	-1	capture	Nonsense_Mutation	SNP	29662002	29662002	NF1	17	C	T	T	T	1	0	0	0	0	0	1	0	0	221	17	6	2	10263	11
KRT37	8688	broad.mit.edu	37	17	39578641	39578641	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39578641C>T	uc002hwp.1	-	4	825	c.778G>A	c.(778-780)GAG>AAG	p.E260K	uc002hwo.1_Intron	NM_003770	NP_003761	O76014	KRT37_HUMAN	keratin 37	260	Linker 12.|Rod.					intermediate filament	structural molecule activity			skin(1)	1		Breast(137;0.000496)				ATGTCCAGCTCGATCCGGAAC	0.552																0.270916	175.685611	187.506424	68	183	KEEP	---	---	---	---	40	43	103	105	-1	capture	Missense_Mutation	SNP	39578641	39578641	KRT37	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8394	11
CLEC4M	10332	broad.mit.edu	37	19	7831634	7831634	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7831634G>A	uc002mih.2	+	6	926	c.808G>A	c.(808-810)GTC>ATC	p.V270I	CLEC4M_uc010xjv.1_3'UTR|CLEC4M_uc002mhy.2_3'UTR|CLEC4M_uc010xjw.1_Missense_Mutation_p.V226I|CLEC4M_uc010dvt.2_Missense_Mutation_p.V247I|CLEC4M_uc010dvs.2_Missense_Mutation_p.V269I|CLEC4M_uc010xjx.1_Missense_Mutation_p.V242I|CLEC4M_uc002mhz.2_Missense_Mutation_p.V201I|CLEC4M_uc002mic.2_Missense_Mutation_p.V265I|CLEC4M_uc002mia.2_Missense_Mutation_p.V157I	NM_001144910	NP_001138382	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M isoform	293	Extracellular (Probable).|C-type lectin.				cell-cell recognition|endocytosis|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to plasma membrane	ICAM-3 receptor activity|mannose binding|metal ion binding|peptide antigen binding|virion binding			pancreas(1)	1						GCACGACTCCGTCACCGCCTG	0.597																0.269006	108.776987	117.012234	46	125	KEEP	---	---	---	---	26	26	73	64	-1	capture	Missense_Mutation	SNP	7831634	7831634	CLEC4M	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3483	11
NCAN	1463	broad.mit.edu	37	19	19337603	19337603	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19337603G>C	uc002nlz.2	+	7	1480	c.1381G>C	c.(1381-1383)GGC>CGC	p.G461R	NCAN_uc010ecc.1_Missense_Mutation_p.G25R	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	461					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			CATGGGGGCAGGCACTGCAGC	0.642																0.261905	54.008498	58.319698	22	62	KEEP	---	---	---	---	13	9	38	33	-1	capture	Missense_Mutation	SNP	19337603	19337603	NCAN	19	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	10111	11
PAPL	390928	broad.mit.edu	37	19	39591969	39591969	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39591969C>T	uc002oki.2	+	10	1289	c.1015C>T	c.(1015-1017)CGA>TGA	p.R339*	PAPL_uc010egl.2_Silent_p.N297N	NM_001004318	NP_001004318	Q6ZNF0	PAPL_HUMAN	iron/zinc purple acid phosphatase-like protein	339						extracellular region	acid phosphatase activity|metal ion binding				0						CTCGTATGAACGACTGTGGCC	0.597																0.162393	33.551744	46.230905	19	98	KEEP	---	---	---	---	12	10	67	43	-1	capture	Nonsense_Mutation	SNP	39591969	39591969	PAPL	19	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	11331	11
APOB	338	broad.mit.edu	37	2	21239331	21239331	+	Silent	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21239331G>A	uc002red.2	-	21	3440	c.3312C>T	c.(3310-3312)GTC>GTT	p.V1104V		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1104					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CCATGAGGGCGACCTCAGTAA	0.478																0.357143	101.199289	102.9602	35	63	KEEP	---	---	---	---	25	15	36	36	-1	capture	Silent	SNP	21239331	21239331	APOB	2	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	778	11
CD207	50489	broad.mit.edu	37	2	71058942	71058942	+	Silent	SNP	C	G	G			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71058942C>G	uc002shg.2	-	5	773	c.726G>C	c.(724-726)CTG>CTC	p.L242L		NM_015717	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 antigen, langerin	242	C-type lectin.|Extracellular (Potential).				defense response to virus	endocytic vesicle|integral to membrane	mannose binding			ovary(1)|lung(1)	2						CTGTTTTATACAGAAACTCCT	0.537																0.318681	90.742781	93.401658	29	62	KEEP	---	---	---	---	15	16	37	28	-1	capture	Silent	SNP	71058942	71058942	CD207	2	C	G	G	G	1	0	0	0	0	0	0	0	1	210	17	4	4	2954	11
ANKRD36	375248	broad.mit.edu	37	2	97869931	97869931	+	Missense_Mutation	SNP	A	T	T	rs76309140		TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:97869931A>T	uc010yva.1	+	50	3236	c.2992A>T	c.(2992-2994)ACA>TCA	p.T998S	ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	998											0						CATTCAGGCTACAAGTGATGA	0.289																0.157895	5.413673	7.533372	3	16	KEEP	---	---	---	---	3	1	6	10	-1	capture	Missense_Mutation	SNP	97869931	97869931	ANKRD36	2	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	661	11
ZAP70	7535	broad.mit.edu	37	2	98351172	98351172	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:98351172G>A	uc002syd.1	+	9	1286	c.1079G>A	c.(1078-1080)CGC>CAC	p.R360H	ZAP70_uc010yvf.1_3'UTR|ZAP70_uc002sye.1_Missense_Mutation_p.R250H|ZAP70_uc002syf.1_Missense_Mutation_p.R53H	NM_001079	NP_001070	P43403	ZAP70_HUMAN	zeta-chain associated protein kinase 70kDa	360	Protein kinase.				immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						TACCGCATGCGCAAGTATGGC	0.637					138											0.229885	40.763409	46.57975	20	67	KEEP	---	---	---	---	11	11	49	30	-1	capture	Missense_Mutation	SNP	98351172	98351172	ZAP70	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17395	11
RSPO4	343637	broad.mit.edu	37	20	947858	947858	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:947858G>A	uc002wej.2	-	3	465	c.368C>T	c.(367-369)CCG>CTG	p.P123L	RSPO4_uc002wek.2_Missense_Mutation_p.P123L	NM_001029871	NP_001025042	Q2I0M5	RSPO4_HUMAN	R-spondin family, member 4 isoform 1 precursor	123	FU.				Wnt receptor signaling pathway	extracellular region	heparin binding				0						AGTGCCCGGCGGGCAGGTGGG	0.647																0.346154	76.909088	78.535443	27	51	KEEP	---	---	---	---	17	12	26	28	-1	capture	Missense_Mutation	SNP	947858	947858	RSPO4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13604	11
PRDM15	63977	broad.mit.edu	37	21	43291677	43291677	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43291677C>T	uc002yzq.1	-	4	578	c.467G>A	c.(466-468)GGG>GAG	p.G156E	PRDM15_uc002yzo.2_Intron|PRDM15_uc002yzp.2_Intron|PRDM15_uc002yzr.1_Intron	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	156					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACCTCATTCCCTAGAGATGT	0.582																0.305882	72.015546	74.873546	26	59	KEEP	---	---	---	---	17	11	46	23	-1	capture	Missense_Mutation	SNP	43291677	43291677	PRDM15	21	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	12352	11
MICAL3	57553	broad.mit.edu	37	22	18274039	18274039	+	Silent	SNP	C	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:18274039C>A	uc002zng.3	-	30	6032	c.5679G>T	c.(5677-5679)CTG>CTT	p.L1893L	MICAL3_uc011agl.1_Silent_p.L1809L|MICAL3_uc010grd.1_Silent_p.L9L|MICAL3_uc010gre.1_RNA	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin	1893	Potential.					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		ACTCCTGCATCAGCTTGGGGT	0.632																0.216216	16.677122	19.428902	8	29	KEEP	---	---	---	---	3	5	19	16	0.625	capture	Silent	SNP	18274039	18274039	MICAL3	22	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	9483	11
NAGA	4668	broad.mit.edu	37	22	42458930	42458930	+	Silent	SNP	C	G	G			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42458930C>G	uc003bbx.2	-	8	995	c.858G>C	c.(856-858)CTG>CTC	p.L286L	NAGA_uc003bby.2_Silent_p.L286L|NAGA_uc003bbw.3_Silent_p.L286L	NM_000262	NP_000253	P17050	NAGAB_HUMAN	alpha-N-acetylgalactosaminidase precursor	286					glycoside catabolic process|glycosylceramide catabolic process|oligosaccharide metabolic process	lysosome	alpha-galactosidase activity|alpha-N-acetylgalactosaminidase activity|cation binding|protein homodimerization activity			central_nervous_system(1)	1						AGATGGTACGCAGGTCTGTGG	0.557																0.269231	96.584924	102.822086	35	95	KEEP	---	---	---	---	23	16	65	33	-1	capture	Silent	SNP	42458930	42458930	NAGA	22	C	G	G	G	1	0	0	0	0	0	0	0	1	314	25	4	4	10051	11
PKDREJ	10343	broad.mit.edu	37	22	46655208	46655208	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46655208T>G	uc003bhh.2	-	1	4012	c.4012A>C	c.(4012-4014)ACT>CCT	p.T1338P		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	1338	Cytoplasmic (Potential).|PLAT.				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CTGTCCAAAGTGGTATCAACA	0.398																0.258065	116.23786	124.452211	40	115	KEEP	---	---	---	---	28	19	60	59	-1	capture	Missense_Mutation	SNP	46655208	46655208	PKDREJ	22	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	11873	11
SCN5A	6331	broad.mit.edu	37	3	38592323	38592323	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38592323C>T	uc003cio.2	-	28	5734	c.5540G>A	c.(5539-5541)CGC>CAC	p.R1847H	SCN5A_uc003cin.2_Missense_Mutation_p.R1846H|SCN5A_uc003cil.3_Missense_Mutation_p.R1847H|SCN5A_uc010hhi.2_Missense_Mutation_p.R1829H|SCN5A_uc010hhk.2_Missense_Mutation_p.R1814H|SCN5A_uc011ayr.1_Missense_Mutation_p.R1793H	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1847					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GCAATGGATGCGGTCCCCACT	0.557																0.027778	-28.713264	6.684573	4	140	KEEP	---	---	---	---	2	3	95	59	-1	capture	Missense_Mutation	SNP	38592323	38592323	SCN5A	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13815	11
MORC1	27136	broad.mit.edu	37	3	108754309	108754309	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108754309C>T	uc003dxl.2	-	15	1424	c.1337G>A	c.(1336-1338)AGA>AAA	p.R446K	MORC1_uc011bhn.1_Missense_Mutation_p.R446K	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	446					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						TGTTAAATTTCTATTATCTTT	0.254																0.225	22.253581	25.032922	9	31	KEEP	---	---	---	---	4	6	21	12	-1	capture	Missense_Mutation	SNP	108754309	108754309	MORC1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	9613	11
BOD1L	259282	broad.mit.edu	37	4	13606401	13606401	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:13606401G>C	uc003gmz.1	-	10	2240	c.2123C>G	c.(2122-2124)TCT>TGT	p.S708C	BOD1L_uc010idr.1_Missense_Mutation_p.S45C	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	708	Lys-rich.						DNA binding			ovary(5)|breast(1)	6						TGGTGTTTCAGAATCATCTTT	0.398																0.015723	-75.729651	8.828185	5	313	KEEP	---	---	---	---	4	2	224	97	-1	capture	Missense_Mutation	SNP	13606401	13606401	BOD1L	4	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	1471	11
SEPSECS	51091	broad.mit.edu	37	4	25125641	25125641	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:25125641T>C	uc003grg.2	-	11	1631	c.1418A>G	c.(1417-1419)TAT>TGT	p.Y473C	SEPSECS_uc003gri.2_Missense_Mutation_p.Y472C|SEPSECS_uc003grh.2_Missense_Mutation_p.Y394C	NM_153825	NP_722547	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine)	473					selenocysteine incorporation	cytoplasm|nucleus	pyridoxal phosphate binding|transferase activity, transferring selenium-containing groups|tRNA binding				0		Breast(46;0.173)			Pyridoxal Phosphate(DB00114)	AGTTTTGTCATAATTGTCATC	0.378																0.280423	157.211196	165.392108	53	136	KEEP	---	---	---	---	31	23	87	52	-1	capture	Missense_Mutation	SNP	25125641	25125641	SEPSECS	4	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	13951	11
RBM47	54502	broad.mit.edu	37	4	40440818	40440818	+	Silent	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40440818G>A	uc003gvc.2	-	4	803	c.93C>T	c.(91-93)AAC>AAT	p.N31N	RBM47_uc003gvd.2_Silent_p.N31N|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Intron|RBM47_uc003gvg.1_Silent_p.N31N	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	31						nucleus	nucleotide binding|RNA binding			breast(3)	3						GTGCTGCCTCGTTGGGCGCGC	0.697																0.25	7.133298	7.805786	3	9	KEEP	---	---	---	---	1	2	7	4	-1	capture	Silent	SNP	40440818	40440818	RBM47	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13036	11
ADAM29	11086	broad.mit.edu	37	4	175896931	175896931	+	Silent	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175896931C>T	uc003iuc.2	+	5	925	c.255C>T	c.(253-255)GAC>GAT	p.D85D	ADAM29_uc003iud.2_Silent_p.D85D|ADAM29_uc010irr.2_Silent_p.D85D|ADAM29_uc011cki.1_Silent_p.D85D	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	85					proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding	p.D85E(1)		skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CCTACACAGACCAGGGTGCTA	0.473	Ovarian(140;1727 1835 21805 25838 41440)				106											0.30137	56.820994	59.393734	22	51	KEEP	---	---	---	---	12	10	27	29	-1	capture	Silent	SNP	175896931	175896931	ADAM29	4	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	247	11
SLC6A19	340024	broad.mit.edu	37	5	1208942	1208942	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1208942G>A	uc003jbw.3	+	2	340	c.284G>A	c.(283-285)CGG>CAG	p.R95Q		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	95	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			ATCGGGCAGCGGCTGCGGCGG	0.677																0.283951	62.853003	66.211638	23	58	KEEP	---	---	---	---	23	15	64	22	-1	capture	Missense_Mutation	SNP	1208942	1208942	SLC6A19	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14574	11
BASP1	10409	broad.mit.edu	37	5	17275409	17275409	+	Silent	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:17275409C>T	uc003jfx.2	+	2	263	c.84C>T	c.(82-84)GGC>GGT	p.G28G		NM_006317	NP_006308	P80723	BASP1_HUMAN	brain abundant, membrane attached signal protein	28					glomerular visceral epithelial cell differentiation|negative regulation of transcription, DNA-dependent	cytoplasm|cytoskeleton|growth cone|nuclear speck|plasma membrane	protein domain specific binding|transcription corepressor activity|transcription regulatory region DNA binding				0						AGGCCGAGGGCGCGGCGACGG	0.627																0.244444	27.814485	30.484089	11	34	KEEP	---	---	---	---	6	5	16	19	-1	capture	Silent	SNP	17275409	17275409	BASP1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1306	11
HCN1	348980	broad.mit.edu	37	5	45262205	45262205	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45262205C>A	uc003jok.2	-	8	2516	c.2491G>T	c.(2491-2493)GGC>TGC	p.G831C		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	831	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GTGCTCCTGCCCCCTGCCTGA	0.677																0.233766	32.115752	37.1191	18	59	KEEP	---	---	---	---	15	7	42	25	0.318181818182	capture	Missense_Mutation	SNP	45262205	45262205	HCN1	5	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	6922	11
VCAN	1462	broad.mit.edu	37	5	82808046	82808046	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:82808046T>A	uc003kii.3	+	6	1229	c.873T>A	c.(871-873)TTT>TTA	p.F291L	VCAN_uc003kij.3_Missense_Mutation_p.F291L|VCAN_uc010jau.2_Missense_Mutation_p.F291L|VCAN_uc003kik.3_Missense_Mutation_p.F291L|VCAN_uc003kih.3_Missense_Mutation_p.F291L	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	291	Link 2.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		GGAACGGCTTTGACCAGTGCG	0.602																0.34375	63.431815	64.811392	22	42	KEEP	---	---	---	---	18	8	27	21	-1	capture	Missense_Mutation	SNP	82808046	82808046	VCAN	5	T	A	A	A	1	0	0	0	0	1	0	0	0	816	63	4	4	17020	11
FNIP1	96459	broad.mit.edu	37	5	131042146	131042146	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131042146C>T	uc003kvs.1	-	9	1014	c.872G>A	c.(871-873)CGC>CAC	p.R291H	RAPGEF6_uc003kvp.1_Intron|FNIP1_uc003kvt.1_Missense_Mutation_p.R263H|FNIP1_uc010jdm.1_Missense_Mutation_p.R246H|FNIP1_uc003kvu.2_Missense_Mutation_p.R291H	NM_133372	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1 isoform 1	291					regulation of protein phosphorylation	cytoplasm	protein binding			pancreas(1)|skin(1)	2		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		TGTTTGGCTGCGTCGCCAACG	0.438																0.313869	118.377638	122.600213	43	94	KEEP	---	---	---	---	28	22	66	47	-1	capture	Missense_Mutation	SNP	131042146	131042146	FNIP1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5919	11
PCDHA12	56137	broad.mit.edu	37	5	140256419	140256419	+	Silent	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140256419G>A	uc003lic.2	+	1	1489	c.1362G>A	c.(1360-1362)GCG>GCA	p.A454A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.A454A	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	454	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGCGCCTGCGTTCGCGCAGC	0.652	Pancreas(113;759 1672 13322 24104 50104)															0.245902	102.737211	113.467786	45	138	KEEP	---	---	---	---	26	24	97	48	-1	capture	Silent	SNP	140256419	140256419	PCDHA12	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11425	11
JAKMIP2	9832	broad.mit.edu	37	5	147040668	147040668	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:147040668G>A	uc003loq.1	-	3	852	c.470C>T	c.(469-471)GCG>GTG	p.A157V	JAKMIP2_uc011dbx.1_Missense_Mutation_p.A115V|JAKMIP2_uc003lor.1_Missense_Mutation_p.A157V|uc003lop.1_3'UTR|JAKMIP2_uc010jgo.1_Missense_Mutation_p.A157V	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	157	Potential.					Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTCAGGTCCGCAATTTCCTG	0.542																0.015198	-80.213091	7.564435	5	324	KEEP	---	---	---	---	5	0	234	133	-1	capture	Missense_Mutation	SNP	147040668	147040668	JAKMIP2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7864	11
COL23A1	91522	broad.mit.edu	37	5	177690250	177690250	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:177690250C>T	uc003mje.2	-	9	956	c.598G>A	c.(598-600)GAC>AAC	p.D200N	COL23A1_uc010jkt.2_Silent_p.A47A	NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	200	Extracellular (Potential).|Collagen-like 1.|Gly-rich.					collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TTCCCAGTGTCGCCAGGAGGG	0.637																0.184211	28.408903	35.516337	14	62	KEEP	---	---	---	---	11	5	41	22	-1	capture	Missense_Mutation	SNP	177690250	177690250	COL23A1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3647	11
RNF8	9025	broad.mit.edu	37	6	37336605	37336605	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:37336605G>A	uc003onq.3	+	3	779	c.586G>A	c.(586-588)GCC>ACC	p.A196T	RNF8_uc003onr.3_Missense_Mutation_p.A196T|RNF8_uc011dtx.1_Missense_Mutation_p.A128T	NM_003958	NP_003949	O76064	RNF8_HUMAN	ring finger protein 8 isoform 1	196					cell division|double-strand break repair|histone H2A ubiquitination|histone H2B ubiquitination|mitosis|positive regulation of DNA repair|response to ionizing radiation	midbody|nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1						AGGTGAAGTGGCCAGTACACC	0.483																0.297872	73.760794	77.195548	28	66	KEEP	---	---	---	---	14	18	42	27	-1	capture	Missense_Mutation	SNP	37336605	37336605	RNF8	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13392	11
PEX6	5190	broad.mit.edu	37	6	42937419	42937419	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:42937419G>A	uc003otf.2	-	5	1447	c.1354C>T	c.(1354-1356)CGC>TGC	p.R452C	PEX6_uc010jya.2_RNA	NM_000287	NP_000278	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	452					protein import into peroxisome matrix, translocation|protein stabilization	cytosol|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)	1			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GGCTGGAGGCGAGGCTTCAGG	0.567																0.275229	80.938248	85.875544	30	79	KEEP	---	---	---	---	22	12	46	45	-1	capture	Missense_Mutation	SNP	42937419	42937419	PEX6	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11653	11
RFX6	222546	broad.mit.edu	37	6	117243268	117243268	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117243268C>A	uc003pxm.2	+	13	1454	c.1391C>A	c.(1390-1392)GCT>GAT	p.A464D		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	464					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						ACTGTGGAGGCTTTTATTGAA	0.323																0.289256	89.932642	94.78077	35	86	KEEP	---	---	---	---	31	11	62	44	0.261904761905	capture	Missense_Mutation	SNP	117243268	117243268	RFX6	6	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	13162	11
PTPRK	5796	broad.mit.edu	37	6	128388894	128388894	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:128388894T>C	uc003qbk.2	-	12	2294	c.1927A>G	c.(1927-1929)AAG>GAG	p.K643E	PTPRK_uc003qbj.2_Missense_Mutation_p.K643E|PTPRK_uc010kfc.2_Missense_Mutation_p.K643E|PTPRK_uc011ebu.1_Missense_Mutation_p.K643E|PTPRK_uc003qbl.1_Missense_Mutation_p.K513E|PTPRK_uc011ebv.1_Missense_Mutation_p.K643E	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	643	Extracellular (Potential).|Fibronectin type-III 4.	Cleavage (Probable).			cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		GCTTCTCTCTTGGTTCGGTGT	0.448																0.28125	94.645947	100.150712	36	92	KEEP	---	---	---	---	23	18	63	37	-1	capture	Missense_Mutation	SNP	128388894	128388894	PTPRK	6	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	12700	11
TYW1B	441250	broad.mit.edu	37	7	72093938	72093938	+	Silent	SNP	G	A	A	rs149299985	by1000genomes	TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72093938G>A	uc011kej.1	-	15	1710	c.1551C>T	c.(1549-1551)AAC>AAT	p.N517N	TYW1B_uc011keh.1_Silent_p.N355N|TYW1B_uc011kei.1_Silent_p.N143N	NM_001145440	NP_001138912	Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B isoform	517					tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity				0						GCTCGTCCACGTTCCATGCTT	0.522																0.088235	0.89899	6.726869	3	31	KEEP	---	---	---	---	2	3	16	22	-1	capture	Silent	SNP	72093938	72093938	TYW1B	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16701	11
ABCB4	5244	broad.mit.edu	37	7	87104766	87104766	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87104766C>T	uc003uiv.1	-	2	92	c.16G>A	c.(16-18)GCA>ACA	p.A6T	ABCB4_uc003uiw.1_Missense_Mutation_p.A6T|ABCB4_uc003uix.1_Missense_Mutation_p.A6T|ABCB4_uc003uiy.2_Missense_Mutation_p.A6T	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	6	Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					CCGTTCTTTGCCGCCTCAAGA	0.647																0.043478	-12.780374	7.769235	4	88	KEEP	---	---	---	---	2	3	60	43	-1	capture	Missense_Mutation	SNP	87104766	87104766	ABCB4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	43	11
ZAN	7455	broad.mit.edu	37	7	100373053	100373053	+	Silent	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100373053C>T	uc003uwj.2	+	33	6048	c.5883C>T	c.(5881-5883)TGC>TGT	p.C1961C	ZAN_uc003uwk.2_Silent_p.C1961C|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kke.1_Silent_p.C48C	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	1961	Extracellular (Potential).|VWFD 3.				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TGAAAGTGTGCCACCCCGCCA	0.547																0.047059	-10.958586	7.611498	4	81	KEEP	---	---	---	---	2	2	58	34	-1	capture	Silent	SNP	100373053	100373053	ZAN	7	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	17394	11
MUC17	140453	broad.mit.edu	37	7	100681607	100681607	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100681607G>C	uc003uxp.1	+	3	6963	c.6910G>C	c.(6910-6912)GTT>CTT	p.V2304L	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2304	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|36.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AACAACTCCTGTTGACTCCAA	0.473																0.197095	238.666374	279.842751	95	387	KEEP	---	---	---	---	57	39	226	183	-1	capture	Missense_Mutation	SNP	100681607	100681607	MUC17	7	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	9884	11
RELN	5649	broad.mit.edu	37	7	103130205	103130205	+	Silent	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103130205G>A	uc003vca.2	-	60	9907	c.9747C>T	c.(9745-9747)TGC>TGT	p.C3249C	RELN_uc010liz.2_Silent_p.C3249C	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	3249	EGF-like 8.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AGCTCTCGTCGCAGATGCAGA	0.408	NSCLC(146;835 1944 15585 22231 52158)															0.189655	21.692298	26.918124	11	47	KEEP	---	---	---	---	6	6	30	22	-1	capture	Silent	SNP	103130205	103130205	RELN	7	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	13115	11
ADAM7	8756	broad.mit.edu	37	8	24365011	24365012	+	Missense_Mutation	DNP	TC	AA	AA			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24365011_24365012TC>AA	uc003xeb.2	+	21	2340_2341	c.2227_2228TC>AA	c.(2227-2229)TCA>AAA	p.S743K	ADAM7_uc003xec.2_Intron	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN	a disintegrin and metalloproteinase domain 7	743	Cytoplasmic (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		AAGTAAAGATTCAAGAGGAATC	0.297																0.328	109.445568	112.718006	41	84	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	24365011	24365012	ADAM7	8	TC	AA	AA	AA	1	0	0	0	0	1	0	0	0	806	62	4	4	251	11
DOCK5	80005	broad.mit.edu	37	8	25158172	25158172	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25158172C>G	uc003xeg.2	+	9	982	c.845C>G	c.(844-846)ACA>AGA	p.T282R	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Intron|DOCK5_uc003xef.2_Missense_Mutation_p.T282R	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	282						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GCAGTGTTTACAGTAAGTCCT	0.363	Pancreas(145;34 1887 3271 10937 30165)															0.176471	7.114116	8.791173	3	14	KEEP	---	---	---	---	2	1	14	1	-1	capture	Missense_Mutation	SNP	25158172	25158172	DOCK5	8	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	4646	11
EBF2	64641	broad.mit.edu	37	8	25715990	25715990	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25715990G>A	uc003xes.1	-	14	1390	c.1373C>T	c.(1372-1374)CCG>CTG	p.P458L	PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_RNA	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	458	Pro/Ser/Thr-rich.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GTATCCCCGCGGAGAGATGCT	0.522	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)															0.333333	97.044875	99.478901	33	66	KEEP	---	---	---	---	25	14	44	33	-1	capture	Missense_Mutation	SNP	25715990	25715990	EBF2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4836	11
TRPA1	8989	broad.mit.edu	37	8	72948651	72948651	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:72948651C>A	uc003xza.2	-	21	2602	c.2427G>T	c.(2425-2427)TGG>TGT	p.W809C	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	809	Helical; Name=3; (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	TGTAGATAATCCATTCAAGAA	0.363																0.298701	58.299306	61.085681	23	54	KEEP	---	---	---	---	16	8	35	23	0.333333333333	capture	Missense_Mutation	SNP	72948651	72948651	TRPA1	8	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	16460	11
RIMS2	9699	broad.mit.edu	37	8	104930679	104930679	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104930679C>T	uc003yls.2	+	7	1622	c.1381C>T	c.(1381-1383)CGA>TGA	p.R461*	RIMS2_uc003ylp.2_Nonsense_Mutation_p.R683*|RIMS2_uc003ylw.2_Nonsense_Mutation_p.R491*|RIMS2_uc003ylq.2_Nonsense_Mutation_p.R491*|RIMS2_uc003ylr.2_Nonsense_Mutation_p.R538*|RIMS2_uc003ylt.2_Nonsense_Mutation_p.R84*|RIMS2_uc003ylu.1_Nonsense_Mutation_p.R74*|RIMS2_uc003ylv.1_Nonsense_Mutation_p.R74*	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	761					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGATATACCGCGAATACCTGA	0.299					728								HNSCC(12;0.0054)			0.2	45.685629	54.897943	22	88	KEEP	---	---	---	---	18	11	67	28	-1	capture	Nonsense_Mutation	SNP	104930679	104930679	RIMS2	8	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	6	1	13260	11
SMARCA2	6595	broad.mit.edu	37	9	2039586	2039586	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:2039586G>A	uc003zhc.2	+	4	575	c.476G>A	c.(475-477)GGT>GAT	p.G159D	SMARCA2_uc003zhd.2_Missense_Mutation_p.G159D|SMARCA2_uc010mha.2_Missense_Mutation_p.G150D	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	159					chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CTCATCCCAGGTGATCCGCAG	0.582																0.355556	86.928834	88.559528	32	58	KEEP	---	---	---	---	20	20	32	43	-1	capture	Missense_Mutation	SNP	2039586	2039586	SMARCA2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	14661	11
DAB2IP	153090	broad.mit.edu	37	9	124535257	124535257	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:124535257C>T	uc004bln.2	+	12	2435	c.2366C>T	c.(2365-2367)CCA>CTA	p.P789L	DAB2IP_uc004blo.2_Missense_Mutation_p.P693L|DAB2IP_uc004blp.2_Missense_Mutation_p.P222L	NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform	817					activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2						GAGGGCGCGCCAGGCCGGCCC	0.726																0.266667	48.563642	52.254902	20	55	KEEP	---	---	---	---	11	11	40	28	-1	capture	Missense_Mutation	SNP	124535257	124535257	DAB2IP	9	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	4179	11
RBM18	92400	broad.mit.edu	37	9	125004210	125004210	+	Nonsense_Mutation	SNP	T	A	A			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125004210T>A	uc004bma.2	-	6	692	c.526A>T	c.(526-528)AAA>TAA	p.K176*	RBM18_uc004blz.2_RNA|RBM18_uc010mvy.2_RNA|RBM18_uc011lyp.1_RNA	NM_033117	NP_149108	Q96H35	RBM18_HUMAN	RNA binding motif protein 18	176							nucleotide binding|RNA binding				0						GTAGTCCTTTTTTTATCTGGT	0.398																0.283688	98.739952	104.666011	40	101	KEEP	---	---	---	---	20	22	76	33	-1	capture	Nonsense_Mutation	SNP	125004210	125004210	RBM18	9	T	A	A	A	1	0	0	0	0	0	1	0	0	832	64	5	4	13015	11
RBM18	92400	broad.mit.edu	37	9	125004227	125004227	+	Missense_Mutation	SNP	A	C	C	rs111532590		TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125004227A>C	uc004bma.2	-	6	675	c.509T>G	c.(508-510)TTT>TGT	p.F170C	RBM18_uc004blz.2_RNA|RBM18_uc010mvy.2_RNA|RBM18_uc011lyp.1_RNA	NM_033117	NP_149108	Q96H35	RBM18_HUMAN	RNA binding motif protein 18	170							nucleotide binding|RNA binding				0						TGGTGGCTTAAAGTAGGAATA	0.403																0.28	105.976458	111.412489	35	90	KEEP	---	---	---	---	17	19	67	29	-1	capture	Missense_Mutation	SNP	125004227	125004227	RBM18	9	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	13015	11
VCAM1	7412	broad.mit.edu	37	1	101197065	101197066	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:101197065_101197066delTA	uc001dti.2	+	6	1636_1637	c.1516_1517delTA	c.(1516-1518)TATfs	p.Y506fs	VCAM1_uc001dtj.2_Frame_Shift_Del_p.Y414fs|VCAM1_uc010ouj.1_Frame_Shift_Del_p.Y444fs	NM_001078	NP_001069	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1 isoform a	506	Ig-like C2-type 5.|Extracellular (Potential).				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding			central_nervous_system(1)	1		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	GCAAACACTTTATGTCAATGGT	0.366																0.26			24	69		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	101197065	101197066	VCAM1	1	TA	-	-	-	1	0	1	0	1	0	0	0	0	793	61	5	5	17019	11
PRB2	653247	broad.mit.edu	37	12	11546320	11546322	+	In_Frame_Del	DEL	TTG	-	-			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11546320_11546322delTTG	uc010shk.1	-	3	725_727	c.690_692delCAA	c.(688-693)AACAAG>AAG	p.N230del		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACTTTGGGACTTGTTGTCTCCTT	0.601																0.01			8	867		---	---	---	---						capture_indel	In_Frame_Del	DEL	11546320	11546322	PRB2	12	TTG	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	12339	11
MYO7B	4648	broad.mit.edu	37	2	128342397	128342399	+	In_Frame_Del	DEL	CAA	-	-			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128342397_128342399delCAA	uc002top.2	+	14	1652_1654	c.1599_1601delCAA	c.(1597-1602)GCCAAC>GCC	p.N535del		NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	535	Myosin head-like.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GCGTCCATGCCAACAACAAGGCC	0.571																0.27			56	150		---	---	---	---						capture_indel	In_Frame_Del	DEL	128342397	128342399	MYO7B	2	CAA	-	-	-	1	0	1	0	1	0	0	0	0	262	21	5	5	9993	11
SLC34A2	10568	broad.mit.edu	37	4	25664233	25664236	+	Splice_Site	DEL	AAGT	-	-			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:25664233_25664236delAAGT	uc003grr.2	+	2	193	c.112_splice	c.e2+1	p.T38_splice	SLC34A2_uc003grs.2_Splice_Site_p.N38_splice|SLC34A2_uc010iev.2_Splice_Site_p.N38_splice	NM_006424	NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (sodium phosphate),						cellular phosphate ion homeostasis	apical plasma membrane|brush border membrane|integral to plasma membrane	phosphate binding|sodium ion binding|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			skin(3)|ovary(1)|kidney(1)	5		Breast(46;0.0503)				AGACCAACAAAAGTAAGTGTCGCT	0.534																0.26			63	177		---	---	---	---						capture_indel	Splice_Site	DEL	25664233	25664236	SLC34A2	4	AAGT	-	-	-	1	0	1	0	1	0	0	1	0	11	1	5	5	14460	11
ZDHHC4	55146	broad.mit.edu	37	7	6621848	6621849	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6621848_6621849insT	uc003sqi.2	+	6	694_695	c.336_337insT	c.(334-339)CTGTTTfs	p.L112fs	ZDHHC4_uc003sqg.2_Frame_Shift_Ins_p.L112fs|ZDHHC4_uc003sql.2_Frame_Shift_Ins_p.L112fs|ZDHHC4_uc003sqh.2_Frame_Shift_Ins_p.L112fs|ZDHHC4_uc003sqj.2_Frame_Shift_Ins_p.L112fs|ZDHHC4_uc003sqk.2_Frame_Shift_Ins_p.L112fs|ZDHHC4_uc003sqm.2_Frame_Shift_Ins_p.L112fs	NM_001134388	NP_001127860	Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	112_113	Helical; (Potential).					integral to membrane	acyltransferase activity|zinc ion binding			breast(1)|pancreas(1)	2		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		GTGTAAACCTGTTTTTTTTCAC	0.450																0.02			7	425		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	6621848	6621849	ZDHHC4	7	-	T	T	T	1	0	1	1	0	0	0	0	0	613	48	5	5	17497	11
VCP	7415	broad.mit.edu	37	9	35059646	35059647	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-0124-01	TCGA-06-0124-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35059646_35059647insT	uc003zvy.2	-	14	2236_2237	c.1847_1848insA	c.(1846-1848)AATfs	p.N616fs	VCP_uc003zvz.2_RNA|VCP_uc010mkh.1_Frame_Shift_Ins_p.N285fs|VCP_uc010mki.1_Frame_Shift_Ins_p.N571fs	NM_007126	NP_009057	P55072	TERA_HUMAN	valosin-containing protein	616					activation of caspase activity|double-strand break repair|endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|retrograde protein transport, ER to cytosol	cytosol|endoplasmic reticulum|microsome|nucleus|proteasome complex	ATP binding|ATPase activity|lipid binding|polyubiquitin binding|protein domain specific binding|protein phosphatase binding			upper_aerodigestive_tract(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TGATGAACACATTTTTTTTTGT	0.515																0.07			12	162		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	35059646	35059647	VCP	9	-	T	T	T	1	0	1	1	0	0	0	0	0	102	8	5	5	17022	11
