Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
LCK	3932	broad.mit.edu	37	1	32740011	32740011	+	Silent	SNP	A	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32740011A>T	uc001bux.2	+	2	219	c.81A>T	c.(79-81)ATA>ATT	p.I27I	LCK_uc001buy.2_Silent_p.I27I|LCK_uc001buz.2_Silent_p.I27I|LCK_uc010ohc.1_Silent_p.I71I|LCK_uc001bva.2_Silent_p.I27I	NM_005356	NP_005347	P06239	LCK_HUMAN	lymphocyte-specific protein tyrosine kinase	27	Interactions with CD4 and CD8 (By similarity).				activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding			lung(3)|central_nervous_system(2)|ovary(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)	ATTATCCCATAGTCCCACTGG	0.547					146	T	TRB@	T-ALL								0.353535	104.895587	106.768144	35	64	KEEP	---	---	---	---	26	22	32	42	-1	capture	Silent	SNP	32740011	32740011	LCK	1	A	T	T	T	1	0	0	0	0	0	0	0	1	189	15	4	4	8596	60
AKR1A1	10327	broad.mit.edu	37	1	46027470	46027470	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46027470G>A	uc001cod.2	+	3	468	c.4G>A	c.(4-6)GCG>ACG	p.A2T	AKR1A1_uc009vxw.2_Missense_Mutation_p.A2T|AKR1A1_uc001coe.2_Missense_Mutation_p.A2T	NM_006066	NP_006057	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1	2					glucose metabolic process		alditol:NADP+ 1-oxidoreductase activity|electron carrier activity|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					GGGGGCAATGGCGGCTTCCTG	0.507																0.548387	220.807021	221.058938	68	56	KEEP	---	---	---	---	46	43	59	46	-1	capture	Missense_Mutation	SNP	46027470	46027470	AKR1A1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	465	60
CCDC17	149483	broad.mit.edu	37	1	46086575	46086575	+	Silent	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46086575C>T	uc010olt.1	-	11	1747	c.1599G>A	c.(1597-1599)CAG>CAA	p.Q533Q	CCDC17_uc009vxy.2_Silent_p.Q501Q|CCDC17_uc010ols.1_Silent_p.Q524Q|CCDC17_uc001com.3_Silent_p.Q354Q|CCDC17_uc001con.3_RNA|CCDC17_uc009vxz.2_Intron	NM_001114938	NP_001108410	Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17	533										ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CCACACTCACCTGAGGAATCC	0.592																0.227273	11.859247	13.36613	5	17	KEEP	---	---	---	---	2	4	6	12	-1	capture	Silent	SNP	46086575	46086575	CCDC17	1	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	2767	60
NBPF10	100132406	broad.mit.edu	37	1	145367739	145367739	+	Silent	SNP	A	G	G	rs146714035	by1000genomes	TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145367739A>G	uc001end.3	+	85	10595	c.10560A>G	c.(10558-10560)AAA>AAG	p.K3520K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3445											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ggaaggggaaaaaaagaaggg	0.244																0.017964	-36.423003	7.305508	3	164	KEEP	---	---	---	---	0	3	85	89	-1	capture	Silent	SNP	145367739	145367739	NBPF10	1	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	10100	60
FCRL4	83417	broad.mit.edu	37	1	157556156	157556156	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157556156C>T	uc001fqw.2	-	6	1073	c.937G>A	c.(937-939)GCT>ACT	p.A313T	FCRL4_uc010phy.1_RNA	NM_031282	NP_112572	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4 precursor	313	Ig-like C2-type 4.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(2)|kidney(1)|skin(1)	4	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				GTGCCTTCAGCCACGGAGCAG	0.597					315											0.025157	-32.749573	7.00747	4	155	KEEP	---	---	---	---	2	2	82	91	-1	capture	Missense_Mutation	SNP	157556156	157556156	FCRL4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	5743	60
FCRL2	79368	broad.mit.edu	37	1	157718679	157718679	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157718679G>T	uc001fre.2	-	9	1438	c.1379C>A	c.(1378-1380)CCA>CAA	p.P460Q	FCRL2_uc001frd.2_Missense_Mutation_p.P207Q|FCRL2_uc010phz.1_Intron|FCRL2_uc009wsp.2_Missense_Mutation_p.P176Q	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor	460	Cytoplasmic (Potential).|ITIM motif 2.				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GACATACACTGGCTGCAGCTC	0.502																0.444444	109.975069	110.194854	36	45	KEEP	---	---	---	---	21	20	33	33	0.512195121951	capture	Missense_Mutation	SNP	157718679	157718679	FCRL2	1	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	5741	60
CEP350	9857	broad.mit.edu	37	1	179965731	179965731	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179965731G>A	uc001gnt.2	+	6	822	c.439G>A	c.(439-441)GAA>AAA	p.E147K	CEP350_uc001gnr.1_Missense_Mutation_p.E121K|CEP350_uc009wxl.2_Missense_Mutation_p.E146K|CEP350_uc001gnu.2_5'UTR	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	147						centrosome|nucleus|spindle				ovary(4)	4						CAGCCATCTGGAATCAAAGCA	0.343																0.384615	31.344326	31.647676	10	16	KEEP	---	---	---	---	7	5	6	10	-1	capture	Missense_Mutation	SNP	179965731	179965731	CEP350	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	3222	60
RYR2	6262	broad.mit.edu	37	1	237802446	237802446	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237802446G>A	uc001hyl.1	+	46	7180	c.7060G>A	c.(7060-7062)GCC>ACC	p.A2354T		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2354	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CATCAAAATCGCCGAGGATCC	0.493																0.355556	45.68618	46.51389	16	29	KEEP	---	---	---	---	9	8	18	17	-1	capture	Missense_Mutation	SNP	237802446	237802446	RYR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13661	60
PAOX	196743	broad.mit.edu	37	10	135203245	135203245	+	Silent	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:135203245C>T	uc001lmv.2	+	6	1466	c.1386C>T	c.(1384-1386)GGC>GGT	p.G462G	PAOX_uc001lmw.2_Intron|PAOX_uc001lmx.2_Intron|PAOX_uc001lmy.2_Intron|PAOX_uc001lmz.2_RNA|PAOX_uc001lna.2_RNA|PAOX_uc001lnb.2_RNA|PAOX_uc001lnc.2_RNA	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN	polyamine oxidase isoform 1	600					polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		ACGGCGCCGGCGCCCAGGTAT	0.741																0.608696	48.055692	48.294058	14	9	KEEP	---	---	---	---	4	12	8	3	-1	capture	Silent	SNP	135203245	135203245	PAOX	10	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11327	60
POU2AF1	5450	broad.mit.edu	37	11	111225126	111225126	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:111225126A>G	uc001plg.3	-	5	886	c.631T>C	c.(631-633)TCT>CCT	p.S211P		NM_006235	NP_006226	Q16633	OBF1_HUMAN	POU class 2 associating factor 1	211					humoral immune response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			kidney(1)	1		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		TCTGGGATAGAGATGGGGAGC	0.622					95	T	BCL6	NHL								0.490909	191.449382	191.45725	54	56	KEEP	---	---	---	---	35	24	35	24	-1	capture	Missense_Mutation	SNP	111225126	111225126	POU2AF1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	12171	60
CADM1	23705	broad.mit.edu	37	11	115080343	115080343	+	Silent	SNP	G	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:115080343G>T	uc001ppi.3	-	8	1158	c.1029C>A	c.(1027-1029)ACC>ACA	p.T343T	CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_Intron|CADM1_uc001ppj.3_Intron|CADM1_uc001pph.3_Silent_p.T95T	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	343	Extracellular (Potential).			PPTTIPPPTTTTTTTTTTTTTILTIIT -> TTATTEPAVH GLTQLPNSAEELDSEDLS (in Ref. 3; BAC11657).	adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		tggtggtggtggttgttgtgg	0.269																0.083333	-0.146781	14.687563	7	77	KEEP	---	---	---	---	5	4	34	51	0.555555555556	capture	Silent	SNP	115080343	115080343	CADM1	11	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	2542	60
CHEK1	1111	broad.mit.edu	37	11	125505406	125505406	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:125505406A>T	uc009zbo.2	+	7	1588	c.696A>T	c.(694-696)AAA>AAT	p.K232N	CHEK1_uc010sbh.1_Missense_Mutation_p.K248N|CHEK1_uc010sbi.1_Missense_Mutation_p.K232N|CHEK1_uc001qcf.3_Missense_Mutation_p.K232N|CHEK1_uc009zbp.2_Missense_Mutation_p.K232N|CHEK1_uc001qcg.3_Missense_Mutation_p.K232N|CHEK1_uc009zbq.2_Missense_Mutation_p.K232N|CHEK1_uc001qci.1_RNA	NM_001114122	NP_001107594	O14757	CHK1_HUMAN	checkpoint kinase 1	232	Protein kinase.				cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|skin(1)	6	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		ACCCTTGGAAAAAAATCGATT	0.373					124						Other_conserved_DNA_damage_response_genes					0.301887	173.613493	181.046153	64	148	KEEP	---	---	---	---	31	39	101	83	-1	capture	Missense_Mutation	SNP	125505406	125505406	CHEK1	11	A	T	T	T	1	0	0	0	0	1	0	0	0	11	1	4	4	3300	60
ETNK1	55500	broad.mit.edu	37	12	22778163	22778163	+	Silent	SNP	C	G	G			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:22778163C>G	uc001rft.2	+	1	88	c.66C>G	c.(64-66)CTC>CTG	p.L22L	ETNK1_uc009ziz.2_Silent_p.L22L|ETNK1_uc001rfs.2_Silent_p.L22L	NM_018638	NP_061108	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1 isoform A	22					phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|ethanolamine kinase activity				0						GGGCCGGGCTCAGTTCAGCTG	0.726	Esophageal Squamous(42;87 913 3224 6226 43339)															0.457143	53.600119	53.655472	16	19	KEEP	---	---	---	---	7	9	12	10	-1	capture	Silent	SNP	22778163	22778163	ETNK1	12	C	G	G	G	1	0	0	0	0	0	0	0	1	366	29	4	4	5228	60
TMTC1	83857	broad.mit.edu	37	12	29757135	29757135	+	Missense_Mutation	SNP	G	A	A	rs144467040		TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:29757135G>A	uc001rjb.2	-	7	1376	c.902C>T	c.(901-903)GCG>GTG	p.A301V	TMTC1_uc001riz.2_Missense_Mutation_p.A58V|TMTC1_uc001rja.2_Missense_Mutation_p.A145V|TMTC1_uc001rjc.1_Missense_Mutation_p.A363V	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	409	Helical; (Potential).					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GACTCTCTCCGCCACCACAAA	0.507																0.412698	79.63973	80.05873	26	37	KEEP	---	---	---	---	14	17	22	19	-1	capture	Missense_Mutation	SNP	29757135	29757135	TMTC1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16143	60
MAPK1IP1L	93487	broad.mit.edu	37	14	55529424	55529424	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:55529424G>T	uc001xbq.1	+	3	271	c.107G>T	c.(106-108)GGC>GTC	p.G36V		NM_144578	NP_653179	Q8NDC0	MISSL_HUMAN	MAPK-interacting and spindle-stabilizing	36	Pro-rich.										0						GGCTGGCCAGGCTCCAACCCT	0.537																0.74	115.451659	118.152459	37	13	KEEP	---	---	---	---	26	17	11	6	0.604651162791	capture	Missense_Mutation	SNP	55529424	55529424	MAPK1IP1L	14	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	9191	60
ZNF174	7727	broad.mit.edu	37	16	3458844	3458844	+	Silent	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3458844G>A	uc002cvc.2	+	3	1964	c.1149G>A	c.(1147-1149)CAG>CAA	p.Q383Q		NM_003450	NP_003441	Q15697	ZN174_HUMAN	zinc finger protein 174 isoform a	383	C2H2-type 3.				negative regulation of transcription from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|cytoplasm|nucleus	protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0						AGCCATACCAGTGTGGCCAGT	0.542																0.518072	145.825592	145.849004	43	40	KEEP	---	---	---	---	22	32	24	30	-1	capture	Silent	SNP	3458844	3458844	ZNF174	16	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	17624	60
FUS	2521	broad.mit.edu	37	16	31202308	31202308	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31202308G>A	uc002ebf.2	+	14	1501	c.1418G>A	c.(1417-1419)CGT>CAT	p.R473H	FUS_uc002ebh.2_Missense_Mutation_p.R472H|FUS_uc002ebg.2_Missense_Mutation_p.R268H|FUS_uc002ebi.2_Missense_Mutation_p.R474H|FUS_uc002ebj.2_Missense_Mutation_p.R269H	NM_004960	NP_004951	P35637	FUS_HUMAN	fusion (involved in t(12;16) in malignant	473	Arg/Gly-rich.				cell death|nuclear mRNA splicing, via spliceosome	nucleoplasm	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		FUS/DDIT3(623)|FUS/ERG(163)|FUS/CREB3L2(158)|FUS/CREB3L1(6)|FUS/ATF1(4)|FUS/FEV(2)	soft_tissue(791)|haematopoietic_and_lymphoid_tissue(153)|bone(12)|breast(2)	958		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		GATGATCGTCGTGGTGGCAGA	0.602					180	T	DDIT3|ERG|FEV|ATF1|CREB3L2|CREB3L1	liposarcoma|AML|Ewing sarcoma|angiomatoid fibrous histiocytoma|fibromyxoid sarcoma								0.496599	227.864052	227.865588	73	74	KEEP	---	---	---	---	48	48	40	57	-1	capture	Missense_Mutation	SNP	31202308	31202308	FUS	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6042	60
PDPR	55066	broad.mit.edu	37	16	70190589	70190589	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:70190589T>G	uc002eyf.1	+	19	3404	c.2447T>G	c.(2446-2448)TTT>TGT	p.F816C	CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Missense_Mutation_p.F716C|PDPR_uc002eyg.1_Missense_Mutation_p.F483C|PDPR_uc002eyh.2_Missense_Mutation_p.F161C|PDPR_uc010vls.1_Missense_Mutation_p.F161C	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory	816					glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		TGCCTGGGCTTTGTGCACAAT	0.552																0.167089	157.908683	199.39532	66	329	KEEP	---	---	---	---	38	40	177	192	-1	capture	Missense_Mutation	SNP	70190589	70190589	PDPR	16	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	11592	60
MON1B	22879	broad.mit.edu	37	16	77229553	77229553	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:77229553G>A	uc002fez.2	+	5	1747	c.1417G>A	c.(1417-1419)GCT>ACT	p.A473T	MON1B_uc010vnf.1_Missense_Mutation_p.A364T|MON1B_uc010vng.1_Missense_Mutation_p.A327T|MON1B_uc002ffa.2_Missense_Mutation_p.A353T	NM_014940	NP_055755	Q7L1V2	MON1B_HUMAN	MON1 homolog B	473							protein binding				0						TTACCACGTGGCTGAGAAGGA	0.587																0.435065	203.395586	203.962763	67	87	KEEP	---	---	---	---	36	48	47	64	-1	capture	Missense_Mutation	SNP	77229553	77229553	MON1B	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	9611	60
LRRC50	123872	broad.mit.edu	37	16	84183927	84183927	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84183927C>T	uc002fhl.3	+	3	513	c.332C>T	c.(331-333)ACG>ATG	p.T111M	LRRC50_uc010chi.1_RNA	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50	111	LRR 1.		Missing (in CILD13).		axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						TTGAATGATACGCTGTATTTA	0.378												Kartagener_syndrome				0.408163	126.384198	127.105691	40	58	KEEP	---	---	---	---	18	29	28	38	-1	capture	Missense_Mutation	SNP	84183927	84183927	LRRC50	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8924	60
USP6	9098	broad.mit.edu	37	17	5042663	5042663	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5042663C>T	uc002gau.1	+	22	3422	c.1192C>T	c.(1192-1194)CGG>TGG	p.R398W	USP6_uc002gav.1_Missense_Mutation_p.R398W|USP6_uc010ckz.1_Missense_Mutation_p.R81W|uc002gbd.2_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	398					protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						CCAGTTCCAGCGGCCCATTTG	0.657					464	T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								0.126761	10.936133	20.58027	9	62	KEEP	---	---	---	---	2	8	36	39	-1	capture	Missense_Mutation	SNP	5042663	5042663	USP6	17	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	16968	60
MKS1	54903	broad.mit.edu	37	17	56288050	56288050	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56288050C>T	uc002ivr.1	-	11	1069	c.994G>A	c.(994-996)GTC>ATC	p.V332I	MKS1_uc010wnq.1_Missense_Mutation_p.V129I|MKS1_uc002ivs.1_Missense_Mutation_p.V332I	NM_017777	NP_060247	Q9NXB0	MKS1_HUMAN	Meckel syndrome type 1 protein isoform 1	332	B9.				cilium assembly	centrosome|cilium|microtubule basal body	protein binding			ovary(1)	1						AAGAAGTGGACGTAGAGATTG	0.398																0.697479	284.069514	288.212293	83	36	KEEP	---	---	---	---	47	51	19	24	-1	capture	Missense_Mutation	SNP	56288050	56288050	MKS1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9521	60
LLGL2	3993	broad.mit.edu	37	17	73555474	73555474	+	Silent	SNP	G	C	C			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73555474G>C	uc002joh.2	+	6	667	c.513G>C	c.(511-513)TCG>TCC	p.S171S	LLGL2_uc002jog.1_Silent_p.S171S|LLGL2_uc010dgf.1_Silent_p.S171S|LLGL2_uc002joi.2_Silent_p.S171S|LLGL2_uc010dgg.1_Silent_p.S171S|LLGL2_uc002joj.2_Silent_p.S160S	NM_001031803	NP_001026973	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 isoform c	171					cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding			ovary(2)	2	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CCATCAGCTCGGACGCGGTGC	0.617																0.149533	28.233199	40.835192	16	91	KEEP	---	---	---	---	10	13	48	57	-1	capture	Silent	SNP	73555474	73555474	LLGL2	17	G	C	C	C	1	0	0	0	0	0	0	0	1	496	39	4	4	8754	60
RNF213	57674	broad.mit.edu	37	17	78355436	78355436	+	Silent	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78355436G>A	uc002jyh.1	+	32	8329	c.8106G>A	c.(8104-8106)AAG>AAA	p.K2702K	uc002jyi.1_Intron|RNF213_uc010dhw.1_Silent_p.K1084K	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AGTTGGCCAAGATGCTGGGAC	0.567																0.040404	-13.890957	8.63704	4	95	KEEP	---	---	---	---	1	4	57	46	-1	capture	Silent	SNP	78355436	78355436	RNF213	17	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	13369	60
DSC3	1825	broad.mit.edu	37	18	28584256	28584256	+	Silent	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28584256C>T	uc002kwj.3	-	13	2120	c.1965G>A	c.(1963-1965)AGG>AGA	p.R655R	DSC3_uc002kwi.3_Silent_p.R655R	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein	655	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			CTTGGCCGGCCCTGTCTTTTA	0.383																0.35	170.718735	173.86461	56	104	KEEP	---	---	---	---	24	40	59	60	-1	capture	Silent	SNP	28584256	28584256	DSC3	18	C	T	T	T	1	0	0	0	0	0	0	0	1	285	22	2	2	4722	60
MUC16	94025	broad.mit.edu	37	19	9090417	9090417	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9090417G>C	uc002mkp.2	-	1	1602	c.1398C>G	c.(1396-1398)AGC>AGG	p.S466R		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	466	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTCTGATCTTGCTGTCAAGAG	0.522																0.329932	330.005975	337.580487	97	197	KEEP	---	---	---	---	45	68	111	112	-1	capture	Missense_Mutation	SNP	9090417	9090417	MUC16	19	G	C	C	C	1	0	0	0	0	1	0	0	0	594	46	4	4	9883	60
CCDC150	284992	broad.mit.edu	37	2	197540931	197540931	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:197540931C>T	uc002utp.1	+	11	1337	c.1202C>T	c.(1201-1203)GCC>GTC	p.A401V	CCDC150_uc010zgq.1_RNA|CCDC150_uc010zgr.1_RNA|CCDC150_uc010zgs.1_Missense_Mutation_p.A69V	NM_001080539	NP_001074008	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	401	Potential.										0						GCAGCCCATGCCAGTATCACA	0.388																0.018018	-51.779241	6.330265	4	218	KEEP	---	---	---	---	1	3	100	130	-1	capture	Missense_Mutation	SNP	197540931	197540931	CCDC150	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2759	60
REM1	28954	broad.mit.edu	37	20	30072181	30072181	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30072181G>A	uc002wwa.2	+	5	1129	c.845G>A	c.(844-846)CGC>CAC	p.R282H	NCRNA00028_uc010ztn.1_5'Flank	NM_014012	NP_054731	O75628	REM1_HUMAN	RAS-like GTP-binding protein REM	282	Arg-rich.|Calmodulin-binding (By similarity).				small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity			lung(2)|pancreas(2)	4	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			AGCGCACGCCGCCGGGCACTC	0.701					265											0.666667	12.203535	12.354074	4	2	KEEP	---	---	---	---	2	2	1	1	-1	capture	Missense_Mutation	SNP	30072181	30072181	REM1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13117	60
HCK	3055	broad.mit.edu	37	20	30689234	30689234	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30689234C>T	uc002wxh.2	+	13	1664	c.1493C>T	c.(1492-1494)CCG>CTG	p.P498L	HCK_uc010gdy.2_Missense_Mutation_p.P477L|HCK_uc002wxi.2_Missense_Mutation_p.P476L	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	498	Protein kinase.				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	p.P477L(1)		lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AAAAACCGTCCGGAGGAGCGG	0.572					262											0.444444	102.097987	102.290217	32	40	KEEP	---	---	---	---	15	19	20	24	-1	capture	Missense_Mutation	SNP	30689234	30689234	HCK	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6920	60
ELMO2	63916	broad.mit.edu	37	20	45023078	45023078	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:45023078G>A	uc002xrt.1	-	3	254	c.44C>T	c.(43-45)CCA>CTA	p.P15L	ELMO2_uc002xru.1_Missense_Mutation_p.P15L|ELMO2_uc010zxr.1_Missense_Mutation_p.P15L|ELMO2_uc010zxs.1_5'UTR|ELMO2_uc002xrx.1_Missense_Mutation_p.P15L	NM_133171	NP_573403	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	15					apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				GTTAGCACCTGGCCACTCAAT	0.547																0.375	78.102362	79.091801	27	45	KEEP	---	---	---	---	22	19	35	26	-1	capture	Missense_Mutation	SNP	45023078	45023078	ELMO2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	5021	60
APPL1	26060	broad.mit.edu	37	3	57302493	57302493	+	Missense_Mutation	SNP	A	G	G	rs144769112		TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:57302493A>G	uc003dio.2	+	21	2108	c.1961A>G	c.(1960-1962)AAT>AGT	p.N654S	APPL1_uc011bey.1_Missense_Mutation_p.N637S|ASB14_uc003dip.1_3'UTR|ASB14_uc003diq.2_3'UTR	NM_012096	NP_036228	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH	654	PID.|Potential.				apoptosis|cell cycle|cell proliferation|insulin receptor signaling pathway|regulation of apoptosis|regulation of establishment of protein localization in plasma membrane|regulation of glucose import	cytosol|early endosome membrane|microsome|nucleus|vesicle membrane	protein kinase B binding			breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		aaagaactcaataaacaaaaa	0.209																0.384615	74.890284	75.496496	20	32	KEEP	---	---	---	---	10	10	15	20	-1	capture	Missense_Mutation	SNP	57302493	57302493	APPL1	3	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	810	60
MAGI1	9223	broad.mit.edu	37	3	65342645	65342645	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:65342645G>A	uc003dmn.2	-	23	4323	c.3797C>T	c.(3796-3798)CCG>CTG	p.P1266L	MAGI1_uc003dmm.2_3'UTR	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	1295					cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		GCTGCCTTTCGGATCCCTTGC	0.592																0.355556	195.802157	199.088008	64	116	KEEP	---	---	---	---	41	33	67	60	-1	capture	Missense_Mutation	SNP	65342645	65342645	MAGI1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9104	60
TMPRSS7	344805	broad.mit.edu	37	3	111794198	111794198	+	Missense_Mutation	SNP	G	A	A	rs142998665	by1000genomes	TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111794198G>A	uc010hqb.2	+	13	1606	c.1436G>A	c.(1435-1437)CGC>CAC	p.R479H	TMPRSS7_uc011bhr.1_Missense_Mutation_p.R334H	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	605	Extracellular (Potential).				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2						GCCCTTCACCGCATCATCGGA	0.537																0.015038	-64.327292	6.706957	4	262	KEEP	---	---	---	---	3	2	149	159	-1	capture	Missense_Mutation	SNP	111794198	111794198	TMPRSS7	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16135	60
ABCF3	55324	broad.mit.edu	37	3	183906608	183906608	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183906608A>G	uc003fmz.2	+	8	1029	c.896A>G	c.(895-897)GAG>GGG	p.E299G	ABCF3_uc003fna.2_Missense_Mutation_p.E293G|ABCF3_uc003fnb.2_5'UTR	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	299	ABC transporter 1.						ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GAGGAGATTGAGGCTGACAAG	0.532																0.04918	-6.328273	6.838859	3	58	KEEP	---	---	---	---	0	3	29	29	-1	capture	Missense_Mutation	SNP	183906608	183906608	ABCF3	3	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	67	60
SORCS2	57537	broad.mit.edu	37	4	7719828	7719828	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:7719828G>A	uc003gkb.3	+	18	2342	c.2342G>A	c.(2341-2343)CGG>CAG	p.R781Q	SORCS2_uc011bwi.1_Missense_Mutation_p.R609Q	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor	781	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						ACGCCGCCCCGGGGCCTGCAG	0.652																0.428571	28.272616	28.365859	9	12	KEEP	---	---	---	---	5	6	8	8	-1	capture	Missense_Mutation	SNP	7719828	7719828	SORCS2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14823	60
DRD5	1816	broad.mit.edu	37	4	9784478	9784478	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:9784478C>A	uc003gmb.3	+	1	1221	c.825C>A	c.(823-825)AGC>AGA	p.S275R		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	275	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	GCCGGAGCAGCGCAGCCTGCG	0.637																0.089552	-5.049609	6.429891	6	61	KEEP	---	---	---	---	5	1	25	43	0.166666666667	capture	Missense_Mutation	SNP	9784478	9784478	DRD5	4	C	A	A	A	1	0	0	0	0	1	0	0	0	350	27	4	4	4715	60
CLOCK	9575	broad.mit.edu	37	4	56348941	56348941	+	Silent	SNP	G	A	A	rs149959118		TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:56348941G>A	uc003haz.1	-	5	938	c.12C>T	c.(10-12)ACC>ACT	p.T4T	CLOCK_uc003hba.1_Silent_p.T4T	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	4					circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			TACAGCTTACGGTAAACAACA	0.269																0.35	67.460281	68.649909	21	39	KEEP	---	---	---	---	9	18	27	23	-1	capture	Silent	SNP	56348941	56348941	CLOCK	4	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3514	60
USP38	84640	broad.mit.edu	37	4	144141519	144141519	+	Silent	SNP	A	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:144141519A>T	uc003ijb.2	+	10	3573	c.3039A>T	c.(3037-3039)GGA>GGT	p.G1013G	USP38_uc003ijc.2_RNA	NM_032557	NP_115946	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	1013					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_hematologic(180;0.158)					GGCCCAATGGATTTGATGACA	0.458																0.398496	166.448031	167.646661	53	80	KEEP	---	---	---	---	25	36	41	52	-1	capture	Silent	SNP	144141519	144141519	USP38	4	A	T	T	T	1	0	0	0	0	0	0	0	1	145	12	4	4	16951	60
PCDHB6	56130	broad.mit.edu	37	5	140532029	140532029	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140532029C>G	uc003lir.2	+	1	2191	c.2191C>G	c.(2191-2193)CCA>GCA	p.P731A	PCDHB6_uc011dah.1_Missense_Mutation_p.P595A	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	731	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGTCCCTTTCCAGGGCATCT	0.612																0.27027	252.175592	266.261919	80	216	KEEP	---	---	---	---	35	50	120	115	-1	capture	Missense_Mutation	SNP	140532029	140532029	PCDHB6	5	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	11449	60
FILIP1	27145	broad.mit.edu	37	6	76063397	76063397	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76063397G>A	uc003pia.2	-	4	860	c.487C>T	c.(487-489)CGG>TGG	p.R163W	FILIP1_uc003phy.1_Missense_Mutation_p.R163W|FILIP1_uc003phz.2_Missense_Mutation_p.R64W|FILIP1_uc010kbe.2_Missense_Mutation_p.R166W	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	163										skin(3)|ovary(1)	4						AGCATGCGCCGGTAGGTTTCT	0.428																0.028369	-27.428635	7.123392	4	137	KEEP	---	---	---	---	3	1	83	72	-1	capture	Missense_Mutation	SNP	76063397	76063397	FILIP1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	5839	60
SGK1	6446	broad.mit.edu	37	6	134493370	134493370	+	Silent	SNP	T	C	C			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:134493370T>C	uc003qen.3	-	8	836	c.747A>G	c.(745-747)GAA>GAG	p.E249E	SGK1_uc003qeo.3_Silent_p.E344E|SGK1_uc011ect.1_Silent_p.E239E|SGK1_uc011ecu.1_Silent_p.E205E|SGK1_uc011ecv.1_Silent_p.E263E|SGK1_uc011ecw.1_Silent_p.E277E	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	249	Protein kinase.				apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TGCTGTTGTGTTCAATGTTCT	0.468					161											0.010067	-76.058532	6.347517	3	295	KEEP	---	---	---	---	2	1	141	169	-1	capture	Silent	SNP	134493370	134493370	SGK1	6	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	14100	60
LRP11	84918	broad.mit.edu	37	6	150174287	150174287	+	Missense_Mutation	SNP	G	A	A	rs150922217	byFrequency	TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:150174287G>A	uc003qng.2	-	2	947	c.623C>T	c.(622-624)GCG>GTG	p.A208V	LRP11_uc003qnh.1_Missense_Mutation_p.A208V	NM_032832	NP_116221	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein	208	Extracellular (Potential).					integral to membrane	receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		AAGTGGAGGCGCATCCTTTTC	0.438																0.028369	-26.933168	7.615121	4	137	KEEP	---	---	---	---	4	1	75	83	-1	capture	Missense_Mutation	SNP	150174287	150174287	LRP11	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8869	60
SEMA3C	10512	broad.mit.edu	37	7	80433493	80433493	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80433493A>G	uc003uhj.2	-	8	1292	c.730T>C	c.(730-732)TTC>CTC	p.F244L	SEMA3C_uc011kgw.1_Missense_Mutation_p.F262L|SEMA3C_uc011kgx.1_Missense_Mutation_p.F96L	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	244	Sema.				immune response|response to drug	membrane	receptor activity			ovary(1)	1						TTTTCTTTGAAGAAGAAGTAC	0.368																0.243243	85.970611	92.639398	27	84	KEEP	---	---	---	---	19	12	54	38	-1	capture	Missense_Mutation	SNP	80433493	80433493	SEMA3C	7	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	13919	60
COL1A2	1278	broad.mit.edu	37	7	94037543	94037543	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94037543C>T	uc003ung.1	+	14	1159	c.688C>T	c.(688-690)CCA>TCA	p.P230S	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	230					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging	p.P230S(1)	COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGCCCCTGGCCCAGCTGTAAG	0.398													HNSCC(75;0.22)			0.26943	145.257445	154.489938	52	141	KEEP	---	---	---	---	33	27	82	77	-1	capture	Missense_Mutation	SNP	94037543	94037543	COL1A2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	3643	60
TRRAP	8295	broad.mit.edu	37	7	98552870	98552870	+	Silent	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98552870G>A	uc003upp.2	+	40	6068	c.5859G>A	c.(5857-5859)GAG>GAA	p.E1953E	TRRAP_uc011kis.1_Silent_p.E1935E|TRRAP_uc003upr.2_Silent_p.E1652E	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	1953					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity	p.E1935E(1)		ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TTGTGGAGGAGGGGCACACCG	0.642					1847											0.237288	74.838942	82.281409	28	90	KEEP	---	---	---	---	20	13	49	52	-1	capture	Silent	SNP	98552870	98552870	TRRAP	7	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	16484	60
RELN	5649	broad.mit.edu	37	7	103191709	103191709	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103191709G>A	uc003vca.2	-	41	6267	c.6107C>T	c.(6106-6108)GCG>GTG	p.A2036V	RELN_uc010liz.2_Missense_Mutation_p.A2036V	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2036					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CACTGGATCCGCGGATGAGCT	0.502	NSCLC(146;835 1944 15585 22231 52158)															0.285714	50.265666	53.153905	20	50	KEEP	---	---	---	---	11	12	26	32	-1	capture	Missense_Mutation	SNP	103191709	103191709	RELN	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13115	60
KEL	3792	broad.mit.edu	37	7	142639989	142639989	+	Silent	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142639989G>A	uc003wcb.2	-	17	2124	c.1914C>T	c.(1912-1914)GAC>GAT	p.D638D		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	638	Extracellular (Potential).	Proton donor (By similarity).			proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					GCCCCCCAACGTCTGCAGCAT	0.502																0.34375	341.107738	348.67986	121	231	KEEP	---	---	---	---	76	67	141	141	-1	capture	Silent	SNP	142639989	142639989	KEL	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8064	60
COL22A1	169044	broad.mit.edu	37	8	139606337	139606337	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:139606337C>T	uc003yvd.2	-	63	4985	c.4538G>A	c.(4537-4539)CGG>CAG	p.R1513Q	COL22A1_uc011ljo.1_Missense_Mutation_p.R793Q	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1513	Pro-rich.|Gly-rich.|Collagen-like 15.				cell adhesion	collagen|cytoplasm	structural molecule activity	p.R1513Q(1)		ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGGGCCGGCCCGGCCTGGAAG	0.662													HNSCC(7;0.00092)			0.357664	147.671399	150.100944	49	88	KEEP	---	---	---	---	25	28	52	47	-1	capture	Missense_Mutation	SNP	139606337	139606337	COL22A1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3646	60
ZNF322B	387328	broad.mit.edu	37	9	99960660	99960660	+	Silent	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:99960660C>T	uc004axd.1	-	1	1251	c.1134G>A	c.(1132-1134)CCG>CCA	p.P378P	uc004axb.2_5'Flank|ZNF322B_uc004axc.1_5'Flank|uc010msl.1_Intron	NM_199005	NP_945356			zinc finger protein 322B												0		Acute lymphoblastic leukemia(62;0.158)				TACAGACAAACGGTTTTTCAC	0.443																0.36342	453.855186	460.767211	153	268	KEEP	---	---	---	---	83	98	177	159	-1	capture	Silent	SNP	99960660	99960660	ZNF322B	9	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	17722	60
C5	727	broad.mit.edu	37	9	123745005	123745005	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:123745005C>T	uc004bkv.2	-	26	3348	c.3318G>A	c.(3316-3318)TGG>TGA	p.W1106*		NM_001735	NP_001726	P01031	CO5_HUMAN	complement component 5 preproprotein	1106					activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)	TCTCAACTAGCCACAATAAAG	0.299																0.075472	-3.447693	6.369314	4	49	KEEP	---	---	---	---	0	4	62	51	-1	capture	Nonsense_Mutation	SNP	123745005	123745005	C5	9	C	T	T	T	1	0	0	0	0	0	1	0	0	338	26	5	2	2258	60
ACRC	93953	broad.mit.edu	37	X	70823913	70823913	+	Silent	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70823913G>A	uc004eae.2	+	8	1287	c.786G>A	c.(784-786)TCG>TCA	p.S262S	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	262	Asp/Ser-rich.					nucleus				ovary(3)	3	Renal(35;0.156)					GTGATGATTCGGAAGCTCCCG	0.552																0.045045	-14.212216	10.341318	5	106	KEEP	---	---	---	---	7	5	119	106	-1	capture	Silent	SNP	70823913	70823913	ACRC	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	171	60
ACRC	93953	broad.mit.edu	37	X	70823943	70823943	+	Silent	SNP	G	A	A			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70823943G>A	uc004eae.2	+	8	1317	c.816G>A	c.(814-816)TCG>TCA	p.S272S	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	272	Asp/Ser-rich.					nucleus				ovary(3)	3	Renal(35;0.156)					GTGATGATTCGGAAGCTCCCG	0.557																0.041667	-25.627138	12.370916	7	161	KEEP	---	---	---	---	5	5	147	116	-1	capture	Silent	SNP	70823943	70823943	ACRC	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	171	60
CDKN2C	1031	broad.mit.edu	37	1	51436083	51436083	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:51436083delA	uc001csf.2	+	2	1259	c.43delA	c.(43-45)AGGfs	p.R15fs	CDKN2C_uc001csg.2_Frame_Shift_Del_p.R15fs	NM_001262	NP_001253	P42773	CDN2C_HUMAN	cyclin-dependent kinase inhibitor 2C	15	ANK 1.				cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding	p.0?(4)|p.R15fs*4(1)		central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(5)|ovary(2)|thyroid(1)|lung(1)|kidney(1)	17				GBM - Glioblastoma multiforme(3;3.61e-13)|all cancers(3;0.00151)		CGCAGCTGCCAGGGGGGACCT	0.468	Melanoma(47;50 1155 4767 22863 47597)			p.R15fs(EN-Tumor)	40	D		glioma|MM				Multiple_Endocrine_Neoplasia_type_1				0.60			41	27		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	51436083	51436083	CDKN2C	1	A	-	-	-	1	0	1	0	1	0	0	0	0	88	7	5	5	3134	60
HYOU1	10525	broad.mit.edu	37	11	118919049	118919049	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118919049delA	uc001puu.2	-	20	2480	c.2287delT	c.(2287-2289)TCCfs	p.S763fs	HYOU1_uc001put.2_Frame_Shift_Del_p.S728fs|HYOU1_uc010ryu.1_Frame_Shift_Del_p.S721fs|HYOU1_uc010ryv.1_Frame_Shift_Del_p.S652fs|HYOU1_uc001pux.3_Frame_Shift_Del_p.S763fs	NM_006389	NP_006380	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1 precursor	763						endoplasmic reticulum lumen	ATP binding|protein binding				0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		TCCTCTGTGGACACTTCCTGG	0.617																0.36			109	195		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	118919049	118919049	HYOU1	11	A	-	-	-	1	0	1	0	1	0	0	0	0	130	10	5	5	7395	60
ZNF571	51276	broad.mit.edu	37	19	38056190	38056193	+	Frame_Shift_Del	DEL	GTAA	-	-			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38056190_38056193delGTAA	uc002ogt.2	-	4	1238_1241	c.1137_1140delTTAC	c.(1135-1140)ACTTACfs	p.T379fs	uc002ogm.2_Intron|uc002ogn.2_Intron|ZNF540_uc002ogo.2_Intron|ZNF540_uc002ogp.2_Intron|ZNF540_uc002ogq.2_Intron|ZNF571_uc002ogr.1_Intron|uc002ogs.1_5'Flank|ZNF571_uc010efp.2_Frame_Shift_Del_p.T379fs	NM_016536	NP_057620	Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	379_380	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTCTCAGGTGGTAAGTAAGTTGTG	0.377																0.38			37	61		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	38056190	38056193	ZNF571	19	GTAA	-	-	-	1	0	1	0	1	0	0	0	0	568	44	5	5	17882	60
CRIPAK	285464	broad.mit.edu	37	4	1389456	1389457	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-06-0646-01	TCGA-06-0646-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1389456_1389457delCA	uc003gdf.2	+	1	4117_4118	c.1157_1158delCA	c.(1156-1158)TCAfs	p.S386fs		NM_175918	NP_787114	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	386	10.|Interaction with PAK1.				ER-nucleus signaling pathway|negative regulation of protein kinase activity|regulation of cytoskeleton organization|response to estrogen stimulus	endoplasmic reticulum|nucleus|plasma membrane	protein binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CCTGCCTGCTCACACACGTGCC	0.639																0.02			9	404		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	1389456	1389457	CRIPAK	4	CA	-	-	-	1	0	1	0	1	0	0	0	0	377	29	5	5	3842	60
