Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
RBBP4	5928	broad.mit.edu	37	1	33134833	33134833	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:33134833T>G	uc001bvr.2	+	7	922	c.763T>G	c.(763-765)TGG>GGG	p.W255G	RBBP4_uc001bvs.2_Missense_Mutation_p.W254G|RBBP4_uc010ohj.1_Missense_Mutation_p.W3G|RBBP4_uc010ohk.1_Missense_Mutation_p.W220G	NM_005610	NP_005601	Q09028	RBBP4_HUMAN	retinoblastoma binding protein 4 isoform a	255	WD 3.				cell cycle|CenH3-containing nucleosome assembly at centromere|DNA replication|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|ESC/E(Z) complex|NuRD complex|NURF complex|Sin3 complex	histone binding|histone deacetylase binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				TCACTGAAGTTGGGATACTCG	0.353																0.378378	99.89957	100.853428	28	46	KEEP	---	---	---	---	13	17	30	18	-1	capture	Missense_Mutation	SNP	33134833	33134833	RBBP4	1	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	12996	33
CYP4A11	1579	broad.mit.edu	37	1	47399686	47399686	+	Missense_Mutation	SNP	G	A	A	rs66477740		TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47399686G>A	uc001cqp.3	-	9	1205	c.1154C>T	c.(1153-1155)CCG>CTG	p.P385L	CYP4A11_uc001cqq.2_Missense_Mutation_p.P385L|CYP4A11_uc010omm.1_RNA	NM_000778	NP_000769	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A,	385					long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|oxygen binding			ovary(2)|skin(2)	4					NADH(DB00157)	GCCTGGCACCGGTGGGTAGAG	0.567																0.52809	162.836701	162.898446	47	42	KEEP	---	---	---	---	30	23	24	27	-1	capture	Missense_Mutation	SNP	47399686	47399686	CYP4A11	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4143	33
LRP8	7804	broad.mit.edu	37	1	53732253	53732253	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53732253C>T	uc001cvi.1	-	9	1461	c.1319G>A	c.(1318-1320)CGG>CAG	p.R440Q	LRP8_uc001cvh.1_5'UTR|LRP8_uc001cvk.1_Missense_Mutation_p.R270Q|LRP8_uc001cvj.1_Missense_Mutation_p.R440Q|LRP8_uc001cvl.1_Missense_Mutation_p.R311Q|LRP8_uc001cvm.1_Missense_Mutation_p.R25Q	NM_004631	NP_004622	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein	440	Extracellular (Potential).				cytokine-mediated signaling pathway|endocytosis|lipid metabolic process|platelet activation|proteolysis	caveola	calcium ion binding|very-low-density lipoprotein particle receptor activity				0						TGAATAGTTCCGCTTCACCAG	0.537																0.436937	315.946186	316.715375	97	125	KEEP	---	---	---	---	60	51	90	56	-1	capture	Missense_Mutation	SNP	53732253	53732253	LRP8	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8879	33
FLG	2312	broad.mit.edu	37	1	152285273	152285273	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152285273G>T	uc001ezu.1	-	3	2125	c.2089C>A	c.(2089-2091)CAT>AAT	p.H697N	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	697	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCTGTTCATGGGATGACGCA	0.557												Ichthyosis				0.010022	-236.484437	11.983276	9	889	KEEP	---	---	---	---	4	5	483	508	0.444444444444	capture	Missense_Mutation	SNP	152285273	152285273	FLG	1	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	5867	33
LCE1F	353137	broad.mit.edu	37	1	152748961	152748961	+	Silent	SNP	T	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152748961T>C	uc010pdv.1	+	1	114	c.114T>C	c.(112-114)CCT>CCC	p.P38P		NM_178354	NP_848131	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	38	Pro-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			ctaagtgccctccTGTCTCTT	0.408																0.136986	38.788287	57.438253	20	126	KEEP	---	---	---	---	16	9	82	76	-1	capture	Silent	SNP	152748961	152748961	LCE1F	1	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	8584	33
C1orf66	51093	broad.mit.edu	37	1	156702252	156702252	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156702252G>A	uc001fpu.2	+	3	1050	c.416G>A	c.(415-417)CGG>CAG	p.R139Q	C1orf66_uc001fpv.2_Missense_Mutation_p.R139Q	NM_015997	NP_057081	Q96FB5	RRNAD_HUMAN	hypothetical protein LOC51093 isoform 1	139						integral to membrane	rRNA (adenine-N6,N6-)-dimethyltransferase activity				0	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CATGAGATCCGGAGGCTGGGA	0.562																0.482759	187.897056	187.92696	56	60	KEEP	---	---	---	---	34	31	25	45	-1	capture	Missense_Mutation	SNP	156702252	156702252	C1orf66	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2038	33
KIRREL	55243	broad.mit.edu	37	1	158063228	158063228	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158063228G>A	uc001frn.3	+	12	1975	c.1571G>A	c.(1570-1572)CGC>CAC	p.R524H	KIRREL_uc010pib.1_Missense_Mutation_p.R424H|KIRREL_uc009wsq.2_Missense_Mutation_p.R360H|KIRREL_uc001fro.3_Missense_Mutation_p.R338H	NM_018240	NP_060710	Q96J84	KIRR1_HUMAN	kin of IRRE like precursor	524	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)					TACCGGCGCCGCAAAGGCAGT	0.607																0.028902	-34.582434	7.673924	5	168	KEEP	---	---	---	---	3	2	73	104	-1	capture	Missense_Mutation	SNP	158063228	158063228	KIRREL	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8246	33
USH2A	7399	broad.mit.edu	37	1	215814045	215814045	+	Silent	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:215814045G>A	uc001hku.1	-	68	15210	c.14823C>T	c.(14821-14823)GAC>GAT	p.D4941D		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4941	Fibronectin type-III 35.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACAAATTGCTGTCCACCGAAA	0.507													HNSCC(13;0.011)			0.431655	176.873176	177.440471	60	79	KEEP	---	---	---	---	38	35	43	52	-1	capture	Silent	SNP	215814045	215814045	USH2A	1	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	16918	33
LYST	1130	broad.mit.edu	37	1	235969724	235969724	+	Silent	SNP	C	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235969724C>T	uc001hxj.2	-	6	2887	c.2712G>A	c.(2710-2712)GTG>GTA	p.V904V	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Silent_p.V904V	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	904					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ATAAAAAAGCCACACAGAGGA	0.428												Chediak-Higashi_syndrome				0.268293	122.419139	130.373271	44	120	KEEP	---	---	---	---	28	19	67	63	-1	capture	Silent	SNP	235969724	235969724	LYST	1	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	9043	33
RTKN2	219790	broad.mit.edu	37	10	63957964	63957964	+	Silent	SNP	T	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:63957964T>C	uc001jlw.2	-	12	1630	c.1533A>G	c.(1531-1533)AAA>AAG	p.K511K	RTKN2_uc009xpf.1_Intron|RTKN2_uc001jlv.2_Silent_p.K165K	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2	511					signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)					TGAATGGAAGTTTATCAGAAG	0.398																0.523148	438.914962	439.01792	113	103	KEEP	---	---	---	---	71	56	67	48	-1	capture	Silent	SNP	63957964	63957964	RTKN2	10	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	13615	33
OR10A3	26496	broad.mit.edu	37	11	7960190	7960190	+	Missense_Mutation	SNP	C	T	T	rs146552050		TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7960190C>T	uc010rbi.1	-	1	878	c.878G>A	c.(877-879)CGA>CAA	p.R293Q		NM_001003745	NP_001003745	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A,	293	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTCACTGTTTCGTAAGCTATA	0.418																0.240602	81.13902	89.301519	32	101	KEEP	---	---	---	---	14	23	71	52	-1	capture	Missense_Mutation	SNP	7960190	7960190	OR10A3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10795	33
SPRYD5	84767	broad.mit.edu	37	11	55653196	55653197	+	Missense_Mutation	DNP	GA	TC	TC			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55653196_55653197GA>TC	uc010rip.1	+	2	384_385	c.292_293GA>TC	c.(292-294)GAG>TCG	p.E98S	SPRYD5_uc010riq.1_5'Flank	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	98	B box-type.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				GATGCACAGAGAGACAAAGAAG	0.485																0.148148	6.580657	9.790821	4	23	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	55653196	55653197	SPRYD5	11	GA	TC	TC	TC	1	0	0	0	0	1	0	0	0	429	33	4	4	15003	33
SPRYD5	84767	broad.mit.edu	37	11	55658647	55658647	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55658647A>T	uc010rip.1	+	7	990	c.898A>T	c.(898-900)ATC>TTC	p.I300F	SPRYD5_uc010riq.1_Missense_Mutation_p.I157F	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	300	B30.2/SPRY.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				CAATAGTCATATCTTCCTGTG	0.348																0.410112	222.06469	223.314017	73	105	KEEP	---	---	---	---	36	44	56	62	-1	capture	Missense_Mutation	SNP	55658647	55658647	SPRYD5	11	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	15003	33
SPRYD5	84767	broad.mit.edu	37	11	55658914	55658914	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55658914T>A	uc010rip.1	+	7	1257	c.1165T>A	c.(1165-1167)TGC>AGC	p.C389S	SPRYD5_uc010riq.1_Missense_Mutation_p.C246S	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	389	B30.2/SPRY.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				GGACACTCACTGCAGTCTCTT	0.448																0.355263	83.003722	84.406591	27	49	KEEP	---	---	---	---	20	19	48	43	-1	capture	Missense_Mutation	SNP	55658914	55658914	SPRYD5	11	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	15003	33
OR8J3	81168	broad.mit.edu	37	11	55904831	55904831	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55904831G>A	uc010riz.1	-	1	364	c.364C>T	c.(364-366)CGC>TGC	p.R122C		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					GCCACATAGCGGTCATAGGCC	0.502																0.268571	127.349636	135.808029	47	128	KEEP	---	---	---	---	33	22	72	65	-1	capture	Missense_Mutation	SNP	55904831	55904831	OR8J3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11146	33
OR5A1	219982	broad.mit.edu	37	11	59210873	59210873	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59210873T>C	uc001nnx.1	+	1	232	c.232T>C	c.(232-234)TCT>CCT	p.S78P		NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A,	78	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2						CTGCTACTCTTCTGCTGTGGC	0.468																0.308036	222.078074	229.444727	69	155	KEEP	---	---	---	---	43	32	86	85	-1	capture	Missense_Mutation	SNP	59210873	59210873	OR5A1	11	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	11043	33
CDC42BPG	55561	broad.mit.edu	37	11	64607007	64607007	+	Silent	SNP	G	A	A	rs141134240	byFrequency	TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64607007G>A	uc001obs.3	-	6	618	c.618C>T	c.(616-618)AAC>AAT	p.N206N		NM_017525	NP_059995	Q6DT37	MRCKG_HUMAN	CDC42 binding protein kinase gamma (DMPK-like)	206	Protein kinase.				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|centrosome	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(3)|central_nervous_system(1)	4						GAATGTGCCCGTTCACATCCA	0.607					665											0.358974	37.93077	38.617053	14	25	KEEP	---	---	---	---	9	8	19	12	-1	capture	Silent	SNP	64607007	64607007	CDC42BPG	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3045	33
UVRAG	7405	broad.mit.edu	37	11	75718654	75718654	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:75718654C>G	uc001oxc.2	+	10	1229	c.988C>G	c.(988-990)CCT>GCT	p.P330A	UVRAG_uc010rrw.1_Missense_Mutation_p.P229A|UVRAG_uc001oxd.2_5'UTR|UVRAG_uc010rrx.1_5'UTR|UVRAG_uc009yuh.1_RNA	NM_003369	NP_003360	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	330					DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6						CTACATTTACCCTATTGATTT	0.318																0.321739	120.839808	124.082427	37	78	KEEP	---	---	---	---	18	22	51	39	-1	capture	Missense_Mutation	SNP	75718654	75718654	UVRAG	11	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	16990	33
SMAGP	57228	broad.mit.edu	37	12	51663060	51663060	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:51663060C>G	uc001ryc.1	-	1	674	c.3G>C	c.(1-3)ATG>ATC	p.M1I	SMAGP_uc001ryd.1_Missense_Mutation_p.M1I|SMAGP_uc001rye.1_Missense_Mutation_p.M1I|SMAGP_uc001ryf.1_RNA	NM_001033873	NP_001029045	Q0VAQ4	SMAGP_HUMAN	small trans-membrane and glycosylated protein	1	Extracellular (Potential).					cytoplasmic vesicle membrane|integral to membrane|plasma membrane					0						GGAGGCTGGTCATTGTCACTA	0.512																0.291139	74.483341	77.57711	23	56	KEEP	---	---	---	---	15	10	35	38	-1	capture	Missense_Mutation	SNP	51663060	51663060	SMAGP	12	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	14657	33
RNF17	56163	broad.mit.edu	37	13	25367336	25367336	+	Silent	SNP	T	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25367336T>C	uc001upr.2	+	10	1133	c.1092T>C	c.(1090-1092)CCT>CCC	p.P364P	RNF17_uc010tdd.1_Silent_p.P223P|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Silent_p.P364P|RNF17_uc001ups.2_Silent_p.P303P|RNF17_uc001upq.1_Silent_p.P364P	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	364					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		CTTTGCAACCTGAGACAAATG	0.428																0.014493	-48.951474	6.524933	3	204	KEEP	---	---	---	---	2	1	113	103	-1	capture	Silent	SNP	25367336	25367336	RNF17	13	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	13353	33
TRPC4	7223	broad.mit.edu	37	13	38237609	38237609	+	Silent	SNP	C	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:38237609C>T	uc001uws.2	-	6	1867	c.1632G>A	c.(1630-1632)ACG>ACA	p.T544T	TRPC4_uc010abv.2_Silent_p.T124T|TRPC4_uc001uwt.2_Silent_p.T544T|TRPC4_uc010tey.1_Silent_p.T544T|TRPC4_uc010abw.2_Silent_p.T371T|TRPC4_uc010abx.2_Silent_p.T544T|TRPC4_uc010aby.2_Silent_p.T544T	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	544	Extracellular (Potential).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TTAACCCTTTCGTTTCTTCAT	0.348																0.470588	127.194641	127.258552	40	45	KEEP	---	---	---	---	23	22	24	27	-1	capture	Silent	SNP	38237609	38237609	TRPC4	13	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	16463	33
COL4A1	1282	broad.mit.edu	37	13	110855947	110855947	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:110855947T>C	uc001vqw.3	-	18	1087	c.965A>G	c.(964-966)AAG>AGG	p.K322R	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	322	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			TGCTTCACCCTTTTCTCCCTA	0.453																0.017241	-38.929314	6.852206	3	171	KEEP	---	---	---	---	1	3	91	117	-1	capture	Missense_Mutation	SNP	110855947	110855947	COL4A1	13	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	3654	33
MAP3K9	4293	broad.mit.edu	37	14	71209191	71209191	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:71209191G>A	uc001xmm.2	-	6	1444	c.1444C>T	c.(1444-1446)CGG>TGG	p.R482W	MAP3K9_uc010ttk.1_Missense_Mutation_p.R219W|MAP3K9_uc001xmk.2_Missense_Mutation_p.R176W|MAP3K9_uc001xml.2_Missense_Mutation_p.R482W	NM_033141	NP_149132	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase	482	Leucine-zipper 2.				activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity			stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		TTGAGCTCCCGTTCCAGGATG	0.617	GBM(114;411 1587 13539 28235 50070)			p.I479fs(FADU-Tumor)	190											0.361905	105.41925	107.182011	38	67	KEEP	---	---	---	---	23	19	37	38	-1	capture	Missense_Mutation	SNP	71209191	71209191	MAP3K9	14	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	9171	33
EPB42	2038	broad.mit.edu	37	15	43499445	43499445	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43499445C>A	uc001zra.3	-	9	1570	c.1270G>T	c.(1270-1272)GGC>TGC	p.G424C	EPB42_uc001zqz.3_Missense_Mutation_p.G91C|EPB42_uc010bde.2_Missense_Mutation_p.G269C|EPB42_uc001zrb.3_Missense_Mutation_p.G454C|EPB42_uc010udm.1_Missense_Mutation_p.G346C	NM_001114134	NP_001107606	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2 isoform 2	424					erythrocyte maturation|peptide cross-linking|regulation of cell shape	cytoplasm|cytoskeleton|plasma membrane	ATP binding|protein binding|protein-glutamine gamma-glutamyltransferase activity|structural constituent of cytoskeleton			ovary(2)	2		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		CGGTCACTGCCCACACCCTTG	0.552																0.342466	68.874931	70.465121	25	48	KEEP	---	---	---	---	14	11	23	30	0.44	capture	Missense_Mutation	SNP	43499445	43499445	EPB42	15	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	5113	33
SMAD3	4088	broad.mit.edu	37	15	67457245	67457245	+	Silent	SNP	C	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:67457245C>T	uc002aqj.2	+	2	517	c.219C>T	c.(217-219)GGC>GGT	p.G73G	SMAD3_uc010ujr.1_5'UTR|SMAD3_uc010ujs.1_Silent_p.G29G|SMAD3_uc010ujt.1_5'Flank	NM_005902	NP_005893	P84022	SMAD3_HUMAN	mothers against decapentaplegic homolog 3	73	MH1.				activation of caspase activity|cell cycle arrest|cell-cell junction organization|evasion of host defenses by virus|immune response|induction of apoptosis|negative regulation of cell growth|negative regulation of mitotic cell cycle|negative regulation of protein catabolic process|negative regulation of protein phosphorylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|protein stabilization|regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|transport|wound healing	cytosol|nuclear inner membrane|receptor complex	beta-catenin binding|co-SMAD binding|metal ion binding|protein homodimerization activity|protein kinase binding|R-SMAD binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor binding|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding			large_intestine(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		CCCTGGATGGCCGGTTGCAGG	0.612					476											0.013158	-95.245879	7.551425	5	375	KEEP	---	---	---	---	2	5	238	253	-1	capture	Silent	SNP	67457245	67457245	SMAD3	15	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	14651	33
CACNA1G	8913	broad.mit.edu	37	17	48697121	48697121	+	Silent	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48697121G>A	uc002irk.1	+	34	6231	c.5859G>A	c.(5857-5859)CTG>CTA	p.L1953L	CACNA1G_uc002irj.1_Intron|CACNA1G_uc002irl.1_Intron|CACNA1G_uc002irm.1_Silent_p.L1919L|CACNA1G_uc002irn.1_Intron|CACNA1G_uc002iro.1_Intron|CACNA1G_uc002irp.1_Silent_p.L1953L|CACNA1G_uc002irq.1_Silent_p.L1930L|CACNA1G_uc002irr.1_Intron|CACNA1G_uc002irs.1_Silent_p.L1942L|CACNA1G_uc002irt.1_Intron|CACNA1G_uc002irv.1_Intron|CACNA1G_uc002irw.1_Intron|CACNA1G_uc002iru.1_Silent_p.L1919L|CACNA1G_uc002irx.1_Intron|CACNA1G_uc002iry.1_Intron|CACNA1G_uc002irz.1_Intron|CACNA1G_uc002isa.1_Intron|CACNA1G_uc002isb.1_Intron|CACNA1G_uc002isc.1_Silent_p.L1855L|CACNA1G_uc002isd.1_Intron|CACNA1G_uc002ise.1_Silent_p.L1821L|CACNA1G_uc002isf.1_Silent_p.L1848L|CACNA1G_uc002isg.1_Intron|CACNA1G_uc002ish.1_Intron|CACNA1G_uc002isi.1_Intron	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G	1953	Cytoplasmic (Potential).				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TGGACGAGCTGGCAGGCCCAG	0.667																0.388889	21.22009	21.41505	7	11	KEEP	---	---	---	---	5	3	5	9	-1	capture	Silent	SNP	48697121	48697121	CACNA1G	17	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	2520	33
KIAA0427	9811	broad.mit.edu	37	18	46385757	46385757	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:46385757A>G	uc002ldc.2	+	12	1909	c.1624A>G	c.(1624-1626)ATG>GTG	p.M542V	KIAA0427_uc002ldd.2_Missense_Mutation_p.M544V|KIAA0427_uc002lde.3_Missense_Mutation_p.M171V	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1	542	MIF4G.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						GCTGCCTGAGATGATGACAGA	0.637																0.248227	102.067197	110.190089	35	106	KEEP	---	---	---	---	21	19	53	64	-1	capture	Missense_Mutation	SNP	46385757	46385757	KIAA0427	18	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	8098	33
DNMT1	1786	broad.mit.edu	37	19	10254528	10254528	+	Silent	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10254528G>A	uc002mng.2	-	28	3162	c.2982C>T	c.(2980-2982)GGC>GGT	p.G994G	DNMT1_uc002mnf.2_5'UTR|DNMT1_uc010xlc.1_Silent_p.G1010G|DNMT1_uc002mnh.2_Silent_p.G889G|DNMT1_uc010xld.1_Silent_p.G994G	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	994	BAH 2.				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	CTTTGATCCGGCCAATTCGGT	0.542					705											0.012712	-120.473401	7.667396	6	466	KEEP	---	---	---	---	4	2	276	252	-1	capture	Silent	SNP	10254528	10254528	DNMT1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	4631	33
CRLF1	9244	broad.mit.edu	37	19	18710416	18710416	+	Missense_Mutation	SNP	C	T	T	rs146027258	byFrequency	TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18710416C>T	uc010ebt.1	-	2	550	c.356G>A	c.(355-357)CGT>CAT	p.R119H		NM_004750	NP_004741	O75462	CRLF1_HUMAN	cytokine receptor-like factor 1 precursor	119	Ig-like C2-type.				negative regulation of neuron apoptosis|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein	extracellular space	cytokine binding|protein heterodimerization activity|receptor activity	p.R119H(1)		central_nervous_system(1)	1						GCTGCCGTCACGGGCGTGGCA	0.652																0.314286	31.714976	32.78765	11	24	KEEP	---	---	---	---	10	12	20	29	-1	capture	Missense_Mutation	SNP	18710416	18710416	CRLF1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3851	33
FOSB	2354	broad.mit.edu	37	19	45973902	45973902	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45973902G>A	uc002pbx.3	+	2	734	c.142G>A	c.(142-144)GGG>AGG	p.G48R	ERCC1_uc002pbu.1_Intron|FOSB_uc002pbw.2_Missense_Mutation_p.G48R|FOSB_uc010eke.2_Intron|FOSB_uc002pby.3_Missense_Mutation_p.G48R|FOSB_uc010eka.1_Intron|FOSB_uc010ekb.1_Missense_Mutation_p.G48R|FOSB_uc010ekc.1_Intron|FOSB_uc010ekf.2_Intron|FOSB_uc010ekd.1_Missense_Mutation_p.G48R|FOSB_uc010ekg.2_Intron|FOSB_uc002pca.3_5'UTR	NM_006732	NP_006723	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	48					behavior|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(2)|lung(1)	3		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		CGCCGGTCTCGGGGAAATGCC	0.408																0.342857	322.310993	329.17991	108	207	KEEP	---	---	---	---	69	60	142	105	-1	capture	Missense_Mutation	SNP	45973902	45973902	FOSB	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5930	33
PNMAL2	57469	broad.mit.edu	37	19	46997949	46997949	+	Silent	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46997949G>A	uc002pes.2	-	1	1221	c.774C>T	c.(772-774)ACC>ACT	p.T258T	uc002peu.1_Silent_p.T20T	NM_020709	NP_065760	Q9ULN7	PNML2_HUMAN	PNMA-like 2	258										central_nervous_system(1)	1		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		TGTCGGTGACGGTGACCAGAG	0.602																0.166667	16.035873	21.742172	9	45	KEEP	---	---	---	---	7	4	21	30	-1	capture	Silent	SNP	46997949	46997949	PNMAL2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	12061	33
DHX34	9704	broad.mit.edu	37	19	47883014	47883014	+	Silent	SNP	C	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47883014C>T	uc010xyn.1	+	14	3095	c.2754C>T	c.(2752-2754)TCC>TCT	p.S918S	DHX34_uc010xyo.1_Silent_p.S47S	NM_014681	NP_055496	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	918						intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		GTGACTGCTCCCGCCTGGTGG	0.627																0.272	91.391389	97.251995	34	91	KEEP	---	---	---	---	21	18	63	52	-1	capture	Silent	SNP	47883014	47883014	DHX34	19	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	4465	33
MTA3	57504	broad.mit.edu	37	2	42883411	42883411	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:42883411C>T	uc002rso.1	+	8	1073	c.403C>T	c.(403-405)CGA>TGA	p.R135*	MTA3_uc002rsp.1_Nonsense_Mutation_p.R135*|MTA3_uc002rsq.2_Nonsense_Mutation_p.R191*|MTA3_uc002rsr.2_Nonsense_Mutation_p.R191*	NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	191	ELM2.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						ACTTACGGATCGACAGATTGA	0.328																0.354167	104.926657	106.724377	34	62	KEEP	---	---	---	---	21	23	30	44	-1	capture	Nonsense_Mutation	SNP	42883411	42883411	MTA3	2	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	9820	33
POTEF	728378	broad.mit.edu	37	2	130877828	130877828	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:130877828G>T	uc010fmh.2	-	3	661	c.261C>A	c.(259-261)GAC>GAA	p.D87E		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	87						cell cortex	ATP binding			skin(3)|ovary(2)	5						TAGCAGAGTCGTCGTGGTCTC	0.612																0.021053	-63.695288	9.495778	6	279	KEEP	---	---	---	---	3	4	182	180	0.428571428571	capture	Missense_Mutation	SNP	130877828	130877828	POTEF	2	G	T	T	T	1	0	0	0	0	1	0	0	0	516	40	4	4	12166	33
ITGAV	3685	broad.mit.edu	37	2	187506166	187506166	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:187506166G>A	uc002upq.2	+	12	1286	c.1010G>A	c.(1009-1011)GGC>GAC	p.G337D	ITGAV_uc010frs.2_Missense_Mutation_p.G301D|ITGAV_uc010zfv.1_Missense_Mutation_p.G291D	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor	337	FG-GAP 5.|Extracellular (Potential).				angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		GGCTCTGATGGCAAACTCCAA	0.458	Melanoma(58;108 1995 6081)				606											0.019139	-46.989429	7.326667	4	205	KEEP	---	---	---	---	3	1	135	119	-1	capture	Missense_Mutation	SNP	187506166	187506166	ITGAV	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7811	33
SGOL2	151246	broad.mit.edu	37	2	201437521	201437521	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201437521A>G	uc002uvw.2	+	7	2565	c.2452A>G	c.(2452-2454)ATA>GTA	p.I818V	SGOL2_uc010zhd.1_Missense_Mutation_p.I818V|SGOL2_uc010zhe.1_Missense_Mutation_p.I818V	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	818					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						AAAGTCAGAAATAATTCCTGA	0.348																0.276596	130.167647	136.49881	39	102	KEEP	---	---	---	---	23	18	60	55	-1	capture	Missense_Mutation	SNP	201437521	201437521	SGOL2	2	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	14110	33
FGFR3	2261	broad.mit.edu	37	4	1807889	1807889	+	Missense_Mutation	SNP	A	G	G	rs78311289		TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1807889A>G	uc003gdr.3	+	14	2204	c.1948A>G	c.(1948-1950)AAG>GAG	p.K650E	FGFR3_uc003gdu.2_Missense_Mutation_p.K652E|FGFR3_uc003gds.3_Missense_Mutation_p.K538E|FGFR3_uc003gdq.3_Missense_Mutation_p.K651E	NM_000142	NP_000133	P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3 isoform 1	650	Protein kinase.|Cytoplasmic (Potential).		K -> E (in KERSEB, TD2 and bladder cancer samples; bladder transitional cell carcinoma; somatic mutation).|K -> Q (in hypochondroplasia and bladder cancer; in hypochondroplasia the form is milder than that seen in individuals with the K-540 or M-650 mutations).|K -> M (in KERSEB, ACH and TD1).		bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding	p.K650M(76)|p.K650E(71)|p.K650Q(5)|p.K650T(5)|p.K650N(1)		urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)	CTACTACAAGAAGACGACCAA	0.667			1	p.K650E(OPM2-Tumor)|p.K650E(J82-Tumor)	527	Mis|T	IGH@|ETV6	bladder|MM|T-cell lymphoma		Hypochondroplasia|Thanatophoric dysplasia		Muenke_syndrome|Saethre-Chotzen_syndrome				0.242424	24.484709	26.479932	8	25	KEEP	---	---	---	---	4	5	14	13	-1	capture	Missense_Mutation	SNP	1807889	1807889	FGFR3	4	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	5813	33
BANK1	55024	broad.mit.edu	37	4	102984233	102984233	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:102984233A>C	uc003hvy.3	+	13	2424	c.2150A>C	c.(2149-2151)GAG>GCG	p.E717A	BANK1_uc003hvx.3_Missense_Mutation_p.E702A|BANK1_uc010ill.2_Missense_Mutation_p.E584A|BANK1_uc003hvz.3_Missense_Mutation_p.E687A	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	717					B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		CACATTAAGGAGAAATTACGA	0.323																0.032609	-15.158614	6.792757	3	89	KEEP	---	---	---	---	2	1	58	44	-1	capture	Missense_Mutation	SNP	102984233	102984233	BANK1	4	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	1298	33
NDST4	64579	broad.mit.edu	37	4	115792048	115792048	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:115792048G>C	uc003ibu.2	-	7	2274	c.1595C>G	c.(1594-1596)ACC>AGC	p.T532S	NDST4_uc010imw.2_RNA	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	532	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GTTCACAAAGGTATATAACCC	0.403																0.23301	74.846418	81.567168	24	79	KEEP	---	---	---	---	14	13	40	45	-1	capture	Missense_Mutation	SNP	115792048	115792048	NDST4	4	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	10165	33
NDST3	9348	broad.mit.edu	37	4	118975673	118975673	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:118975673G>A	uc003ibx.2	+	2	1011	c.608G>A	c.(607-609)CGT>CAT	p.R203H	NDST3_uc011cgf.1_Missense_Mutation_p.R203H|NDST3_uc003ibw.2_Missense_Mutation_p.R203H	NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan	203	Lumenal (Potential).|Heparan sulfate N-deacetylase 3.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1						CCATTGATTCGTGTGACCAAA	0.358																0.315436	267.341932	276.371962	94	204	KEEP	---	---	---	---	61	58	147	99	-1	capture	Missense_Mutation	SNP	118975673	118975673	NDST3	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10164	33
ASB5	140458	broad.mit.edu	37	4	177190191	177190191	+	Silent	SNP	C	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:177190191C>T	uc003iuq.1	-	1	85	c.69G>A	c.(67-69)TCG>TCA	p.S23S		NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	23					intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		AACAGAACAGCGAAAGTATTG	0.433																0.322314	107.982501	111.374868	39	82	KEEP	---	---	---	---	18	28	34	54	-1	capture	Silent	SNP	177190191	177190191	ASB5	4	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1017	33
PCDHA3	56145	broad.mit.edu	37	5	140182149	140182149	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140182149C>T	uc003lhf.2	+	1	1367	c.1367C>T	c.(1366-1368)TCG>TTG	p.S456L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.S456L	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	456	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGGCATTCTCGCAGTCCGAG	0.672																0.361582	182.275351	185.24947	64	113	KEEP	---	---	---	---	35	38	70	57	-1	capture	Missense_Mutation	SNP	140182149	140182149	PCDHA3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11428	33
PCDHB13	56123	broad.mit.edu	37	5	140595338	140595338	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140595338G>A	uc003lja.1	+	1	1830	c.1643G>A	c.(1642-1644)CGC>CAC	p.R548H		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	548	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGCTGGTGCGCGTGGTGGTG	0.716																0.403226	68.636213	69.150103	25	37	KEEP	---	---	---	---	14	15	22	21	-1	capture	Missense_Mutation	SNP	140595338	140595338	PCDHB13	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11441	33
PRPF4B	8899	broad.mit.edu	37	6	4042762	4042762	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:4042762T>C	uc003mvv.2	+	5	1701	c.1610T>C	c.(1609-1611)CTA>CCA	p.L537P	PRPF4B_uc003mvw.2_RNA|PRPF4B_uc011dhv.1_RNA	NM_003913	NP_003904	Q13523	PRP4B_HUMAN	serine/threonine-protein kinase PRP4K	537						catalytic step 2 spliceosome	ATP binding|protein binding|protein serine/threonine kinase activity			breast(5)	5	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GAAGAAGCCCTAATAGAACAG	0.313					298											0.029703	-16.966185	7.568094	3	98	KEEP	---	---	---	---	3	0	61	65	-1	capture	Missense_Mutation	SNP	4042762	4042762	PRPF4B	6	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	12469	33
OR2H1	26716	broad.mit.edu	37	6	29430141	29430141	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29430141G>C	uc003nmi.2	+	3	1038	c.595G>C	c.(595-597)GTG>CTG	p.V199L	OR2H1_uc003nmj.1_Missense_Mutation_p.V199L|OR2H1_uc010jri.1_Missense_Mutation_p.V121L	NM_030883	NP_112145	Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H,	199	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CCAGTTGGCTGTGTCCAGTGT	0.512																0.017361	-65.79037	9.939728	5	283	KEEP	---	---	---	---	3	2	164	141	-1	capture	Missense_Mutation	SNP	29430141	29430141	OR2H1	6	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	10905	33
DST	667	broad.mit.edu	37	6	56566691	56566691	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56566691G>A	uc003pdf.2	-	7	878	c.850C>T	c.(850-852)CGC>TGC	p.R284C	DST_uc003pcz.3_Missense_Mutation_p.R106C|DST_uc011dxj.1_Missense_Mutation_p.R135C|DST_uc011dxk.1_Missense_Mutation_p.R146C|DST_uc011dxl.1_Missense_Mutation_p.R135C	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	106	CH 1.|Actin-binding.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CATACCTGGCGTCTTTTCAAA	0.343					2498											0.325	75.825183	77.997762	26	54	KEEP	---	---	---	---	16	13	26	33	-1	capture	Missense_Mutation	SNP	56566691	56566691	DST	6	G	A	A	A	1	0	0	0	0	1	0	0	0	508	40	1	1	4738	33
SASH1	23328	broad.mit.edu	37	6	148854037	148854037	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:148854037G>A	uc003qme.1	+	14	2144	c.1669G>A	c.(1669-1671)GGG>AGG	p.G557R	SASH1_uc011eeb.1_Missense_Mutation_p.G318R|SASH1_uc003qmf.1_5'UTR	NM_015278	NP_056093	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	557	SH3.						protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		CCCGTTCTGCGGGCGTGCCAG	0.582																0.28	200.452474	211.325356	70	180	KEEP	---	---	---	---	47	35	109	105	-1	capture	Missense_Mutation	SNP	148854037	148854037	SASH1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13740	33
GRM3	2913	broad.mit.edu	37	7	86415679	86415679	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86415679G>A	uc003uid.2	+	3	1670	c.571G>A	c.(571-573)GTG>ATG	p.V191M	GRM3_uc010lef.2_Missense_Mutation_p.V189M|GRM3_uc010leg.2_Missense_Mutation_p.V63M|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	191	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	TGCCAGGACCGTGCCCCCCGA	0.567	GBM(52;969 1098 3139 52280)															0.226027	158.577485	178.649432	66	226	KEEP	---	---	---	---	31	42	134	115	-1	capture	Missense_Mutation	SNP	86415679	86415679	GRM3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6731	33
MUC17	140453	broad.mit.edu	37	7	100678176	100678176	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100678176C>G	uc003uxp.1	+	3	3532	c.3479C>G	c.(3478-3480)ACT>AGT	p.T1160S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1160	Extracellular (Potential).|59 X approximate tandem repeats.|17.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGGAACCACTCCGTTAGCA	0.522																0.018487	-132.447889	22.866313	11	584	KEEP	---	---	---	---	6	5	330	348	-1	capture	Missense_Mutation	SNP	100678176	100678176	MUC17	7	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	9884	33
PTPRZ1	5803	broad.mit.edu	37	7	121636615	121636615	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:121636615G>C	uc003vjy.2	+	9	1503	c.1108G>C	c.(1108-1110)GAC>CAC	p.D370H	PTPRZ1_uc003vjz.2_Missense_Mutation_p.D370H	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	370	Extracellular (Potential).|Fibronectin type-III.				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						TGGCTATCAAGACTTGGTAAC	0.338																0.233202	186.088847	202.576968	59	194	KEEP	---	---	---	---	30	35	127	100	-1	capture	Missense_Mutation	SNP	121636615	121636615	PTPRZ1	7	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	12709	33
EPHB6	2051	broad.mit.edu	37	7	142562429	142562430	+	Missense_Mutation	DNP	AA	CC	CC			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142562429_142562430AA>CC	uc011kst.1	+	7	1658_1659	c.871_872AA>CC	c.(871-873)AAG>CCG	p.K291P	EPHB6_uc011ksu.1_Missense_Mutation_p.K291P|EPHB6_uc003wbs.2_5'UTR|EPHB6_uc003wbt.2_5'UTR|EPHB6_uc003wbu.2_5'UTR|EPHB6_uc003wbv.2_5'Flank	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	291	Extracellular (Potential).|Cys-rich.					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)					CGGGGAGGGCAAGTGGATGGTA	0.653					313											0.048193	-11.171775	6.861082	4	79	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	142562429	142562430	EPHB6	7	AA	CC	CC	CC	1	0	0	0	0	1	0	0	0	65	5	4	4	5133	33
SLCO5A1	81796	broad.mit.edu	37	8	70594493	70594493	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70594493A>T	uc003xyl.2	-	7	2415	c.1708T>A	c.(1708-1710)TGT>AGT	p.C570S	SLCO5A1_uc010lzb.2_Missense_Mutation_p.C515S|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_Missense_Mutation_p.C570S	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	570	Extracellular (Potential).|Kazal-like.					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TCTGATCCACAGACTGGCTCA	0.428																0.26875	122.649852	130.375285	43	117	KEEP	---	---	---	---	19	25	57	71	-1	capture	Missense_Mutation	SNP	70594493	70594493	SLCO5A1	8	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	14623	33
C9orf66	157983	broad.mit.edu	37	9	214614	214614	+	Silent	SNP	G	T	T			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:214614G>T	uc003zge.3	-	1	1280	c.783C>A	c.(781-783)GGC>GGA	p.G261G	DOCK8_uc011lls.1_5'Flank|DOCK8_uc003zgf.2_5'Flank	NM_152569	NP_689782	Q5T8R8	CI066_HUMAN	hypothetical protein LOC157983	261	Arg-rich.									central_nervous_system(1)	1	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		GGAGCTTCCGGCCTGCGCGCA	0.711																0.26087	29.17293	31.559018	12	34	KEEP	---	---	---	---	6	9	19	17	0.4	capture	Silent	SNP	214614	214614	C9orf66	9	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	2466	33
SVEP1	79987	broad.mit.edu	37	9	113169426	113169426	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:113169426G>C	uc010mtz.2	-	38	8791	c.8454C>G	c.(8452-8454)GAC>GAG	p.D2818E	SVEP1_uc010mty.2_Missense_Mutation_p.D744E	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	2818	Sushi 23.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						CCCAGTTTTTGTCATCCTGGC	0.512																0.273408	242.057388	254.408994	73	194	KEEP	---	---	---	---	41	39	118	106	-1	capture	Missense_Mutation	SNP	113169426	113169426	SVEP1	9	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	15308	33
C9orf98	158067	broad.mit.edu	37	9	135702270	135702270	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135702270T>G	uc004cbu.1	-	8	1284	c.728A>C	c.(727-729)GAC>GCC	p.D243A	C9orf98_uc010mzx.1_RNA|C9orf98_uc004cbv.1_Missense_Mutation_p.D39A	NM_152572	NP_689785	Q96MA6	KAD8_HUMAN	putative adenylate kinase-like protein C9orf98	243						cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)		ACATGGCTGGTCAGCACTGAT	0.557																0.101351	-19.023327	6.548041	15	133	KEEP	---	---	---	---	31	34	79	82	-1	capture	Missense_Mutation	SNP	135702270	135702270	C9orf98	9	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	2485	33
GPRASP2	114928	broad.mit.edu	37	X	101972203	101972203	+	Silent	SNP	T	C	C			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:101972203T>C	uc004ejk.2	+	4	3740	c.2406T>C	c.(2404-2406)GAT>GAC	p.D802D	GPRASP2_uc004ejl.2_Silent_p.D802D|GPRASP2_uc004ejm.2_Silent_p.D802D|GPRASP2_uc011mrp.1_Silent_p.D141D	NM_138437	NP_612446	Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting	802						cytoplasm	protein binding			ovary(1)	1						TTGATGATGATTTCAGTCTTG	0.333																0.510917	438.578651	438.602386	117	112	KEEP	---	---	---	---	76	55	66	64	-1	capture	Silent	SNP	101972203	101972203	GPRASP2	23	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	6656	33
PTEN	5728	broad.mit.edu	37	10	89720827	89720831	+	Frame_Shift_Del	DEL	CAAAG	-	-			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720827_89720831delCAAAG	uc001kfb.2	+	9	2009_2013	c.978_982delCAAAG	c.(976-984)GACAAAGCAfs	p.D326fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	326_328	C2 tensin-type.			KANKDKANR->AAGADAANA: Reduces growth suppression activity and promotes anchorage-independent growth. Reduces binding to phospholipid membranes in vitro; phosphatase activity towards PtdIns(3,4,5)P3 is not affected.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.T319_K332del(1)|p.G165_*404del(1)|p.D326G(1)|p.G165_K342del(1)|p.D326fs*4(1)|p.W274_F341del(1)|p.A328fs*1(1)|p.D326_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		ATGATCTTGACAAAGCAAATAAAGA	0.337			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.29			41	100		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	89720827	89720831	PTEN	10	CAAAG	-	-	-	1	0	1	0	1	0	0	0	0	220	17	5	5	12633	33
REV1	51455	broad.mit.edu	37	2	100024503	100024507	+	Frame_Shift_Del	DEL	TGATA	-	-			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:100024503_100024507delTGATA	uc002tad.2	-	15	2644_2648	c.2432_2436delTATCA	c.(2431-2436)ATATCAfs	p.I811fs	REV1_uc002tac.2_Frame_Shift_Del_p.I810fs	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1	811_812					DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						CTCTCATATCTGATATATTTAGTTT	0.346											DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					0.27			59	157		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	100024503	100024507	REV1	2	TGATA	-	-	-	1	0	1	0	1	0	0	0	0	704	55	5	5	13134	33
SEPT10	151011	broad.mit.edu	37	2	110303622	110303625	+	Splice_Site	DEL	CTTA	-	-			TCGA-06-0168-01	TCGA-06-0168-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:110303622_110303625delCTTA	uc002tew.2	-	10	1728	c.1349_splice	c.e10+1	p.N450_splice	SEPT10_uc010ywu.1_3'UTR|SEPT10_uc002tex.2_Splice_Site_p.N427_splice|SEPT10_uc002tey.2_Splice_Site_p.K450_splice|SEPT10_uc010ywv.1_Splice_Site_p.N316_splice|SEPT10_uc002tev.1_3'UTR|SEPT10_uc010fjo.2_Splice_Site	NM_144710	NP_653311	Q9P0V9	SEP10_HUMAN	septin 10 isoform 1						cell cycle|cell division	septin complex	GTP binding				0						GGCTGGGCCTCTTACTTCTTACGG	0.495														OREG0014878	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.31			66	149		---	---	---	---						capture_indel	Splice_Site	DEL	110303622	110303625	SEPT10	2	CTTA	-	-	-	1	0	1	0	1	0	0	1	0	404	32	5	5	13953	33
