Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NPHP4	261734	broad.mit.edu	37	1	5969224	5969224	+	Silent	SNP	A	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:5969224A>T	uc001alq.1	-	12	1757	c.1491T>A	c.(1489-1491)CCT>CCA	p.P497P	NPHP4_uc001als.1_RNA|NPHP4_uc009vlt.1_Intron|NPHP4_uc001alt.1_Intron	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin	497					actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CTGGTCCCACAGGTGAGTTCT	0.597																0.4	6.849253	6.892914	2	3	KEEP	---	---	---	---	0	2	2	1	-1	capture	Silent	SNP	5969224	5969224	NPHP4	1	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	10488	13
TNFRSF1B	7133	broad.mit.edu	37	1	12253032	12253032	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12253032A>C	uc001att.2	+	6	753	c.664A>C	c.(664-666)ACA>CCA	p.T222P	TNFRSF1B_uc001atu.2_Missense_Mutation_p.T27P|TNFRSF1B_uc009vnk.2_RNA	NM_001066	NP_001057	P20333	TNR1B_HUMAN	tumor necrosis factor receptor 2 precursor	222	Extracellular (Potential).				apoptosis	extracellular region|integral to membrane|membrane raft|plasma membrane	tumor necrosis factor receptor activity	p.T222P(1)		liver(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)|Infliximab(DB00065)	GCCAGTGTCCACACGATCCCA	0.637					222											0.467532	125.998037	126.068278	36	41	KEEP	---	---	---	---	19	23	17	28	-1	capture	Missense_Mutation	SNP	12253032	12253032	TNFRSF1B	1	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	16177	13
THRAP3	9967	broad.mit.edu	37	1	36752347	36752347	+	Silent	SNP	T	C	C			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:36752347T>C	uc001cae.3	+	4	740	c.516T>C	c.(514-516)TCT>TCC	p.S172S	THRAP3_uc001caf.3_Silent_p.S172S|THRAP3_uc001cag.1_Silent_p.S172S	NM_005119	NP_005110	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	172	Ser-rich.				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(5)|lung(3)|breast(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TTGAATCTTCTAAGCGCAAGT	0.527	Pancreas(129;785 1795 20938 23278 32581)				199	T	USP6	aneurysmal bone cysts								0.390428	556.457849	560.626231	155	242	KEEP	---	---	---	---	89	88	158	124	-1	capture	Silent	SNP	36752347	36752347	THRAP3	1	T	C	C	C	1	0	0	0	0	0	0	0	1	678	53	3	3	15759	13
C8A	731	broad.mit.edu	37	1	57383364	57383364	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:57383364G>A	uc001cyo.2	+	11	1862	c.1730G>A	c.(1729-1731)CGG>CAG	p.R577Q		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	577	TSP type-1 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3						TGTCCAGGGCGGAAAGTACAG	0.557																0.333333	63.75548	65.304579	21	42	KEEP	---	---	---	---	14	12	29	19	-1	capture	Missense_Mutation	SNP	57383364	57383364	C8A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2393	13
SYDE2	84144	broad.mit.edu	37	1	85648703	85648703	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85648703C>T	uc009wcm.2	-	3	1671	c.1622G>A	c.(1621-1623)CGA>CAA	p.R541Q	SYDE2_uc001dku.3_Missense_Mutation_p.R541Q	NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2	541					activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)		GCTTAGCTTTCGGCTAAATTC	0.338																0.42053	390.939666	392.610808	127	175	KEEP	---	---	---	---	86	46	116	63	-1	capture	Missense_Mutation	SNP	85648703	85648703	SYDE2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15324	13
KCNA10	3744	broad.mit.edu	37	1	111060591	111060591	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:111060591C>A	uc001dzt.1	-	1	1207	c.819G>T	c.(817-819)ATG>ATT	p.M273I		NM_005549	NP_005540	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related	273	Helical; Name=Segment S2; (Potential).					voltage-gated potassium channel complex	intracellular cyclic nucleotide activated cation channel activity|voltage-gated potassium channel activity			ovary(3)|large_intestine(1)	4		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)		TAGACTCCACCATGAAGAAAG	0.532																0.023392	-36.552402	6.681977	4	167	KEEP	---	---	---	---	2	2	87	90	0.5	capture	Missense_Mutation	SNP	111060591	111060591	KCNA10	1	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	7924	13
FLG2	388698	broad.mit.edu	37	1	152326339	152326339	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152326339C>T	uc001ezw.3	-	3	3996	c.3923G>A	c.(3922-3924)CGC>CAC	p.R1308H	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1308							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGTCTTCTGCGAACTGTGGA	0.473																0.422472	569.539059	571.868047	188	257	KEEP	---	---	---	---	131	67	199	85	-1	capture	Missense_Mutation	SNP	152326339	152326339	FLG2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5868	13
ETV3L	440695	broad.mit.edu	37	1	157068567	157068567	+	Silent	SNP	G	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157068567G>T	uc001fqq.1	-	3	702	c.417C>A	c.(415-417)TCC>TCA	p.S139S		NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	139						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)				GCAAGTGGGGGGATGGCGGCG	0.602																0.430657	144.364166	144.942437	59	78	KEEP	---	---	---	---	31	32	39	44	0.492063492063	capture	Silent	SNP	157068567	157068567	ETV3L	1	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	5235	13
PVRL4	81607	broad.mit.edu	37	1	161043074	161043074	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161043074C>T	uc001fxo.2	-	8	1548	c.1249G>A	c.(1249-1251)GGG>AGG	p.G417R	PVRL4_uc010pjy.1_Intron|PVRL4_uc010pjz.1_Intron	NM_030916	NP_112178	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4 precursor	417	Cytoplasmic (Potential).				adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane				ovary(2)	2	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GCTCTCAGCCCTACACTCTCC	0.652	NSCLC(76;1160 1387 14476 16172 29359)															0.309524	37.67044	39.02206	13	29	KEEP	---	---	---	---	7	6	15	15	-1	capture	Missense_Mutation	SNP	161043074	161043074	PVRL4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	12737	13
RGS1	5996	broad.mit.edu	37	1	192547487	192547487	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:192547487C>G	uc001gsi.1	+	4	482	c.416C>G	c.(415-417)GCA>GGA	p.A139G	RGS1_uc010pou.1_Missense_Mutation_p.A139G	NM_002922	NP_002913	Q08116	RGS1_HUMAN	regulator of G-protein signalling 1	139	RGS.				immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|negative regulation of signal transduction	cytoplasm|plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity				0		Breast(1374;0.188)				ATATATAAAGCATTTGTGCAT	0.343																0.445783	263.63296	264.057841	74	92	KEEP	---	---	---	---	41	43	67	36	-1	capture	Missense_Mutation	SNP	192547487	192547487	RGS1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	13184	13
THNSL1	79896	broad.mit.edu	37	10	25313145	25313145	+	Silent	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:25313145G>A	uc001isi.3	+	3	1322	c.993G>A	c.(991-993)AGG>AGA	p.R331R	ENKUR_uc001ish.1_Intron	NM_024838	NP_079114	Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1	331					threonine biosynthetic process		ATP binding|pyridoxal phosphate binding|shikimate kinase activity|threonine synthase activity			pancreas(1)	1					L-Threonine(DB00156)|Pyridoxal Phosphate(DB00114)	CTCCTGTCAGGCACCTTTCAG	0.433																0.685714	158.723645	160.872063	48	22	KEEP	---	---	---	---	34	19	11	12	-1	capture	Silent	SNP	25313145	25313145	THNSL1	10	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	15747	13
CNNM2	54805	broad.mit.edu	37	10	104836896	104836896	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:104836896A>T	uc001kwm.2	+	8	2711	c.2587A>T	c.(2587-2589)AGT>TGT	p.S863C	CNNM2_uc001kwn.2_Missense_Mutation_p.S841C	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	863					ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TGTGACGCACAGTAAGGCCAA	0.617																0.0375	-11.946262	6.578292	3	77	KEEP	---	---	---	---	2	1	31	60	-1	capture	Missense_Mutation	SNP	104836896	104836896	CNNM2	10	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	3578	13
SMC3	9126	broad.mit.edu	37	10	112350834	112350834	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:112350834A>G	uc001kze.2	+	17	1882	c.1756A>G	c.(1756-1758)ACT>GCT	p.T586A		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	586	Flexible hinge.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TGGAGAGGTTACTTTTCTGCC	0.328																0.77551	148.078464	151.498165	38	11	KEEP	---	---	---	---	24	15	7	4	-1	capture	Missense_Mutation	SNP	112350834	112350834	SMC3	10	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	14676	13
RAG2	5897	broad.mit.edu	37	11	36614899	36614899	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:36614899C>A	uc001mwv.3	-	2	1008	c.820G>T	c.(820-822)GTT>TTT	p.V274F	C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	NM_000536	NP_000527	P55895	RAG2_HUMAN	recombination activating gene 2	274					chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding			skin(3)|ovary(1)|pancreas(1)	5	all_lung(20;0.226)	all_hematologic(20;0.00756)				TAGCCACCAACAATAACAAAT	0.428												Familial_Hemophagocytic_Lymphohistiocytosis				0.379562	156.760232	158.506123	52	85	KEEP	---	---	---	---	26	27	50	44	0.509433962264	capture	Missense_Mutation	SNP	36614899	36614899	RAG2	11	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	12900	13
PPME1	51400	broad.mit.edu	37	11	73964552	73964552	+	Silent	SNP	T	C	C			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:73964552T>C	uc001ouw.2	+	14	1257	c.1158T>C	c.(1156-1158)TGT>TGC	p.C386C	PPME1_uc009yty.2_Silent_p.C270C|PPME1_uc001oux.2_Silent_p.C199C|P4HA3_uc001ouy.3_Intron	NM_016147	NP_057231	Q9Y570	PPME1_HUMAN	protein phosphatase methylesterase 1	386					protein demethylation		carboxylesterase activity|protein C-terminal methylesterase activity|protein phosphatase 2A binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity				0	Breast(11;3.29e-05)					TTCCTGGCTGTTAGTGACCTG	0.498																0.38	65.216158	65.846686	19	31	KEEP	---	---	---	---	14	5	18	19	-1	capture	Silent	SNP	73964552	73964552	PPME1	11	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	12248	13
HMBS	3145	broad.mit.edu	37	11	118962836	118962836	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118962836T>G	uc001puz.1	+	10	771	c.614T>G	c.(613-615)ATC>AGC	p.I205S	HMBS_uc009zao.1_Missense_Mutation_p.I150S|HMBS_uc001pvc.1_Missense_Mutation_p.I150S|HMBS_uc009zap.1_Missense_Mutation_p.I188S|HMBS_uc001pva.1_Missense_Mutation_p.I205S|HMBS_uc001pvb.1_Intron|HMBS_uc001pvd.1_Missense_Mutation_p.I188S|HMBS_uc001pve.1_Missense_Mutation_p.I188S|HMBS_uc001pvf.1_Missense_Mutation_p.I188S	NM_000190	NP_000181	P08397	HEM3_HUMAN	hydroxymethylbilane synthase isoform 1	205					peptidyl-pyrromethane cofactor linkage	cytosol	hydroxymethylbilane synthase activity				0	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		CCTCCACAGATCCTGCACCCT	0.537												Porphyria_Acute_Intermittent				0.392857	77.741207	78.303048	22	34	KEEP	---	---	---	---	13	12	24	14	-1	capture	Missense_Mutation	SNP	118962836	118962836	HMBS	11	T	G	G	G	1	0	0	0	0	1	0	0	0	650	50	4	4	7144	13
ANO2	57101	broad.mit.edu	37	12	5963280	5963280	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5963280G>A	uc001qnm.2	-	4	622	c.550C>T	c.(550-552)CGG>TGG	p.R184W		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	188	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						GCGTGTATCCGGACAAAGATG	0.458																0.319549	257.374863	265.074868	85	181	KEEP	---	---	---	---	68	49	139	116	-1	capture	Missense_Mutation	SNP	5963280	5963280	ANO2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	691	13
LUM	4060	broad.mit.edu	37	12	91497971	91497971	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:91497971G>A	uc001tbm.2	-	3	1377	c.988C>T	c.(988-990)CGT>TGT	p.R330C	LUM_uc001tbn.2_RNA	NM_002345	NP_002336	P51884	LUM_HUMAN	lumican precursor	330					collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent			central_nervous_system(2)	2						TTAGCAACACGTAGACATTCA	0.383																0.357143	87.626755	89.136641	30	54	KEEP	---	---	---	---	23	13	36	23	-1	capture	Missense_Mutation	SNP	91497971	91497971	LUM	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9000	13
DAO	1610	broad.mit.edu	37	12	109288048	109288048	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109288048G>A	uc001tnr.3	+	7	670	c.517G>A	c.(517-519)GAA>AAA	p.E173K	DAO_uc001tnq.3_Missense_Mutation_p.E107K|DAO_uc009zvb.2_RNA|DAO_uc001tns.3_RNA	NM_001917	NP_001908	P14920	OXDA_HUMAN	D-amino-acid oxidase	173					glyoxylate metabolic process	peroxisomal matrix	binding|D-amino-acid oxidase activity			ovary(1)|skin(1)	2						GGTGGCAAGAGAAGGCGCAGA	0.582																0.351351	38.862736	39.584427	13	24	KEEP	---	---	---	---	5	8	10	16	-1	capture	Missense_Mutation	SNP	109288048	109288048	DAO	12	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	4190	13
PCDH9	5101	broad.mit.edu	37	13	67800099	67800099	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:67800099A>T	uc001vik.2	-	2	3166	c.2474T>A	c.(2473-2475)GTG>GAG	p.V825E	PCDH9_uc001vil.2_Missense_Mutation_p.V825E|PCDH9_uc010thl.1_Missense_Mutation_p.V825E|PCDH9_uc001vin.3_Missense_Mutation_p.V825E	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	825	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		AACAATGACCACCATGGCACC	0.517																0.392713	306.422509	308.910915	97	150	KEEP	---	---	---	---	63	39	90	67	-1	capture	Missense_Mutation	SNP	67800099	67800099	PCDH9	13	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	11421	13
OR4N5	390437	broad.mit.edu	37	14	20612258	20612258	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20612258C>T	uc010tla.1	+	1	364	c.364C>T	c.(364-366)CGC>TGC	p.R122C		NM_001004724	NP_001004724	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		GGCCTTTGACCGCTACATCGC	0.483																0.412903	405.137555	407.192165	128	182	KEEP	---	---	---	---	87	51	125	72	-1	capture	Missense_Mutation	SNP	20612258	20612258	OR4N5	14	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10983	13
CDCA4	55038	broad.mit.edu	37	14	105477589	105477589	+	Silent	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105477589G>A	uc001yqa.2	-	2	774	c.678C>T	c.(676-678)TCC>TCT	p.S226S	CDCA4_uc001yqb.2_Silent_p.S226S	NM_145701	NP_663747	Q9BXL8	CDCA4_HUMAN	cell division cycle associated 4	226						nucleus				ovary(1)	1		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.142)		CGCCCAGGTCGGACTTGCAGC	0.672																0.358974	40.23879	40.921904	14	25	KEEP	---	---	---	---	8	6	13	13	-1	capture	Silent	SNP	105477589	105477589	CDCA4	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3059	13
EIF2AK4	440275	broad.mit.edu	37	15	40282488	40282488	+	Silent	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40282488G>A	uc001zkm.1	+	16	2591	c.2541G>A	c.(2539-2541)CGG>CGA	p.R847R	EIF2AK4_uc010bbj.1_Silent_p.R548R|EIF2AK4_uc001zkn.1_5'Flank	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha	847	Protein kinase 2.				translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		TGATTCACCGGGATTTGAAGC	0.378					876											0.315315	203.467404	210.20453	70	152	KEEP	---	---	---	---	45	32	96	65	-1	capture	Silent	SNP	40282488	40282488	EIF2AK4	15	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	4954	13
NEDD4	4734	broad.mit.edu	37	15	56208834	56208834	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:56208834C>T	uc002adj.2	-	1	496	c.196G>A	c.(196-198)GTT>ATT	p.V66I	NEDD4_uc002adl.2_Intron|NEDD4_uc002adi.2_Missense_Mutation_p.V66I|NEDD4_uc010ugj.1_Missense_Mutation_p.V66I|NEDD4_uc010bfm.2_Missense_Mutation_p.V66I|NEDD4_uc002adk.2_RNA	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally	66					development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		TGAGACTGAACGTTTTCCTTT	0.408																0.357143	248.305861	252.585344	85	153	KEEP	---	---	---	---	60	32	86	79	-1	capture	Missense_Mutation	SNP	56208834	56208834	NEDD4	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10217	13
SCNN1G	6340	broad.mit.edu	37	16	23226531	23226531	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23226531G>A	uc002dlm.1	+	13	1830	c.1691G>A	c.(1690-1692)CGC>CAC	p.R564H		NM_001039	NP_001030	P51170	SCNNG_HUMAN	sodium channel, nonvoltage-gated 1, gamma	564	Cytoplasmic (By similarity).				excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	ATTGCCCGCCGCCAGTGGCAG	0.587																0.42623	156.866204	157.447512	52	70	KEEP	---	---	---	---	24	32	51	47	-1	capture	Missense_Mutation	SNP	23226531	23226531	SCNN1G	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13823	13
CHD9	80205	broad.mit.edu	37	16	53289572	53289572	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53289572A>G	uc002ehb.2	+	18	4254	c.4090A>G	c.(4090-4092)ATT>GTT	p.I1364V	CHD9_uc002egy.2_Missense_Mutation_p.I1364V|CHD9_uc002ehc.2_Missense_Mutation_p.I1364V|CHD9_uc002ehf.2_Missense_Mutation_p.I478V|CHD9_uc002ehd.2_Missense_Mutation_p.I890V	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1364					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				TTATGGTGCTATTATGGAGGA	0.348					1157											0.363636	211.069738	213.763329	60	105	KEEP	---	---	---	---	38	31	70	42	-1	capture	Missense_Mutation	SNP	53289572	53289572	CHD9	16	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	3298	13
CDH16	1014	broad.mit.edu	37	16	66946751	66946751	+	Silent	SNP	G	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:66946751G>T	uc002eql.2	-	10	1171	c.1098C>A	c.(1096-1098)CCC>CCA	p.P366P	CDH16_uc010cdy.2_Silent_p.P366P|CDH16_uc002eqm.2_Silent_p.P269P	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	366	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		TGGGGGAGCCGGGGGCATCTG	0.612																0.329114	75.082304	77.098442	26	53	KEEP	---	---	---	---	14	15	36	28	0.48275862069	capture	Silent	SNP	66946751	66946751	CDH16	16	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	3072	13
PLCG2	5336	broad.mit.edu	37	16	81968079	81968079	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81968079G>A	uc002fgt.2	+	26	2937	c.2785G>A	c.(2785-2787)GAG>AAG	p.E929K		NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	929					intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						CATCGCCATCGAGCTCTCTGA	0.478					1880											0.333333	29.039996	29.778017	10	20	KEEP	---	---	---	---	4	6	10	12	-1	capture	Missense_Mutation	SNP	81968079	81968079	PLCG2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11939	13
KRTAP4-11	653240	broad.mit.edu	37	17	39274416	39274416	+	Missense_Mutation	SNP	C	T	T	rs408579	by1000genomes	TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274416C>T	uc002hvz.2	-	1	191	c.152G>A	c.(151-153)AGG>AAG	p.R51K		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	51	6.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14).			keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCACTGGGGCCTGCAGCAGCT	0.672																0.054945	-12.742473	6.594877	5	86	KEEP	---	---	---	---	4	2	62	49	-1	capture	Missense_Mutation	SNP	39274416	39274416	KRTAP4-11	17	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	8469	13
HEXIM2	124790	broad.mit.edu	37	17	43246862	43246862	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:43246862C>T	uc002iih.1	+	4	786	c.547C>T	c.(547-549)CGA>TGA	p.R183*	HEXIM2_uc010daf.1_Nonsense_Mutation_p.R205*|HEXIM2_uc002iii.1_Nonsense_Mutation_p.R183*|HEXIM2_uc002iij.1_Nonsense_Mutation_p.R183*|uc002iik.1_RNA	NM_144608	NP_653209	Q96MH2	HEXI2_HUMAN	hexamthylene bis-acetamide inducible 2	183					negative regulation of cyclin-dependent protein kinase activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	cyclin-dependent protein kinase inhibitor activity|protein binding|snRNA binding				0						TGGGCGGGGCCGAGCGCACGG	0.647																0.34375	31.416367	32.105932	11	21	KEEP	---	---	---	---	9	3	13	10	-1	capture	Nonsense_Mutation	SNP	43246862	43246862	HEXIM2	17	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	7002	13
TEX2	55852	broad.mit.edu	37	17	62272375	62272375	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62272375C>A	uc002jec.2	-	3	1898	c.1725G>T	c.(1723-1725)GAG>GAT	p.E575D	TEX2_uc002jed.2_Missense_Mutation_p.E575D|TEX2_uc002jee.2_Missense_Mutation_p.E575D	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	testis expressed sequence 2	575					signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		AGGTTCCACCCTCAAGTCGAA	0.423																0.373984	133.614147	135.3313	46	77	KEEP	---	---	---	---	32	17	53	26	0.34693877551	capture	Missense_Mutation	SNP	62272375	62272375	TEX2	17	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	15666	13
MUC16	94025	broad.mit.edu	37	19	9085127	9085127	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9085127A>G	uc002mkp.2	-	1	6892	c.6688T>C	c.(6688-6690)TCC>CCC	p.S2230P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2230	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GCTACTGTGGACAAGCCAGGT	0.488																0.28972	100.298002	104.528144	31	76	KEEP	---	---	---	---	22	13	55	32	-1	capture	Missense_Mutation	SNP	9085127	9085127	MUC16	19	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	9883	13
OR7G2	390882	broad.mit.edu	37	19	9213088	9213088	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9213088A>T	uc010xkk.1	-	1	895	c.895T>A	c.(895-897)TAT>AAT	p.Y299N		NM_001005193	NP_001005193	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G,	278	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						AACACAGAATACATCACTGAA	0.453	Esophageal Squamous(67;143 1448 28637 40648)															0.222222	50.507614	58.223005	24	84	KEEP	---	---	---	---	17	14	36	53	-1	capture	Missense_Mutation	SNP	9213088	9213088	OR7G2	19	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	11127	13
PKN1	5585	broad.mit.edu	37	19	14574778	14574778	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14574778C>T	uc002myp.2	+	11	1802	c.1634C>T	c.(1633-1635)ACG>ATG	p.T545M	PKN1_uc002myq.2_Missense_Mutation_p.T551M	NM_002741	NP_002732	Q16512	PKN1_HUMAN	protein kinase N1 isoform 2	545					activation of JUN kinase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	endosome|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|GTP-Rho binding|histone binding|histone deacetylase binding|histone kinase activity (H3-T11 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|Rac GTPase binding			ovary(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8						GCCCGGACCACGGGGTAAGGA	0.672	NSCLC(185;2539 2965 10733 52867)				331											0.037383	-17.573638	7.205567	4	103	KEEP	---	---	---	---	1	3	61	50	-1	capture	Missense_Mutation	SNP	14574778	14574778	PKN1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11882	13
TMEM59L	25789	broad.mit.edu	37	19	18731283	18731283	+	Silent	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18731283G>A	uc002njy.3	+	8	1053	c.966G>A	c.(964-966)CCG>CCA	p.P322P		NM_012109	NP_036241	Q9UK28	TM59L_HUMAN	brain-specific membrane-anchored protein	322						Golgi membrane|integral to membrane|membrane fraction				ovary(2)|skin(2)	4						ACCCGCCGCCGTCCCACGCCT	0.642																0.326923	142.481405	146.621191	51	105	KEEP	---	---	---	---	17	45	67	67	-1	capture	Silent	SNP	18731283	18731283	TMEM59L	19	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	16069	13
ZNF135	7694	broad.mit.edu	37	19	58579144	58579144	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58579144T>G	uc010yhq.1	+	5	1424	c.1328T>G	c.(1327-1329)ATT>AGT	p.I443S	ZNF135_uc002qre.2_Missense_Mutation_p.I431S|ZNF135_uc002qrd.1_Intron|ZNF135_uc002qrf.2_Missense_Mutation_p.I389S|ZNF135_uc002qrg.2_Missense_Mutation_p.I401S|ZNF135_uc010yhr.1_Missense_Mutation_p.I252S	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN	zinc finger protein 135 isoform 2	443					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CATCGGAGGATTCACACAGGA	0.547																0.252101	88.596978	95.235891	30	89	KEEP	---	---	---	---	10	20	41	54	-1	capture	Missense_Mutation	SNP	58579144	58579144	ZNF135	19	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	17605	13
SRD5A2	6716	broad.mit.edu	37	2	31756490	31756490	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31756490T>C	uc002rnw.1	-	4	569	c.498A>G	c.(496-498)ATA>ATG	p.I166M		NM_000348	NP_000339	P31213	S5A2_HUMAN	3-oxo-5 alpha-steroid 4-dehydrogenase 2	166	Helical; (Potential).				androgen biosynthetic process|cell differentiation|cell-cell signaling|male gonad development	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|sterol 5-alpha reductase activity				0	Acute lymphoblastic leukemia(172;0.155)				Azelaic Acid(DB00548)|Dutasteride(DB01126)	GCTGGCGCAATATATAGTCAC	0.433																0.166667	5.542908	6.806389	2	10	KEEP	---	---	---	---	2	2	7	4	-1	capture	Missense_Mutation	SNP	31756490	31756490	SRD5A2	2	T	C	C	C	1	0	0	0	0	1	0	0	0	628	49	3	3	15031	13
TTN	7273	broad.mit.edu	37	2	179452825	179452825	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179452825C>A	uc010zfg.1	-	254	55829	c.55605G>T	c.(55603-55605)ATG>ATT	p.M18535I	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.M12230I|TTN_uc010zfi.1_Missense_Mutation_p.M12163I|TTN_uc010zfj.1_Missense_Mutation_p.M12038I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19462							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTTGGTCTCATTTCCACAA	0.453					8722											0.388889	82.281644	83.061117	28	44	KEEP	---	---	---	---	18	14	23	24	0.4375	capture	Missense_Mutation	SNP	179452825	179452825	TTN	2	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	16617	13
ABCG1	9619	broad.mit.edu	37	21	43708133	43708133	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43708133C>T	uc002zaq.2	+	9	1214	c.1108C>T	c.(1108-1110)CGG>TGG	p.R370W	ABCG1_uc002zan.2_Missense_Mutation_p.R372W|ABCG1_uc002zam.2_Missense_Mutation_p.R348W|ABCG1_uc002zao.2_Missense_Mutation_p.R367W|ABCG1_uc002zap.2_Missense_Mutation_p.R370W|ABCG1_uc002zar.2_Missense_Mutation_p.R381W|ABCG1_uc011aev.1_Missense_Mutation_p.R381W|ABCG1_uc010gpb.1_5'UTR	NM_004915	NP_004906	P45844	ABCG1_HUMAN	ATP-binding cassette sub-family G member 1	370	Cytoplasmic (Potential).				amyloid precursor protein catabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|detection of hormone stimulus|high-density lipoprotein particle remodeling|intracellular cholesterol transport|lipoprotein metabolic process|low-density lipoprotein particle remodeling|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|positive regulation of cholesterol biosynthetic process|regulation of cholesterol esterification|regulation of transcription, DNA-dependent|response to lipid|reverse cholesterol transport	endoplasmic reticulum membrane|external side of plasma membrane|Golgi membrane|recycling endosome	ADP binding|ATP binding|cholesterol transporter activity|glycoprotein transporter activity|phospholipid transporter activity|protein heterodimerization activity|protein homodimerization activity|sterol-transporting ATPase activity|toxin transporter activity			ovary(2)|central_nervous_system(1)	3					Adenosine triphosphate(DB00171)	TCTTTGGCACCGGCCCTCTGA	0.577																0.323144	220.381765	226.734531	74	155	KEEP	---	---	---	---	46	34	101	72	-1	capture	Missense_Mutation	SNP	43708133	43708133	ABCG1	21	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	68	13
KRTAP10-6	386674	broad.mit.edu	37	21	46011400	46011400	+	Silent	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46011400G>A	uc002zfm.2	-	1	987	c.966C>T	c.(964-966)TCC>TCT	p.S322S	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198688	NP_941961	P60371	KR106_HUMAN	keratin associated protein 10-6	322	29 X 5 AA repeats of C-C-X(3).					keratin filament					0						AGGCACCACAGGAGGGGACGG	0.692																0.04	-14.180212	8.619426	4	96	KEEP	---	---	---	---	2	3	52	55	-1	capture	Silent	SNP	46011400	46011400	KRTAP10-6	21	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	8433	13
SREBF2	6721	broad.mit.edu	37	22	42276831	42276831	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42276831C>T	uc003bbi.2	+	10	2042	c.1873C>T	c.(1873-1875)CGC>TGC	p.R625C	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|SREBF2_uc003bbj.2_RNA	NM_004599	NP_004590	Q12772	SRBP2_HUMAN	sterol regulatory element-binding transcription	625	Cytoplasmic (Potential).				cholesterol metabolic process	ER to Golgi transport vesicle membrane|Golgi membrane|nucleus|SREBP-SCAP-Insig complex	protein C-terminus binding			breast(2)|ovary(1)|central_nervous_system(1)	4						GAACGTGATCCGCTACAGCCT	0.647																0.333333	68.041034	69.719306	23	46	KEEP	---	---	---	---	23	15	35	32	-1	capture	Missense_Mutation	SNP	42276831	42276831	SREBF2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15034	13
CNTN4	152330	broad.mit.edu	37	3	3078881	3078881	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:3078881G>T	uc003bpc.2	+	17	2182	c.1961G>T	c.(1960-1962)GGG>GTG	p.G654V	CNTN4_uc003bpb.1_Missense_Mutation_p.G325V|CNTN4_uc003bpd.1_Missense_Mutation_p.G654V|CNTN4_uc003bpe.2_Missense_Mutation_p.G326V|CNTN4_uc003bpf.2_Missense_Mutation_p.G325V|CNTN4_uc003bpg.2_5'Flank	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	654	Fibronectin type-III 1.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		CTCATTGATGGGAAGACATTC	0.483																0.345865	256.210013	261.794262	92	174	KEEP	---	---	---	---	56	41	113	80	0.577319587629	capture	Missense_Mutation	SNP	3078881	3078881	CNTN4	3	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	3608	13
ABCC5	10057	broad.mit.edu	37	3	183665250	183665250	+	Silent	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183665250C>T	uc003fmg.2	-	23	3441	c.3276G>A	c.(3274-3276)ACG>ACA	p.T1092T	ABCC5_uc011bqt.1_Silent_p.T620T|ABCC5_uc010hxl.2_Silent_p.T1049T	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	1092	ABC transmembrane type-1 2.					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GCATCGCACACGTAAACAAAA	0.532																0.30303	28.539068	29.680907	10	23	KEEP	---	---	---	---	10	7	17	17	-1	capture	Silent	SNP	183665250	183665250	ABCC5	3	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	56	13
ADRA2C	152	broad.mit.edu	37	4	3768581	3768581	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:3768581G>A	uc003ghm.2	+	1	286	c.248G>A	c.(247-249)CGC>CAC	p.R83H	ADRA2C_uc010icx.2_Missense_Mutation_p.R83H	NM_000683	NP_000674	P18825	ADA2C_HUMAN	alpha-2C-adrenergic receptor	83	Cytoplasmic (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|energy reserve metabolic process|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation|regulation of insulin secretion	endosome|integral to plasma membrane	alpha-2A adrenergic receptor binding|alpha2-adrenergic receptor activity|epinephrine binding|protein heterodimerization activity|protein homodimerization activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)	CGGGCGCTGCGCGCGCCACAG	0.677	Esophageal Squamous(12;454 628 4517 14479)															0.3	16.543577	17.257545	6	14	KEEP	---	---	---	---	4	2	4	11	-1	capture	Missense_Mutation	SNP	3768581	3768581	ADRA2C	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	339	13
UGT2B28	54490	broad.mit.edu	37	4	70148376	70148376	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70148376C>A	uc003hej.2	+	2	868	c.866C>A	c.(865-867)CCT>CAT	p.P289H	UGT2B28_uc010ihr.2_Missense_Mutation_p.P289H	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	289					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	AAACCCCTACCTAAGGTAAAC	0.383																0.383673	282.085995	284.995275	94	151	KEEP	---	---	---	---	64	63	112	88	0.496062992126	capture	Missense_Mutation	SNP	70148376	70148376	UGT2B28	4	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	16842	13
FGB	2244	broad.mit.edu	37	4	155490927	155490927	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155490927C>T	uc003ioa.3	+	7	1259	c.1220C>T	c.(1219-1221)ACG>ATG	p.T407M	FGB_uc003iob.3_Intron|FGB_uc010ipv.2_Missense_Mutation_p.T345M|FGB_uc010ipw.2_Intron|FGB_uc003ioc.3_Missense_Mutation_p.T188M	NM_005141	NP_005132	P02675	FIBB_HUMAN	fibrinogen, beta chain preproprotein	407	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TTCTTCAGCACGTATGACAGA	0.423	NSCLC(106;1133 1613 21870 46110 52656)															0.380282	82.008787	82.901188	27	44	KEEP	---	---	---	---	19	13	26	34	-1	capture	Missense_Mutation	SNP	155490927	155490927	FGB	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5777	13
GRIA2	2891	broad.mit.edu	37	4	158234012	158234012	+	Silent	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:158234012C>T	uc003ipm.3	+	4	1110	c.651C>T	c.(649-651)AAC>AAT	p.N217N	GRIA2_uc011cit.1_Silent_p.N170N|GRIA2_uc003ipl.3_Silent_p.N217N|GRIA2_uc003ipk.3_Silent_p.N170N|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	217	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	p.N217N(1)		central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	ATAAAGTAAACGACATTGTAG	0.373																0.320988	153.74754	158.356379	52	110	KEEP	---	---	---	---	25	33	70	54	-1	capture	Silent	SNP	158234012	158234012	GRIA2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6701	13
RAPGEF2	9693	broad.mit.edu	37	4	160251077	160251077	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:160251077T>G	uc003iqg.3	+	6	1044	c.734T>G	c.(733-735)GTT>GGT	p.V245G		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	245	cNMP.				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		ATGCAAAAAGTTGAAGAGGAA	0.398					322											0.448276	182.09178	182.361372	52	64	KEEP	---	---	---	---	39	16	37	31	-1	capture	Missense_Mutation	SNP	160251077	160251077	RAPGEF2	4	T	G	G	G	1	0	0	0	0	1	0	0	0	780	60	4	4	12939	13
SORBS2	8470	broad.mit.edu	37	4	186545050	186545050	+	Silent	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:186545050G>A	uc003iyl.2	-	13	2379	c.1521C>T	c.(1519-1521)CCC>CCT	p.P507P	SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Silent_p.P607P|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Silent_p.P411P|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Silent_p.P621P|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2	507						actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		AGATGCGTGTGGGCACCATGT	0.572	Esophageal Squamous(153;41 2433 9491 36028)															0.407895	185.317542	186.445196	62	90	KEEP	---	---	---	---	35	29	64	37	-1	capture	Silent	SNP	186545050	186545050	SORBS2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	14820	13
DNAH5	1767	broad.mit.edu	37	5	13916467	13916467	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13916467A>G	uc003jfd.2	-	9	1229	c.1187T>C	c.(1186-1188)CTG>CCG	p.L396P	DNAH5_uc003jfe.1_RNA	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	396	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CTTTACAAACAGAGATGTGAT	0.323												Kartagener_syndrome				0.393258	104.308544	105.195278	35	54	KEEP	---	---	---	---	16	21	36	24	-1	capture	Missense_Mutation	SNP	13916467	13916467	DNAH5	5	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	4561	13
HEATR7B2	133558	broad.mit.edu	37	5	41049516	41049516	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41049516G>T	uc003jmj.3	-	14	1857	c.1367C>A	c.(1366-1368)ACT>AAT	p.T456N	HEATR7B2_uc003jmi.3_Missense_Mutation_p.T11N	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	456							binding	p.T456N(1)		ovary(6)|central_nervous_system(2)	8						TACCACAAAAGTCAGGATCCT	0.458																0.412698	80.537355	80.957075	26	37	KEEP	---	---	---	---	9	18	29	13	0.333333333333	capture	Missense_Mutation	SNP	41049516	41049516	HEATR7B2	5	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	6961	13
OR2Y1	134083	broad.mit.edu	37	5	180166818	180166818	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180166818G>A	uc003mmf.1	-	1	241	c.241C>T	c.(241-243)CTC>TTC	p.L81F		NM_001001657	NP_001001657	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y,	81	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTGATCAGGAGCTGGGGCACG	0.587																0.35443	83.673633	85.150713	28	51	KEEP	---	---	---	---	19	12	36	22	-1	capture	Missense_Mutation	SNP	180166818	180166818	OR2Y1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	10939	13
SNRNP48	154007	broad.mit.edu	37	6	7602909	7602909	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7602909G>T	uc003mxr.2	+	6	708	c.649G>T	c.(649-651)GAT>TAT	p.D217Y	SNRNP48_uc003mxs.2_RNA|SNRNP48_uc003mxt.1_5'UTR	NM_152551	NP_689764	Q6IEG0	SNR48_HUMAN	U11/U12 snRNP 48K	217					mRNA processing	cytoplasm|U12-type spliceosomal complex	metal ion binding				0						AGAAGTACGAGATTATAAAAG	0.308																0.376623	81.553652	82.583249	29	48	KEEP	---	---	---	---	14	20	27	29	0.411764705882	capture	Missense_Mutation	SNP	7602909	7602909	SNRNP48	6	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	14749	13
LGSN	51557	broad.mit.edu	37	6	63990671	63990671	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:63990671C>T	uc003peh.2	-	4	819	c.785G>A	c.(784-786)AGG>AAG	p.R262K	LGSN_uc003pei.2_Intron	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	262					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	CTGACCAGGCCTGGTAGAGGA	0.433																0.355263	86.405031	87.807352	27	49	KEEP	---	---	---	---	10	19	24	27	-1	capture	Missense_Mutation	SNP	63990671	63990671	LGSN	6	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	8679	13
C6orf97	80129	broad.mit.edu	37	6	151914390	151914390	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:151914390C>T	uc003qol.2	+	8	1531	c.1442C>T	c.(1441-1443)ACC>ATC	p.T481I		NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	hypothetical protein LOC80129	481	Potential.										0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)		GAGAACAAGACCATTGCCCAC	0.423					349											0.323077	59.057212	60.861033	21	44	KEEP	---	---	---	---	12	9	35	16	-1	capture	Missense_Mutation	SNP	151914390	151914390	C6orf97	6	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	2351	13
KLHL7	55975	broad.mit.edu	37	7	23163411	23163411	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:23163411G>A	uc003svs.3	+	2	429	c.136G>A	c.(136-138)GTG>ATG	p.V46M	KLHL7_uc003svr.3_Missense_Mutation_p.V24M|KLHL7_uc011jys.1_Intron|KLHL7_uc011jyt.1_Intron|KLHL7_uc003svt.2_Translation_Start_Site|KLHL7_uc003svp.2_Missense_Mutation_p.V24M|KLHL7_uc003svq.2_Missense_Mutation_p.V46M|KLHL7_uc011jyu.1_Missense_Mutation_p.V24M	NM_001031710	NP_001026880	Q8IXQ5	KLHL7_HUMAN	kelch-like 7 isoform 1	46	BTB.					Golgi apparatus|nucleolus|plasma membrane					0						GTTGTGTGACGTGATCCTCAT	0.373																0.321839	82.474486	84.924244	28	59	KEEP	---	---	---	---	27	9	44	24	-1	capture	Missense_Mutation	SNP	23163411	23163411	KLHL7	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8314	13
MRPL32	64983	broad.mit.edu	37	7	42977165	42977165	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:42977165C>T	uc003tia.2	+	3	604	c.557C>T	c.(556-558)ACC>ATC	p.T186I	MRPL32_uc003tib.2_RNA|MRPL32_uc003tic.2_Missense_Mutation_p.T133I	NM_031903	NP_114109	Q9BYC8	RM32_HUMAN	mitochondrial ribosomal protein L32 precursor	186					translation	large ribosomal subunit|mitochondrial ribosome	structural constituent of ribosome				0						TCCTGGTTCACCCAGAATTGA	0.418																0.291667	57.652049	60.447449	21	51	KEEP	---	---	---	---	13	12	24	30	-1	capture	Missense_Mutation	SNP	42977165	42977165	MRPL32	7	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	9705	13
WBSCR17	64409	broad.mit.edu	37	7	70886068	70886068	+	Silent	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:70886068C>T	uc003tvy.2	+	5	939	c.939C>T	c.(937-939)GCC>GCT	p.A313A	WBSCR17_uc003tvz.2_Silent_p.A12A	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	313	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GGTGGGACGCCGGAGACCCTT	0.597																0.322034	107.040344	110.342838	38	80	KEEP	---	---	---	---	20	19	47	37	-1	capture	Silent	SNP	70886068	70886068	WBSCR17	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17145	13
GRM3	2913	broad.mit.edu	37	7	86468552	86468552	+	Silent	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86468552C>T	uc003uid.2	+	4	2821	c.1722C>T	c.(1720-1722)GAC>GAT	p.D574D	GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Silent_p.D446D|GRM3_uc010leh.2_Silent_p.D166D	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	574	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	GGTGGGAAGACGCCTGGGCCA	0.498	GBM(52;969 1098 3139 52280)															0.349794	244.478637	249.281063	85	158	KEEP	---	---	---	---	56	36	93	68	-1	capture	Silent	SNP	86468552	86468552	GRM3	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6731	13
COL1A2	1278	broad.mit.edu	37	7	94054953	94054953	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94054953G>A	uc003ung.1	+	43	3284	c.2813G>A	c.(2812-2814)CGC>CAC	p.R938H	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	938					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging	p.R938H(1)	COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CCCCCAGGTCGCGATGGTCAA	0.488													HNSCC(75;0.22)			0.23741	82.705199	91.462575	33	106	KEEP	---	---	---	---	25	15	61	66	-1	capture	Missense_Mutation	SNP	94054953	94054953	COL1A2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3643	13
FZD6	8323	broad.mit.edu	37	8	104342147	104342147	+	Silent	SNP	G	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104342147G>A	uc003ylh.2	+	6	2090	c.1806G>A	c.(1804-1806)GCG>GCA	p.A602A	FZD6_uc003ylj.2_Silent_p.A602A|FZD6_uc011lhn.1_Silent_p.A568A|FZD6_uc011lho.1_Silent_p.A297A|FZD6_uc011lhp.1_Silent_p.A547A	NM_003506	NP_003497	O60353	FZD6_HUMAN	frizzled 6 isoform a precursor	602	Cytoplasmic (Potential).				angiogenesis|axonogenesis|cell proliferation in midbrain|establishment of planar polarity|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|neural tube closure|non-canonical Wnt receptor signaling pathway	apical part of cell|apicolateral plasma membrane|cytoplasm|integral to plasma membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			AGGTGAAAGCGGACGGAGCTA	0.512																0.044776	-8.332815	6.514515	3	64	KEEP	---	---	---	---	3	0	33	35	-1	capture	Silent	SNP	104342147	104342147	FZD6	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6076	13
EPPK1	83481	broad.mit.edu	37	8	144940328	144940328	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144940328C>T	uc003zaa.1	-	2	15117	c.15104G>A	c.(15103-15105)CGC>CAC	p.R5035H		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	5035	Plectin 64.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GAAGTAGCCGCGCCGGTAGGC	0.692																0.056075	-42.01367	46.690514	24	404	KEEP	---	---	---	---	21	16	316	221	-1	capture	Missense_Mutation	SNP	144940328	144940328	EPPK1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5145	13
TEK	7010	broad.mit.edu	37	9	27158007	27158007	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:27158007T>A	uc003zqi.3	+	2	673	c.231T>A	c.(229-231)GAT>GAA	p.D77E	TEK_uc010mjc.1_Intron|TEK_uc011lnn.1_Missense_Mutation_p.D77E|TEK_uc011lno.1_Missense_Mutation_p.D77E|TEK_uc011lnp.1_Intron|TEK_uc003zqj.1_Missense_Mutation_p.D54E	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor	77	Extracellular (Potential).|Ig-like C2-type 1.				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity	p.D77E(1)		ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		TTACTCAAGATGTGACCAGAG	0.493					493											0.408602	123.340127	124.016356	38	55	KEEP	---	---	---	---	24	15	27	29	-1	capture	Missense_Mutation	SNP	27158007	27158007	TEK	9	T	A	A	A	1	0	0	0	0	1	0	0	0	660	51	4	4	15636	13
TGFBR1	7046	broad.mit.edu	37	9	101908855	101908855	+	Missense_Mutation	SNP	G	A	A	rs146549837		TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101908855G>A	uc004azc.2	+	7	1295	c.1219G>A	c.(1219-1221)GTA>ATA	p.V407I	TGFBR1_uc004azd.2_Missense_Mutation_p.V330I|TGFBR1_uc011lvc.1_Missense_Mutation_p.V338I	NM_004612	NP_004603	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor I	407	Protein kinase.|Cytoplasmic (Potential).				activation of MAPKK activity|anterior/posterior pattern formation|artery morphogenesis|collagen fibril organization|embryonic cranial skeleton morphogenesis|germ cell migration|heart development|kidney development|neuron fate commitment|palate development|parathyroid gland development|pathway-restricted SMAD protein phosphorylation|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|pharyngeal system development|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of cellular component movement|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of SMAD protein import into nucleus|positive regulation of survival gene product expression|positive regulation of transcription, DNA-dependent|response to cholesterol|thymus development|transforming growth factor beta receptor signaling pathway		ATP binding|I-SMAD binding|metal ion binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type I|type II transforming growth factor beta receptor binding			lung(2)|ovary(1)	3		Acute lymphoblastic leukemia(62;0.0559)				AATGGGCTTAGTATTCTGGGA	0.398					168											0.40874	500.446755	503.279305	159	230	KEEP	---	---	---	---	111	72	142	114	-1	capture	Missense_Mutation	SNP	101908855	101908855	TGFBR1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	15706	13
ORM2	5005	broad.mit.edu	37	9	117092750	117092750	+	Silent	SNP	C	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117092750C>A	uc004bil.2	+	2	267	c.151C>A	c.(151-153)CGA>AGA	p.R51R	ORM1_uc011lxo.1_Intron	NM_000608	NP_000599	P19652	A1AG2_HUMAN	orosomucoid 2 precursor	51					acute-phase response|regulation of immune system process|transport	extracellular space	binding				0		Myeloproliferative disorder(63;0.163)				ATCGGCCTTTCGAAACGAGGA	0.438	NSCLC(65;867 1308 1814 2391 12508)															0.540541	66.20242	66.255249	20	17	KEEP	---	---	---	---	15	11	18	15	0.423076923077	capture	Silent	SNP	117092750	117092750	ORM2	9	C	A	A	A	1	0	0	0	0	0	0	0	1	399	31	4	4	11172	13
LPAR3	23566	broad.mit.edu	37	1	85331129	85331142	+	Frame_Shift_Del	DEL	ACTTGTATGCGGAG	-	-	rs140283678;rs149462985		TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85331129_85331142delACTTGTATGCGGAG	uc001dkl.2	-	1	701_714	c.662_675delCTCCGCATACAAGT	c.(661-675)TCTCCGCATACAAGTfs	p.S221fs	LPAR3_uc009wcj.1_Frame_Shift_Del_p.S221fs	NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	221_225	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				lung(3)|ovary(2)	5						TGATGGACCCACTTGTATGCGGAGACAAGACGTT	0.500																0.24			11	35		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	85331129	85331142	LPAR3	1	ACTTGTATGCGGAG	-	-	-	1	0	1	0	1	0	0	0	0	76	6	5	5	8822	13
RYR3	6263	broad.mit.edu	37	15	34130001	34130002	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34130001_34130002insA	uc001zhi.2	+	89	11890_11891	c.11820_11821insA	c.(11818-11823)TCCAAAfs	p.S3940fs	RYR3_uc010bar.2_Frame_Shift_Ins_p.S3935fs	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3940_3941	EF-hand.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GAATTATCTCCAAAAAAGAATT	0.391																0.32			26	56		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	34130001	34130002	RYR3	15	-	A	A	A	1	0	1	1	0	0	0	0	0	262	21	5	5	13662	13
ZNF563	147837	broad.mit.edu	37	19	12430217	12430217	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12430217delA	uc002mtp.2	-	4	860	c.622delT	c.(622-624)TGGfs	p.W208fs	ZNF563_uc002mtq.2_Intron	NM_145276	NP_660319	Q8TA94	ZN563_HUMAN	zinc finger protein 563	208	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAACTGGGCCAAAAAAAAGCT	0.393	GBM(39;623 795 5132 29510 31476)															0.02			7	329		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	12430217	12430217	ZNF563	19	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	17873	13
C8orf76	84933	broad.mit.edu	37	8	124243741	124243743	+	In_Frame_Del	DEL	AAG	-	-			TCGA-06-0126-01	TCGA-06-0126-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124243741_124243743delAAG	uc003yqc.1	-	4	643_645	c.612_614delCTT	c.(610-615)TTCTTT>TTT	p.204_205FF>F	C8orf76_uc003yqd.2_In_Frame_Del_p.172_173FF>F	NM_032847	NP_116236	Q96K31	CH076_HUMAN	hypothetical protein LOC84933	204_205							binding			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			TGAGTGTGGAAAGAAGGATTTGA	0.433																0.44			89	115		---	---	---	---						capture_indel	In_Frame_Del	DEL	124243741	124243743	C8orf76	8	AAG	-	-	-	1	0	1	0	1	0	0	0	0	13	1	5	5	2414	13
