Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CLCNKA	1187	broad.mit.edu	37	1	16355293	16355293	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16355293G>A	uc001axu.2	+	11	1086	c.1006G>A	c.(1006-1008)GCC>ACC	p.A336T	CLCNKA_uc001axt.2_RNA|CLCNKA_uc001axv.2_Missense_Mutation_p.A336T|CLCNKA_uc010obw.1_Missense_Mutation_p.A293T|CLCNKB_uc001axw.3_Intron|CLCNKA_uc010obx.1_5'UTR|CLCNKA_uc010oby.1_Missense_Mutation_p.R65H	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1	336	Helical; (Potential).				excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	CTTGCTTCTCGCCTCCATCAC	0.632																0.208054	135.123165	158.630488	62	236	KEEP	---	---	---	---	42	38	159	142	-1	capture	Missense_Mutation	SNP	16355293	16355293	CLCNKA	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3434	26
LRRC7	57554	broad.mit.edu	37	1	70503971	70503971	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:70503971A>G	uc001dep.2	+	19	2380	c.2350A>G	c.(2350-2352)ACC>GCC	p.T784A	LRRC7_uc009wbg.2_Missense_Mutation_p.T68A|LRRC7_uc001deq.2_Missense_Mutation_p.T25A	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	784						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						TGCTGAGGAAACCACAGCCGA	0.488					783											0.213953	127.564517	143.785793	46	169	KEEP	---	---	---	---	36	48	96	108	-1	capture	Missense_Mutation	SNP	70503971	70503971	LRRC7	1	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	8935	26
MCOLN3	55283	broad.mit.edu	37	1	85499910	85499910	+	Missense_Mutation	SNP	C	T	T	rs144793042	byFrequency	TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:85499910C>T	uc001dkp.2	-	4	514	c.421G>A	c.(421-423)GTT>ATT	p.V141I	MCOLN3_uc001dkq.2_Missense_Mutation_p.V85I|MCOLN3_uc001dkr.2_Missense_Mutation_p.V141I|MCOLN3_uc001dks.3_5'UTR	NM_018298	NP_060768	Q8TDD5	MCLN3_HUMAN	mucolipin 3	141						integral to membrane	ion channel activity			skin(1)	1				all cancers(265;0.00957)|Epithelial(280;0.0254)		TGATTCCCAACGGAGACATTG	0.468																0.366197	157.664548	159.899265	52	90	KEEP	---	---	---	---	34	25	57	49	-1	capture	Missense_Mutation	SNP	85499910	85499910	MCOLN3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9310	26
RPL5	6125	broad.mit.edu	37	1	93301746	93301746	+	Splice_Site	SNP	G	C	C			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:93301746G>C	uc001doz.2	+	5	403	c.325_splice	c.e5-1	p.L109_splice	FAM69A_uc001dpc.2_Intron|RPL5_uc001dpa.2_Intron|RPL5_uc001dpb.2_Splice_Site_p.L59_splice|RPL5_uc001dpd.2_5'Flank|SNORD21_uc001dpe.2_5'Flank	NM_000969	NP_000960	P46777	RL5_HUMAN	ribosomal protein L5						endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome				0		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		TTCTTGAATAGCTTCTCAATA	0.398																0.018605	-47.109157	8.969984	4	211	KEEP	---	---	---	---	2	2	141	106	-1	capture	Splice_Site	SNP	93301746	93301746	RPL5	1	G	C	C	C	1	0	0	0	0	0	0	1	0	442	34	5	4	13489	26
C1orf161	126868	broad.mit.edu	37	1	116675825	116675825	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:116675825C>T	uc001egc.1	+	7	1193	c.928C>T	c.(928-930)CGC>TGC	p.R310C		NM_152367	NP_689580	Q8N8X9	MB213_HUMAN	hypothetical protein LOC126868	310											0	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		AGCATTTCTGCGCCTGGTGAG	0.507																0.2875	60.50824	63.738911	23	57	KEEP	---	---	---	---	14	11	29	30	-1	capture	Missense_Mutation	SNP	116675825	116675825	C1orf161	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1991	26
ADAMTSL4	54507	broad.mit.edu	37	1	150530514	150530514	+	Silent	SNP	T	G	G			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150530514T>G	uc001eux.2	+	14	2507	c.2271T>G	c.(2269-2271)GGT>GGG	p.G757G	ADAMTSL4_uc001euw.2_Silent_p.G757G|ADAMTSL4_uc009wlw.2_Silent_p.G780G|ADAMTSL4_uc010pcg.1_Silent_p.G718G|ADAMTSL4_uc009wlx.2_5'UTR	NM_019032	NP_061905	Q6UY14	ATL4_HUMAN	thrombospondin repeat containing 1 isoform 1	757	TSP type-1 2.				apoptosis|positive regulation of apoptosis		metalloendopeptidase activity|protease binding			ovary(1)|skin(1)	2	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			TTGGGGGGGGTGGCTCCTCGG	0.692																0.067227	-17.164183	6.455519	8	111	KEEP	---	---	---	---	22	28	80	79	-1	capture	Silent	SNP	150530514	150530514	ADAMTSL4	1	T	G	G	G	1	0	0	0	0	0	0	0	1	756	59	4	4	277	26
FLG	2312	broad.mit.edu	37	1	152283083	152283083	+	Missense_Mutation	SNP	C	T	T	rs148844389	byFrequency	TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152283083C>T	uc001ezu.1	-	3	4315	c.4279G>A	c.(4279-4281)GCA>ACA	p.A1427T	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1427	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGCCACGTGCGGACTCTTTG	0.557												Ichthyosis				0.349206	377.51982	385.089017	132	246	KEEP	---	---	---	---	75	66	145	138	-1	capture	Missense_Mutation	SNP	152283083	152283083	FLG	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5867	26
F5	2153	broad.mit.edu	37	1	169510563	169510563	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169510563C>G	uc001ggg.1	-	13	3910	c.3765G>C	c.(3763-3765)CAG>CAC	p.Q1255H		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	1255	2-8.|35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	AGAGGTTTGTCTGGCTGAGGT	0.522																0.304498	280.590547	290.44536	88	201	KEEP	---	---	---	---	69	34	131	113	-1	capture	Missense_Mutation	SNP	169510563	169510563	F5	1	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	5302	26
OBSCN	84033	broad.mit.edu	37	1	228467603	228467603	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228467603G>A	uc009xez.1	+	28	7522	c.7478G>A	c.(7477-7479)CGG>CAG	p.R2493Q	OBSCN_uc001hsn.2_Missense_Mutation_p.R2493Q|OBSCN_uc001hsp.1_Missense_Mutation_p.R192Q|OBSCN_uc001hsq.1_5'Flank	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	2493	Ig-like 24.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				TGCGACTTCCGGCCAGCCCCC	0.622					4006											0.25	8.319209	9.000895	3	9	KEEP	---	---	---	---	2	1	5	8	-1	capture	Missense_Mutation	SNP	228467603	228467603	OBSCN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10717	26
RYR2	6262	broad.mit.edu	37	1	237924281	237924281	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237924281G>A	uc001hyl.1	+	84	11549	c.11429G>A	c.(11428-11430)CGA>CAA	p.R3810Q	RYR2_uc010pya.1_Missense_Mutation_p.R225Q	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3810					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCATTTGAGCGACAAAACAAA	0.393																0.5	13.400031	13.400031	4	4	KEEP	---	---	---	---	3	3	1	4	-1	capture	Missense_Mutation	SNP	237924281	237924281	RYR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13661	26
ARHGAP21	57584	broad.mit.edu	37	10	24889768	24889768	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:24889768G>C	uc001isb.2	-	14	3426	c.2939C>G	c.(2938-2940)ACG>AGG	p.T980R	ARHGAP21_uc010qdb.1_RNA|ARHGAP21_uc009xkl.1_Missense_Mutation_p.T980R|ARHGAP21_uc010qdc.1_Missense_Mutation_p.T815R	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	979	Interaction with ARF1 and ARF6.|PH.				signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						AGACGGAGTCGTCTGCTCTCT	0.453																0.556701	207.163638	207.435453	54	43	KEEP	---	---	---	---	41	36	43	54	-1	capture	Missense_Mutation	SNP	24889768	24889768	ARHGAP21	10	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	864	26
APBB1IP	54518	broad.mit.edu	37	10	26825105	26825105	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:26825105C>T	uc001iss.2	+	10	1324	c.1003C>T	c.(1003-1005)CGG>TGG	p.R335W	APBB1IP_uc009xks.1_Missense_Mutation_p.R335W	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	335	PH.				blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium		p.R335W(1)		lung(4)|skin(2)|central_nervous_system(1)	7						TTTTCTTTTACGGGCTTCTGG	0.338					307											0.413408	227.726761	228.896271	74	105	KEEP	---	---	---	---	30	49	63	56	-1	capture	Missense_Mutation	SNP	26825105	26825105	APBB1IP	10	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	753	26
ANK3	288	broad.mit.edu	37	10	61829891	61829891	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:61829891G>A	uc001jky.2	-	37	10940	c.10748C>T	c.(10747-10749)ACG>ATG	p.T3583M	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	3583					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding	p.T3583M(1)		skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TCTGGCTGGCGTTGTATCAGG	0.488																0.451613	127.638714	127.828325	42	51	KEEP	---	---	---	---	29	20	39	25	-1	capture	Missense_Mutation	SNP	61829891	61829891	ANK3	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	619	26
OR5M3	219482	broad.mit.edu	37	11	56237372	56237372	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56237372G>A	uc010rjk.1	-	1	602	c.602C>T	c.(601-603)GCC>GTC	p.A201V		NM_001004742	NP_001004742	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M,	201	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					GTTAATGCCGGCAAGTATGAT	0.413																0.02	-44.982948	6.706552	4	196	KEEP	---	---	---	---	4	0	128	94	-1	capture	Missense_Mutation	SNP	56237372	56237372	OR5M3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11079	26
OR9G4	283189	broad.mit.edu	37	11	56510792	56510792	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56510792C>A	uc010rjo.1	-	1	496	c.496G>T	c.(496-498)GGA>TGA	p.G166*		NM_001005284	NP_001005284	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G,	166	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						AAAAATCCTCCTATGTAGGAG	0.453																0.308725	127.888208	132.750072	46	103	KEEP	---	---	---	---	28	25	66	44	0.471698113208	capture	Nonsense_Mutation	SNP	56510792	56510792	OR9G4	11	C	A	A	A	1	0	0	0	0	0	1	0	0	312	24	5	4	11155	26
HNRNPUL2	221092	broad.mit.edu	37	11	62490074	62490074	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62490074G>A	uc001nuw.2	-	6	1287	c.1094C>T	c.(1093-1095)GCT>GTT	p.A365V	HNRNPUL2_uc001nuu.1_RNA	NM_001079559	NP_001073027	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like	365	B30.2/SPRY.				cell killing	nucleus	ATP binding|nucleic acid binding				0						AGCACTTACAGCAAAGCAGCC	0.458																0.024	-25.095586	6.388241	3	122	KEEP	---	---	---	---	2	1	66	59	-1	capture	Missense_Mutation	SNP	62490074	62490074	HNRNPUL2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	7200	26
KLC2	64837	broad.mit.edu	37	11	66033175	66033175	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66033175C>T	uc010rov.1	+	12	1627	c.1384C>T	c.(1384-1386)CAG>TAG	p.Q462*	KLC2_uc010row.1_Nonsense_Mutation_p.Q462*|KLC2_uc009yra.2_Intron|KLC2_uc001ohb.2_Nonsense_Mutation_p.Q462*|KLC2_uc010rox.1_Nonsense_Mutation_p.Q385*|KLC2_uc001ohc.2_Nonsense_Mutation_p.Q462*|KLC2_uc001ohd.2_Nonsense_Mutation_p.Q385*|KLC2_uc001ohe.1_Nonsense_Mutation_p.Q323*|RAB1B_uc001ohf.2_5'Flank	NM_001134775	NP_001128247	Q9H0B6	KLC2_HUMAN	kinesin light chain 2 isoform 1	462	TPR 6.				blood coagulation	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0						ATACCGGCGCCAGGGCAAGCT	0.647																0.378378	43.740672	44.221095	14	23	KEEP	---	---	---	---	9	6	13	13	-1	capture	Nonsense_Mutation	SNP	66033175	66033175	KLC2	11	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	8255	26
CHORDC1	26973	broad.mit.edu	37	11	89951306	89951306	+	Silent	SNP	T	C	C			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89951306T>C	uc001pdg.2	-	2	521	c.111A>G	c.(109-111)TTA>TTG	p.L37L	CHORDC1_uc009yvz.2_Silent_p.L37L	NM_012124	NP_036256	Q9UHD1	CHRD1_HUMAN	cysteine and histidine-rich domain-containing	37	Interaction with PPP5C (By similarity).|CHORD 1.				chaperone-mediated protein folding|regulation of response to stress|response to stress		Hsp90 protein binding|identical protein binding				0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)				TTCCTACCTTTAATGCATCGT	0.313																0.392857	81.240878	81.802886	22	34	KEEP	---	---	---	---	13	13	23	21	-1	capture	Silent	SNP	89951306	89951306	CHORDC1	11	T	C	C	C	1	0	0	0	0	0	0	0	1	790	61	3	3	3330	26
KLRK1	22914	broad.mit.edu	37	12	10525755	10525755	+	Silent	SNP	A	G	G			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10525755A>G	uc009zhj.2	-	8	773	c.609T>C	c.(607-609)TGT>TGC	p.C203C	uc001qya.1_Intron|KLRK1_uc001qyb.2_RNA|KLRK1_uc001qyc.2_Silent_p.C203C|KLRK1_uc009zhk.2_Silent_p.C203C|KLRK1_uc001qyd.2_Silent_p.C203C	NM_007360	NP_031386	P26718	NKG2D_HUMAN	NKG2-D type II integral membrane protein	203	Extracellular (Potential).|C-type lectin.				natural killer cell activation|T cell costimulation	integral to plasma membrane	sugar binding				0						TTGGAGTTGAACAGTTTTCTA	0.279																0.319231	289.937278	297.484821	83	177	KEEP	---	---	---	---	54	41	130	94	-1	capture	Silent	SNP	10525755	10525755	KLRK1	12	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	8343	26
PRB4	5545	broad.mit.edu	37	12	11461583	11461583	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11461583C>G	uc001qzf.1	-	3	368	c.334G>C	c.(334-336)GGT>CGT	p.G112R	PRB4_uc001qzt.2_Missense_Mutation_p.G112R	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	154	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.|6.		Missing (in allele M and allele S).	Missing (in Ref. 7; CAA30542).		extracellular region				ovary(1)	1						GGTGGGGTACCTTGGGACTGG	0.607													HNSCC(22;0.051)			0.013559	-151.424015	7.915618	8	582	KEEP	---	---	---	---	11	4	403	277	-1	capture	Missense_Mutation	SNP	11461583	11461583	PRB4	12	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	12341	26
PRB4	5545	broad.mit.edu	37	12	11461589	11461589	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11461589A>G	uc001qzf.1	-	3	362	c.328T>C	c.(328-330)TCC>CCC	p.S110P	PRB4_uc001qzt.2_Missense_Mutation_p.S110P	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	152	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.|6.		Missing (in allele M and allele S).			extracellular region				ovary(1)	1						GTACCTTGGGACTGGTTTCCT	0.602													HNSCC(22;0.051)			0.010274	-150.635611	10.567556	6	578	KEEP	---	---	---	---	9	5	396	281	-1	capture	Missense_Mutation	SNP	11461589	11461589	PRB4	12	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	12341	26
PIK3C2G	5288	broad.mit.edu	37	12	18552608	18552608	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18552608G>C	uc001rdt.2	+	15	2135	c.2019G>C	c.(2017-2019)AAG>AAC	p.K673N	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.K714N|PIK3C2G_uc010sic.1_Missense_Mutation_p.K492N	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	673					cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				CTGAAGAAAAGAAAAGATATT	0.378				p.K673N(SNU1041-Tumor)	655											0.234375	89.481786	97.746393	30	98	KEEP	---	---	---	---	13	22	52	60	-1	capture	Missense_Mutation	SNP	18552608	18552608	PIK3C2G	12	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	11814	26
OR6C74	254783	broad.mit.edu	37	12	55641790	55641790	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55641790C>T	uc010spg.1	+	1	719	c.719C>T	c.(718-720)TCT>TTT	p.S240F		NM_001005490	NP_001005490	A6NCV1	O6C74_HUMAN	olfactory receptor, family 6, subfamily C,	240	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						TCTACATGTTCTTCCCACATG	0.373																0.302013	130.71381	135.930843	45	104	KEEP	---	---	---	---	34	41	82	66	-1	capture	Missense_Mutation	SNP	55641790	55641790	OR6C74	12	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	11102	26
LRP1	4035	broad.mit.edu	37	12	57569290	57569290	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57569290G>C	uc001snd.2	+	23	4061	c.3595G>C	c.(3595-3597)GCA>CCA	p.A1199P		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	1199	EGF-like 5.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTGCTCAGTGGCACCTGGCGA	0.602					1456									OREG0021937	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.350877	61.669413	62.793259	20	37	KEEP	---	---	---	---	24	9	35	29	-1	capture	Missense_Mutation	SNP	57569290	57569290	LRP1	12	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	8867	26
GALNT9	50614	broad.mit.edu	37	12	132682414	132682414	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132682414C>T	uc001ukc.3	-	10	1704	c.1588G>A	c.(1588-1590)GGC>AGC	p.G530S	GALNT9_uc009zyr.2_Missense_Mutation_p.G304S|GALNT9_uc001ukb.2_Missense_Mutation_p.G387S|GALNT9_uc001uka.2_Missense_Mutation_p.G164S	NM_001122636	NP_001116108	Q9HCQ5	GALT9_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	530	Ricin B-type lectin.|Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		CGGCCCGTGCCGTCATCCACC	0.657	Colon(186;2147 2752 13553 41466)															0.28	18.411848	19.501764	7	18	KEEP	---	---	---	---	3	5	11	10	-1	capture	Missense_Mutation	SNP	132682414	132682414	GALNT9	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6160	26
SYNE2	23224	broad.mit.edu	37	14	64457171	64457171	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64457171A>G	uc001xgm.2	+	20	2586	c.2356A>G	c.(2356-2358)AGA>GGA	p.R786G	SYNE2_uc001xgl.2_Missense_Mutation_p.R786G	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	786	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GCTTATGGCAAGAAGTGAAGA	0.343																0.243697	89.110661	96.239638	29	90	KEEP	---	---	---	---	24	27	61	39	-1	capture	Missense_Mutation	SNP	64457171	64457171	SYNE2	14	A	G	G	G	1	0	0	0	0	1	0	0	0	36	3	3	3	15334	26
GABRA5	2558	broad.mit.edu	37	15	27182399	27182399	+	Silent	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:27182399G>A	uc001zbd.1	+	9	987	c.648G>A	c.(646-648)GCG>GCA	p.A216A	GABRB3_uc001zbb.2_Intron	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	216	Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TGGTGGTGGCGGAAGATGGCT	0.577																0.293478	79.78853	83.300762	27	65	KEEP	---	---	---	---	14	14	42	29	-1	capture	Silent	SNP	27182399	27182399	GABRA5	15	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6106	26
BAHD1	22893	broad.mit.edu	37	15	40751044	40751044	+	Silent	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40751044C>T	uc001zlu.2	+	2	452	c.381C>T	c.(379-381)CTC>CTT	p.L127L	BAHD1_uc001zlt.2_Silent_p.L127L|BAHD1_uc010bbp.1_Silent_p.L127L|BAHD1_uc001zlv.2_Silent_p.L127L	NM_014952	NP_055767	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	127					heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding				0		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		CTGAAGCTCTCAATAACCTGC	0.682																0.329114	70.9177	72.96563	26	53	KEEP	---	---	---	---	16	12	33	26	-1	capture	Silent	SNP	40751044	40751044	BAHD1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	1286	26
CKMT1A	548596	broad.mit.edu	37	15	43991225	43991225	+	Missense_Mutation	SNP	C	T	T	rs148934583		TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43991225C>T	uc001zsn.2	+	10	1584	c.1192C>T	c.(1192-1194)CGG>TGG	p.R398W	CKMT1A_uc010uea.1_Missense_Mutation_p.R429W|CKMT1A_uc001zso.3_Missense_Mutation_p.R398W	NM_001015001	NP_001015001	P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1A precursor	398	Phosphagen kinase C-terminal.				creatine metabolic process	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	TGATTGTGAACGGCGTCTGGA	0.493																0.293269	170.294719	178.25101	61	147	KEEP	---	---	---	---	27	50	89	105	-1	capture	Missense_Mutation	SNP	43991225	43991225	CKMT1A	15	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	3414	26
CREBBP	1387	broad.mit.edu	37	16	3807844	3807844	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3807844A>G	uc002cvv.2	-	18	3779	c.3575T>C	c.(3574-3576)GTC>GCC	p.V1192A	CREBBP_uc002cvw.2_Missense_Mutation_p.V1154A	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1192					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGACTGCATGACAGGGTCAAT	0.443					748	T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				0.029703	-17.566202	6.968901	3	98	KEEP	---	---	---	---	0	4	49	59	-1	capture	Missense_Mutation	SNP	3807844	3807844	CREBBP	16	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	3826	26
XYLT1	64131	broad.mit.edu	37	16	17228564	17228564	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:17228564C>T	uc002dfa.2	-	9	1878	c.1793G>A	c.(1792-1794)CGC>CAC	p.R598H		NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	598	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						TTCAAACTTGCGGGCAAAGAA	0.552																0.014535	-83.626247	8.558936	5	339	KEEP	---	---	---	---	2	3	194	211	-1	capture	Missense_Mutation	SNP	17228564	17228564	XYLT1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17344	26
ZNF23	7571	broad.mit.edu	37	16	71482423	71482423	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:71482423T>C	uc002faf.2	-	6	2319	c.1505A>G	c.(1504-1506)AAG>AGG	p.K502R	ZNF23_uc002fad.2_Missense_Mutation_p.K444R|ZNF23_uc002fae.2_Missense_Mutation_p.K444R|ZNF23_uc010vmf.1_Missense_Mutation_p.K444R|ZNF23_uc002fag.2_Missense_Mutation_p.K444R|ZNF23_uc002fah.2_Missense_Mutation_p.K502R|ZNF23_uc002fai.2_Missense_Mutation_p.K541R	NM_145911	NP_666016	P17027	ZNF23_HUMAN	zinc finger protein 23	502					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		TTGATAGGGCTTTTCTCCAGT	0.403																0.017442	-37.835354	7.366487	3	169	KEEP	---	---	---	---	2	1	109	100	-1	capture	Missense_Mutation	SNP	71482423	71482423	ZNF23	16	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	17663	26
MYH2	4620	broad.mit.edu	37	17	10428788	10428788	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10428788C>T	uc010coi.2	-	32	4645	c.4517G>A	c.(4516-4518)CGA>CAA	p.R1506Q	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.R1506Q|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1506	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	p.R1506*(1)		ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TTTGTTCTCTCGCTTCAGGGT	0.428																0.315	184.25044	190.341205	63	137	KEEP	---	---	---	---	42	28	77	87	-1	capture	Missense_Mutation	SNP	10428788	10428788	MYH2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9945	26
MYH2	4620	broad.mit.edu	37	17	10442604	10442604	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10442604C>T	uc010coi.2	-	14	1462	c.1334G>A	c.(1333-1335)CGC>CAC	p.R445H	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.R445H|MYH2_uc010coj.2_Missense_Mutation_p.R445H	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	445	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	p.R445H(1)		ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						CTGGTTGATGCGGGCAACCAT	0.473																0.016835	-71.434412	6.908658	5	292	KEEP	---	---	---	---	4	2	175	171	-1	capture	Missense_Mutation	SNP	10442604	10442604	MYH2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9945	26
GAS2L2	246176	broad.mit.edu	37	17	34074267	34074267	+	Silent	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34074267G>A	uc002hjv.1	-	5	881	c.853C>T	c.(853-855)CTG>TTG	p.L285L		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	285					cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGGGGCTTCAGGAAGCTGCCT	0.597																0.360606	384.936357	390.580353	119	211	KEEP	---	---	---	---	74	75	139	118	-1	capture	Silent	SNP	34074267	34074267	GAS2L2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	6187	26
KRT33B	3884	broad.mit.edu	37	17	39522870	39522870	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39522870G>A	uc002hwl.2	-	3	485	c.440C>T	c.(439-441)ACG>ATG	p.T147M		NM_002279	NP_002270	Q14525	KT33B_HUMAN	type I hair keratin 3B	147	Rod.|Coil 1B.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)				GGACTGCTCCGTCTGGTACCT	0.517																0.338235	65.504058	67.077605	23	45	KEEP	---	---	---	---	11	16	35	41	-1	capture	Missense_Mutation	SNP	39522870	39522870	KRT33B	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8390	26
KRT34	3885	broad.mit.edu	37	17	39535941	39535941	+	Missense_Mutation	SNP	C	T	T	rs140296098	byFrequency	TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39535941C>T	uc002hwm.2	-	4	769	c.757G>A	c.(757-759)GTG>ATG	p.V253M		NM_021013	NP_066293	O76011	KRT34_HUMAN	keratin 34	253	Rod.|Linker 12.				epidermis development	intermediate filament	protein binding|structural molecule activity			central_nervous_system(1)	1		Breast(137;0.000496)				TCCACCTCCACGTTGAGGCGG	0.552																0.290323	51.626647	54.067946	18	44	KEEP	---	---	---	---	10	13	25	26	-1	capture	Missense_Mutation	SNP	39535941	39535941	KRT34	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8391	26
OTOP3	347741	broad.mit.edu	37	17	72937902	72937902	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72937902G>A	uc010wrr.1	+	2	488	c.488G>A	c.(487-489)CGG>CAG	p.R163Q	OTOP3_uc010wrq.1_Missense_Mutation_p.R145Q	NM_178233	NP_839947	Q7RTS5	OTOP3_HUMAN	otopetrin 3	163	Helical; (Potential).					integral to membrane|intracellular	zinc ion binding			ovary(1)	1	all_lung(278;0.151)|Lung NSC(278;0.185)					CTCTGGGTGCGGGGTGAGTGT	0.687																0.285714	23.088421	24.242127	8	20	KEEP	---	---	---	---	5	5	15	7	-1	capture	Missense_Mutation	SNP	72937902	72937902	OTOP3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11211	26
ZFR2	23217	broad.mit.edu	37	19	3825291	3825291	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3825291C>T	uc002lyw.2	-	7	1162	c.1150G>A	c.(1150-1152)GTG>ATG	p.V384M	ZFR2_uc010xhx.1_Intron	NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1	384						intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GAGGCACACACGCTGGGGCCA	0.672																0.235294	8.490514	9.580948	4	13	KEEP	---	---	---	---	2	4	5	14	-1	capture	Missense_Mutation	SNP	3825291	3825291	ZFR2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17540	26
OR7D2	162998	broad.mit.edu	37	19	9297245	9297245	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9297245C>T	uc002mkz.1	+	1	976	c.788C>T	c.(787-789)GCG>GTG	p.A263V		NM_175883	NP_787079	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D,	263	Extracellular (Potential).				regulation of transcription, DNA-dependent|sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|upper_aerodigestive_tract(1)	3						TTCACTTCTGCGGTGACTCAC	0.507																0.1875	103.94107	127.358109	48	208	KEEP	---	---	---	---	23	31	126	112	-1	capture	Missense_Mutation	SNP	9297245	9297245	OR7D2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11123	26
TRMT1	55621	broad.mit.edu	37	19	13218442	13218442	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13218442C>T	uc002mwj.2	-	13	1779	c.1529G>A	c.(1528-1530)CGG>CAG	p.R510Q	TRMT1_uc010xmy.1_Missense_Mutation_p.R114Q|TRMT1_uc002mwk.2_Missense_Mutation_p.R481Q|TRMT1_uc002mwl.3_Missense_Mutation_p.R510Q|TRMT1_uc010xmz.1_Missense_Mutation_p.R296Q	NM_017722	NP_060192	Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 isoform 1	510							RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		TAGTCGCTCCCGTTTCACCGG	0.617																0.230769	30.673034	34.126901	12	40	KEEP	---	---	---	---	9	5	18	35	-1	capture	Missense_Mutation	SNP	13218442	13218442	TRMT1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16444	26
NLRP2	55655	broad.mit.edu	37	19	55494686	55494686	+	Silent	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55494686C>T	uc002qij.2	+	6	1706	c.1620C>T	c.(1618-1620)TCC>TCT	p.S540S	NLRP2_uc010yfp.1_Silent_p.S517S|NLRP2_uc010esn.2_Silent_p.S516S|NLRP2_uc010eso.2_Silent_p.S537S|NLRP2_uc010esp.2_Silent_p.S518S	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	540					apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		AGCTGCTTTCCGGAGTAGAAA	0.552																0.337748	157.385547	160.897724	51	100	KEEP	---	---	---	---	33	30	59	56	-1	capture	Silent	SNP	55494686	55494686	NLRP2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10384	26
SCN7A	6332	broad.mit.edu	37	2	167327191	167327191	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167327191C>A	uc002udu.1	-	6	725	c.598G>T	c.(598-600)GAC>TAC	p.D200Y	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	200	Helical; Name=S3 of repeat I; (By similarity).				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						GGAATGAAGTCCAGAGGTGAG	0.294																0.266667	40.970206	43.922721	16	44	KEEP	---	---	---	---	9	10	28	28	0.526315789474	capture	Missense_Mutation	SNP	167327191	167327191	SCN7A	2	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	13816	26
PDYN	5173	broad.mit.edu	37	20	1961100	1961100	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1961100G>A	uc010gaj.2	-	3	876	c.634C>T	c.(634-636)CGG>TGG	p.R212W	uc002wfu.1_Intron|PDYN_uc002wfv.2_Missense_Mutation_p.R212W|PDYN_uc010zpt.1_Missense_Mutation_p.R57W	NM_024411	NP_077722	P01213	PDYN_HUMAN	beta-neoendorphin-dynorphin preproprotein	212			R -> W (in SCA23; the mutant PDYN protein is produced, but processing to opioid peptides is dramatically affected, with increased levels of dynorphin A compared to dynorphin B; mutant dynorphin A is neurotoxic to cultured striatal neurons, suggesting a dominant-negative effect).		cell death|neuropeptide signaling pathway|synaptic transmission	extracellular region|plasma membrane	opioid peptide activity			upper_aerodigestive_tract(1)|ovary(1)	2						CGAATGCGCCGCAAGAAGCCC	0.587																0.012658	-79.083514	6.705577	4	312	KEEP	---	---	---	---	2	2	167	187	-1	capture	Missense_Mutation	SNP	1961100	1961100	PDYN	20	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	11602	26
SPAG4	6676	broad.mit.edu	37	20	34206631	34206631	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:34206631G>A	uc002xdb.1	+	7	823	c.706G>A	c.(706-708)GCC>ACC	p.A236T	SPAG4_uc010zvi.1_Missense_Mutation_p.A159T	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	236	Potential.				spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity				0	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			TGTTCGGGCAGCCAACAGCGA	0.642																0.115385	3.404639	7.194657	3	23	KEEP	---	---	---	---	2	1	9	20	-1	capture	Missense_Mutation	SNP	34206631	34206631	SPAG4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	14872	26
PCIF1	63935	broad.mit.edu	37	20	44571848	44571848	+	Silent	SNP	C	T	T	rs35751664		TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44571848C>T	uc002xqs.2	+	8	1100	c.786C>T	c.(784-786)TCC>TCT	p.S262S	PCIF1_uc002xqt.2_5'Flank	NM_022104	NP_071387	Q9H4Z3	PCIF1_HUMAN	phosphorylated CTD interacting factor 1	262						nucleus				skin(1)	1						TGTCACCTTCCATGTTTCGTG	0.527																0.242991	144.288299	157.17682	52	162	KEEP	---	---	---	---	32	26	95	93	-1	capture	Silent	SNP	44571848	44571848	PCIF1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	11483	26
RIPK4	54101	broad.mit.edu	37	21	43161994	43161994	+	Silent	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43161994G>A	uc002yzn.1	-	8	1407	c.1359C>T	c.(1357-1359)TGC>TGT	p.C453C		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	453						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity	p.C453C(1)		ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						GCCACTTGGCGCACTCCTCTT	0.657					268											0.352518	137.419532	140.091499	49	90	KEEP	---	---	---	---	40	42	73	68	-1	capture	Silent	SNP	43161994	43161994	RIPK4	21	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	13275	26
SLC5A4	6527	broad.mit.edu	37	22	32650199	32650199	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32650199G>A	uc003ami.2	-	2	139	c.137C>T	c.(136-138)GCG>GTG	p.A46V		NM_014227	NP_055042	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (low affinity glucose	46	Helical; (Potential).				carbohydrate transport|sodium ion transport	integral to membrane	symporter activity				0						CTTCAGCATCGCCTGAGCAGA	0.572																0.394737	82.026301	82.765504	30	46	KEEP	---	---	---	---	17	15	24	31	-1	capture	Missense_Mutation	SNP	32650199	32650199	SLC5A4	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14559	26
ISX	91464	broad.mit.edu	37	22	35480407	35480407	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:35480407G>A	uc003anj.2	+	3	1364	c.413G>A	c.(412-414)CGG>CAG	p.R138Q	ISX_uc011amg.1_Missense_Mutation_p.R126Q	NM_001008494	NP_001008494	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	138	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)	5						GCCAAGTGGCGGAAGCAGGAG	0.537																0.259259	39.024627	41.859406	14	40	KEEP	---	---	---	---	10	6	28	20	-1	capture	Missense_Mutation	SNP	35480407	35480407	ISX	22	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7788	26
SGSM3	27352	broad.mit.edu	37	22	40803235	40803235	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:40803235A>G	uc003ayu.1	+	12	1480	c.1271A>G	c.(1270-1272)AAG>AGG	p.K424R	SGSM3_uc011aos.1_Missense_Mutation_p.K357R|SGSM3_uc011aot.1_Missense_Mutation_p.K361R|SGSM3_uc010gyd.1_Missense_Mutation_p.K467R	NM_015705	NP_056520	Q96HU1	SGSM3_HUMAN	small G protein signaling modulator 3	424	Potential.				cell cycle arrest|Rap protein signal transduction	cytoplasm	Rab GTPase activator activity|Rab GTPase binding			ovary(2)	2						CTCAAGGCCAAGAACATCAAG	0.627																0.357895	120.627854	122.31565	34	61	KEEP	---	---	---	---	18	18	32	40	-1	capture	Missense_Mutation	SNP	40803235	40803235	SGSM3	22	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	14117	26
RBMS3	27303	broad.mit.edu	37	3	29938905	29938905	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:29938905G>A	uc003cel.2	+	9	1057	c.827G>A	c.(826-828)CGC>CAC	p.R276H	RBMS3_uc003cek.2_Missense_Mutation_p.R276H|RBMS3_uc010hfq.2_Missense_Mutation_p.R289H|RBMS3_uc003cem.2_Missense_Mutation_p.R275H|RBMS3_uc010hfr.2_Missense_Mutation_p.R276H	NM_001003793	NP_001003793	Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting	276						cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)				GCAACCAACCGCATGATTCCA	0.433																0.327138	261.31287	268.439359	88	181	KEEP	---	---	---	---	56	51	108	111	-1	capture	Missense_Mutation	SNP	29938905	29938905	RBMS3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13045	26
DNAH1	25981	broad.mit.edu	37	3	52422625	52422625	+	Silent	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52422625G>A	uc011bef.1	+	58	9624	c.9363G>A	c.(9361-9363)AAG>AAA	p.K3121K	DNAH1_uc003ddv.2_5'UTR	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3121	Potential.				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GAGCTGGCAAGGTGCGCACCC	0.657																0.25	12.464893	13.601546	5	15	KEEP	---	---	---	---	2	3	7	10	-1	capture	Silent	SNP	52422625	52422625	DNAH1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	4555	26
FETUB	26998	broad.mit.edu	37	3	186362610	186362610	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186362610C>A	uc010hyq.2	+	5	756	c.495C>A	c.(493-495)CAC>CAA	p.H165Q	FETUB_uc011brz.1_Missense_Mutation_p.H17Q|FETUB_uc003fqn.2_Missense_Mutation_p.H165Q|FETUB_uc003fqo.2_Missense_Mutation_p.H60Q|FETUB_uc010hyr.2_Missense_Mutation_p.H128Q|FETUB_uc010hys.2_Missense_Mutation_p.H17Q|FETUB_uc003fqp.3_Missense_Mutation_p.H100Q	NM_014375	NP_055190	Q9UGM5	FETUB_HUMAN	fetuin B precursor	165	Cystatin fetuin-B-type 2.					extracellular space	cysteine-type endopeptidase inhibitor activity			ovary(1)|lung(1)	2	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		CTTCCAATCACCAAGTGCTGG	0.443																0.347305	176.900121	180.336995	58	109	KEEP	---	---	---	---	32	39	72	59	0.549295774648	capture	Missense_Mutation	SNP	186362610	186362610	FETUB	3	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	5767	26
GABRA4	2557	broad.mit.edu	37	4	46973176	46973176	+	Silent	SNP	C	T	T	rs147092196		TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:46973176C>T	uc003gxg.2	-	7	937	c.798G>A	c.(796-798)CCG>CCA	p.P266P		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	266	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TCATAATGCACGGAATATAGG	0.368	Ovarian(6;283 369 8234 12290 33402)															0.351852	113.417482	115.508273	38	70	KEEP	---	---	---	---	21	18	37	38	-1	capture	Silent	SNP	46973176	46973176	GABRA4	4	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	6105	26
UGT2B7	7364	broad.mit.edu	37	4	69962448	69962448	+	Silent	SNP	C	T	T	rs151180306		TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69962448C>T	uc003heg.3	+	1	256	c.210C>T	c.(208-210)TCC>TCT	p.S70S	UGT2B7_uc010ihq.2_Silent_p.S70S	NM_001074	NP_001065	P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2B7 precursor	70					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			ovary(1)|skin(1)	2						ACAACTCATCCGCTCTTAAAA	0.373																0.278075	148.138495	156.412418	52	135	KEEP	---	---	---	---	32	25	79	63	-1	capture	Silent	SNP	69962448	69962448	UGT2B7	4	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16844	26
GLRA3	8001	broad.mit.edu	37	4	175598335	175598335	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175598335G>A	uc003ity.1	-	7	1324	c.821C>T	c.(820-822)TCA>TTA	p.S274L	GLRA3_uc003itz.1_Missense_Mutation_p.S274L	NM_006529	NP_006520	O75311	GLRA3_HUMAN	glycine receptor, alpha 3 isoform a	274	Helical; (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)	GATCCAGAATGAAACCCAGGA	0.478																0.291139	65.092569	68.17999	23	56	KEEP	---	---	---	---	18	8	33	27	-1	capture	Missense_Mutation	SNP	175598335	175598335	GLRA3	4	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	6392	26
PRDM9	56979	broad.mit.edu	37	5	23526914	23526914	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23526914A>T	uc003jgo.2	+	11	1899	c.1717A>T	c.(1717-1719)ATA>TTA	p.I573L		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	573	C2H2-type 3.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						TCACCAGAGGATACACACAGG	0.562													HNSCC(3;0.000094)			0.041096	-31.812662	17.807016	9	210	KEEP	---	---	---	---	4	5	125	114	-1	capture	Missense_Mutation	SNP	23526914	23526914	PRDM9	5	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	12359	26
AP3S1	1176	broad.mit.edu	37	5	115249179	115249179	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:115249179T>C	uc003krl.2	+	6	690	c.574T>C	c.(574-576)TTT>CTT	p.F192L	AP3S1_uc003krk.2_Missense_Mutation_p.F170L|AP3S1_uc003krm.2_Missense_Mutation_p.F156L	NM_001284	NP_001275	Q92572	AP3S1_HUMAN	adaptor-related protein complex 3, sigma 1	192					insulin receptor signaling pathway|intracellular protein transport|vesicle-mediated transport	AP-type membrane coat adaptor complex|cytoplasmic vesicle membrane|Golgi apparatus|transport vesicle	protein binding|protein transporter activity				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;1.08e-07)|Epithelial(69;1.11e-06)|all cancers(49;5.2e-05)		CCTGCCCTCTTTTAAATAAAA	0.393																0.183406	118.822439	140.35339	42	187	KEEP	---	---	---	---	17	30	124	99	-1	capture	Missense_Mutation	SNP	115249179	115249179	AP3S1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	742	26
PCDHA13	56136	broad.mit.edu	37	5	140263908	140263908	+	Silent	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140263908C>T	uc003lif.2	+	1	2055	c.2055C>T	c.(2053-2055)GGC>GGT	p.G685G	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Silent_p.G685G|PCDHA13_uc003lid.2_Silent_p.G685G	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	685	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTCGGCAGGCGCTGTGGGTC	0.632	Melanoma(147;1739 1852 5500 27947 37288)															0.363636	79.798794	81.050077	28	49	KEEP	---	---	---	---	16	19	36	49	-1	capture	Silent	SNP	140263908	140263908	PCDHA13	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11426	26
PCDHB12	56124	broad.mit.edu	37	5	140590224	140590224	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140590224C>T	uc003liz.2	+	1	1934	c.1745C>T	c.(1744-1746)CCG>CTG	p.P582L	PCDHB12_uc011dak.1_Missense_Mutation_p.P245L	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	582	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGGCCGAGCCGGGCTACCTG	0.692																0.291209	152.137747	159.224039	53	129	KEEP	---	---	---	---	26	38	114	95	-1	capture	Missense_Mutation	SNP	140590224	140590224	PCDHB12	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11440	26
PCDHGA5	56110	broad.mit.edu	37	5	140745008	140745008	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140745008G>A	uc003lju.1	+	1	1111	c.1111G>A	c.(1111-1113)GTA>ATA	p.V371I	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Missense_Mutation_p.V371I	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5 isoform 1	371	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGTTTAGCGTACATGATGG	0.443																0.307018	99.485259	103.268909	35	79	KEEP	---	---	---	---	19	22	49	40	-1	capture	Missense_Mutation	SNP	140745008	140745008	PCDHGA5	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11460	26
DOCK2	1794	broad.mit.edu	37	5	169503081	169503081	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169503081G>A	uc003maf.2	+	47	4939	c.4859G>A	c.(4858-4860)CGA>CAA	p.R1620Q	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.R1112Q|DOCK2_uc003mah.2_Missense_Mutation_p.R176Q	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1620	DHR-2.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TACGGTGTCCGAGAGATGGTA	0.532																0.490196	158.244311	158.25293	50	52	KEEP	---	---	---	---	26	30	33	30	-1	capture	Missense_Mutation	SNP	169503081	169503081	DOCK2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4643	26
AGPAT1	10554	broad.mit.edu	37	6	32138354	32138354	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32138354G>A	uc003oae.2	-	4	676	c.358C>T	c.(358-360)CGC>TGC	p.R120C	PPT2_uc003nzy.1_RNA|AGPAT1_uc011dpj.1_RNA|AGPAT1_uc011dpk.1_Missense_Mutation_p.R84C|AGPAT1_uc003oaf.2_Missense_Mutation_p.R120C|AGPAT1_uc003oag.2_Intron|AGPAT1_uc003oah.2_Missense_Mutation_p.R120C|AGPAT1_uc003oai.1_Missense_Mutation_p.R120C|AGPAT1_uc011dpl.1_Missense_Mutation_p.R8C	NM_006411	NP_006402	Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	120					energy reserve metabolic process|phosphatidic acid biosynthetic process|positive regulation of cellular metabolic process|positive regulation of cytokine production|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			central_nervous_system(1)	1						GGCACACAGCGGCCTGGCAGT	0.652																0.354839	103.951652	105.677304	33	60	KEEP	---	---	---	---	14	25	38	30	-1	capture	Missense_Mutation	SNP	32138354	32138354	AGPAT1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	386	26
SPDEF	25803	broad.mit.edu	37	6	34508955	34508955	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:34508955G>C	uc003ojq.1	-	3	855	c.440C>G	c.(439-441)CCC>CGC	p.P147R	SPDEF_uc011dsq.1_Missense_Mutation_p.P147R	NM_012391	NP_036523	O95238	SPDEF_HUMAN	SAM pointed domain containing ets transcription	147	PNT.				negative regulation of survival gene product expression|negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	p.P147R(1)		skin(3)|ovary(1)|central_nervous_system(1)	5						CCAGTCCATGGGATCTGGGCA	0.647																0.388889	19.924244	20.117686	7	11	KEEP	---	---	---	---	1	6	6	8	-1	capture	Missense_Mutation	SNP	34508955	34508955	SPDEF	6	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	14918	26
KHDRBS2	202559	broad.mit.edu	37	6	62604709	62604709	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:62604709G>A	uc003peg.2	-	6	888	c.641C>T	c.(640-642)CCA>CTA	p.P214L		NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal	214	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		TCCAGGTGGTGGGGGAGGAGG	0.557																0.337838	73.652689	75.373402	25	49	KEEP	---	---	---	---	12	16	34	25	-1	capture	Missense_Mutation	SNP	62604709	62604709	KHDRBS2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	8069	26
ANKRD6	22881	broad.mit.edu	37	6	90337365	90337365	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:90337365C>T	uc003pni.3	+	14	1776	c.1435C>T	c.(1435-1437)CGC>TGC	p.R479C	ANKRD6_uc003pne.3_Missense_Mutation_p.R479C|ANKRD6_uc003pnf.3_Missense_Mutation_p.R444C|ANKRD6_uc011dzy.1_Missense_Mutation_p.R479C|ANKRD6_uc010kcd.2_Missense_Mutation_p.R420C|LYRM2_uc010kce.1_Intron|LYRM2_uc003png.2_Intron|ANKRD6_uc003pnh.3_Missense_Mutation_p.R75C|LYRM2_uc010kcf.1_Intron|ANKRD6_uc003pnj.3_Missense_Mutation_p.R75C	NM_014942	NP_055757	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	479							protein binding			ovary(2)|pancreas(1)	3		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		GTGCCTGAACCGCCTGCAACA	0.512																0.414634	109.941629	110.461758	34	48	KEEP	---	---	---	---	17	21	36	29	-1	capture	Missense_Mutation	SNP	90337365	90337365	ANKRD6	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	680	26
KIAA1244	57221	broad.mit.edu	37	6	138531166	138531166	+	Silent	SNP	G	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:138531166G>T	uc003qhu.2	+	4	339	c.339G>T	c.(337-339)GTG>GTT	p.V113V		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	113					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		ACCTGCAGGTGGAAGTGATGA	0.502																0.348315	93.79677	95.604731	31	58	KEEP	---	---	---	---	13	19	40	26	0.40625	capture	Silent	SNP	138531166	138531166	KIAA1244	6	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	8139	26
KIAA1244	57221	broad.mit.edu	37	6	138657552	138657552	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:138657552G>A	uc003qhu.2	+	34	6463	c.6463G>A	c.(6463-6465)GAC>AAC	p.D2155N		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	2155					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TCACGTGACCGACATCAGAGT	0.562																0.266304	130.500721	139.573225	49	135	KEEP	---	---	---	---	36	28	74	88	-1	capture	Missense_Mutation	SNP	138657552	138657552	KIAA1244	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8139	26
PLG	5340	broad.mit.edu	37	6	161139731	161139731	+	Silent	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161139731G>A	uc003qtm.3	+	9	1020	c.957G>A	c.(955-957)TTG>TTA	p.L319L		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	319	Kringle 3.				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TCAGAAATTTGGATGAAAACT	0.453																0.37037	87.325178	88.522607	30	51	KEEP	---	---	---	---	16	18	31	34	-1	capture	Silent	SNP	161139731	161139731	PLG	6	G	A	A	A	1	0	0	0	0	0	0	0	1	607	47	2	2	11989	26
GHRHR	2692	broad.mit.edu	37	7	31016046	31016046	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31016046G>A	uc003tbx.2	+	11	1025	c.977G>A	c.(976-978)CGT>CAT	p.R326H	GHRHR_uc003tby.2_Missense_Mutation_p.R262H|GHRHR_uc003tbz.2_Silent_p.A92A	NM_000823	NP_000814	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	326	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation|positive regulation of growth hormone secretion|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of multicellular organism growth|response to estrogen stimulus|response to glucocorticoid stimulus	cell surface|integral to membrane|nuclear inner membrane|nuclear matrix|nuclear outer membrane|plasma membrane|stored secretory granule	growth factor binding|growth hormone-releasing hormone receptor activity|peptide hormone binding			ovary(2)|lung(1)|breast(1)|large_intestine(1)	5					Sermorelin(DB00010)	TCCTGCAGGCGTCTCTCCAAG	0.423																0.36	105.070983	106.797137	36	64	KEEP	---	---	---	---	24	19	37	36	-1	capture	Missense_Mutation	SNP	31016046	31016046	GHRHR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6312	26
EGFR	1956	broad.mit.edu	37	7	55220274	55220274	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55220274C>T	uc003tqk.2	+	6	910	c.664C>T	c.(664-666)CGC>TGC	p.R222C	EGFR_uc003tqh.2_Missense_Mutation_p.R222C|EGFR_uc003tqi.2_Missense_Mutation_p.R222C|EGFR_uc003tqj.2_Missense_Mutation_p.R222C|EGFR_uc010kzg.1_Missense_Mutation_p.R177C|EGFR_uc011kco.1_Missense_Mutation_p.R169C|EGFR_uc003tql.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	222	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.R222C(2)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GTGCTCCGGGCGCTGCCGTGG	0.597			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.819079	2427.131034	2514.3934	747	165	KEEP	---	---	---	---	433	399	95	70	-1	capture	Missense_Mutation	SNP	55220274	55220274	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4922	26
WBSCR28	135886	broad.mit.edu	37	7	73280082	73280082	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73280082C>T	uc003tzk.2	+	3	713	c.677C>T	c.(676-678)GCC>GTC	p.A226V	RFC2_uc011kfa.1_Intron|WBSCR28_uc003tzl.2_Missense_Mutation_p.A125V	NM_182504	NP_872310	Q6UE05	WBS28_HUMAN	hypothetical protein LOC135886	226						integral to membrane				breast(1)	1		Lung NSC(55;0.159)				ACCCAGCTGGCCGAGGCCCAG	0.627																0.009506	-138.779116	7.243243	5	521	KEEP	---	---	---	---	5	1	290	294	-1	capture	Missense_Mutation	SNP	73280082	73280082	WBSCR28	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	17148	26
ASNS	440	broad.mit.edu	37	7	97484694	97484694	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:97484694G>A	uc003uot.3	-	9	1614	c.1108C>T	c.(1108-1110)CTT>TTT	p.L370F	ASNS_uc011kin.1_Missense_Mutation_p.L287F|ASNS_uc003uou.3_Missense_Mutation_p.L370F|ASNS_uc003uov.3_Missense_Mutation_p.L370F|ASNS_uc011kio.1_Missense_Mutation_p.L349F|ASNS_uc003uow.3_Missense_Mutation_p.L349F|ASNS_uc003uox.3_Missense_Mutation_p.L287F	NM_133436	NP_597680	P08243	ASNS_HUMAN	asparagine synthetase	370	Asparagine synthetase.				cellular response to glucose starvation|glutamine metabolic process|negative regulation of apoptosis|positive regulation of mitotic cell cycle	cytosol|soluble fraction	asparagine synthase (glutamine-hydrolyzing) activity|ATP binding			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	CCCTGCGTAAGTTCATCTGAT	0.338	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)															0.171296	83.634077	105.700253	37	179	KEEP	---	---	---	---	20	26	105	115	-1	capture	Missense_Mutation	SNP	97484694	97484694	ASNS	7	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	1039	26
CNTNAP2	26047	broad.mit.edu	37	7	146997332	146997332	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:146997332G>A	uc003weu.1	+	9	1964	c.1448G>A	c.(1447-1449)CGA>CAA	p.R483Q		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	483	Extracellular (Potential).|Laminin G-like 2.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TCAGCAGTTCGAACTAATAGT	0.423													HNSCC(39;0.1)			0.208333	120.61315	139.52257	50	190	KEEP	---	---	---	---	25	30	105	110	-1	capture	Missense_Mutation	SNP	146997332	146997332	CNTNAP2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3612	26
PTPRD	5789	broad.mit.edu	37	9	8633320	8633320	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:8633320G>A	uc003zkk.2	-	13	1060	c.349C>T	c.(349-351)CGG>TGG	p.R117W	PTPRD_uc003zkp.2_Missense_Mutation_p.R117W|PTPRD_uc003zkq.2_Missense_Mutation_p.R117W|PTPRD_uc003zkr.2_Missense_Mutation_p.R117W|PTPRD_uc003zks.2_Missense_Mutation_p.R117W|PTPRD_uc003zkl.2_Missense_Mutation_p.R117W|PTPRD_uc003zkm.2_Missense_Mutation_p.R117W|PTPRD_uc003zkn.2_Missense_Mutation_p.R117W|PTPRD_uc003zko.2_Missense_Mutation_p.R117W|PTPRD_uc003zkt.1_Missense_Mutation_p.R117W	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	117	Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CACTTACCCCGCAAAACTGTG	0.418				p.R117W(NCIH1781-Tumor)	1253								TSP Lung(15;0.13)			0.028369	-27.626068	6.921067	4	137	KEEP	---	---	---	---	5	0	71	94	-1	capture	Missense_Mutation	SNP	8633320	8633320	PTPRD	9	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	12694	26
KIAA1797	54914	broad.mit.edu	37	9	20976500	20976500	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:20976500C>A	uc003zog.1	+	38	4577	c.4214C>A	c.(4213-4215)CCT>CAT	p.P1405H	KIAA1797_uc003zoh.1_Missense_Mutation_p.P841H	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	1405						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		CAATATCCTCCTGTGAACTGG	0.393																0.024242	-34.354603	7.141476	4	161	KEEP	---	---	---	---	2	2	89	92	0.5	capture	Missense_Mutation	SNP	20976500	20976500	KIAA1797	9	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	8180	26
NXNL2	158046	broad.mit.edu	37	9	91150637	91150637	+	Silent	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:91150637C>T	uc011ltj.1	+	1	622	c.288C>T	c.(286-288)CAC>CAT	p.H96H	NXNL2_uc004aqa.2_Silent_p.H96H	NM_001161625	NP_001155097	Q5VZ03	NXNL2_HUMAN	nucleoredoxin-like 2 isoform 1	96	Thioredoxin.										0						TGCCCTTCCACGACCCCTACC	0.602																0.073171	-0.805428	6.872872	3	38	KEEP	---	---	---	---	0	3	23	22	-1	capture	Silent	SNP	91150637	91150637	NXNL2	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10694	26
CERCAM	51148	broad.mit.edu	37	9	131185156	131185156	+	Silent	SNP	G	A	A	rs147490658	by1000genomes	TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:131185156G>A	uc004buz.3	+	2	605	c.207G>A	c.(205-207)ACG>ACA	p.T69T	CERCAM_uc004buy.1_5'UTR|CERCAM_uc010mxz.2_5'UTR|CERCAM_uc010mya.1_5'Flank	NM_016174	NP_057258	Q5T4B2	GT253_HUMAN	cerebral endothelial cell adhesion molecule 1	69					cellular component movement|leukocyte cell-cell adhesion|lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen|plasma membrane				pancreas(1)	1						GGTGTGCCACGGACCACAATG	0.602																0.238636	56.138986	61.622785	21	67	KEEP	---	---	---	---	15	15	36	43	-1	capture	Silent	SNP	131185156	131185156	CERCAM	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3234	26
ELF4	2000	broad.mit.edu	37	X	129200915	129200915	+	Silent	SNP	C	T	T			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129200915C>T	uc004evd.3	-	9	2158	c.1773G>A	c.(1771-1773)CCG>CCA	p.P591P	ELF4_uc004eve.3_Silent_p.P591P	NM_001421	NP_001412	Q99607	ELF4_HUMAN	E74-like factor 4	591					natural killer cell proliferation|NK T cell proliferation|positive regulation of transcription from RNA polymerase II promoter	PML body	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCAGAAGGCTCGGATTGTGGG	0.607					86	T	ERG	AML								0.614458	340.082243	341.986927	102	64	KEEP	---	---	---	---	67	49	39	35	-1	capture	Silent	SNP	129200915	129200915	ELF4	23	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	5011	26
RLTPR	146206	broad.mit.edu	37	16	67683162	67683162	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0154-01	TCGA-06-0154-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67683162delC	uc002etn.2	+	19	1814	c.1694delC	c.(1693-1695)ACCfs	p.T565fs	RLTPR_uc010cel.1_Frame_Shift_Del_p.T558fs|RLTPR_uc010vjr.1_Frame_Shift_Del_p.T529fs	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	565	LRR 12.									breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		CACAGGGAGACCCTGGACGAC	0.637																0.28			10	26		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	67683162	67683162	RLTPR	16	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	13286	26
