Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SLC45A1	50651	broad.mit.edu	37	1	8403928	8403928	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:8403928C>T	uc001apb.2	+	8	2102	c.2102C>T	c.(2101-2103)GCC>GTC	p.A701V	SLC45A1_uc001apc.2_Missense_Mutation_p.A399V	NM_001080397	NP_001073866	Q9Y2W3	S45A1_HUMAN	DNB5	701	Helical; (Potential).				carbohydrate transport	integral to membrane	symporter activity	p.A701V(1)		central_nervous_system(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CTGACCTCGGCCGTGGGCAGT	0.617																0.166667	27.943847	38.062049	16	80	KEEP	---	---	---	---	5	12	54	43	-1	capture	Missense_Mutation	SNP	8403928	8403928	SLC45A1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14532	14
ZNF644	84146	broad.mit.edu	37	1	91405171	91405171	+	Silent	SNP	G	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91405171G>C	uc001dnw.2	-	3	1882	c.1740C>G	c.(1738-1740)TCC>TCG	p.S580S	ZNF644_uc001dnv.2_Intron|ZNF644_uc001dnx.2_Intron|ZNF644_uc001dny.1_Silent_p.S580S	NM_201269	NP_958357	Q9H582	ZN644_HUMAN	zinc finger protein 644 isoform 1	580					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		CTGATTTTTTGGATGATCCTA	0.383																0.376068	412.304385	417.040254	132	219	KEEP	---	---	---	---	62	89	152	104	-1	capture	Silent	SNP	91405171	91405171	ZNF644	1	G	C	C	C	1	0	0	0	0	0	0	0	1	600	47	4	4	17938	14
ANKRD35	148741	broad.mit.edu	37	1	145558859	145558859	+	Missense_Mutation	SNP	G	A	A	rs150752253	byFrequency	TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145558859G>A	uc001eob.1	+	7	586	c.478G>A	c.(478-480)GCA>ACA	p.A160T	NBPF10_uc001emp.3_Intron|ANKRD35_uc010oyx.1_Missense_Mutation_p.A3T	NM_144698	NP_653299	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	160	ANK 4.									ovary(4)|skin(1)	5	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCTGATGATCGCATCGCTGGG	0.577	Melanoma(9;127 754 22988 51047)															0.413793	318.954101	320.646263	108	153	KEEP	---	---	---	---	65	62	87	86	-1	capture	Missense_Mutation	SNP	145558859	145558859	ANKRD35	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	660	14
SLC45A3	85414	broad.mit.edu	37	1	205632669	205632669	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205632669G>A	uc001hda.1	-	3	589	c.250C>T	c.(250-252)CGC>TGC	p.R84C	SLC45A3_uc010prn.1_5'Flank|SLC45A3_uc010pro.1_5'UTR|SLC45A3_uc010prp.1_Intron|ELK4_uc010prq.1_Intron	NM_033102	NP_149093	Q96JT2	S45A3_HUMAN	prostein	84					transmembrane transport	integral to membrane			SLC45A3/BRAF(2)	ovary(2)|prostate(2)	4	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			GGCCGGCGGCGGCCATAGCGT	0.637					123	T	ETV1|ETV5|ELK4|ERG	prostate 								0.369565	46.062802	46.750517	17	29	KEEP	---	---	---	---	17	14	18	27	-1	capture	Missense_Mutation	SNP	205632669	205632669	SLC45A3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14534	14
FAM177B	400823	broad.mit.edu	37	1	222919976	222919976	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:222919976A>G	uc001hnt.2	+	3	355	c.89A>G	c.(88-90)GAC>GGC	p.D30G	uc001hnr.1_Intron|FAM177B_uc009xeb.2_RNA	NM_207468	NP_997351	A6PVY3	F177B_HUMAN	hypothetical protein LOC400823	30										ovary(1)	1						CATTTTGTTGACGGAGACATC	0.323																0.029126	-18.066343	7.042895	3	100	KEEP	---	---	---	---	3	0	65	44	-1	capture	Missense_Mutation	SNP	222919976	222919976	FAM177B	1	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	5455	14
EXO1	9156	broad.mit.edu	37	1	242048792	242048792	+	Silent	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:242048792A>G	uc001hzh.2	+	15	2928	c.2388A>G	c.(2386-2388)AAA>AAG	p.K796K	EXO1_uc001hzi.2_Silent_p.K796K|EXO1_uc001hzj.2_Silent_p.K796K|EXO1_uc009xgq.2_Silent_p.K795K	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	796	Interaction with MLH1.|Interaction with MSH2.				meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			AGCTCTGGAAAAACTTTGGAT	0.418											Direct_reversal_of_damage|Editing_and_processing_nucleases					0.430894	192.161624	192.672964	53	70	KEEP	---	---	---	---	28	29	38	38	-1	capture	Silent	SNP	242048792	242048792	EXO1	1	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	5255	14
RRP8	23378	broad.mit.edu	37	11	6622635	6622635	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6622635C>G	uc001med.2	-	3	740	c.661G>C	c.(661-663)GAG>CAG	p.E221Q	ILK_uc001mee.2_5'Flank|ILK_uc001mef.2_5'Flank|ILK_uc010rap.1_5'Flank|ILK_uc010raq.1_5'Flank|ILK_uc001meg.2_5'Flank|ILK_uc001meh.2_5'Flank	NM_015324	NP_056139	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase,	221					chromatin modification|chromatin silencing at rDNA|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	methylated histone residue binding|S-adenosylmethionine-dependent methyltransferase activity				0						GGAGACACCTCTGTCTTCTCT	0.607																0.2	22.29284	25.628749	8	32	KEEP	---	---	---	---	3	5	20	16	-1	capture	Missense_Mutation	SNP	6622635	6622635	RRP8	11	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	13582	14
OR8J3	81168	broad.mit.edu	37	11	55904564	55904564	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55904564T>C	uc010riz.1	-	1	631	c.631A>G	c.(631-633)ATG>GTG	p.M211V		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	211	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					ACTGTAATCATGGAAAAAACC	0.358																0.031447	-27.766506	10.446324	5	154	KEEP	---	---	---	---	2	3	85	79	-1	capture	Missense_Mutation	SNP	55904564	55904564	OR8J3	11	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	11146	14
MS4A14	84689	broad.mit.edu	37	11	60164186	60164186	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60164186G>T	uc001npj.2	+	1	700	c.135G>T	c.(133-135)TTG>TTT	p.L45F	MS4A14_uc001npi.2_Intron|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Missense_Mutation_p.L45F|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	45						integral to membrane	receptor activity			breast(1)	1						CAAGAGTCTTGGGGGTAAGTC	0.423																0.396226	66.864262	67.3637	21	32	KEEP	---	---	---	---	14	10	13	19	0.583333333333	capture	Missense_Mutation	SNP	60164186	60164186	MS4A14	11	G	T	T	T	1	0	0	0	0	1	0	0	0	607	47	4	4	9768	14
TPCN2	219931	broad.mit.edu	37	11	68822263	68822263	+	Silent	SNP	A	G	G	rs142314553		TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:68822263A>G	uc001oos.2	+	3	365	c.249A>G	c.(247-249)CAA>CAG	p.Q83Q	TPCN2_uc009ysk.1_RNA|TPCN2_uc001oor.2_Intron|TPCN2_uc010rqg.1_Silent_p.Q83Q	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	83	Cytoplasmic (Potential).				cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ACGTATGCCAACGGTGAGAAC	0.602																0.240741	37.850106	41.160106	13	41	KEEP	---	---	---	---	7	8	24	22	-1	capture	Silent	SNP	68822263	68822263	TPCN2	11	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	16279	14
MFRP	83552	broad.mit.edu	37	11	119212361	119212361	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119212361T>G	uc001pwj.2	-	13	1797	c.1637A>C	c.(1636-1638)GAG>GCG	p.E546A	MFRP_uc010rzf.1_RNA|MFRP_uc010rzg.1_Missense_Mutation_p.E428A	NM_031433	NP_113621	Q9BXJ0	C1QT5_HUMAN	membrane frizzled-related protein	Error:Variant_position_missing_in_Q9BXJ0_after_alignment						collagen					0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		GCACTGGTGCTCCGCTTCCTG	0.647																0.259259	59.036448	63.289266	21	60	KEEP	---	---	---	---	11	10	34	30	-1	capture	Missense_Mutation	SNP	119212361	119212361	MFRP	11	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	9438	14
OR10S1	219873	broad.mit.edu	37	11	123847740	123847740	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123847740A>G	uc001pzm.1	-	1	659	c.659T>C	c.(658-660)GTG>GCG	p.V220A		NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S,	220	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GCCTGCAGCCACGATGCCAAT	0.562																0.036585	-12.342282	6.746039	3	79	KEEP	---	---	---	---	2	3	62	54	-1	capture	Missense_Mutation	SNP	123847740	123847740	OR10S1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	10822	14
APLP2	334	broad.mit.edu	37	11	129999095	129999095	+	Silent	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:129999095G>A	uc010sby.1	+	10	1606	c.1449G>A	c.(1447-1449)CCG>CCA	p.P483P	APLP2_uc001qfp.2_Silent_p.P483P|APLP2_uc001qfq.2_Silent_p.P427P|APLP2_uc010sbz.1_Silent_p.P271P|APLP2_uc001qfr.2_Silent_p.P249P|APLP2_uc001qfs.2_Silent_p.P254P|APLP2_uc001qfv.2_Silent_p.P374P	NM_001642	NP_001633	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	483	Extracellular (Potential).				G-protein coupled receptor protein signaling pathway	integral to membrane|nucleus|plasma membrane	DNA binding|identical protein binding|serine-type endopeptidase inhibitor activity			ovary(3)	3	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		AGTCTGACCCGCCACGGGTGA	0.572																0.028571	-26.889002	7.330481	4	136	KEEP	---	---	---	---	0	4	114	141	-1	capture	Silent	SNP	129999095	129999095	APLP2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	772	14
ATN1	1822	broad.mit.edu	37	12	7045674	7045674	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7045674C>T	uc001qrw.1	+	5	1481	c.1244C>T	c.(1243-1245)CCA>CTA	p.P415L	ATN1_uc001qrx.1_Missense_Mutation_p.P415L|ATN1_uc001qry.1_Missense_Mutation_p.P414L	NM_001007026	NP_001007027	P54259	ATN1_HUMAN	atrophin-1	415					cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						TTCCCTCCCCCAACAAGCCTC	0.468																0.027273	-20.626652	6.458264	3	107	KEEP	---	---	---	---	3	0	37	79	-1	capture	Missense_Mutation	SNP	7045674	7045674	ATN1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	1102	14
PDE3A	5139	broad.mit.edu	37	12	20790147	20790147	+	Silent	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:20790147A>G	uc001reh.1	+	9	2137	c.2115A>G	c.(2113-2115)AGA>AGG	p.R705R		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	705					lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	ATATAGGAAGAAAATGTGGCC	0.343																0.371795	98.757701	99.88301	29	49	KEEP	---	---	---	---	14	20	30	26	-1	capture	Silent	SNP	20790147	20790147	PDE3A	12	A	G	G	G	1	0	0	0	0	0	0	0	1	115	9	3	3	11540	14
SACS	26278	broad.mit.edu	37	13	23912431	23912431	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:23912431T>C	uc001uon.2	-	10	6173	c.5584A>G	c.(5584-5586)ACA>GCA	p.T1862A	SACS_uc001uoo.2_Missense_Mutation_p.T1715A|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1862					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GGTTTCACTGTCCACTTCTGG	0.453					738											0.370968	161.125302	162.936592	46	78	KEEP	---	---	---	---	23	28	40	44	-1	capture	Missense_Mutation	SNP	23912431	23912431	SACS	13	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	13696	14
PAN3	255967	broad.mit.edu	37	13	28851372	28851372	+	Splice_Site	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28851372A>G	uc001urz.2	+	14	1620	c.1612_splice	c.e14-2	p.Q538_splice	PAN3_uc001ury.2_Splice_Site_p.Q372_splice|PAN3_uc001urx.2_Splice_Site_p.Q484_splice	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		CTTTCATGTCAGCAAGCAGAT	0.343																0.144578	20.042301	30.136126	12	71	KEEP	---	---	---	---	9	4	48	26	-1	capture	Splice_Site	SNP	28851372	28851372	PAN3	13	A	G	G	G	1	0	0	0	0	0	0	1	0	91	7	5	3	11319	14
G2E3	55632	broad.mit.edu	37	14	31081472	31081472	+	Nonsense_Mutation	SNP	C	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:31081472C>G	uc001wqk.2	+	13	1714	c.1560C>G	c.(1558-1560)TAC>TAG	p.Y520*	G2E3_uc010tpf.1_Nonsense_Mutation_p.Y474*|G2E3_uc001wql.1_Nonsense_Mutation_p.Y32*	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase	520	HECT.				apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						GCTATAACTACCTTGAGTTAA	0.318																0.144928	65.320364	90.419347	30	177	KEEP	---	---	---	---	22	11	101	91	-1	capture	Nonsense_Mutation	SNP	31081472	31081472	G2E3	14	C	G	G	G	1	0	0	0	0	0	1	0	0	233	18	5	4	6082	14
WDHD1	11169	broad.mit.edu	37	14	55451511	55451511	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:55451511T>G	uc001xbm.1	-	15	1914	c.1836A>C	c.(1834-1836)CAA>CAC	p.Q612H	WDHD1_uc010aom.1_Missense_Mutation_p.Q129H|WDHD1_uc001xbn.1_Missense_Mutation_p.Q489H	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	612				Q -> K (in Ref. 2; AAH43349/AAH00622).		cytoplasm|nucleoplasm	DNA binding			skin(1)	1						CATGCAAAATTTGTTTTTTCT	0.378					606											0.616162	226.598917	227.770516	61	38	KEEP	---	---	---	---	24	43	25	16	-1	capture	Missense_Mutation	SNP	55451511	55451511	WDHD1	14	T	G	G	G	1	0	0	0	0	1	0	0	0	829	64	4	4	17152	14
TCF12	6938	broad.mit.edu	37	15	57555309	57555309	+	Splice_Site	SNP	G	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:57555309G>C	uc002aec.2	+	17	1795	c.1511_splice	c.e17-1	p.G504_splice	TCF12_uc010ugm.1_Splice_Site_p.G556_splice|TCF12_uc010ugn.1_Splice_Site_p.G524_splice|TCF12_uc002aea.2_Splice_Site_p.G528_splice|TCF12_uc010bfs.2_Intron|TCF12_uc002aeb.2_Splice_Site_p.G528_splice|TCF12_uc002aed.2_Splice_Site_p.G504_splice|TCF12_uc002aee.2_Splice_Site_p.G334_splice|TCF12_uc010bft.2_Splice_Site_p.G358_splice|TCF12_uc010ugo.1_Splice_Site_p.G268_splice|TCF12_uc010ugp.1_Splice_Site_p.G162_splice|TCF12_uc010ugq.1_Splice_Site_p.G138_splice|TCF12_uc010ugr.1_Splice_Site_p.G117_splice	NM_207038	NP_996921	Q99081	HTF4_HUMAN	transcription factor 12 isoform b						immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	p.?(1)		central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		CTCTTTGTTAGGTGGCTTGCA	0.358					335	T	TEC	extraskeletal myxoid chondrosarcoma								0.377358	65.486682	66.186518	20	33	KEEP	---	---	---	---	9	13	18	21	-1	capture	Splice_Site	SNP	57555309	57555309	TCF12	15	G	C	C	C	1	0	0	0	0	0	0	1	0	455	35	6	4	15573	14
TARSL2	123283	broad.mit.edu	37	15	102241320	102241320	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:102241320A>G	uc002bxm.2	-	10	1344	c.1289T>C	c.(1288-1290)TTC>TCC	p.F430S	TARSL2_uc002bxl.2_5'UTR|TARSL2_uc010usi.1_RNA	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	430					threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity			ovary(2)	2	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ATTATAAATGAAGGCTCCTCT	0.303																0.035714	-16.000049	10.216068	4	108	KEEP	---	---	---	---	3	4	70	61	-1	capture	Missense_Mutation	SNP	102241320	102241320	TARSL2	15	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	15449	14
SSTR5	6755	broad.mit.edu	37	16	1129388	1129388	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1129388C>A	uc002ckq.2	+	1	608	c.520C>A	c.(520-522)CTC>ATC	p.L174I	LOC146336_uc002cko.2_5'Flank|LOC146336_uc002ckp.1_5'Flank	NM_001053	NP_001044	P35346	SSR5_HUMAN	somatostatin receptor 5	174	Helical; Name=4; (Potential).				negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			lung(1)	1		Hepatocellular(780;0.00369)			Octreotide(DB00104)	GTCGCTGCCGCTCCTGGTGTT	0.721																0.571429	37.501844	37.595121	12	9	KEEP	---	---	---	---	7	6	10	2	0.461538461538	capture	Missense_Mutation	SNP	1129388	1129388	SSTR5	16	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	15093	14
C16orf91	283951	broad.mit.edu	37	16	1470457	1470457	+	Silent	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1470457C>T	uc002clr.2	-	2	210	c.189G>A	c.(187-189)TCG>TCA	p.S63S	C16orf91_uc010uvd.1_Silent_p.S220S	NM_001010878	NP_001010878	Q4G0I0	CSMT1_HUMAN	hypothetical protein LOC283951	63	Extracellular (Potential).					integral to membrane					0						TATGGCCCACCGACCAGCGGT	0.652																0.152542	35.479551	49.10613	18	100	KEEP	---	---	---	---	8	11	41	76	-1	capture	Silent	SNP	1470457	1470457	C16orf91	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	1829	14
PDILT	204474	broad.mit.edu	37	16	20370764	20370764	+	Silent	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20370764G>A	uc002dhc.1	-	12	1855	c.1632C>T	c.(1630-1632)TAC>TAT	p.Y544Y		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	544					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						GCTTGGATACGTACTTGGTCA	0.512																0.357513	390.486905	397.411708	138	248	KEEP	---	---	---	---	86	90	140	136	-1	capture	Silent	SNP	20370764	20370764	PDILT	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11577	14
ARMC5	79798	broad.mit.edu	37	16	31470871	31470871	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31470871C>A	uc002ecc.2	+	1	555	c.26C>A	c.(25-27)ACG>AAG	p.T9K	ARMC5_uc010vfn.1_Missense_Mutation_p.T104K|ARMC5_uc010vfo.1_Missense_Mutation_p.T41K|ARMC5_uc002eca.3_Missense_Mutation_p.T9K|ARMC5_uc010vfp.1_Missense_Mutation_p.T9K|ARMC5_uc002ecb.2_Missense_Mutation_p.T9K	NM_001105247	NP_001098717	Q96C12	ARMC5_HUMAN	armadillo repeat containing 5 isoform a	9							binding			pancreas(1)	1						CCAACCCTCACGGACTCGCTC	0.687																0.545455	19.196704	19.225131	6	5	KEEP	---	---	---	---	2	4	4	5	0.666666666667	capture	Missense_Mutation	SNP	31470871	31470871	ARMC5	16	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	947	14
SPNS3	201305	broad.mit.edu	37	17	4337372	4337372	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:4337372G>A	uc002fxt.2	+	1	154	c.110G>A	c.(109-111)TGG>TAG	p.W37*	SPNS3_uc002fxu.2_5'UTR	NM_182538	NP_872344	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3	37					lipid transport|transmembrane transport	integral to membrane				large_intestine(1)	1						CCCACCTCCTGGAGCCTGCCC	0.657																0.408333	137.35618	138.235564	49	71	KEEP	---	---	---	---	23	30	36	45	-1	capture	Nonsense_Mutation	SNP	4337372	4337372	SPNS3	17	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	14968	14
KRTAP4-11	653240	broad.mit.edu	37	17	39274424	39274424	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274424G>C	uc002hvz.2	-	1	183	c.144C>G	c.(142-144)AGC>AGG	p.S48R		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	48	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].|5.		Missing (in allele KAP4.14).			keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCCTGCAGCAGCTGGACACAC	0.672																0.073529	-2.381745	10.3503	5	63	KEEP	---	---	---	---	4	4	42	31	-1	capture	Missense_Mutation	SNP	39274424	39274424	KRTAP4-11	17	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	8469	14
EVPL	2125	broad.mit.edu	37	17	74004095	74004095	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74004095G>A	uc002jqi.2	-	22	5419	c.5191C>T	c.(5191-5193)CCC>TCC	p.P1731S	EVPL_uc010wss.1_Missense_Mutation_p.P1753S|EVPL_uc010wst.1_Missense_Mutation_p.P1201S	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	1731	Globular 2.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						TCCCCACAGGGCCCCGAGGTG	0.642																0.486111	107.855759	107.866067	35	37	KEEP	---	---	---	---	19	18	17	25	-1	capture	Missense_Mutation	SNP	74004095	74004095	EVPL	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5247	14
WDR7	23335	broad.mit.edu	37	18	54694330	54694330	+	Silent	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:54694330G>A	uc002lgk.1	+	28	4576	c.4365G>A	c.(4363-4365)GCG>GCA	p.A1455A	WDR7_uc002lgl.1_Silent_p.A1422A	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	1455										ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		TGCAGCCCGCGTCCCCCGGCT	0.617																0.050505	-11.801567	9.396757	5	94	KEEP	---	---	---	---	4	1	45	53	-1	capture	Silent	SNP	54694330	54694330	WDR7	18	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	17201	14
ZNF407	55628	broad.mit.edu	37	18	72345426	72345426	+	Silent	SNP	G	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:72345426G>C	uc002llw.2	+	1	2508	c.2451G>C	c.(2449-2451)GCG>GCC	p.A817A	ZNF407_uc010xfc.1_Silent_p.A817A|ZNF407_uc010dqu.1_Silent_p.A817A|ZNF407_uc002llu.2_Silent_p.A816A	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	817					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GCATGCTGGCGTCTGAGGAAC	0.438																0.013274	-54.783627	6.310073	3	223	KEEP	---	---	---	---	2	1	121	120	-1	capture	Silent	SNP	72345426	72345426	ZNF407	18	G	C	C	C	1	0	0	0	0	0	0	0	1	509	40	4	4	17767	14
C3	718	broad.mit.edu	37	19	6707242	6707242	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6707242C>T	uc002mfm.2	-	17	2152	c.2090G>A	c.(2089-2091)GGC>GAC	p.G697D		NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	697	Anaphylatoxin-like.				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		CTCCCGCATGCCGTCCTCGCA	0.667																0.083333	0.463405	8.932332	4	44	KEEP	---	---	---	---	4	1	24	24	-1	capture	Missense_Mutation	SNP	6707242	6707242	C3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2184	14
ZNF440	126070	broad.mit.edu	37	19	11943173	11943173	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11943173A>C	uc002msp.1	+	4	1338	c.1182A>C	c.(1180-1182)AAA>AAC	p.K394N		NM_152357	NP_689570	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	394					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTGGAGAGAAACCCTATGAGT	0.463																0.078313	5.843455	36.007512	13	153	KEEP	---	---	---	---	11	5	73	102	-1	capture	Missense_Mutation	SNP	11943173	11943173	ZNF440	19	A	C	C	C	1	0	0	0	0	1	0	0	0	24	2	4	4	17793	14
BCAM	4059	broad.mit.edu	37	19	45315773	45315773	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45315773A>G	uc002ozu.2	+	4	516	c.472A>G	c.(472-474)ACA>GCA	p.T158A	BCAM_uc002ozt.1_Missense_Mutation_p.T158A	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1	158	Extracellular (Potential).|Ig-like V-type 2.				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CAACAAAGGGACACTGTCTGT	0.448																0.072464	0.335919	13.298745	5	64	KEEP	---	---	---	---	3	2	39	40	-1	capture	Missense_Mutation	SNP	45315773	45315773	BCAM	19	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	1333	14
ZNF649	65251	broad.mit.edu	37	19	52394411	52394411	+	Silent	SNP	G	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52394411G>C	uc002pxy.2	-	5	1246	c.978C>G	c.(976-978)GGC>GGG	p.G326G	ZNF577_uc010ydf.1_5'Flank	NM_023074	NP_075562	Q9BS31	ZN649_HUMAN	zinc finger protein 649	326	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		TCTGAATGAAGCCTTTTCCAC	0.458																0.149123	36.822369	50.265653	17	97	KEEP	---	---	---	---	10	8	55	53	-1	capture	Silent	SNP	52394411	52394411	ZNF649	19	G	C	C	C	1	0	0	0	0	0	0	0	1	431	34	4	4	17942	14
ZNF649	65251	broad.mit.edu	37	19	52394423	52394423	+	Silent	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52394423T>C	uc002pxy.2	-	5	1234	c.966A>G	c.(964-966)GAA>GAG	p.E322E	ZNF577_uc010ydf.1_5'Flank	NM_023074	NP_075562	Q9BS31	ZN649_HUMAN	zinc finger protein 649	322	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		CTTTTCCACATTCACTGCATG	0.458																0.157895	44.693472	57.399244	18	96	KEEP	---	---	---	---	12	8	54	46	-1	capture	Silent	SNP	52394423	52394423	ZNF649	19	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	17942	14
KIR2DL1	3802	broad.mit.edu	37	19	55284980	55284980	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55284980G>A	uc002qhb.1	+	3	304	c.266G>A	c.(265-267)CGC>CAC	p.R89H	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL3_uc010erw.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron|KIR3DP1_uc010yfi.1_Intron|KIR2DL1_uc010erz.1_Missense_Mutation_p.R89H	NM_014218	NP_055033	P43626	KI2L1_HUMAN	killer cell immunoglobulin-like receptor, two	89	Extracellular (Potential).|Ig-like C2-type 1.				immune response|natural killer cell inhibitory signaling pathway	integral to plasma membrane	protein binding|receptor activity				0				GBM - Glioblastoma multiforme(193;0.0192)		TCCATCAGTCGCATGACGCAA	0.537	GBM(72;624 1217 3963 34152 38303)															0.012107	-104.794952	7.765258	5	408	KEEP	---	---	---	---	4	1	220	215	-1	capture	Missense_Mutation	SNP	55284980	55284980	KIR2DL1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8238	14
ZNF586	54807	broad.mit.edu	37	19	58290731	58290731	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58290731A>G	uc002qqd.2	+	3	962	c.776A>G	c.(775-777)GAA>GGA	p.E259G	ZNF587_uc002qqb.2_Intron|ZNF586_uc002qqe.2_3'UTR|ZNF586_uc010euh.2_Missense_Mutation_p.E216G|ZNF586_uc002qqf.1_Intron	NM_017652	NP_060122	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	259					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CACACAGGAGAAAGGCCTTAT	0.443																0.417391	169.887677	170.570982	48	67	KEEP	---	---	---	---	21	28	38	34	-1	capture	Missense_Mutation	SNP	58290731	58290731	ZNF586	19	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	17897	14
WDR43	23160	broad.mit.edu	37	2	29158460	29158460	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:29158460C>T	uc002rmo.2	+	12	1543	c.1511C>T	c.(1510-1512)CCG>CTG	p.P504L		NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43	504						nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					ACTATTATTCCGTTGTTACAA	0.328																0.209677	65.58237	75.253532	26	98	KEEP	---	---	---	---	17	15	51	59	-1	capture	Missense_Mutation	SNP	29158460	29158460	WDR43	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	17176	14
THADA	63892	broad.mit.edu	37	2	43804328	43804328	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:43804328A>T	uc002rsw.3	-	10	1222	c.870T>A	c.(868-870)TTT>TTA	p.F290L	THADA_uc002rsx.3_Missense_Mutation_p.F290L|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_5'Flank|THADA_uc002rsz.2_5'UTR|THADA_uc002rta.2_5'UTR|THADA_uc002rtb.1_Missense_Mutation_p.F290L|THADA_uc002rtc.3_Missense_Mutation_p.F290L|THADA_uc002rtd.2_Missense_Mutation_p.F290L	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	290							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				AGCTGCTCATAAACCACTCGG	0.478														OREG0014580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.25	5.815253	6.50118	3	9	KEEP	---	---	---	---	4	0	5	5	-1	capture	Missense_Mutation	SNP	43804328	43804328	THADA	2	A	T	T	T	1	0	0	0	0	1	0	0	0	167	13	4	4	15725	14
SLC3A1	6519	broad.mit.edu	37	2	44528234	44528234	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:44528234G>C	uc002ruc.3	+	6	1182	c.1104G>C	c.(1102-1104)ATG>ATC	p.M368I	SLC3A1_uc002rty.2_Missense_Mutation_p.M368I|SLC3A1_uc002rtz.2_Missense_Mutation_p.M368I|SLC3A1_uc002rua.2_Missense_Mutation_p.M368I|SLC3A1_uc002rub.2_Missense_Mutation_p.M368I|SLC3A1_uc002rud.3_Missense_Mutation_p.M90I|SLC3A1_uc002rue.3_5'Flank	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1	368	Extracellular (Potential).				carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	GGCAGACCATGGACCAATACA	0.532																0.107143	9.308892	22.177043	9	75	KEEP	---	---	---	---	4	5	39	47	-1	capture	Missense_Mutation	SNP	44528234	44528234	SLC3A1	2	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	14518	14
ACVR1	90	broad.mit.edu	37	2	158626971	158626971	+	Silent	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:158626971G>A	uc002tzm.3	-	8	1038	c.699C>T	c.(697-699)GCC>GCT	p.A233A	ACVR1_uc002tzn.3_Silent_p.A233A|ACVR1_uc010fog.2_Silent_p.A233A	NM_001111067	NP_001104537	Q04771	ACVR1_HUMAN	activin A receptor, type I precursor	233	Cytoplasmic (Potential).|Protein kinase.				BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	AGATCTTCACGGCAACATTCT	0.463				p.A233A(HCC1569-Tumor)	185											0.450495	297.404534	297.83507	91	111	KEEP	---	---	---	---	43	53	53	65	-1	capture	Silent	SNP	158626971	158626971	ACVR1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	220	14
TTN	7273	broad.mit.edu	37	2	179528601	179528601	+	Silent	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179528601G>A	uc010zfk.1	-	15	1379	c.831C>T	c.(829-831)CGC>CGT	p.R277R	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron			Q8WZ42	TITIN_HUMAN	SubName: Full=Titin; Flags: Fragment;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTCTCTTCGCGGATAACCT	0.423					8722											0.019465	-93.5639	13.021009	8	403	KEEP	---	---	---	---	6	3	239	242	-1	capture	Silent	SNP	179528601	179528601	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	482	38	1	1	16617	14
TTN	7273	broad.mit.edu	37	2	179575886	179575886	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179575886A>C	uc010zfg.1	-	94	24569	c.24345T>G	c.(24343-24345)AAT>AAG	p.N8115K	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.N4776K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9042							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTAAAAATATTGAGTGTGG	0.448					8722											0.087912	21.401274	68.264558	24	249	KEEP	---	---	---	---	11	13	168	123	-1	capture	Missense_Mutation	SNP	179575886	179575886	TTN	2	A	C	C	C	1	0	0	0	0	1	0	0	0	206	16	4	4	16617	14
NCKAP1	10787	broad.mit.edu	37	2	183860521	183860521	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:183860521T>C	uc002upc.2	-	7	1051	c.649A>G	c.(649-651)AGG>GGG	p.R217G	NCKAP1_uc002upb.2_Missense_Mutation_p.R223G	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1	217					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			GAAAGATTCCTTCGAGGATAT	0.373																0.386667	208.218806	209.906493	58	92	KEEP	---	---	---	---	28	35	47	52	-1	capture	Missense_Mutation	SNP	183860521	183860521	NCKAP1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	726	56	3	3	10128	14
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393	Pancreas(158;264 1958 3300 35450 36047)				134	Mis		gliobastoma 								0.422222	168.558543	169.26936	57	78	KEEP	---	---	---	---	28	33	43	42	-1	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	14
BCS1L	617	broad.mit.edu	37	2	219527689	219527689	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219527689C>T	uc002vio.2	+	7	1391	c.973C>T	c.(973-975)CGC>TGC	p.R325C	BCS1L_uc002vip.2_Missense_Mutation_p.R325C|BCS1L_uc002viq.2_Missense_Mutation_p.R325C|BCS1L_uc010fvu.2_Missense_Mutation_p.R325C|BCS1L_uc010fvv.2_Missense_Mutation_p.R325C|BCS1L_uc002vir.2_Missense_Mutation_p.R325C|BCS1L_uc002vis.2_Missense_Mutation_p.R325C	NM_004328	NP_004319	Q9Y276	BCS1_HUMAN	BCS1-like	325	Mitochondrial matrix (Potential).				mitochondrial respiratory chain complex I assembly|mitochondrial respiratory chain complex III assembly|mitochondrial respiratory chain complex IV assembly	integral to membrane|mitochondrial respiratory chain complex III	ATP binding|nucleoside-triphosphatase activity|protein binding				0		Renal(207;0.0474)		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CACCGAGGCCCGCATCGTGTT	0.577																0.071429	-6.391229	22.762594	11	143	KEEP	---	---	---	---	7	5	76	82	-1	capture	Missense_Mutation	SNP	219527689	219527689	BCS1L	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1378	14
ANO7	50636	broad.mit.edu	37	2	242147068	242147068	+	Missense_Mutation	SNP	G	A	A	rs137878201		TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242147068G>A	uc002wax.2	+	11	1325	c.1222G>A	c.(1222-1224)GCC>ACC	p.A408T		NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	408	Extracellular (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3						GCTCTCCAGCGCCTGTGCCCT	0.622																0.28481	112.703911	119.2758	45	113	KEEP	---	---	---	---	23	27	61	59	-1	capture	Missense_Mutation	SNP	242147068	242147068	ANO7	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	696	14
DNMT3B	1789	broad.mit.edu	37	20	31368258	31368258	+	Silent	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31368258C>T	uc002wyc.2	+	2	450	c.129C>T	c.(127-129)ACC>ACT	p.T43T	DNMT3B_uc010ztx.1_RNA|DNMT3B_uc010zty.1_RNA|DNMT3B_uc002wyd.2_Silent_p.T43T|DNMT3B_uc002wye.2_Silent_p.T43T|DNMT3B_uc010gee.2_RNA|DNMT3B_uc010gef.2_RNA|DNMT3B_uc010ztz.1_Silent_p.T43T|DNMT3B_uc010zua.1_Silent_p.T43T|DNMT3B_uc002wyf.2_Silent_p.T55T	NM_006892	NP_008823	Q9UBC3	DNM3B_HUMAN	DNA cytosine-5 methyltransferase 3 beta isoform	43	Interaction with DNMT1 and DNMT3A.				negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		metal ion binding|protein binding|transcription corepressor activity			lung(3)|ovary(2)	5						CTATCCGCACCCCGGAGATCA	0.652					1211											0.078947	-0.004491	6.875466	3	35	KEEP	---	---	---	---	0	3	7	32	-1	capture	Silent	SNP	31368258	31368258	DNMT3B	20	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	4633	14
SULF2	55959	broad.mit.edu	37	20	46307466	46307466	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:46307466C>T	uc002xto.2	-	8	1477	c.1147G>A	c.(1147-1149)GGG>AGG	p.G383R	SULF2_uc002xtr.2_Missense_Mutation_p.G383R|SULF2_uc002xtq.2_Missense_Mutation_p.G383R	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	383					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						ATGGATTTCCCGTCCATATCC	0.617					709											0.464286	292.118941	292.335227	91	105	KEEP	---	---	---	---	54	51	62	76	-1	capture	Missense_Mutation	SNP	46307466	46307466	SULF2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15261	14
CHODL	140578	broad.mit.edu	37	21	19638284	19638284	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:19638284A>G	uc002ykv.2	+	6	1142	c.751A>G	c.(751-753)AAA>GAA	p.K251E	CHODL_uc002ykr.2_Missense_Mutation_p.K210E|CHODL_uc002yks.2_Missense_Mutation_p.K210E|CHODL_uc002ykt.2_Silent_p.Q175Q|CHODL_uc002yku.2_Silent_p.Q175Q	NM_024944	NP_079220	Q9H9P2	CHODL_HUMAN	chondrolectin precursor	251	Cytoplasmic (Potential).				muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		AGGAAGAACAAAAACTAGTCC	0.343																0.080357	5.183225	25.29427	9	103	KEEP	---	---	---	---	3	6	54	64	-1	capture	Missense_Mutation	SNP	19638284	19638284	CHODL	21	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	3329	14
POTEH	23784	broad.mit.edu	37	22	16287511	16287511	+	Silent	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:16287511G>A	uc010gqp.2	-	1	427	c.375C>T	c.(373-375)GAC>GAT	p.D125D	POTEH_uc002zlg.1_5'Flank|POTEH_uc002zlh.1_5'Flank|POTEH_uc002zlj.1_Intron	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3	125										skin(1)	1						TCATAGCAGAGTCGTCGTGGT	0.612																0.015905	-122.324052	11.234147	8	495	KEEP	---	---	---	---	4	6	397	383	-1	capture	Silent	SNP	16287511	16287511	POTEH	22	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	12168	14
MYO18B	84700	broad.mit.edu	37	22	26291213	26291213	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26291213C>T	uc003abz.1	+	28	4884	c.4634C>T	c.(4633-4635)TCG>TTG	p.S1545L	MYO18B_uc003aca.1_Missense_Mutation_p.S1426L|MYO18B_uc010guy.1_Missense_Mutation_p.S1427L|MYO18B_uc010guz.1_Missense_Mutation_p.S1425L|MYO18B_uc011aka.1_Missense_Mutation_p.S699L|MYO18B_uc011akb.1_Missense_Mutation_p.S1058L	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1545	Potential.|Tail.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						AGGCTGGACTCGGAGCTGACA	0.552					968											0.470588	23.798804	23.811546	8	9	KEEP	---	---	---	---	1	7	6	6	-1	capture	Missense_Mutation	SNP	26291213	26291213	MYO18B	22	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9976	14
SF3A1	10291	broad.mit.edu	37	22	30738811	30738811	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30738811G>A	uc003ahl.2	-	5	841	c.709C>T	c.(709-711)CGA>TGA	p.R237*		NM_005877	NP_005868	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa isoform 1	237					nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding			ovary(3)|large_intestine(1)|pancreas(1)	5						AAAACTTCTCGGGGGTTTTCA	0.408																0.113924	20.939025	44.170518	18	140	KEEP	---	---	---	---	11	11	80	83	-1	capture	Nonsense_Mutation	SNP	30738811	30738811	SF3A1	22	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	14039	14
GGA1	26088	broad.mit.edu	37	22	38016850	38016850	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38016850A>G	uc003atc.2	+	6	823	c.458A>G	c.(457-459)GAT>GGT	p.D153G	GGA1_uc003atd.2_Missense_Mutation_p.D153G|GGA1_uc003ate.2_Missense_Mutation_p.D153G|GGA1_uc003atf.2_Missense_Mutation_p.D80G	NM_013365	NP_037497	Q9UJY5	GGA1_HUMAN	golgi associated, gamma adaptin ear containing,	153	Interaction with ARF3.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|Golgi apparatus part	protein binding			breast(2)|ovary(1)	3	Melanoma(58;0.0574)					AAGCTTCCAGATGACACTACC	0.522																0.307692	171.497656	177.519368	56	126	KEEP	---	---	---	---	31	42	81	70	-1	capture	Missense_Mutation	SNP	38016850	38016850	GGA1	22	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	6291	14
FGD5	152273	broad.mit.edu	37	3	14862089	14862089	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14862089A>G	uc003bzc.2	+	1	1621	c.1511A>G	c.(1510-1512)GAG>GGG	p.E504G	FGD5_uc011avk.1_Missense_Mutation_p.E504G	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	504					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						ACCGGACCTGAGGCGGGCTCG	0.637																0.08	1.667248	10.657087	4	46	KEEP	---	---	---	---	4	2	22	29	-1	capture	Missense_Mutation	SNP	14862089	14862089	FGD5	3	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	5782	14
KALRN	8997	broad.mit.edu	37	3	124438292	124438292	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:124438292T>C	uc003ehg.2	+	60	9063	c.8936T>C	c.(8935-8937)GTC>GCC	p.V2979A	KALRN_uc003ehk.2_Missense_Mutation_p.V1282A	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	2978					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						AGCTACATTGTCAACCGGGTG	0.502					1865											0.08642	1.820306	16.040328	7	74	KEEP	---	---	---	---	2	6	33	48	-1	capture	Missense_Mutation	SNP	124438292	124438292	KALRN	3	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	7898	14
ATR	545	broad.mit.edu	37	3	142188272	142188272	+	Silent	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142188272G>A	uc003eux.3	-	38	6581	c.6459C>T	c.(6457-6459)CAC>CAT	p.H2153H	ATR_uc003euy.1_Silent_p.H39H	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	2153	FAT.				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						AAACTTCATCGTGAGAATGAC	0.343					936						Other_conserved_DNA_damage_response_genes					0.21	97.141237	112.704063	42	158	KEEP	---	---	---	---	20	25	85	82	-1	capture	Silent	SNP	142188272	142188272	ATR	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1195	14
ABCC5	10057	broad.mit.edu	37	3	183700632	183700632	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183700632C>G	uc003fmg.2	-	6	920	c.755G>C	c.(754-756)GGG>GCG	p.G252A	ABCC5_uc011bqt.1_5'UTR|ABCC5_uc010hxl.2_Missense_Mutation_p.G252A	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	252	ABC transmembrane type-1 1.					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TAGGATGGCCCCCCGCAAGCG	0.507																0.353982	116.670906	118.792971	40	73	KEEP	---	---	---	---	20	26	41	42	-1	capture	Missense_Mutation	SNP	183700632	183700632	ABCC5	3	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	56	14
FAM193A	8603	broad.mit.edu	37	4	2698176	2698176	+	Silent	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:2698176T>C	uc010icl.2	+	16	2841	c.2490T>C	c.(2488-2490)CCT>CCC	p.P830P	FAM193A_uc010ick.2_Silent_p.P1030P|FAM193A_uc003gfd.2_Silent_p.P830P|FAM193A_uc011bvm.1_Silent_p.P852P|FAM193A_uc011bvn.1_Silent_p.P830P|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Silent_p.P684P	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	830										ovary(3)	3						AGGAGCAACCTAAAAAAATGG	0.453																0.023437	-25.383965	6.956152	3	125	KEEP	---	---	---	---	3	0	66	71	-1	capture	Silent	SNP	2698176	2698176	FAM193A	4	T	C	C	C	1	0	0	0	0	0	0	0	1	678	53	3	3	5476	14
SLIT2	9353	broad.mit.edu	37	4	20547701	20547701	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:20547701A>G	uc003gpr.1	+	22	2528	c.2324A>G	c.(2323-2325)AAC>AGC	p.N775S	SLIT2_uc003gps.1_Missense_Mutation_p.N767S	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	775	LRR 17.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	p.N775S(1)		central_nervous_system(4)|skin(4)|ovary(3)	11						GAACTCTCCAACTACAAACAT	0.358																0.247312	71.881295	77.283056	23	70	KEEP	---	---	---	---	13	14	43	40	-1	capture	Missense_Mutation	SNP	20547701	20547701	SLIT2	4	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	14632	14
KDR	3791	broad.mit.edu	37	4	55958819	55958819	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55958819C>T	uc003has.2	-	22	3336	c.3034G>A	c.(3034-3036)GTG>ATG	p.V1012M	KDR_uc003hat.1_Missense_Mutation_p.V1012M	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	1012	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	CCCTTAGCCACTTGGAAGCTG	0.463					1022	Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			0.056	-10.585528	15.330455	7	118	KEEP	---	---	---	---	6	1	59	79	-1	capture	Missense_Mutation	SNP	55958819	55958819	KDR	4	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	8061	14
TMPRSS11A	339967	broad.mit.edu	37	4	68784796	68784796	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:68784796T>G	uc003hdr.1	-	8	977	c.856A>C	c.(856-858)ACC>CCC	p.T286P	LOC550112_uc003hdl.3_Intron|TMPRSS11A_uc003hds.1_Missense_Mutation_p.T283P	NM_182606	NP_872412	Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A isoform 1	286	Peptidase S1.|Extracellular (Potential).				cell cycle|proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			skin(1)	1						TCCGAAAAGGTGACTCTGGAA	0.433	NSCLC(26;2 894 10941 14480 22546)															0.124424	42.970756	73.166446	27	190	KEEP	---	---	---	---	12	17	105	95	-1	capture	Missense_Mutation	SNP	68784796	68784796	TMPRSS11A	4	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	16122	14
UGT2B10	7365	broad.mit.edu	37	4	69874638	69874638	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69874638T>C	uc011cao.1	-	8	1269	c.1133A>G	c.(1132-1134)GAC>GGC	p.D378G	UGT2B10_uc011can.1_Missense_Mutation_p.D294G			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	415					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						TGTGTTGAAGTCCACTCTAAC	0.403	Melanoma(133;755 1763 25578 26334 46021)															0.072973	5.941591	75.310887	27	343	KEEP	---	---	---	---	20	11	223	184	-1	capture	Missense_Mutation	SNP	69874638	69874638	UGT2B10	4	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	16838	14
ADAM29	11086	broad.mit.edu	37	4	175897388	175897388	+	Missense_Mutation	SNP	G	C	C	rs148389603		TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175897388G>C	uc003iuc.2	+	5	1382	c.712G>C	c.(712-714)GTC>CTC	p.V238L	ADAM29_uc003iud.2_Missense_Mutation_p.V238L|ADAM29_uc010irr.2_Missense_Mutation_p.V238L|ADAM29_uc011cki.1_Missense_Mutation_p.V238L	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	238	Peptidase M12B.|Extracellular (Potential).				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CATTTTGGATGTCATTGGTGT	0.348	Ovarian(140;1727 1835 21805 25838 41440)				106											0.100437	29.342408	65.854169	23	206	KEEP	---	---	---	---	16	8	127	100	-1	capture	Missense_Mutation	SNP	175897388	175897388	ADAM29	4	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	247	14
NLN	57486	broad.mit.edu	37	5	65088386	65088386	+	Silent	SNP	A	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:65088386A>C	uc003juf.2	+	9	1547	c.1431A>C	c.(1429-1431)TCA>TCC	p.S477S	NLN_uc003jue.2_Silent_p.S477S|NLN_uc003jug.2_Silent_p.S306S|NLN_uc010iww.2_Silent_p.S172S	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor	477					proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		TGAACTTCTCACAGCCAGTGG	0.552																0.204082	1.942667	6.467781	10	39	KEEP	---	---	---	---	11	5	43	39	-1	capture	Silent	SNP	65088386	65088386	NLN	5	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	10374	14
PIK3R1	5295	broad.mit.edu	37	5	67589138	67589138	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589138G>C	uc003jva.2	+	10	1686	c.1126G>C	c.(1126-1128)GGA>CGA	p.G376R	PIK3R1_uc003jvb.2_Missense_Mutation_p.G376R|PIK3R1_uc003jvc.2_Missense_Mutation_p.G76R|PIK3R1_uc003jvd.2_Missense_Mutation_p.G106R|PIK3R1_uc003jve.2_Missense_Mutation_p.G55R|PIK3R1_uc011crb.1_Missense_Mutation_p.G46R	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	376	SH2 1.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.G376R(3)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	CAGGAAAGGGGGAAATAACAA	0.308					370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.054264	-9.288668	17.728834	7	122	KEEP	---	---	---	---	8	0	73	67	-1	capture	Missense_Mutation	SNP	67589138	67589138	PIK3R1	5	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	11821	14
PCDHA8	56140	broad.mit.edu	37	5	140222411	140222411	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140222411G>A	uc003lhs.2	+	1	1505	c.1505G>A	c.(1504-1506)CGC>CAC	p.R502H	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.R502H	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	502	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGGCGAGCGCTCGCTGTCG	0.672																0.135135	13.501703	23.049414	10	64	KEEP	---	---	---	---	8	4	43	35	-1	capture	Missense_Mutation	SNP	140222411	140222411	PCDHA8	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11433	14
PCDHGA12	26025	broad.mit.edu	37	5	140810513	140810513	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140810513G>A	uc003lkt.1	+	1	356	c.187G>A	c.(187-189)GGA>AGA	p.G63R	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Missense_Mutation_p.G63R	NM_003735	NP_003726	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12 isoform 1	63	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGGAGCGCGGAGTCCGCAT	0.652																0.025907	-39.295191	8.73007	5	188	KEEP	---	---	---	---	5	0	105	104	-1	capture	Missense_Mutation	SNP	140810513	140810513	PCDHGA12	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11456	14
ODZ2	57451	broad.mit.edu	37	5	167553791	167553791	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:167553791G>A	uc010jjd.2	+	12	2242	c.2242G>A	c.(2242-2244)GTC>ATC	p.V748I	ODZ2_uc003lzr.3_Missense_Mutation_p.V516I|ODZ2_uc003lzt.3_Missense_Mutation_p.V112I|ODZ2_uc010jje.2_Missense_Mutation_p.V19I|uc003lzs.1_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		CACTCACGGCGTCTGCATCGG	0.587																0.157895	6.215628	8.333421	3	16	KEEP	---	---	---	---	1	2	11	7	-1	capture	Missense_Mutation	SNP	167553791	167553791	ODZ2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10740	14
PPIL6	285755	broad.mit.edu	37	6	109752491	109752491	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:109752491G>A	uc003ptg.3	-	3	343	c.289C>T	c.(289-291)CAG>TAG	p.Q97*	PPIL6_uc010kdo.2_Nonsense_Mutation_p.Q65*|PPIL6_uc010kdp.2_Nonsense_Mutation_p.Q97*	NM_173672	NP_775943	Q8IXY8	PPIL6_HUMAN	peptidylprolyl isomerase-like 6 isoform 1	97					protein folding		peptidyl-prolyl cis-trans isomerase activity				0		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)		CCCAGAAACTGACCATTAACA	0.403																0.096552	8.63157	32.297577	14	131	KEEP	---	---	---	---	5	9	81	65	-1	capture	Nonsense_Mutation	SNP	109752491	109752491	PPIL6	6	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	12232	14
HOXA2	3199	broad.mit.edu	37	7	27142031	27142031	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:27142031T>A	uc003syh.2	-	1	364	c.89A>T	c.(88-90)GAT>GTT	p.D30V		NM_006735	NP_006726	O43364	HXA2_HUMAN	homeobox A2	30						nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						TTGAAATGTATCAGCGACAGG	0.493																0.12749	52.228452	86.18153	32	219	KEEP	---	---	---	---	16	20	133	126	-1	capture	Missense_Mutation	SNP	27142031	27142031	HOXA2	7	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	7217	14
GCK	2645	broad.mit.edu	37	7	44189583	44189583	+	Silent	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44189583A>G	uc003tkl.2	-	5	1034	c.564T>C	c.(562-564)GCT>GCC	p.A188A	GCK_uc003tkj.1_Silent_p.A187A|GCK_uc003tkk.1_Silent_p.A189A	NM_000162	NP_000153	P35557	HXK4_HUMAN	glucokinase isoform 1	188			A -> T (in MODY2; large increase in Km for glucose).		cellular response to insulin stimulus|cellular response to leptin stimulus|detection of glucose|endocrine pancreas development|glucose homeostasis|glucose transport|glycolysis|negative regulation of gluconeogenesis|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|regulation of glucose transport|regulation of glycolysis|transmembrane transport	cytosol|nucleoplasm	ATP binding|glucokinase activity|glucose binding|protein binding			skin(3)|lung(1)	4						TCCGTTTGATAGCGTCTCGCA	0.632					356											0.034483	-12.951006	7.565547	3	84	KEEP	---	---	---	---	1	2	56	43	-1	capture	Silent	SNP	44189583	44189583	GCK	7	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	6233	14
MAGI2	9863	broad.mit.edu	37	7	77797372	77797372	+	Silent	SNP	A	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:77797372A>T	uc003ugx.2	-	15	2711	c.2457T>A	c.(2455-2457)CTT>CTA	p.L819L	MAGI2_uc003ugy.2_Silent_p.L805L|MAGI2_uc010ldx.1_Silent_p.L412L	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	819	PDZ 4.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CTCCTGGGTGAAGGCGGCCAT	0.517																0.331551	160.209526	164.899728	62	125	KEEP	---	---	---	---	37	29	89	49	-1	capture	Silent	SNP	77797372	77797372	MAGI2	7	A	T	T	T	1	0	0	0	0	0	0	0	1	106	9	4	4	9105	14
SAMD9L	219285	broad.mit.edu	37	7	92763379	92763379	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92763379G>A	uc003umh.1	-	5	3122	c.1906C>T	c.(1906-1908)CCC>TCC	p.P636S	SAMD9L_uc003umj.1_Missense_Mutation_p.P636S|SAMD9L_uc003umi.1_Missense_Mutation_p.P636S|SAMD9L_uc010lfb.1_Missense_Mutation_p.P636S|SAMD9L_uc003umk.1_Missense_Mutation_p.P636S|SAMD9L_uc010lfc.1_Missense_Mutation_p.P636S|SAMD9L_uc010lfd.1_Missense_Mutation_p.P636S|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	636										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CCACGGGCGGGCAAAAACCTT	0.398																0.01634	-73.593574	7.424495	5	301	KEEP	---	---	---	---	2	3	171	150	-1	capture	Missense_Mutation	SNP	92763379	92763379	SAMD9L	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13719	14
PPP1R3A	5506	broad.mit.edu	37	7	113519285	113519285	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:113519285C>A	uc010ljy.1	-	4	1893	c.1862G>T	c.(1861-1863)AGA>ATA	p.R621I		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	621					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						ATTTCCAGTTCTTGATGAACA	0.383					235											0.270992	174.499093	186.899189	71	191	KEEP	---	---	---	---	32	43	92	111	0.573333333333	capture	Missense_Mutation	SNP	113519285	113519285	PPP1R3A	7	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	12272	14
MGAM	8972	broad.mit.edu	37	7	141759688	141759688	+	Silent	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141759688T>C	uc003vwy.2	+	33	4035	c.3981T>C	c.(3979-3981)CCT>CCC	p.P1327P		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1327	Glucoamylase.|Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGACACAGCCTTATCCTGCCT	0.463																0.073171	1.190519	8.870873	3	38	KEEP	---	---	---	---	3	0	22	23	-1	capture	Silent	SNP	141759688	141759688	MGAM	7	T	C	C	C	1	0	0	0	0	0	0	0	1	717	56	3	3	9453	14
TUSC3	7991	broad.mit.edu	37	8	15519674	15519674	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:15519674T>C	uc003wwt.2	+	5	787	c.577T>C	c.(577-579)TTC>CTC	p.F193L	TUSC3_uc003wwr.2_Missense_Mutation_p.F193L|TUSC3_uc003wws.2_Missense_Mutation_p.F193L|TUSC3_uc003wwu.2_Missense_Mutation_p.F193L|TUSC3_uc003wwv.2_Missense_Mutation_p.F193L|TUSC3_uc003www.2_Missense_Mutation_p.F193L|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Missense_Mutation_p.F193L	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	193					cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex		p.F193L(1)		ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)		GATTCGGGTTTTCAGACCACC	0.353																0.392857	422.523095	425.614399	121	187	KEEP	---	---	---	---	67	70	125	85	-1	capture	Missense_Mutation	SNP	15519674	15519674	TUSC3	8	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	16660	14
TRIM32	22954	broad.mit.edu	37	9	119461599	119461599	+	Silent	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:119461599C>T	uc004bjx.2	+	2	1736	c.1578C>T	c.(1576-1578)ACC>ACT	p.T526T	ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjs.1_Intron|ASTN2_uc004bjt.1_Intron|TRIM32_uc004bjw.2_Silent_p.T526T	NM_001099679	NP_001093149	Q13049	TRI32_HUMAN	tripartite motif-containing 32	526					fat cell differentiation|innate immune response|negative regulation of apoptosis|negative regulation of fibroblast proliferation|positive regulation of cell cycle|positive regulation of cell growth|positive regulation of cell migration|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein catabolic process|positive regulation of proteolysis|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to tumor necrosis factor|response to UV	nucleus	myosin binding|protein self-association|RNA binding|Tat protein binding|transcription coactivator activity|translation initiation factor binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding	p.T526T(1)		central_nervous_system(2)|kidney(1)	3						CTGAGGGCACCGTCTACTTCA	0.542	Esophageal Squamous(92;212 1916 19711 26951)											Bardet-Biedl_syndrome				0.344086	97.573613	99.569575	32	61	KEEP	---	---	---	---	16	16	25	43	-1	capture	Silent	SNP	119461599	119461599	TRIM32	9	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16389	14
GARNL3	84253	broad.mit.edu	37	9	130155514	130155514	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130155514A>G	uc011mae.1	+	28	3424	c.3023A>G	c.(3022-3024)GAC>GGC	p.D1008G	GARNL3_uc011mad.1_Missense_Mutation_p.D986G|GARNL3_uc010mxi.2_Missense_Mutation_p.D238G	NM_032293	NP_115669	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	1008					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity|small GTPase regulator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						TCCGATGAAGACATTATAGAC	0.483																0.039683	-17.231923	11.555229	5	121	KEEP	---	---	---	---	4	1	61	88	-1	capture	Missense_Mutation	SNP	130155514	130155514	GARNL3	9	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	6181	14
FTSJ1	24140	broad.mit.edu	37	X	48337070	48337070	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48337070T>C	uc004djo.1	+	4	580	c.257T>C	c.(256-258)GTA>GCA	p.V86A	FTSJ1_uc004djl.2_Missense_Mutation_p.V86A|FTSJ1_uc004djm.2_Missense_Mutation_p.V86A|FTSJ1_uc004djn.1_Missense_Mutation_p.V86A|FTSJ1_uc004djp.1_Missense_Mutation_p.V86A|FTSJ1_uc011mlw.1_Intron	NM_012280	NP_036412	Q9UET6	RRMJ1_HUMAN	FtsJ homolog 1 isoform a	86					RNA methylation|rRNA processing		methyltransferase activity|nucleic acid binding				0						CCAGGTGTGGTACAGATCCAG	0.567																0.083333	2.234763	6.465143	2	22	KEEP	---	---	---	---	2	0	8	15	-1	capture	Missense_Mutation	SNP	48337070	48337070	FTSJ1	23	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	6029	14
TP53	7157	broad.mit.edu	37	17	7576910	7576910	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7576910delG	uc002gim.2	-	9	1130	c.936delC	c.(934-936)ACCfs	p.T312fs	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Frame_Shift_Del_p.T312fs|TP53_uc010cne.1_RNA|TP53_uc010cnf.1_Frame_Shift_Del_p.T180fs|TP53_uc010cng.1_Frame_Shift_Del_p.T180fs|TP53_uc002gii.1_Frame_Shift_Del_p.T180fs|TP53_uc010cnh.1_Frame_Shift_Del_p.T312fs|TP53_uc010cni.1_Frame_Shift_Del_p.T312fs|TP53_uc002gij.2_Frame_Shift_Del_p.T312fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	312	Bipartite nuclear localization signal.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.		T -> I (in sporadic cancers; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.T312S(4)|p.?(2)|p.T312T(2)|p.S313fs*24(2)|p.T312fs*25(1)|p.T312fs*33(1)|p.L308fs*15(1)|p.L308fs*31(1)|p.T312A(1)|p.S313fs*32(1)|p.T312I(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GAGAGGAGCTGGTGTTGTTGG	0.488	Pancreas(47;798 1329 9957 10801)		111		690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.78			131	38		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	7576910	7576910	TP53	17	G	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	16264	14
KRT34	3885	broad.mit.edu	37	17	39538605	39538605	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39538605delG	uc002hwm.2	-	1	32	c.20delC	c.(19-21)CCAfs	p.P7fs		NM_021013	NP_066293	O76011	KRT34_HUMAN	keratin 34	7	Head.				epidermis development	intermediate filament	protein binding|structural molecule activity			central_nervous_system(1)	1		Breast(137;0.000496)				AATTGTGGGTGGGGGCTTGGC	0.458																0.21			28	108		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	39538605	39538605	KRT34	17	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	8391	14
LINGO2	158038	broad.mit.edu	37	9	27949442	27949443	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-0128-01	TCGA-06-0128-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:27949442_27949443insT	uc003zqu.1	-	2	1421_1422	c.1227_1228insA	c.(1225-1230)AAACCCfs	p.K409fs	LINGO2_uc010mjf.1_Frame_Shift_Ins_p.K409fs|LINGO2_uc003zqv.1_Frame_Shift_Ins_p.K409fs	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	409_410	Ig-like C2-type.|Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		CGGATTTTGGGTTTTTTGCAGG	0.490																0.11			19	161		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	27949442	27949443	LINGO2	9	-	T	T	T	1	0	1	1	0	0	0	0	0	572	44	5	5	8735	14
