Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KAZ	23254	broad.mit.edu	37	1	15428142	15428142	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:15428142G>A	uc001avm.3	+	11	1932	c.1651G>A	c.(1651-1653)GAT>AAT	p.D551N	KAZ_uc001avs.3_5'UTR	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E	551	SAM 2.				keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						CCACCTGGTTGATGGGCGGAT	0.577																0.4375	20.02208	20.076655	7	9	KEEP	---	---	---	---	3	4	5	4	-1	capture	Missense_Mutation	SNP	15428142	15428142	KAZ	1	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	7911	74
HSPG2	3339	broad.mit.edu	37	1	22206668	22206668	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22206668C>T	uc001bfj.2	-	17	2315	c.2275G>A	c.(2275-2277)GGC>AGC	p.G759S	HSPG2_uc009vqd.2_Missense_Mutation_p.G760S	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	759	Laminin EGF-like 1; second part.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	GAGCAGGTGCCCAGGTAGGGC	0.577																0.273684	68.272071	72.617395	26	69	KEEP	---	---	---	---	18	10	28	43	-1	capture	Missense_Mutation	SNP	22206668	22206668	HSPG2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7355	74
GBP5	115362	broad.mit.edu	37	1	89729595	89729595	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89729595G>A	uc001dnc.2	-	9	1723	c.1186C>T	c.(1186-1188)CGG>TGG	p.R396W	GBP5_uc001dnd.2_Missense_Mutation_p.R396W|GBP5_uc001dne.1_Missense_Mutation_p.R396W	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN	guanylate-binding protein 5	396						plasma membrane	GTP binding|GTPase activity			ovary(1)	1				all cancers(265;0.00784)|Epithelial(280;0.0286)		TCCAGGTTCCGTTTACAAATG	0.378																0.355114	349.263201	355.779522	125	227	KEEP	---	---	---	---	82	55	119	135	-1	capture	Missense_Mutation	SNP	89729595	89729595	GBP5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	6217	74
AMY2B	280	broad.mit.edu	37	1	104122114	104122114	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:104122114A>C	uc001duq.2	+	12	2144	c.1528A>C	c.(1528-1530)AAA>CAA	p.K510Q	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.K510Q|AMY2B_uc001dus.1_Intron	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	510					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TGCTGAATCtaaattataaaa	0.284																0.078498	9.604027	62.777629	23	270	KEEP	---	---	---	---	10	13	143	135	-1	capture	Missense_Mutation	SNP	104122114	104122114	AMY2B	1	A	C	C	C	1	0	0	0	0	1	0	0	0	169	13	4	4	592	74
FCRL3	115352	broad.mit.edu	37	1	157667597	157667597	+	Silent	SNP	T	C	C			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157667597T>C	uc001frb.2	-	5	703	c.411A>G	c.(409-411)GGA>GGG	p.G137G	FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Silent_p.G137G|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_5'UTR|FCRL3_uc001frc.1_Silent_p.G137G	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	137	Ig-like C2-type 2.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					GAAGCTGTTTTCCATCCTTGT	0.363																0.034286	-55.406706	27.23709	12	338	KEEP	---	---	---	---	10	4	200	171	-1	capture	Silent	SNP	157667597	157667597	FCRL3	1	T	C	C	C	1	0	0	0	0	0	0	0	1	795	62	3	3	5742	74
ZNF692	55657	broad.mit.edu	37	1	249148230	249148230	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:249148230G>T	uc001ifc.1	-	10	1226	c.1059C>A	c.(1057-1059)CAC>CAA	p.H353Q	ZNF692_uc001iez.1_Missense_Mutation_p.H75Q|ZNF692_uc001ifa.1_Missense_Mutation_p.H75Q|ZNF692_uc001ifb.1_Missense_Mutation_p.H149Q|ZNF692_uc001ifd.1_Missense_Mutation_p.H352Q|ZNF692_uc001ife.1_RNA|ZNF692_uc001iff.1_Missense_Mutation_p.H308Q|ZNF692_uc010pzr.1_Missense_Mutation_p.H358Q	NM_017865	NP_060335	Q9BU19	ZN692_HUMAN	zinc finger protein 692 isoform 2	353	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			TCTGGTGGATGTGCTGGTACT	0.512																0.4	106.030767	106.774727	34	51	KEEP	---	---	---	---	19	17	32	22	0.527777777778	capture	Missense_Mutation	SNP	249148230	249148230	ZNF692	1	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	17975	74
COL17A1	1308	broad.mit.edu	37	10	105823552	105823552	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105823552G>A	uc001kxr.2	-	11	960	c.791C>T	c.(790-792)GCG>GTG	p.A264V	COL17A1_uc010qqv.1_Missense_Mutation_p.A248V|COL17A1_uc009xxp.1_Missense_Mutation_p.A264V	NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	264	Cytoplasmic (Potential).|Nonhelical region (NC16).				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TGAGCAGGACGCCATGTTGTT	0.517																0.082192	0.391272	13.360807	6	67	KEEP	---	---	---	---	3	4	35	36	-1	capture	Missense_Mutation	SNP	105823552	105823552	COL17A1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3639	74
OR8H2	390151	broad.mit.edu	37	11	55873034	55873034	+	Silent	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55873034C>T	uc010riy.1	+	1	516	c.516C>T	c.(514-516)AAC>AAT	p.N172N		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					ACGACTCAAACGTAATTCATC	0.428													HNSCC(53;0.14)			0.328947	422.142949	433.946941	150	306	KEEP	---	---	---	---	83	82	166	172	-1	capture	Silent	SNP	55873034	55873034	OR8H2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11142	74
ADAMTS20	80070	broad.mit.edu	37	12	43770043	43770043	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:43770043A>T	uc010skx.1	-	34	5216	c.5216T>A	c.(5215-5217)ATA>AAA	p.I1739K		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1739	GON.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TAATACCTTTATTATTCTTCC	0.274				p.I1739K(NCIH146-Tumor)	2149											0.428571	9.023966	9.055097	3	4	KEEP	---	---	---	---	2	1	4	2	-1	capture	Missense_Mutation	SNP	43770043	43770043	ADAMTS20	12	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	266	74
NCKAP1L	3071	broad.mit.edu	37	12	54913072	54913072	+	Silent	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54913072C>T	uc001sgc.3	+	16	1660	c.1581C>T	c.(1579-1581)TCC>TCT	p.S527S	NCKAP1L_uc010sox.1_Silent_p.S69S|NCKAP1L_uc010soy.1_Silent_p.S477S	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	527					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						TGCTGGACTCCGTAGAAAAAT	0.438																0.387665	281.858799	284.365437	88	139	KEEP	---	---	---	---	56	43	78	81	-1	capture	Silent	SNP	54913072	54913072	NCKAP1L	12	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10129	74
PPFIA2	8499	broad.mit.edu	37	12	81688794	81688794	+	Silent	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:81688794C>T	uc001szo.1	-	24	2906	c.2745G>A	c.(2743-2745)GCG>GCA	p.A915A	PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA|PPFIA2_uc010suf.1_RNA|PPFIA2_uc009zsh.2_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	841										ovary(3)|lung(2)|pancreas(1)	6						CCACGTACCACGCAGGCATTC	0.353																0.282051	30.61262	32.274543	11	28	KEEP	---	---	---	---	6	5	12	16	-1	capture	Silent	SNP	81688794	81688794	PPFIA2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	12211	74
MYO1H	283446	broad.mit.edu	37	12	109843786	109843786	+	Silent	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109843786C>T	uc010sxn.1	+	7	861	c.861C>T	c.(859-861)GAC>GAT	p.D287D		NM_001101421	NP_001094891	Q8N1T3	MYO1H_HUMAN	myosin 1H	Error:Variant_position_missing_in_B4DNW6_after_alignment						myosin complex	motor activity				0						TTGAAGAAGACGACCAAGGCT	0.498																0.22449	52.724798	59.542153	22	76	KEEP	---	---	---	---	13	14	56	38	-1	capture	Silent	SNP	109843786	109843786	MYO1H	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9985	74
C12orf51	283450	broad.mit.edu	37	12	112703783	112703783	+	Silent	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112703783C>T	uc009zwc.2	-	8	1119	c.1101G>A	c.(1099-1101)GAG>GAA	p.E367E	C12orf51_uc010syk.1_Silent_p.E190E|C12orf51_uc001tts.2_Silent_p.E190E|C12orf51_uc001ttt.3_Silent_p.E190E	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						CACTGTTTCTCTCTCCTAACA	0.418																0.068493	-3.088661	10.975447	5	68	KEEP	---	---	---	---	2	3	40	29	-1	capture	Silent	SNP	112703783	112703783	C12orf51	12	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	1682	74
ATP8B4	79895	broad.mit.edu	37	15	50254197	50254197	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50254197C>A	uc001zxu.2	-	14	1406	c.1264G>T	c.(1264-1266)GAT>TAT	p.D422Y	ATP8B4_uc010ber.2_Missense_Mutation_p.D295Y|ATP8B4_uc010ufd.1_Missense_Mutation_p.D295Y|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	422	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		GTCTTCTGATCCAGGTCATCA	0.264																0.34	44.420121	45.570658	17	33	KEEP	---	---	---	---	8	10	20	20	0.555555555556	capture	Missense_Mutation	SNP	50254197	50254197	ATP8B4	15	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	1188	74
UMOD	7369	broad.mit.edu	37	16	20357449	20357449	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20357449G>A	uc002dgz.2	-	5	1310	c.1181C>T	c.(1180-1182)ACG>ATG	p.T394M	UMOD_uc002dha.2_Missense_Mutation_p.T394M|UMOD_uc002dhb.2_Missense_Mutation_p.T427M	NM_003361	NP_003352	P07911	UROM_HUMAN	uromodulin precursor	394	ZP.				cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2						AGGACGTACCGTCAACACTGT	0.398																0.47191	130.344364	130.405	42	47	KEEP	---	---	---	---	27	19	21	32	-1	capture	Missense_Mutation	SNP	20357449	20357449	UMOD	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16861	74
ATP2C2	9914	broad.mit.edu	37	16	84472802	84472802	+	Silent	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84472802G>A	uc002fhx.2	+	12	1106	c.1017G>A	c.(1015-1017)CTG>CTA	p.L339L	ATP2C2_uc010chj.2_Silent_p.L339L|ATP2C2_uc002fhy.2_Silent_p.L356L|ATP2C2_uc002fhz.2_Silent_p.L188L	NM_014861	NP_055676	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	339	Helical; Name=5; (Potential).				ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2						CAGAGGGTCTGCCCATCGTCG	0.572																0.361446	77.922444	79.326614	30	53	KEEP	---	---	---	---	24	14	39	33	-1	capture	Silent	SNP	84472802	84472802	ATP2C2	16	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	1135	74
FCGBP	8857	broad.mit.edu	37	19	40395919	40395919	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40395919G>A	uc002omp.3	-	15	7486	c.7478C>T	c.(7477-7479)GCC>GTC	p.A2493V		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	2493	VWFD 6.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CTGCAGGACGGCAAACCGATG	0.627																0.012868	-138.354932	9.051429	7	537	KEEP	---	---	---	---	6	3	289	360	-1	capture	Missense_Mutation	SNP	40395919	40395919	FCGBP	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5724	74
RAB4B	53916	broad.mit.edu	37	19	41292794	41292794	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41292794G>A	uc002opd.1	+	7	678	c.568G>A	c.(568-570)GGG>AGG	p.G190R	RAB4B_uc002opc.1_RNA|RAB4B_uc002ope.1_RNA|EGLN2_uc010ehd.2_5'UTR|RAB4B_uc002opf.1_Missense_Mutation_p.G216R	NM_016154	NP_057238	P61018	RAB4B_HUMAN	ras-related GTP-binding protein 4b	190					protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	intracellular|plasma membrane	GTP binding|GTPase activity			skin(1)	1			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CATTCAGTACGGGGATGCGTC	0.682																0.132743	23.608563	38.355352	15	98	KEEP	---	---	---	---	10	5	42	70	-1	capture	Missense_Mutation	SNP	41292794	41292794	RAB4B	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12842	74
AXL	558	broad.mit.edu	37	19	41726597	41726597	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41726597C>T	uc010ehj.2	+	2	332	c.142C>T	c.(142-144)CGG>TGG	p.R48W	CYP2F1_uc010xvw.1_Intron|AXL_uc010ehi.1_Missense_Mutation_p.R48W|AXL_uc010ehk.2_Missense_Mutation_p.R48W	NM_021913	NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase isoform 1	48	Extracellular (Potential).|Interaction with GAS6.|Ig-like C2-type 1.					integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						CACAGGTGCCCGGGGACTCAC	0.622					318											0.068182	-1.411092	7.076829	3	41	KEEP	---	---	---	---	2	1	19	26	-1	capture	Missense_Mutation	SNP	41726597	41726597	AXL	19	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	1228	74
ERCC1	2067	broad.mit.edu	37	19	45912970	45912970	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45912970A>G	uc002pbs.1	-	10	1003	c.857T>C	c.(856-858)TTT>TCT	p.F286S	CD3EAP_uc002pbq.1_3'UTR|CD3EAP_uc002pbr.1_3'UTR|ERCC1_uc002pbt.1_Missense_Mutation_p.F262S|ERCC1_uc002pbu.1_Missense_Mutation_p.F214S	NM_001983	NP_001974	P07992	ERCC1_HUMAN	excision repair cross-complementing 1 isofrom 2	286					mitotic recombination|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|response to oxidative stress|transcription-coupled nucleotide-excision repair	cytoplasm|nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair complex	damaged DNA binding|endonuclease activity|protein C-terminus binding|protein domain specific binding|single-stranded DNA binding			ovary(2)	2		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		CAGGACATCAAACAGCCTCCG	0.502											NER					0.433333	43.671911	43.787899	13	17	KEEP	---	---	---	---	8	7	9	9	-1	capture	Missense_Mutation	SNP	45912970	45912970	ERCC1	19	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	5167	74
NCR1	9437	broad.mit.edu	37	19	55420770	55420770	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55420770G>C	uc002qib.2	+	4	560	c.522G>C	c.(520-522)GAG>GAC	p.E174D	NCR1_uc002qic.2_Missense_Mutation_p.E174D|NCR1_uc002qie.2_Missense_Mutation_p.E174D|NCR1_uc002qid.2_Missense_Mutation_p.E79D|NCR1_uc002qif.2_Missense_Mutation_p.E79D|NCR1_uc010esj.2_Missense_Mutation_p.E67D	NM_004829	NP_004820	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	174	Extracellular (Potential).|Ig-like 2.				cellular defense response|natural killer cell activation|regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane|SWI/SNF complex	receptor activity|receptor signaling protein activity			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(193;0.0449)		TCCAGGCGGAGTTCCCCCTGG	0.572																0.32	174.751004	179.781808	56	119	KEEP	---	---	---	---	25	40	72	61	-1	capture	Missense_Mutation	SNP	55420770	55420770	NCR1	19	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	10144	74
ALLC	55821	broad.mit.edu	37	2	3743415	3743415	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:3743415G>T	uc010ewt.2	+	8	781	c.620G>T	c.(619-621)TGT>TTT	p.C207F	ALLC_uc002qyf.2_5'UTR	NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a	226							allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		GGGGGTGTCTGTGTAGGATTT	0.448													HNSCC(21;0.051)			0.098765	5.735707	18.783103	8	73	KEEP	---	---	---	---	6	2	38	41	0.75	capture	Missense_Mutation	SNP	3743415	3743415	ALLC	2	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	534	74
ITGB6	3694	broad.mit.edu	37	2	161025770	161025770	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:161025770C>T	uc002ubh.2	-	7	986	c.970G>A	c.(970-972)GTG>ATG	p.V324M	ITGB6_uc010fow.1_RNA|ITGB6_uc010fou.2_Missense_Mutation_p.V324M|ITGB6_uc010zcq.1_Missense_Mutation_p.V282M|ITGB6_uc010fov.1_Missense_Mutation_p.V324M	NM_000888	NP_000879	P18564	ITB6_HUMAN	integrin, beta 6 precursor	324	Extracellular (Potential).|VWFA.				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3						ATCAATAACACGTTGTTTTGT	0.294					575											0.38914	262.003947	264.382155	86	135	KEEP	---	---	---	---	45	54	76	87	-1	capture	Missense_Mutation	SNP	161025770	161025770	ITGB6	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7822	74
DNAH7	56171	broad.mit.edu	37	2	196865488	196865488	+	Silent	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:196865488G>A	uc002utj.3	-	12	1394	c.1293C>T	c.(1291-1293)GAC>GAT	p.D431D		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	431	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TAATCATGACGTCATAAACAT	0.338																0.356098	419.531723	427.012948	146	264	KEEP	---	---	---	---	85	78	139	147	-1	capture	Silent	SNP	196865488	196865488	DNAH7	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4562	74
CHGB	1114	broad.mit.edu	37	20	5903131	5903131	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5903131G>A	uc002wmg.2	+	4	647	c.341G>A	c.(340-342)GGC>GAC	p.G114D	CHGB_uc010zqz.1_Intron	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	114						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						GACATCCAAGGCCCAACAAAG	0.607																0.326531	41.687852	42.993423	16	33	KEEP	---	---	---	---	9	9	14	20	-1	capture	Missense_Mutation	SNP	5903131	5903131	CHGB	20	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3305	74
LSM14B	149986	broad.mit.edu	37	20	60697790	60697790	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60697790G>A	uc010gjy.1	+	1	274	c.68G>A	c.(67-69)CGC>CAC	p.R23H	LSM14B_uc002ybt.2_Missense_Mutation_p.R23H|LSM14B_uc010gjx.1_Missense_Mutation_p.R23H|LSM14B_uc002ybv.2_Missense_Mutation_p.R23H|LSM14B_uc010gjz.1_5'Flank|LSM14B_uc010zzz.1_5'Flank	NM_144703	NP_653304	Q9BX40	LS14B_HUMAN	LSM14 homolog B	23					multicellular organismal development|regulation of translation	ribonucleoprotein complex					0	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			GCGCAGATCCGCTACGAGGGC	0.706																0.045455	-7.991568	6.536233	3	63	KEEP	---	---	---	---	1	2	28	44	-1	capture	Missense_Mutation	SNP	60697790	60697790	LSM14B	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8970	74
KRTAP19-1	337882	broad.mit.edu	37	21	31852408	31852408	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31852408G>A	uc011acx.1	-	1	229	c.229C>T	c.(229-231)CGC>TGC	p.R77C		NM_181607	NP_853638	Q8IUB9	KR191_HUMAN	keratin associated protein 19-1	77	26 X 2 AA repeats of G-[YCGS].					intermediate filament					0						TACGATGGGCGGCAGCAGCCA	0.488																0.420455	458.322787	460.244394	148	204	KEEP	---	---	---	---	88	71	93	136	-1	capture	Missense_Mutation	SNP	31852408	31852408	KRTAP19-1	21	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8448	74
KRTAP20-2	337976	broad.mit.edu	37	21	32007726	32007726	+	Nonsense_Mutation	SNP	T	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:32007726T>A	uc011adg.1	+	1	144	c.144T>A	c.(142-144)TAT>TAA	p.Y48*		NM_181616	NP_853647	Q3LI61	KR202_HUMAN	keratin associated protein 20-2	48						intermediate filament				central_nervous_system(1)	1						GCTATGGATATGGCTGCTGCC	0.557																0.354167	151.990547	154.686693	51	93	KEEP	---	---	---	---	47	40	72	66	-1	capture	Nonsense_Mutation	SNP	32007726	32007726	KRTAP20-2	21	T	A	A	A	1	0	0	0	0	0	1	0	0	660	51	5	4	8457	74
BCL2L13	23786	broad.mit.edu	37	22	18178948	18178948	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:18178948C>T	uc002zmw.2	+	5	646	c.428C>T	c.(427-429)ACC>ATC	p.T143I	BCL2L13_uc002zmu.2_Missense_Mutation_p.T143I|BCL2L13_uc002zmv.2_Missense_Mutation_p.T143I|BCL2L13_uc002zmx.2_5'UTR|BCL2L13_uc002zmy.2_Intron|BCL2L13_uc010gqy.2_Intron|BCL2L13_uc011agk.1_Intron|BCL2L13_uc010gqz.2_Intron|BCL2L13_uc002zmz.2_Intron	NM_015367	NP_056182	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)	143					induction of apoptosis	integral to membrane|mitochondrial membrane|nucleus	caspase activator activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4		all_epithelial(15;0.123)		Lung(27;0.199)		ACACTGGAGACCACAGTTCAT	0.383																0.55102	84.542894	84.657391	27	22	KEEP	---	---	---	---	16	14	15	13	-1	capture	Missense_Mutation	SNP	18178948	18178948	BCL2L13	22	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	1360	74
TMPRSS6	164656	broad.mit.edu	37	22	37482392	37482392	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37482392C>T	uc003aqs.1	-	8	1045	c.931G>A	c.(931-933)GTC>ATC	p.V311I	TMPRSS6_uc003aqt.1_Missense_Mutation_p.V302I|TMPRSS6_uc003aqu.2_Missense_Mutation_p.V302I	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	311	CUB 1.|Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						TTCTTCCAGACGACCGCCATG	0.667																0.888889	24.798415	25.949896	8	1	KEEP	---	---	---	---	2	6	1	2	-1	capture	Missense_Mutation	SNP	37482392	37482392	TMPRSS6	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16134	74
TBC1D22A	25771	broad.mit.edu	37	22	47189513	47189513	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:47189513G>A	uc003bib.2	+	3	370	c.235G>A	c.(235-237)GAT>AAT	p.D79N	TBC1D22A_uc010haf.2_Missense_Mutation_p.D49N|TBC1D22A_uc003bic.2_Missense_Mutation_p.D79N|TBC1D22A_uc003bie.2_Missense_Mutation_p.D60N|TBC1D22A_uc003bid.2_RNA|TBC1D22A_uc010hag.2_RNA|TBC1D22A_uc003bif.2_Missense_Mutation_p.D32N	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	79						intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		GGAGGACGACGATGAGCTCCT	0.647																0.072289	-2.716077	12.913838	6	77	KEEP	---	---	---	---	2	5	37	46	-1	capture	Missense_Mutation	SNP	47189513	47189513	TBC1D22A	22	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15499	74
FBLN2	2199	broad.mit.edu	37	3	13672223	13672223	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13672223G>A	uc011avb.1	+	14	2977	c.2852G>A	c.(2851-2853)CGC>CAC	p.R951H	FBLN2_uc011auz.1_Missense_Mutation_p.R977H|FBLN2_uc011ava.1_Missense_Mutation_p.R998H|FBLN2_uc011avc.1_Missense_Mutation_p.R998H	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	951	EGF-like 8; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GAGGCCCAGCGCTGCAGCCAG	0.607																0.555556	31.751251	31.799583	10	8	KEEP	---	---	---	---	8	3	7	3	-1	capture	Missense_Mutation	SNP	13672223	13672223	FBLN2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5645	74
ATP11B	23200	broad.mit.edu	37	3	182585181	182585181	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:182585181T>C	uc003flb.2	+	15	1894	c.1637T>C	c.(1636-1638)ATT>ACT	p.I546T	ATP11B_uc003flc.2_Missense_Mutation_p.I130T	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	546	Cytoplasmic (Potential).				aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			ATTGTGTTTATTGGCAATTCT	0.294																0.291845	209.811457	218.849475	68	165	KEEP	---	---	---	---	51	28	106	94	-1	capture	Missense_Mutation	SNP	182585181	182585181	ATP11B	3	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	1111	74
CTBP1	1487	broad.mit.edu	37	4	1206064	1206064	+	Silent	SNP	G	C	C			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1206064G>C	uc003gcv.1	-	9	1452	c.1287C>G	c.(1285-1287)CCC>CCG	p.P429P	uc003gcs.1_RNA|CTBP1_uc003gct.1_Silent_p.P410P|CTBP1_uc003gcu.1_Silent_p.P418P|CTBP1_uc003gcw.2_Silent_p.P104P	NM_001328	NP_001319	Q13363	CTBP1_HUMAN	C-terminal binding protein 1 isoform 1	429					interspecies interaction between organisms|negative regulation of cell proliferation|negative regulation of histone H4 acetylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|protein phosphorylation|regulation of cell cycle|regulation of transcription by chromatin organization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|viral genome replication|white fat cell differentiation	cytoplasm|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein C-terminus binding|protein domain specific binding|transcription factor binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		TATCCGCCTCGGGCTTGACGG	0.692					261											0.444444	13.500955	13.524752	4	5	KEEP	---	---	---	---	4	0	2	3	-1	capture	Silent	SNP	1206064	1206064	CTBP1	4	G	C	C	C	1	0	0	0	0	0	0	0	1	496	39	4	4	3961	74
CLNK	116449	broad.mit.edu	37	4	10515205	10515205	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:10515205C>A	uc003gmo.3	-	16	926	c.789G>T	c.(787-789)ATG>ATT	p.M263I		NM_052964	NP_443196	Q7Z7G1	CLNK_HUMAN	mast cell immunoreceptor signal transducer	263					immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity			ovary(1)	1						AACAGGGCTGCATGCCTCCTC	0.502	GBM(87;402 1286 6949 13902 35851)															0.46875	46.322263	46.349487	15	17	KEEP	---	---	---	---	10	7	9	9	0.411764705882	capture	Missense_Mutation	SNP	10515205	10515205	CLNK	4	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	3512	74
DCHS2	54798	broad.mit.edu	37	4	155252747	155252747	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155252747C>T	uc003inw.2	-	10	2353	c.2353G>A	c.(2353-2355)GAA>AAA	p.E785K	DCHS2_uc003inx.2_Intron	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	785	Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		tctcctaattcacagaaCAGA	0.219																0.326531	43.382571	44.690833	16	33	KEEP	---	---	---	---	6	11	16	18	-1	capture	Missense_Mutation	SNP	155252747	155252747	DCHS2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	4247	74
CTNND2	1501	broad.mit.edu	37	5	11022883	11022883	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:11022883A>C	uc003jfa.1	-	17	3142	c.2997T>G	c.(2995-2997)GAT>GAG	p.D999E	CTNND2_uc010itt.2_Missense_Mutation_p.D908E|CTNND2_uc011cmy.1_Missense_Mutation_p.D662E|CTNND2_uc011cmz.1_Missense_Mutation_p.D566E|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.D591E	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	999	ARM 9.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						TAACTTACTTATCTCCTTTGC	0.488																0.352	142.660759	145.076219	44	81	KEEP	---	---	---	---	15	33	34	49	-1	capture	Missense_Mutation	SNP	11022883	11022883	CTNND2	5	A	C	C	C	1	0	0	0	0	1	0	0	0	206	16	4	4	3983	74
PCDHA8	56140	broad.mit.edu	37	5	140222517	140222517	+	Silent	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140222517G>A	uc003lhs.2	+	1	1611	c.1611G>A	c.(1609-1611)GCG>GCA	p.A537A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.A537A	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	537	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGAGCGCGCGCGACGCGG	0.667																0.393617	207.193265	209.059107	74	114	KEEP	---	---	---	---	41	40	83	65	-1	capture	Silent	SNP	140222517	140222517	PCDHA8	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11433	74
DOCK2	1794	broad.mit.edu	37	5	169122848	169122848	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169122848G>T	uc003maf.2	+	10	965	c.885G>T	c.(883-885)TTG>TTT	p.L295F	DOCK2_uc011der.1_RNA	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	295					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAATTTACTTGATTTGTCAAA	0.463																0.355932	170.95515	174.200193	63	114	KEEP	---	---	---	---	36	31	50	72	0.537313432836	capture	Missense_Mutation	SNP	169122848	169122848	DOCK2	5	G	T	T	T	1	0	0	0	0	1	0	0	0	581	45	4	4	4643	74
HCRTR2	3062	broad.mit.edu	37	6	55142306	55142306	+	Silent	SNP	A	G	G			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55142306A>G	uc003pcl.2	+	5	1206	c.891A>G	c.(889-891)CGA>CGG	p.R297R	HCRTR2_uc010jzv.2_RNA	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2	297	Cytoplasmic (Potential).				feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			AGCAGATCCGAGCCAGAAGGA	0.493																0.347826	77.080019	78.48998	24	45	KEEP	---	---	---	---	13	11	25	28	-1	capture	Silent	SNP	55142306	55142306	HCRTR2	6	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	6929	74
GHRHR	2692	broad.mit.edu	37	7	31016925	31016925	+	Silent	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31016925C>T	uc003tbx.2	+	12	1182	c.1134C>T	c.(1132-1134)TTC>TTT	p.F378F	GHRHR_uc003tby.2_Silent_p.F314F|GHRHR_uc003tbz.2_Missense_Mutation_p.P145S	NM_000823	NP_000814	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	378	Helical; Name=7; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation|positive regulation of growth hormone secretion|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of multicellular organism growth|response to estrogen stimulus|response to glucocorticoid stimulus	cell surface|integral to membrane|nuclear inner membrane|nuclear matrix|nuclear outer membrane|plasma membrane|stored secretory granule	growth factor binding|growth hormone-releasing hormone receptor activity|peptide hormone binding			ovary(2)|lung(1)|breast(1)|large_intestine(1)	5					Sermorelin(DB00010)	TCTACTGCTTCCTCAACCAAG	0.552																0.06	-18.887484	31.730402	15	235	KEEP	---	---	---	---	14	6	156	112	-1	capture	Silent	SNP	31016925	31016925	GHRHR	7	C	T	T	T	1	0	0	0	0	0	0	0	1	389	30	2	2	6312	74
EGFR	1956	broad.mit.edu	37	7	55221781	55221781	+	Silent	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221781C>T	uc003tqk.2	+	7	1071	c.825C>T	c.(823-825)TAC>TAT	p.Y275Y	EGFR_uc003tqh.2_Silent_p.Y275Y|EGFR_uc003tqi.2_Silent_p.Y275Y|EGFR_uc003tqj.2_Silent_p.Y275Y|EGFR_uc010kzg.1_Silent_p.Y230Y|EGFR_uc011kco.1_Silent_p.Y222Y|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	275	Approximate.|Extracellular (Potential).			Y->A: Strongly reduced autophosphorylation and activation of down-stream kinases; when associated with A-309.	activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CCACCACGTACCAGATGGATG	0.587			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.246377	534.586433	587.090426	221	676	KEEP	---	---	---	---	144	170	314	371	-1	capture	Silent	SNP	55221781	55221781	EGFR	7	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	4922	74
EGFR	1956	broad.mit.edu	37	7	55221796	55221796	+	Silent	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221796C>T	uc003tqk.2	+	7	1086	c.840C>T	c.(838-840)AAC>AAT	p.N280N	EGFR_uc003tqh.2_Silent_p.N280N|EGFR_uc003tqi.2_Silent_p.N280N|EGFR_uc003tqj.2_Silent_p.N280N|EGFR_uc010kzg.1_Silent_p.N235N|EGFR_uc011kco.1_Silent_p.N227N|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	280	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGGATGTGAACCCCGAGGGCA	0.587			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.260109	579.547336	627.245287	238	677	KEEP	---	---	---	---	136	156	320	388	-1	capture	Silent	SNP	55221796	55221796	EGFR	7	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	4922	74
EGFR	1956	broad.mit.edu	37	7	55221821	55221822	+	Missense_Mutation	DNP	GC	AT	AT	rs149840192		TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221821_55221822GC>AT	uc003tqk.2	+	7	1111_1112	c.865_866GC>AT	c.(865-867)GCC>ATC	p.A289I	EGFR_uc003tqh.2_Missense_Mutation_p.A289I|EGFR_uc003tqi.2_Missense_Mutation_p.A289I|EGFR_uc003tqj.2_Missense_Mutation_p.A289I|EGFR_uc010kzg.1_Missense_Mutation_p.A244I|EGFR_uc011kco.1_Missense_Mutation_p.A236I|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289T(3)|p.A289D(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAGCTTTGGTGCCACCTGCGTG	0.589			8	p.A289V(HEC6-Tumor)|p.A289D(HS683-Tumor)|p.A289V(RL952-Tumor)	608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.026316	-195.440388	30.9842	24	888	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	55221821	55221822	EGFR	7	GC	AT	AT	AT	1	0	0	0	0	1	0	0	0	598	46	2	2	4922	74
SEMA3E	9723	broad.mit.edu	37	7	82997221	82997221	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82997221A>C	uc003uhy.1	-	17	2475	c.2009T>G	c.(2008-2010)TTG>TGG	p.L670W		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	670					axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				CACTACCTCCAAGGTGATTTT	0.468																0.248148	197.994136	213.572964	67	203	KEEP	---	---	---	---	30	41	100	114	-1	capture	Missense_Mutation	SNP	82997221	82997221	SEMA3E	7	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	13921	74
ZAN	7455	broad.mit.edu	37	7	100350611	100350611	+	Silent	SNP	A	G	G			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100350611A>G	uc003uwj.2	+	14	3048	c.2883A>G	c.(2881-2883)AAA>AAG	p.K961K	ZAN_uc003uwk.2_Silent_p.K961K|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	961	66 X heptapeptide repeats (approximate) (mucin-like domain).|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CCACAGAAAAACCCACCATCT	0.512																0.092025	12.223318	39.518379	15	148	KEEP	---	---	---	---	7	9	60	103	-1	capture	Silent	SNP	100350611	100350611	ZAN	7	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	17394	74
LAMB4	22798	broad.mit.edu	37	7	107706946	107706946	+	Missense_Mutation	SNP	C	T	T	rs148837121		TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107706946C>T	uc010ljo.1	-	20	2630	c.2546G>A	c.(2545-2547)CGC>CAC	p.R849H	LAMB4_uc003vey.2_Missense_Mutation_p.R849H|LAMB4_uc010ljp.1_5'Flank	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	849	Laminin EGF-like 7.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						TGCCAGGCAGCGATCACAGCG	0.532																0.261538	44.649616	47.991616	17	48	KEEP	---	---	---	---	9	14	35	36	-1	capture	Missense_Mutation	SNP	107706946	107706946	LAMB4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8533	74
MLL3	58508	broad.mit.edu	37	7	151892993	151892993	+	Silent	SNP	T	C	C			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151892993T>C	uc003wla.2	-	28	4596	c.4377A>G	c.(4375-4377)TCA>TCG	p.S1459S	MLL3_uc003wkz.2_Silent_p.S520S	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	1459					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CATATATACCTGAATGATCAA	0.363	Colon(68;14 1149 1884 27689 34759)				1780	N		medulloblastoma								0.027273	-20.574944	6.556675	3	107	KEEP	---	---	---	---	3	0	51	60	-1	capture	Silent	SNP	151892993	151892993	MLL3	7	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	9534	74
PREX2	80243	broad.mit.edu	37	8	69104577	69104577	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:69104577G>A	uc003xxv.1	+	37	4448	c.4421G>A	c.(4420-4422)AGG>AAG	p.R1474K		NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1474					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						CAGCTAATGAGGCCTCTCAAC	0.413					1011											0.366667	67.736009	68.673177	22	38	KEEP	---	---	---	---	10	15	18	24	-1	capture	Missense_Mutation	SNP	69104577	69104577	PREX2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	12373	74
LPAR1	1902	broad.mit.edu	37	9	113704320	113704320	+	Silent	SNP	A	C	C			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:113704320A>C	uc004bfa.2	-	4	429	c.174T>G	c.(172-174)ACT>ACG	p.T58T	LPAR1_uc011lwm.1_Silent_p.T59T|LPAR1_uc004bfb.2_Silent_p.T58T|LPAR1_uc004bfc.2_Silent_p.T58T|LPAR1_uc011lwn.1_Silent_p.T40T|LPAR1_uc011lwo.1_Silent_p.T59T|LPAR1_uc010mub.2_Silent_p.T58T	NM_057159	NP_476500	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1	58	Helical; Name=1; (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	cell surface|integral to plasma membrane				ovary(2)	2						AGATACAAACAGTGATTCCAA	0.438	NSCLC(115;661 2323 9836 34256)															0.368794	161.062888	163.196555	52	89	KEEP	---	---	---	---	24	34	53	43	-1	capture	Silent	SNP	113704320	113704320	LPAR1	9	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	8820	74
TRAF1	7185	broad.mit.edu	37	9	123675735	123675735	+	Silent	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:123675735C>T	uc004bku.1	-	5	1148	c.576G>A	c.(574-576)GGG>GGA	p.G192G	TRAF1_uc011lyg.1_Silent_p.G70G|TRAF1_uc010mvl.1_Silent_p.G192G	NM_005658	NP_005649	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	192					apoptosis|positive regulation of NF-kappaB transcription factor activity|protein complex assembly|regulation of apoptosis|signal transduction	cytoplasm	protein binding|zinc ion binding			skin(2)|ovary(1)	3						CACGCAGCTTCCCCTCCAGCT	0.612																0.34965	132.022413	134.867209	50	93	KEEP	---	---	---	---	26	32	59	47	-1	capture	Silent	SNP	123675735	123675735	TRAF1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	16320	74
GOLGA1	2800	broad.mit.edu	37	9	127670739	127670739	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:127670739C>T	uc004bpc.2	-	12	1324	c.982G>A	c.(982-984)GAG>AAG	p.E328K	GOLGA1_uc010mws.2_RNA	NM_002077	NP_002068	Q92805	GOGA1_HUMAN	golgin 97	328	Potential.					Golgi cisterna membrane				ovary(1)	1						AAATTCTGCTCAGCAAGTGTT	0.343																0.349398	157.3903	160.716897	58	108	KEEP	---	---	---	---	41	24	59	60	-1	capture	Missense_Mutation	SNP	127670739	127670739	GOLGA1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	6487	74
KCNT1	57582	broad.mit.edu	37	9	138667205	138667205	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138667205A>C	uc011mdq.1	+	20	2367	c.2293A>C	c.(2293-2295)ACC>CCC	p.T765P	KCNT1_uc011mdr.1_Missense_Mutation_p.T592P|KCNT1_uc010nbf.2_Missense_Mutation_p.T720P|KCNT1_uc004cgo.1_Missense_Mutation_p.T514P	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	765						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CAGCTCCCCAACCCTGTGCCA	0.662																0.153846	0.850894	7.262255	8	44	KEEP	---	---	---	---	5	10	25	43	-1	capture	Missense_Mutation	SNP	138667205	138667205	KCNT1	9	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	8013	74
SCML2	10389	broad.mit.edu	37	X	18275064	18275064	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18275064G>A	uc004cyl.2	-	11	1517	c.1360C>T	c.(1360-1362)CAC>TAC	p.H454Y	SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Missense_Mutation_p.H454Y|SCML2_uc011miz.1_Missense_Mutation_p.H388Y|SCML2_uc010nfc.2_Missense_Mutation_p.H190Y	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2	454					anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(33;0.183)					TGCAGACTGTGGCAGAAGTTC	0.468	Esophageal Squamous(100;1252 1965 19021 35517)															0.142857	40.044212	59.810343	23	138	KEEP	---	---	---	---	11	14	56	92	-1	capture	Missense_Mutation	SNP	18275064	18275064	SCML2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	13803	74
KLHL13	90293	broad.mit.edu	37	X	117054239	117054239	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:117054239A>T	uc004eql.2	-	3	397	c.335T>A	c.(334-336)ATG>AAG	p.M112K	KLHL13_uc004eqk.2_Missense_Mutation_p.M61K|KLHL13_uc011mtn.1_5'UTR|KLHL13_uc011mto.1_Missense_Mutation_p.M106K|KLHL13_uc011mtp.1_Missense_Mutation_p.M114K|KLHL13_uc004eqm.2_Missense_Mutation_p.M61K|KLHL13_uc011mtq.1_Missense_Mutation_p.M96K	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	112	BTB.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2						AGCAGATGCCATCATGACTCT	0.408																0.2875	133.778545	140.262687	46	114	KEEP	---	---	---	---	30	23	66	59	-1	capture	Missense_Mutation	SNP	117054239	117054239	KLHL13	23	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	8289	74
SUV420H1	51111	broad.mit.edu	37	11	67941367	67941370	+	Frame_Shift_Del	DEL	AAAT	-	-			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:67941367_67941370delAAAT	uc001onm.1	-	6	810_813	c.554_557delATTT	c.(553-558)TATTTGfs	p.Y185fs	SUV420H1_uc009yse.1_5'UTR|SUV420H1_uc001onn.1_Frame_Shift_Del_p.Y13fs|SUV420H1_uc009ysf.2_5'UTR|SUV420H1_uc001ono.1_Frame_Shift_Del_p.Y185fs|SUV420H1_uc001onp.2_Frame_Shift_Del_p.Y185fs|SUV420H1_uc010rqa.1_Frame_Shift_Del_p.Y162fs|SUV420H1_uc001onq.2_Frame_Shift_Del_p.Y185fs	NM_017635	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 isoform	185_186					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3						AAACATTCGCAAATAAATAAATAC	0.319																0.11			14	113		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	67941367	67941370	SUV420H1	11	AAAT	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	15302	74
ITFG3	83986	broad.mit.edu	37	16	315011	315012	+	Frame_Shift_Del	DEL	GT	-	-			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:315011_315012delGT	uc002cgf.2	+	13	1844_1845	c.1649_1650delGT	c.(1648-1650)AGTfs	p.S550fs	ITFG3_uc002cgg.2_Intron|ITFG3_uc010uud.1_Intron|ITFG3_uc002cgh.2_Frame_Shift_Del_p.S550fs	NM_032039	NP_114428	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3	550	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				CGGTACCAGAGTGAGGCGTAGA	0.649																0.16			14	76		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	315011	315012	ITFG3	16	GT	-	-	-	1	0	1	0	1	0	0	0	0	468	36	5	5	7794	74
NOD2	64127	broad.mit.edu	37	16	50731207	50731209	+	In_Frame_Del	DEL	TCC	-	-			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50731207_50731209delTCC	uc002egm.1	+	1	158_160	c.53_55delTCC	c.(52-57)GTCCTC>GTC	p.L20del	NOD2_uc010cbj.1_Intron|NOD2_uc010cbk.1_Intron|NOD2_uc002egl.1_5'UTR	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	20					activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				AGAGCAAGTGTCCTCCTCGGACA	0.601																0.46			6	7		---	---	---	---						capture_indel	In_Frame_Del	DEL	50731207	50731209	NOD2	16	TCC	-	-	-	1	0	1	0	1	0	0	0	0	754	58	5	5	10424	74
TMEM182	130827	broad.mit.edu	37	2	103379127	103379133	+	Frame_Shift_Del	DEL	ATTTGGA	-	-			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103379127_103379133delATTTGGA	uc010fjb.2	+	2	401_407	c.214_220delATTTGGA	c.(214-222)ATTTGGAAGfs	p.I72fs	TMEM182_uc002tcc.3_Frame_Shift_Del_p.I29fs|TMEM182_uc002tcd.3_5'UTR	NM_144632	NP_653233	Q6ZP80	TM182_HUMAN	transmembrane protein 182 precursor	72_74	Extracellular (Potential).					integral to membrane					0						TGACTCCAATATTTGGAAGTTCTGGTA	0.362																0.09			11	116		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	103379127	103379133	TMEM182	2	ATTTGGA	-	-	-	1	0	1	0	1	0	0	0	0	208	16	5	5	15984	74
IRS1	3667	broad.mit.edu	37	2	227660808	227660810	+	In_Frame_Del	DEL	GCT	-	-			TCGA-06-0878-01	TCGA-06-0878-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227660808_227660810delGCT	uc002voh.3	-	1	2697_2699	c.2645_2647delAGC	c.(2644-2649)CAGCCC>CCC	p.Q882del		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	882	Poly-Gln.				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		TGCAGCAAGGgctgctgctgctg	0.557					143											0.04			7	167		---	---	---	---						capture_indel	In_Frame_Del	DEL	227660808	227660810	IRS1	2	GCT	-	-	-	1	0	1	0	1	0	0	0	0	546	42	5	5	7763	74
