Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
FBXO44	93611	broad.mit.edu	37	1	11716011	11716011	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11716011T>C	uc001asm.2	+	2	245	c.119T>C	c.(118-120)CTC>CCC	p.L40P	FBXO2_uc001asj.2_5'Flank|FBXO2_uc009vna.2_5'Flank|FBXO2_uc009vnb.1_5'Flank|FBXO44_uc001ask.2_Missense_Mutation_p.L40P|FBXO44_uc010oaq.1_Missense_Mutation_p.L40P|FBXO44_uc001asl.2_Missense_Mutation_p.L40P|FBXO44_uc001asn.2_Missense_Mutation_p.L40P|FBXO44_uc010oar.1_Missense_Mutation_p.L40P|FBXO44_uc010oas.1_5'UTR	NM_033182	NP_149438	Q9H4M3	FBX44_HUMAN	F-box protein 44 isoform 1	40	F-box.				protein catabolic process	SCF ubiquitin ligase complex	protein binding			ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.41e-06)|COAD - Colon adenocarcinoma(227;0.000255)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000758)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		TGGCGGGACCTCATCGACCTC	0.632																0.037383	-18.689337	6.728622	4	103	KEEP	---	---	---	---	0	4	62	69	-1	capture	Missense_Mutation	SNP	11716011	11716011	FBXO44	1	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	5699	78
NFIA	4774	broad.mit.edu	37	1	61869812	61869812	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:61869812C>T	uc001czw.2	+	8	1596	c.1112C>T	c.(1111-1113)CCG>CTG	p.P371L	NFIA_uc001czy.2_Missense_Mutation_p.P363L|NFIA_uc010oos.1_Missense_Mutation_p.P416L|NFIA_uc001czv.2_Missense_Mutation_p.P371L|NFIA_uc001czx.2_Missense_Mutation_p.P19L|NFIA_uc009wae.2_5'Flank	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1	371					DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						CTTCATTTCCCGACATCACCC	0.493					682											0.195364	136.682989	162.789021	59	243	KEEP	---	---	---	---	35	36	142	163	-1	capture	Missense_Mutation	SNP	61869812	61869812	NFIA	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10277	78
LRRC8C	84230	broad.mit.edu	37	1	90178321	90178321	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:90178321C>A	uc001dnl.3	+	3	434	c.192C>A	c.(190-192)AAC>AAA	p.N64K		NM_032270	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member	64						endoplasmic reticulum membrane|integral to membrane				ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CTGCTCAGAACCACTCTTCCC	0.433																0.020548	-31.010425	6.584014	3	143	KEEP	---	---	---	---	4	2	84	94	0.333333333333	capture	Missense_Mutation	SNP	90178321	90178321	LRRC8C	1	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	8938	78
FLG	2312	broad.mit.edu	37	1	152287099	152287099	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152287099G>T	uc001ezu.1	-	3	299	c.263C>A	c.(262-264)TCT>TAT	p.S88Y	uc001ezv.2_Splice_Site	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	88					keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTTTCTGGTAGACTCATAATA	0.358												Ichthyosis				0.416667	169.562992	170.438683	60	84	KEEP	---	---	---	---	35	30	40	57	0.538461538462	capture	Missense_Mutation	SNP	152287099	152287099	FLG	1	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	5867	78
PBXIP1	57326	broad.mit.edu	37	1	154918742	154918742	+	Silent	SNP	T	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154918742T>G	uc001ffr.2	-	10	1467	c.1408A>C	c.(1408-1410)AGG>CGG	p.R470R	PBXIP1_uc001ffs.2_Silent_p.R441R|PBXIP1_uc010pep.1_Silent_p.R315R	NM_020524	NP_065385	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein	470					cell differentiation|multicellular organismal development|negative regulation of transcription, DNA-dependent	cytosol|microtubule|nucleus	protein binding|transcription corepressor activity			large_intestine(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CTCCACTCCCTAGAATTCTGG	0.567																0.310997	558.354132	576.939641	181	401	KEEP	---	---	---	---	101	114	222	290	-1	capture	Silent	SNP	154918742	154918742	PBXIP1	1	T	G	G	G	1	0	0	0	0	0	0	0	1	687	53	4	4	11399	78
SPTA1	6708	broad.mit.edu	37	1	158615169	158615169	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158615169G>A	uc001fst.1	-	29	4202	c.4003C>T	c.(4003-4005)CGT>TGT	p.R1335C		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1335	Spectrin 13.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					ATGTCAGCACGGTGCTCCTGT	0.488																0.292035	96.431083	100.806858	33	80	KEEP	---	---	---	---	17	25	45	51	-1	capture	Missense_Mutation	SNP	158615169	158615169	SPTA1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15008	78
DCAF8	50717	broad.mit.edu	37	1	160250017	160250017	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160250017C>T	uc010pjc.1	-	4	445	c.173G>A	c.(172-174)AGT>AAT	p.S58N	PEX19_uc010pje.1_RNA|PEX19_uc001fvs.2_Missense_Mutation_p.S205N|PEX19_uc001fvt.2_Missense_Mutation_p.S115N	NM_015726	NP_056541	Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	142						CUL4 RING ubiquitin ligase complex	protein binding			skin(2)	2						TTCCCGATGACTCTGCAACCA	0.418																0.301105	323.942483	336.727833	109	253	KEEP	---	---	---	---	65	63	130	173	-1	capture	Missense_Mutation	SNP	160250017	160250017	DCAF8	1	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	4235	78
PAPPA2	60676	broad.mit.edu	37	1	176563773	176563773	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:176563773G>A	uc001gkz.2	+	3	2197	c.1033G>A	c.(1033-1035)GAC>AAC	p.D345N	PAPPA2_uc001gky.1_Missense_Mutation_p.D345N|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	345					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CCTCTGCACCGACCGCGTGAA	0.592																0.368421	98.498511	99.944768	35	60	KEEP	---	---	---	---	15	21	29	34	-1	capture	Missense_Mutation	SNP	176563773	176563773	PAPPA2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11337	78
ABL2	27	broad.mit.edu	37	1	179090932	179090932	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179090932T>C	uc001gmj.3	-	5	1045	c.758A>G	c.(757-759)GAT>GGT	p.D253G	ABL2_uc010pnf.1_Missense_Mutation_p.D253G|ABL2_uc010png.1_Missense_Mutation_p.D232G|ABL2_uc010pnh.1_Missense_Mutation_p.D232G|ABL2_uc009wxe.2_Missense_Mutation_p.D232G|ABL2_uc001gmg.3_Missense_Mutation_p.D238G|ABL2_uc001gmi.3_Missense_Mutation_p.D238G|ABL2_uc001gmh.3_Missense_Mutation_p.D217G|ABL2_uc010pne.1_Missense_Mutation_p.D217G|ABL2_uc009wxf.1_Missense_Mutation_p.D238G|ABL2_uc001gmk.2_Missense_Mutation_p.D217G	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b	253	SH2.				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	CACCAGCCCATCAGCCACTGT	0.498					285	T	ETV6	AML								0.133333	-1.295739	7.180028	8	52	KEEP	---	---	---	---	7	15	32	41	-1	capture	Missense_Mutation	SNP	179090932	179090932	ABL2	1	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	93	78
IL10	3586	broad.mit.edu	37	1	206942020	206942020	+	Silent	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:206942020G>A	uc001hen.1	-	5	557	c.498C>T	c.(496-498)AAC>AAT	p.N166N		NM_000572	NP_000563	P22301	IL10_HUMAN	interleukin 10 precursor	166					anti-apoptosis|B cell differentiation|B cell proliferation|cytoplasmic sequestering of NF-kappaB|inflammatory response|leukocyte chemotaxis|negative regulation of B cell proliferation|negative regulation of cytokine secretion involved in immune response|negative regulation of interferon-alpha biosynthetic process|negative regulation of interleukin-6 production|negative regulation of membrane protein ectodomain proteolysis|negative regulation of MHC class II biosynthetic process|negative regulation of T cell proliferation|positive regulation of B cell apoptosis|positive regulation of cytokine secretion|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|receptor biosynthetic process|regulation of isotype switching|response to glucocorticoid stimulus|type 2 immune response	extracellular space	cytokine activity|growth factor activity|interleukin-10 receptor binding				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			CTTCTATGTAGTTGATGAAGA	0.413																0.214286	22.550605	25.717348	9	33	KEEP	---	---	---	---	5	10	23	22	-1	capture	Silent	SNP	206942020	206942020	IL10	1	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	7542	78
CD46	4179	broad.mit.edu	37	1	207930974	207930974	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207930974A>G	uc001hgc.2	+	3	532	c.376A>G	c.(376-378)ATT>GTT	p.I126V	CD46_uc001hgd.2_Missense_Mutation_p.I126V|CD46_uc001hge.2_Missense_Mutation_p.I126V|CD46_uc001hgf.2_Missense_Mutation_p.I126V|CD46_uc001hgg.2_Missense_Mutation_p.I126V|CD46_uc001hgh.2_Missense_Mutation_p.I126V|CD46_uc001hgi.2_Missense_Mutation_p.I126V|CD46_uc001hgj.2_Missense_Mutation_p.I126V|CD46_uc001hgk.2_Missense_Mutation_p.I126V|CD46_uc001hgl.2_Missense_Mutation_p.I126V|CD46_uc001hgm.2_Missense_Mutation_p.I126V|CD46_uc001hgn.2_Missense_Mutation_p.I126V|CD46_uc001hgo.2_Missense_Mutation_p.I126V|CD46_uc001hgp.2_Missense_Mutation_p.I126V	NM_002389	NP_002380	P15529	MCP_HUMAN	CD46 antigen, complement regulatory protein	126	Extracellular (Potential).|Sushi 2.				complement activation, classical pathway|innate immune response|interspecies interaction between organisms|single fertilization	inner acrosomal membrane|integral to plasma membrane	protein binding|receptor activity			large_intestine(2)|lung(1)|central_nervous_system(1)	4						GATGCACTTTATTTGTAATGA	0.363																0.071429	1.329598	6.625755	2	26	KEEP	---	---	---	---	0	2	13	17	-1	capture	Missense_Mutation	SNP	207930974	207930974	CD46	1	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	2989	78
CD46	4179	broad.mit.edu	37	1	207934671	207934671	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207934671G>T	uc001hgc.2	+	5	709	c.553G>T	c.(553-555)GAT>TAT	p.D185Y	CD46_uc001hgd.2_Missense_Mutation_p.D185Y|CD46_uc001hge.2_Missense_Mutation_p.D185Y|CD46_uc001hgf.2_Missense_Mutation_p.D185Y|CD46_uc001hgg.2_Missense_Mutation_p.D185Y|CD46_uc001hgh.2_Missense_Mutation_p.D185Y|CD46_uc001hgi.2_Missense_Mutation_p.D185Y|CD46_uc001hgj.2_Missense_Mutation_p.D185Y|CD46_uc001hgk.2_Missense_Mutation_p.D185Y|CD46_uc001hgl.2_Missense_Mutation_p.D185Y|CD46_uc001hgm.2_Missense_Mutation_p.D185Y|CD46_uc001hgn.2_Missense_Mutation_p.D185Y|CD46_uc001hgo.2_Missense_Mutation_p.D185Y|CD46_uc001hgp.2_Missense_Mutation_p.D185Y	NM_002389	NP_002380	P15529	MCP_HUMAN	CD46 antigen, complement regulatory protein	185	Extracellular (Potential).|Sushi 3.				complement activation, classical pathway|innate immune response|interspecies interaction between organisms|single fertilization	inner acrosomal membrane|integral to plasma membrane	protein binding|receptor activity			large_intestine(2)|lung(1)|central_nervous_system(1)	4						TGAGTATCTTGATGCAGTAAC	0.373																0.035714	-13.354161	6.316025	3	81	KEEP	---	---	---	---	1	2	38	47	0.333333333333	capture	Missense_Mutation	SNP	207934671	207934671	CD46	1	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	2989	78
SVIL	6840	broad.mit.edu	37	10	29776136	29776136	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:29776136A>G	uc001iut.1	-	24	5194	c.4441T>C	c.(4441-4443)TTC>CTC	p.F1481L	LOC387647_uc001iuq.1_RNA|SVIL_uc010qdw.1_Missense_Mutation_p.F395L|SVIL_uc001iuu.1_Missense_Mutation_p.F1055L|SVIL_uc009xlc.2_Missense_Mutation_p.F273L	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1481	Gelsolin-like 1.|Interaction with NEB.				cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				ACCCACAGGAAGCAGCAGTGG	0.517																0.055556	-1.081524	6.399953	2	34	KEEP	---	---	---	---	3	0	26	15	-1	capture	Missense_Mutation	SNP	29776136	29776136	SVIL	10	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	15309	78
C10orf71	118461	broad.mit.edu	37	10	50532018	50532018	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50532018C>T	uc010qgp.1	+	3	1767	c.1428C>T	c.(1426-1428)AAC>AAT	p.N476N		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	476											0						GACAGCTAAACGGATACCAAG	0.572																0.5	45.423768	45.423768	15	15	KEEP	---	---	---	---	4	11	7	8	-1	capture	Silent	SNP	50532018	50532018	C10orf71	10	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1602	78
PTEN	5728	broad.mit.edu	37	10	89717672	89717672	+	Nonsense_Mutation	SNP	C	T	T	rs121909219		TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717672C>T	uc001kfb.2	+	8	1728	c.697C>T	c.(697-699)CGA>TGA	p.R233*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	233	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R233*(61)|p.R233fs*10(4)|p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.R233fs*12(1)|p.R233fs*20(1)|p.R233fs*25(1)|p.R233fs*23(1)|p.R233R(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGGACCCACACGACGGGAAGA	0.423		R233*(JHUEM1_ENDOMETRIUM)|R233*(SW1783_CENTRAL_NERVOUS_SYSTEM)|R233*(NCIH1155_LUNG)|R233*(SF295_CENTRAL_NERVOUS_SYSTEM)|R233*(HEC59_ENDOMETRIUM)	31	p.R233*(JHUEM1-Tumor)|p.R233*(SW1783-Tumor)|p.R233*(SF295-Tumor)|p.T232fs(P31FUJ-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.05	-16.394051	13.681172	7	133	KEEP	---	---	---	---	1	7	80	81	-1	capture	Nonsense_Mutation	SNP	89717672	89717672	PTEN	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	12633	78
MICAL2	9645	broad.mit.edu	37	11	12244171	12244171	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:12244171C>A	uc001mjz.2	+	11	1618	c.1330C>A	c.(1330-1332)CTC>ATC	p.L444I	MICAL2_uc010rch.1_Missense_Mutation_p.L444I|MICAL2_uc001mka.2_Missense_Mutation_p.L444I|MICAL2_uc010rci.1_Missense_Mutation_p.L444I|MICAL2_uc001mkb.2_Missense_Mutation_p.L444I|MICAL2_uc001mkc.2_Missense_Mutation_p.L444I|MICAL2_uc001mkd.2_Missense_Mutation_p.L273I|MICAL2_uc010rcj.1_5'UTR	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin	444						cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)		CAGGGAAAGTCTCTACCGGCT	0.567																0.066667	-2.314901	6.449288	3	42	KEEP	---	---	---	---	2	1	32	45	0.333333333333	capture	Missense_Mutation	SNP	12244171	12244171	MICAL2	11	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	9482	78
OR5M10	390167	broad.mit.edu	37	11	56344526	56344526	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56344526C>T	uc001niz.1	-	1	672	c.672G>A	c.(670-672)GCG>GCA	p.A224A		NM_001004741	NP_001004741	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M,	224	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCCTGAAGATCGCTGCAAAAA	0.443																0.271186	81.543041	87.11872	32	86	KEEP	---	---	---	---	22	27	71	92	-1	capture	Silent	SNP	56344526	56344526	OR5M10	11	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	11077	78
SLC22A10	387775	broad.mit.edu	37	11	63072232	63072232	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63072232C>T	uc009yor.2	+	9	1677	c.1469C>T	c.(1468-1470)ACG>ATG	p.T490M	SLC22A10_uc010rmo.1_Intron|SLC22A10_uc001nwu.3_RNA|SLC22A10_uc010rmp.1_3'UTR	NM_001039752	NP_001034841	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	490	Helical; (Potential).					integral to membrane	transmembrane transporter activity			ovary(2)	2						ATGACCTTAACGGTATTTTTT	0.423																0.32567	231.489219	238.52465	85	176	KEEP	---	---	---	---	25	62	93	88	-1	capture	Missense_Mutation	SNP	63072232	63072232	SLC22A10	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14334	78
GRM5	2915	broad.mit.edu	37	11	88242179	88242179	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:88242179C>G	uc001pcq.2	-	9	3420	c.3220G>C	c.(3220-3222)GAG>CAG	p.E1074Q	GRM5_uc009yvm.2_Missense_Mutation_p.E1042Q	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	1074	Cytoplasmic (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	GAGTTGAGCTCGCTGATGTTG	0.667																0.4	7.24953	7.2931	2	3	KEEP	---	---	---	---	3	0	2	1	-1	capture	Missense_Mutation	SNP	88242179	88242179	GRM5	11	C	G	G	G	1	0	0	0	0	1	0	0	0	403	31	4	4	6733	78
MAML2	84441	broad.mit.edu	37	11	96075000	96075000	+	Silent	SNP	C	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:96075000C>G	uc001pfw.1	-	1	1345	c.60G>C	c.(58-60)GCG>GCC	p.A20A		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	20					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				CAAGGAGCCCCGCCCCAGAGG	0.682					501	T	MECT1|CRTC3	salivary gland mucoepidermoid						OREG0021305	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.125	4.340245	6.536673	2	14	KEEP	---	---	---	---	0	2	9	6	-1	capture	Silent	SNP	96075000	96075000	MAML2	11	C	G	G	G	1	0	0	0	0	0	0	0	1	288	23	4	4	9120	78
PGR	5241	broad.mit.edu	37	11	100996783	100996783	+	Missense_Mutation	SNP	G	A	A	rs144880156		TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:100996783G>A	uc001pgh.2	-	2	2487	c.1744C>T	c.(1744-1746)CTT>TTT	p.L582F	PGR_uc001pgi.2_Missense_Mutation_p.L582F|PGR_uc009yww.1_RNA|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	582	NR C4-type.|Nuclear receptor.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)	CCACAGGTAAGGACACCATAA	0.443	Pancreas(124;2271 2354 21954 22882)				429											0.022059	-27.597878	7.077905	3	133	KEEP	---	---	---	---	4	0	77	82	-1	capture	Missense_Mutation	SNP	100996783	100996783	PGR	11	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	11708	78
ELMOD1	55531	broad.mit.edu	37	11	107501263	107501263	+	Silent	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:107501263G>A	uc010rvs.1	+	3	542	c.138G>A	c.(136-138)CCG>CCA	p.P46P	ELMOD1_uc001pjm.2_Silent_p.P46P|ELMOD1_uc010rvt.1_Silent_p.P40P	NM_018712	NP_061182	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1 isoform 1	46					phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		ATACCAAGCCGGGAGCTTCTA	0.398																0.394737	48.821072	49.188187	15	23	KEEP	---	---	---	---	11	7	12	14	-1	capture	Silent	SNP	107501263	107501263	ELMOD1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5023	78
C11orf65	160140	broad.mit.edu	37	11	108302504	108302504	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108302504C>T	uc001pkh.2	-	3	213	c.143G>A	c.(142-144)CGT>CAT	p.R48H	C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_RNA	NM_152587	NP_689800	Q8NCR3	CK065_HUMAN	hypothetical protein LOC160140	48										ovary(1)	1		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;8.21e-06)|BRCA - Breast invasive adenocarcinoma(274;1.01e-05)|all cancers(92;0.000189)|Colorectal(284;0.114)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		CACTATCTGACGTGGTTCTCC	0.303					1											0.21118	78.484853	90.888154	34	127	KEEP	---	---	---	---	20	20	65	88	-1	capture	Missense_Mutation	SNP	108302504	108302504	C11orf65	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1641	78
NTF3	4908	broad.mit.edu	37	12	5603799	5603799	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5603799C>T	uc001qnl.3	+	1	502	c.419C>T	c.(418-420)GCG>GTG	p.A140V	NTF3_uc001qnk.3_Missense_Mutation_p.A153V	NM_002527	NP_002518	P20783	NTF3_HUMAN	neurotrophin 3 isoform 2 preproprotein	140					signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1						AAACGGTACGCGGAGCATAAG	0.602	GBM(194;1104 2182 8339 9578 18493)															0.233161	101.611434	114.170072	45	148	KEEP	---	---	---	---	22	35	78	82	-1	capture	Missense_Mutation	SNP	5603799	5603799	NTF3	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10603	78
LEPREL2	10536	broad.mit.edu	37	12	6946946	6946946	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6946946T>A	uc001qra.1	+	14	1796	c.1762T>A	c.(1762-1764)TGC>AGC	p.C588S	LEPREL2_uc001qqz.1_Missense_Mutation_p.C395S|LEPREL2_uc001qrb.1_Missense_Mutation_p.C395S|GNB3_uc001qrc.2_5'Flank|GNB3_uc001qrd.2_5'Flank	NM_014262	NP_055077	Q8IVL6	P3H3_HUMAN	leprecan-like 2 precursor	588	Fe2OG dioxygenase.				negative regulation of cell proliferation	endoplasmic reticulum	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity				0					L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CGCAGACAACTGCGTCCTGGA	0.642																0.194444	15.10383	18.240021	7	29	KEEP	---	---	---	---	3	4	18	19	-1	capture	Missense_Mutation	SNP	6946946	6946946	LEPREL2	12	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	8651	78
CCDC91	55297	broad.mit.edu	37	12	28459762	28459762	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:28459762G>A	uc001riq.2	+	4	371	c.355G>A	c.(355-357)GTG>ATG	p.V119M	CCDC91_uc001rio.2_Missense_Mutation_p.V89M|CCDC91_uc009zjk.2_RNA|CCDC91_uc001rip.1_Missense_Mutation_p.V119M|CCDC91_uc001rir.2_Translation_Start_Site|CCDC91_uc009zjl.2_Translation_Start_Site	NM_018318	NP_060788	Q7Z6B0	CCD91_HUMAN	GGA binding partner	119					protein transport	Golgi apparatus|membrane				central_nervous_system(1)	1	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					AATTGCCCTTGTGGATGATTC	0.358																0.275591	85.259805	91.025864	35	92	KEEP	---	---	---	---	18	21	44	63	-1	capture	Missense_Mutation	SNP	28459762	28459762	CCDC91	12	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	2843	78
SP7	121340	broad.mit.edu	37	12	53722081	53722081	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53722081C>G	uc001sct.2	-	2	1252	c.1145G>C	c.(1144-1146)GGT>GCT	p.G382A	SP7_uc001scu.2_Missense_Mutation_p.G364A|SP7_uc001scv.2_Missense_Mutation_p.G382A	NM_152860	NP_690599	Q8TDD2	SP7_HUMAN	osterix	382					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGGAGGGGGACCCGGGCCTGG	0.672														OREG0021867	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.138889	11.256385	15.787355	5	31	KEEP	---	---	---	---	4	5	19	21	-1	capture	Missense_Mutation	SNP	53722081	53722081	SP7	12	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	14861	78
KSR2	283455	broad.mit.edu	37	12	117977618	117977618	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117977618C>T	uc001two.2	-	10	1561	c.1506G>A	c.(1504-1506)TCG>TCA	p.S502S		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	531	Pro-rich.				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGGGTGCTGGCGAGGAGGGCG	0.627					623											0.267241	70.656811	76.346214	31	85	KEEP	---	---	---	---	19	22	51	55	-1	capture	Silent	SNP	117977618	117977618	KSR2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8502	78
FLT1	2321	broad.mit.edu	37	13	28971149	28971149	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28971149T>C	uc001usb.3	-	12	1893	c.1608A>G	c.(1606-1608)ATA>ATG	p.I536M	FLT1_uc010aar.1_Missense_Mutation_p.I536M|FLT1_uc001usc.3_Missense_Mutation_p.I536M|FLT1_uc010aas.1_RNA|FLT1_uc010aat.1_Missense_Mutation_p.I19M	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	536	Ig-like C2-type 5.|Extracellular (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	TATTGGAAGCTATGCAAATGT	0.413					738											0.047059	-8.463717	10.10651	4	81	KEEP	---	---	---	---	5	0	53	46	-1	capture	Missense_Mutation	SNP	28971149	28971149	FLT1	13	T	C	C	C	1	0	0	0	0	1	0	0	0	680	53	3	3	5885	78
BRCA2	675	broad.mit.edu	37	13	32937431	32937431	+	Missense_Mutation	SNP	G	A	A	rs80359052	by1000genomes	TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:32937431G>A	uc001uub.1	+	18	8319	c.8092G>A	c.(8092-8094)GCA>ACA	p.A2698T		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	2698					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTCATTGAGCGCAAATATATC	0.378	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)				677	D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			0.032787	-22.407038	6.676688	4	118	KEEP	---	---	---	---	4	0	58	62	-1	capture	Missense_Mutation	SNP	32937431	32937431	BRCA2	13	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1487	78
RB1	5925	broad.mit.edu	37	13	48953730	48953730	+	Nonsense_Mutation	SNP	C	T	T	rs3092891		TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48953730C>T	uc001vcb.2	+	14	1499	c.1333C>T	c.(1333-1335)CGA>TGA	p.R445*		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	445	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)|p.R445*(2)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTGTTTGTAGCGATACAAACT	0.204			6	p.R445*(639V-Tumor)	568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.368421	20.31982	20.60905	7	12	KEEP	---	---	---	---	5	4	10	4	-1	capture	Nonsense_Mutation	SNP	48953730	48953730	RB1	13	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	12993	78
IPO5	3843	broad.mit.edu	37	13	98641352	98641352	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:98641352A>T	uc001vnf.1	+	4	466	c.401A>T	c.(400-402)AAG>ATG	p.K134M	IPO5_uc001vne.2_Missense_Mutation_p.K152M|IPO5_uc010tik.1_Intron|IPO5_uc010til.1_Missense_Mutation_p.K74M	NM_002271	NP_002262	O00410	IPO5_HUMAN	importin 5	134					interspecies interaction between organisms|NLS-bearing substrate import into nucleus|ribosomal protein import into nucleus	cytoplasm|nuclear pore|nucleolus	GTPase inhibitor activity|protein transporter activity|Ran GTPase binding			ovary(1)|lung(1)|skin(1)	3						GAAGGTTTGAAGTTCCTTTTT	0.383																0.256	80.832457	87.589838	32	93	KEEP	---	---	---	---	14	25	50	63	-1	capture	Missense_Mutation	SNP	98641352	98641352	IPO5	13	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	7719	78
SLC22A17	51310	broad.mit.edu	37	14	23820969	23820969	+	Silent	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23820969G>A	uc001wjl.2	-	2	419	c.363C>T	c.(361-363)CCC>CCT	p.P121P	SLC22A17_uc010akk.2_5'UTR|SLC22A17_uc001wjn.2_Intron|SLC22A17_uc001wjm.2_Silent_p.P121P|SLC22A17_uc010akl.1_Silent_p.P121P	NM_020372	NP_065105	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17 isoform a	121					siderophore transport	integral to organelle membrane|integral to plasma membrane|vacuolar membrane	transmembrane receptor activity|transmembrane transporter activity				0	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		ACCTGTCTGCGGGGTAACCCA	0.617																0.328767	69.574258	71.472363	24	49	KEEP	---	---	---	---	17	17	34	35	-1	capture	Silent	SNP	23820969	23820969	SLC22A17	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	14341	78
FSCB	84075	broad.mit.edu	37	14	44975096	44975096	+	Silent	SNP	A	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:44975096A>G	uc001wvn.2	-	1	1404	c.1095T>C	c.(1093-1095)GCT>GCC	p.A365A		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	365	Pro-rich.					cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		GCAGAATTTCAGCAGGAGGCT	0.493					151											0.290441	238.89198	249.611131	79	193	KEEP	---	---	---	---	44	50	96	123	-1	capture	Silent	SNP	44975096	44975096	FSCB	14	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	6009	78
PCNX	22990	broad.mit.edu	37	14	71444226	71444226	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:71444226G>A	uc001xmo.2	+	6	1618	c.1172G>A	c.(1171-1173)CGG>CAG	p.R391Q	PCNX_uc001xmn.3_Missense_Mutation_p.R391Q|PCNX_uc010are.1_Missense_Mutation_p.R391Q	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	391						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GGAACGGACCGGGACACTAAC	0.498																0.341463	163.349678	166.99236	56	108	KEEP	---	---	---	---	23	42	66	69	-1	capture	Missense_Mutation	SNP	71444226	71444226	PCNX	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11494	78
ESRRB	2103	broad.mit.edu	37	14	76964704	76964704	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:76964704C>T	uc001xsq.1	+	7	1272	c.1205C>T	c.(1204-1206)ACG>ATG	p.T402M	ESRRB_uc001xsr.2_Missense_Mutation_p.T402M|ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta	402						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		CTGCGGCAGACGGCCGCCAAG	0.627																0.375	15.544877	15.764713	6	10	KEEP	---	---	---	---	7	3	13	10	-1	capture	Missense_Mutation	SNP	76964704	76964704	ESRRB	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5216	78
BCL11B	64919	broad.mit.edu	37	14	99640778	99640778	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:99640778C>T	uc001yga.2	-	4	2662	c.2395G>A	c.(2395-2397)GAG>AAG	p.E799K	BCL11B_uc001ygb.2_Missense_Mutation_p.E728K	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1	799	C2H2-type 4.					nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CCGCAGTACTCGCACGTGTCG	0.597					98	T	TLX3	T-ALL								0.411765	20.22187	20.337434	7	10	KEEP	---	---	---	---	3	4	9	3	-1	capture	Missense_Mutation	SNP	99640778	99640778	BCL11B	14	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1353	78
FAM82A2	55177	broad.mit.edu	37	15	41046948	41046948	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41046948C>T	uc001zmo.1	-	2	178	c.34G>A	c.(34-36)GCC>ACC	p.A12T	FAM82A2_uc001zmp.1_Missense_Mutation_p.A12T|FAM82A2_uc001zmq.1_Missense_Mutation_p.A12T	NM_018145	NP_060615	Q96TC7	RMD3_HUMAN	family with sequence similarity 82, member A2	12					apoptosis|cell differentiation	integral to membrane|microtubule|mitochondrial membrane|nucleus|spindle pole	protein binding				0						CCCAGCCCGGCACGGGCACCA	0.572																0.129032	3.890403	8.037247	4	27	KEEP	---	---	---	---	2	3	19	13	-1	capture	Missense_Mutation	SNP	41046948	41046948	FAM82A2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	5577	78
SPINT1	6692	broad.mit.edu	37	15	41146113	41146113	+	Missense_Mutation	SNP	C	T	T	rs145193299		TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41146113C>T	uc001zna.2	+	5	1151	c.947C>T	c.(946-948)GCG>GTG	p.A316V	SPINT1_uc001znb.2_Intron|SPINT1_uc001znc.2_Intron|SPINT1_uc010ucs.1_Missense_Mutation_p.A316V	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	316						extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GGGGCTCAGGCGACTTTCCCC	0.592																0.320675	213.585309	220.31963	76	161	KEEP	---	---	---	---	37	41	69	98	-1	capture	Missense_Mutation	SNP	41146113	41146113	SPINT1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14960	78
TP53BP1	7158	broad.mit.edu	37	15	43748820	43748820	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43748820C>T	uc001zrs.2	-	12	2119	c.1971G>A	c.(1969-1971)GAG>GAA	p.E657E	TP53BP1_uc010udp.1_Silent_p.E657E|TP53BP1_uc001zrq.3_Silent_p.E662E|TP53BP1_uc001zrr.3_Silent_p.E662E|TP53BP1_uc010udq.1_Silent_p.E662E	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	657					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CTGAAGACCCCTCCTCTGGAT	0.483					421						Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					0.287938	221.19013	231.526736	74	183	KEEP	---	---	---	---	36	54	87	129	-1	capture	Silent	SNP	43748820	43748820	TP53BP1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	16266	78
ADAMTS18	170692	broad.mit.edu	37	16	77401546	77401546	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:77401546G>T	uc002ffc.3	-	4	989	c.570C>A	c.(568-570)AAC>AAA	p.N190K	ADAMTS18_uc002ffe.1_5'UTR|ADAMTS18_uc010vni.1_RNA	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	190					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						GGGAGCTGTAGTTGTGTTCCT	0.502					1451											0.05625	-14.166587	18.958643	9	151	KEEP	---	---	---	---	5	5	96	79	0.5	capture	Missense_Mutation	SNP	77401546	77401546	ADAMTS18	16	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	263	78
OR1E2	8388	broad.mit.edu	37	17	3336801	3336801	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3336801C>T	uc010vre.1	-	1	335	c.335G>A	c.(334-336)AGC>AAC	p.S112N		NM_003554	NP_003545	P47887	OR1E2_HUMAN	olfactory receptor, family 1, subfamily E,	112	Helical; Name=3; (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			large_intestine(1)	1						AAGGAGGAAGCTCTCTAGATC	0.522																0.324324	63.470979	65.49972	24	50	KEEP	---	---	---	---	19	7	32	23	-1	capture	Missense_Mutation	SNP	3336801	3336801	OR1E2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	10859	78
TRPV1	7442	broad.mit.edu	37	17	3486725	3486725	+	Splice_Site	SNP	C	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3486725C>G	uc010vrr.1	-	8	1911	c.1384_splice	c.e8-1	p.P462_splice	TRPV1_uc010vro.1_Splice_Site_p.P473_splice|TRPV1_uc010vrp.1_Splice_Site_p.P402_splice|TRPV1_uc010vrq.1_Splice_Site_p.P460_splice|TRPV1_uc010vrs.1_Splice_Site_p.P462_splice|TRPV1_uc010vrt.1_Splice_Site_p.P462_splice|TRPV1_uc010vru.1_Splice_Site_p.P462_splice	NM_080706	NP_542437	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel,						cell surface receptor linked signaling pathway|chemosensory behavior|thermoception	cell junction|dendritic spine membrane|integral to plasma membrane|postsynaptic membrane	ATP binding|calcium channel activity|calmodulin binding			ovary(1)	1				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	TAAAGGGAGGCTGTGAGATGC	0.473	Melanoma(38;962 1762 15789)															0.222222	7.145119	7.783869	2	7	KEEP	---	---	---	---	0	2	4	3	-1	capture	Splice_Site	SNP	3486725	3486725	TRPV1	17	C	G	G	G	1	0	0	0	0	0	0	1	0	364	28	5	4	16478	78
PLXDC1	57125	broad.mit.edu	37	17	37295949	37295949	+	Silent	SNP	G	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37295949G>T	uc002hrg.2	-	2	425	c.213C>A	c.(211-213)ACC>ACA	p.T71T	PLXDC1_uc002hrh.2_RNA|PLXDC1_uc002hri.2_RNA|PLXDC1_uc002hrj.1_RNA|PLXDC1_uc002hrk.1_RNA	NM_020405	NP_065138	Q8IUK5	PXDC1_HUMAN	plexin domain containing 1 precursor	71	Extracellular (Potential).				angiogenesis	cytoplasm|extracellular region|integral to membrane|tight junction				ovary(1)|kidney(1)|skin(1)	3						CCATGGCCAGGGTGCCCCCAC	0.672																0.23913	49.214471	54.925636	22	70	KEEP	---	---	---	---	11	15	40	54	0.423076923077	capture	Silent	SNP	37295949	37295949	PLXDC1	17	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	12020	78
KRT13	3860	broad.mit.edu	37	17	39661434	39661434	+	Silent	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39661434G>A	uc002hwu.1	-	1	432	c.369C>T	c.(367-369)CGC>CGT	p.R123R	KRT13_uc002hwv.1_Silent_p.R123R|KRT13_uc002hww.2_Silent_p.R16R|KRT13_uc010wfr.1_Silent_p.R16R|KRT13_uc010cxo.2_Silent_p.R123R|KRT13_uc002hwx.1_Silent_p.R111R	NM_153490	NP_705694	P13646	K1C13_HUMAN	keratin 13 isoform a	123	Coil 1A.|Rod.				epidermis development	intermediate filament	structural molecule activity			ovary(2)|skin(2)|pancreas(1)	5		Breast(137;0.000286)				CCTCCAGGGCGCGCACCTTCT	0.532																0.312849	150.936178	156.516992	56	123	KEEP	---	---	---	---	35	35	74	75	-1	capture	Silent	SNP	39661434	39661434	KRT13	17	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8370	78
HLF	3131	broad.mit.edu	37	17	53398080	53398080	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:53398080G>A	uc002iug.1	+	4	1253	c.728G>A	c.(727-729)CGC>CAC	p.R243H	HLF_uc010dce.1_Missense_Mutation_p.R158H|HLF_uc002iuh.2_Missense_Mutation_p.R158H|HLF_uc010wni.1_Missense_Mutation_p.R190H	NM_002126	NP_002117	Q16534	HLF_HUMAN	hepatic leukemia factor	243	Basic motif.				multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						AAGCGCTCCCGCGACGCCCGG	0.547					60	T	TCF3	ALL								0.267857	34.59921	37.325118	15	41	KEEP	---	---	---	---	9	10	25	24	-1	capture	Missense_Mutation	SNP	53398080	53398080	HLF	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7139	78
TLK2	11011	broad.mit.edu	37	17	60679467	60679467	+	Silent	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:60679467G>A	uc010ddp.2	+	20	2119	c.1851G>A	c.(1849-1851)TCG>TCA	p.S617S	TLK2_uc002izx.3_Silent_p.S443S|TLK2_uc002izz.3_Silent_p.S595S|TLK2_uc002jaa.3_Silent_p.S563S|TLK2_uc010wpd.1_Silent_p.S563S	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A	617	Protein kinase.				cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						TTGGTCTTTCGAAGATCATGG	0.383					505											0.231884	79.228372	88.314976	32	106	KEEP	---	---	---	---	18	21	75	56	-1	capture	Silent	SNP	60679467	60679467	TLK2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	15829	78
ABCA10	10349	broad.mit.edu	37	17	67181653	67181653	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67181653G>A	uc010dfa.1	-	21	3341	c.2462C>T	c.(2461-2463)ACG>ATG	p.T821M	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_Missense_Mutation_p.T422M	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	821					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					GGTAAGAGGCGTCTTCGGGAT	0.363																0.333333	124.436004	127.754097	45	90	KEEP	---	---	---	---	20	32	48	60	-1	capture	Missense_Mutation	SNP	67181653	67181653	ABCA10	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	29	78
P4HB	5034	broad.mit.edu	37	17	79804920	79804920	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79804920A>C	uc002kbn.1	-	6	955	c.758T>G	c.(757-759)ATC>AGC	p.I253S	P4HB_uc002kbl.1_Intron|P4HB_uc002kbm.1_5'UTR	NM_000918	NP_000909	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta subunit precursor	253					cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			GTGAGTCTTGATTTCACCTCC	0.468	Colon(49;444 983 1296 7887 42561)				156											0.019231	-148.802294	26.734302	13	663	KEEP	---	---	---	---	7	10	361	432	-1	capture	Missense_Mutation	SNP	79804920	79804920	P4HB	17	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	11263	78
LAMA3	3909	broad.mit.edu	37	18	21492813	21492813	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:21492813A>G	uc002kuq.2	+	56	7383	c.7297A>G	c.(7297-7299)AAT>GAT	p.N2433D	LAMA3_uc002kur.2_Missense_Mutation_p.N2377D|LAMA3_uc002kus.3_Missense_Mutation_p.N824D|LAMA3_uc002kut.3_Missense_Mutation_p.N768D	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	2433	Laminin G-like 1.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGGTACTGAGAATATGTTTGT	0.398																0.274611	169.810111	178.628141	53	140	KEEP	---	---	---	---	27	41	86	86	-1	capture	Missense_Mutation	SNP	21492813	21492813	LAMA3	18	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	8527	78
TMEM146	257062	broad.mit.edu	37	19	5748191	5748191	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5748191C>T	uc002mda.2	+	10	890	c.829C>T	c.(829-831)CGG>TGG	p.R277W	TMEM146_uc010duj.1_5'UTR	NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	277	Extracellular (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						CGACACCGTCCGGGTGAAAAA	0.542																0.268456	112.344485	119.547952	40	109	KEEP	---	---	---	---	17	28	60	71	-1	capture	Missense_Mutation	SNP	5748191	5748191	TMEM146	19	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	15944	78
CATSPERG	57828	broad.mit.edu	37	19	38851477	38851477	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38851477G>A	uc002oih.3	+	16	1961	c.1874G>A	c.(1873-1875)CGG>CAG	p.R625Q	CATSPERG_uc002oig.3_Missense_Mutation_p.R585Q|CATSPERG_uc002oif.3_Missense_Mutation_p.R265Q|CATSPERG_uc010efw.2_RNA	NM_021185	NP_067008	Q6ZRH7	CTSRG_HUMAN	cation channel, sperm-associated, gamma	625	Extracellular (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)|skin(1)	2						GACTTGGAGCGGAAAGGGTGA	0.403																0.571429	14.00134	14.032559	4	3	KEEP	---	---	---	---	4	3	2	2	-1	capture	Missense_Mutation	SNP	38851477	38851477	CATSPERG	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2668	78
ZNF780A	284323	broad.mit.edu	37	19	40580618	40580618	+	Silent	SNP	T	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40580618T>C	uc002omy.2	-	6	1956	c.1731A>G	c.(1729-1731)AAA>AAG	p.K577K	ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Silent_p.K577K|ZNF780A_uc010xvh.1_Silent_p.K578K	NM_001010880	NP_001010880	O75290	Z780A_HUMAN	zinc finger protein 780A isoform b	577	C2H2-type 15.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CAGTATGCAATTTCTGATGTC	0.388																0.286184	285.208456	297.671418	87	217	KEEP	---	---	---	---	43	59	106	153	-1	capture	Silent	SNP	40580618	40580618	ZNF780A	19	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	18028	78
PPFIA3	8541	broad.mit.edu	37	19	49633717	49633717	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49633717C>G	uc002pmr.2	+	7	1072	c.740C>G	c.(739-741)GCC>GGC	p.A247G	PPFIA3_uc010yai.1_RNA|PPFIA3_uc010emt.2_Missense_Mutation_p.A171G|PPFIA3_uc010yaj.1_RNA|PPFIA3_uc002pms.2_Missense_Mutation_p.A115G	NM_003660	NP_003651	O75145	LIPA3_HUMAN	PTPRF interacting protein alpha 3	247	Potential.					cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		CGGCAGCGCGCCGAGGTGTGC	0.692																0.071429	1.034038	6.326074	2	26	KEEP	---	---	---	---	0	2	15	12	-1	capture	Missense_Mutation	SNP	49633717	49633717	PPFIA3	19	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	12212	78
ZNF544	27300	broad.mit.edu	37	19	58772416	58772416	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58772416G>C	uc010euo.2	+	7	918	c.444G>C	c.(442-444)GAG>GAC	p.E148D	ZNF544_uc010yhw.1_Intron|ZNF544_uc010yhx.1_Missense_Mutation_p.E120D|ZNF544_uc010yhy.1_Missense_Mutation_p.E120D|ZNF544_uc002qrt.3_Missense_Mutation_p.E6D|ZNF544_uc002qru.3_Missense_Mutation_p.E6D|uc002qrx.1_Intron	NM_014480	NP_055295	Q6NX49	ZN544_HUMAN	zinc finger protein 544	148					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		TCACCTCAGAGAGACTGTTTG	0.448																0.028846	-17.773206	7.629133	3	101	KEEP	---	---	---	---	2	2	51	58	-1	capture	Missense_Mutation	SNP	58772416	58772416	ZNF544	19	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	17856	78
PSD4	23550	broad.mit.edu	37	2	113940279	113940279	+	Silent	SNP	C	T	T	rs147089589		TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113940279C>T	uc002tjc.2	+	2	429	c.246C>T	c.(244-246)GAC>GAT	p.D82D	PSD4_uc002tjd.2_Translation_Start_Site|PSD4_uc002tje.2_Silent_p.D81D|PSD4_uc002tjf.2_5'Flank	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	82					regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						TCCATCAGGACGGGCTGGAGC	0.622																0.372881	58.021586	58.863327	22	37	KEEP	---	---	---	---	9	15	21	23	-1	capture	Silent	SNP	113940279	113940279	PSD4	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12544	78
MGAT5	4249	broad.mit.edu	37	2	135107438	135107438	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135107438C>T	uc002ttv.1	+	9	1320	c.1175C>T	c.(1174-1176)GCC>GTC	p.A392V		NM_002410	NP_002401	Q09328	MGT5A_HUMAN	N-acetylglucosaminyltransferase V	392	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0964)		GCAAATTATGCCCAATCGAAA	0.413																0.028986	-39.923161	10.584579	6	201	KEEP	---	---	---	---	3	3	110	116	-1	capture	Missense_Mutation	SNP	135107438	135107438	MGAT5	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9460	78
XIRP2	129446	broad.mit.edu	37	2	168107813	168107813	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:168107813G>A	uc002udx.2	+	8	9929	c.9911G>A	c.(9910-9912)CGC>CAC	p.R3304H	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.R3129H|XIRP2_uc010fpq.2_Missense_Mutation_p.R3082H|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	3129					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GTGCCTCCTCGCCTGTCAGAG	0.438																0.312741	218.49423	226.571801	81	178	KEEP	---	---	---	---	47	45	86	118	-1	capture	Missense_Mutation	SNP	168107813	168107813	XIRP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17311	78
LRP2	4036	broad.mit.edu	37	2	170134318	170134318	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170134318C>T	uc002ues.2	-	13	1922	c.1709G>A	c.(1708-1710)CGT>CAT	p.R570H	LRP2_uc010zdf.1_Intron	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	570	LDL-receptor class B 4.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CCAGTAAACACGCTTCGATAT	0.408					2055											0.270588	174.355549	186.465843	69	186	KEEP	---	---	---	---	43	38	107	114	-1	capture	Missense_Mutation	SNP	170134318	170134318	LRP2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8872	78
TTN	7273	broad.mit.edu	37	2	179544077	179544077	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179544077G>A	uc010zfg.1	-	139	30223	c.29999C>T	c.(29998-30000)CCG>CTG	p.P10000L	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.P6661L|TTN_uc010fre.1_Intron|TTN_uc002una.1_RNA|TTN_uc010frf.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10927							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTGCTGGCGGAGGCTTCTC	0.413					8722											0.261682	77.854661	83.351138	28	79	KEEP	---	---	---	---	25	12	45	57	-1	capture	Missense_Mutation	SNP	179544077	179544077	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16617	78
SDPR	8436	broad.mit.edu	37	2	192711596	192711596	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192711596C>T	uc002utb.2	-	1	386	c.56G>A	c.(55-57)CGG>CAG	p.R19Q		NM_004657	NP_004648	O95810	SDPR_HUMAN	serum deprivation response protein	19						caveola|cytosol	phosphatidylserine binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0647)		Phosphatidylserine(DB00144)	CTTTTCCTGCCGCATGTCAGA	0.607																0.030769	-23.61026	7.758184	4	126	KEEP	---	---	---	---	5	1	67	89	-1	capture	Missense_Mutation	SNP	192711596	192711596	SDPR	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13863	78
NGEF	25791	broad.mit.edu	37	2	233744299	233744299	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233744299G>T	uc002vts.2	-	15	2281	c.2033C>A	c.(2032-2034)TCC>TAC	p.S678Y	NGEF_uc010zmm.1_Missense_Mutation_p.S401Y|NGEF_uc010fyg.1_Missense_Mutation_p.S586Y	NM_019850	NP_062824	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	678					apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)|skin(1)	7		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		GAGGTTCTGGGACCGGATCTT	0.582																0.05988	-22.009672	12.237414	10	157	KEEP	---	---	---	---	1	12	105	81	0.0769230769231	capture	Missense_Mutation	SNP	233744299	233744299	NGEF	2	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	10301	78
MYH7B	57644	broad.mit.edu	37	20	33586908	33586908	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:33586908G>A	uc002xbi.1	+	34	4458	c.4366G>A	c.(4366-4368)GCC>ACC	p.A1456T		NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	1414	Potential.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CGTGGAGGCTGCCAACGCCAA	0.607																0.052632	-5.1762	6.835341	3	54	KEEP	---	---	---	---	1	2	33	43	-1	capture	Missense_Mutation	SNP	33586908	33586908	MYH7B	20	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	9950	78
SALL4	57167	broad.mit.edu	37	20	50407987	50407987	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50407987C>T	uc002xwh.3	-	2	1136	c.1035G>A	c.(1033-1035)CAG>CAA	p.Q345Q	SALL4_uc010gii.2_Silent_p.Q345Q|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	345					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						AGAAAGGGCTCTGGAAGAGCA	0.632																0.275362	50.292364	53.429632	19	50	KEEP	---	---	---	---	10	11	18	34	-1	capture	Silent	SNP	50407987	50407987	SALL4	20	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	13705	78
COL20A1	57642	broad.mit.edu	37	20	61942767	61942767	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61942767C>T	uc011aau.1	+	12	1515	c.1415C>T	c.(1414-1416)GCG>GTG	p.A472V	COL20A1_uc011aav.1_Missense_Mutation_p.A293V	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	472	Fibronectin type-III 3.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					CCGCCCCGGGCGCTGACCCTG	0.687																0.333333	13.369936	13.738978	5	10	KEEP	---	---	---	---	3	4	6	7	-1	capture	Missense_Mutation	SNP	61942767	61942767	COL20A1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3644	78
CCT8L2	150160	broad.mit.edu	37	22	17072541	17072541	+	Silent	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:17072541G>A	uc002zlp.1	-	1	1160	c.900C>T	c.(898-900)GAC>GAT	p.D300D		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	300					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GGGTCTCCTCGTCGACCTCCC	0.493																0.390625	286.056008	288.73313	100	156	KEEP	---	---	---	---	51	75	101	120	-1	capture	Silent	SNP	17072541	17072541	CCT8L2	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	2932	78
PARVG	64098	broad.mit.edu	37	22	44586519	44586519	+	Silent	SNP	C	T	T	rs3842780	byFrequency;by1000genomes	TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:44586519C>T	uc011aqe.1	+	7	901	c.477C>T	c.(475-477)AAC>AAT	p.N159N	PARVG_uc003bep.2_Silent_p.N159N|PARVG_uc011aqf.1_Silent_p.N159N|PARVG_uc003beq.2_RNA|PARVG_uc003ber.2_RNA	NM_001137605	NP_001131077	Q9HBI0	PARVG_HUMAN	parvin, gamma	159					cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)				TCCCAACCAACGTCCAGGTGG	0.602																0.316832	87.35963	90.375457	32	69	KEEP	---	---	---	---	17	18	34	44	-1	capture	Silent	SNP	44586519	44586519	PARVG	22	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11373	78
PPARG	5468	broad.mit.edu	37	3	12447429	12447429	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:12447429C>T	uc003bwx.2	+	5	759	c.668C>T	c.(667-669)GCG>GTG	p.A223V	PPARG_uc003bwr.2_Missense_Mutation_p.A195V|PPARG_uc003bws.2_Missense_Mutation_p.A195V|PPARG_uc003bwu.2_Missense_Mutation_p.A195V|PPARG_uc003bwv.2_Missense_Mutation_p.A195V|PPARG_uc010hea.1_RNA|PPARG_uc003bwq.1_Missense_Mutation_p.A195V|PPARG_uc003bwt.1_Missense_Mutation_p.A195V|PPARG_uc003bww.1_Missense_Mutation_p.A223V	NM_015869	NP_056953	P37231	PPARG_HUMAN	peroxisome proliferative activated receptor	223	Interaction with FAM120B (By similarity).				activation of caspase activity|cell fate commitment|cell maturation|cellular response to insulin stimulus|epithelial cell differentiation|glucose homeostasis|induction of apoptosis|innate immune response|lipid homeostasis|lipoprotein transport|long-chain fatty acid transport|low-density lipoprotein particle receptor biosynthetic process|monocyte differentiation|negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|placenta development|positive regulation of fat cell differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to lipid|response to low-density lipoprotein particle stimulus|white fat cell differentiation	cytosol|nucleoplasm	activating transcription factor binding|arachidonic acid binding|drug binding|enzyme binding|prostaglandin receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|kidney(1)	2					Atorvastatin(DB01076)|Icosapent(DB00159)|Pioglitazone(DB01132)|Rosiglitazone(DB00412)|Troglitazone(DB00197)	AAGCTGTTGGCGGAGATCTCC	0.512					191	T	PAX8	follicular thyroid		Insulin resistance ; lipodystrophy|familial partial L;diabetes mellitus|insulin-resistantI|with acanthosis nigricans and hypertension						0.263158	87.914641	94.630942	35	98	KEEP	---	---	---	---	23	23	56	72	-1	capture	Missense_Mutation	SNP	12447429	12447429	PPARG	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12200	78
C3orf72	401089	broad.mit.edu	37	3	138669148	138669148	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138669148C>T	uc003esx.1	+	3	393	c.262C>T	c.(262-264)CGG>TGG	p.R88W	C3orf72_uc011bmr.1_3'UTR	NM_001040061	NP_001035150	Q6ZUU3	CC072_HUMAN	chromosome 3 open reading frame 72	88											0						GCCCGCGCCTCGGGCTTCCGG	0.692																0.342105	36.363245	37.200416	13	25	KEEP	---	---	---	---	9	15	20	23	-1	capture	Missense_Mutation	SNP	138669148	138669148	C3orf72	3	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	2224	78
SUCNR1	56670	broad.mit.edu	37	3	151598459	151598459	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:151598459T>C	uc003ezf.1	+	3	227	c.128T>C	c.(127-129)ATT>ACT	p.I43T		NM_033050	NP_149039	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	43	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	GGAAATACCATTGTTGTTTAC	0.433																0.308235	440.425992	454.322553	131	294	KEEP	---	---	---	---	95	110	191	275	-1	capture	Missense_Mutation	SNP	151598459	151598459	SUCNR1	3	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	15256	78
ZNF732	654254	broad.mit.edu	37	4	266352	266352	+	Silent	SNP	A	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:266352A>G	uc011buu.1	-	3	305	c.291T>C	c.(289-291)CTT>CTC	p.L97L	ZNF732_uc010ibb.1_Intron	NM_001137608	NP_001131080	B4DXR9	ZN732_HUMAN	zinc finger protein 732	98					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTCTTAATATAAGTTTGTGGA	0.328																0.095238	2.936767	6.386592	2	19	KEEP	---	---	---	---	0	2	16	8	-1	capture	Silent	SNP	266352	266352	ZNF732	4	A	G	G	G	1	0	0	0	0	0	0	0	1	158	13	3	3	18000	78
WDR19	57728	broad.mit.edu	37	4	39267694	39267694	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39267694C>T	uc003gtv.2	+	29	3349	c.3195C>T	c.(3193-3195)GCC>GCT	p.A1065A	WDR19_uc011byi.1_Silent_p.A905A|WDR19_uc003gtw.1_Silent_p.A662A	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	1065					cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						TTGGTCAGGCCAAAGATGAAC	0.473																0.333333	6.248039	6.395623	2	4	KEEP	---	---	---	---	2	0	3	1	-1	capture	Silent	SNP	39267694	39267694	WDR19	4	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	17160	78
GUCY1B3	2983	broad.mit.edu	37	4	156721201	156721201	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:156721201G>T	uc003ipc.2	+	9	1317	c.1150G>T	c.(1150-1152)GAA>TAA	p.E384*	GUCY1B3_uc011cio.1_Nonsense_Mutation_p.E406*|GUCY1B3_uc011cip.1_Nonsense_Mutation_p.E364*|GUCY1B3_uc003ipd.2_Nonsense_Mutation_p.E312*|GUCY1B3_uc010iqf.2_Nonsense_Mutation_p.E384*|GUCY1B3_uc010iqg.2_Nonsense_Mutation_p.E312*|GUCY1B3_uc011ciq.1_Nonsense_Mutation_p.E312*	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	384					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		AAGAGCCCTGGAAGATGAAAA	0.393																0.318182	54.246062	56.18851	21	45	KEEP	---	---	---	---	11	11	24	27	0.5	capture	Nonsense_Mutation	SNP	156721201	156721201	GUCY1B3	4	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	6824	78
KIAA0947	23379	broad.mit.edu	37	5	5464090	5464090	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5464090C>G	uc003jdm.3	+	13	4865	c.4643C>G	c.(4642-4644)CCA>CGA	p.P1548R		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1548										ovary(1)|central_nervous_system(1)	2						AAACTAGAGCCATCTGGCAAA	0.358																0.08	2.329722	6.82782	2	23	KEEP	---	---	---	---	0	4	14	12	-1	capture	Missense_Mutation	SNP	5464090	5464090	KIAA0947	5	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	8124	78
BDP1	55814	broad.mit.edu	37	5	70806902	70806902	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:70806902C>A	uc003kbp.1	+	17	4246	c.3983C>A	c.(3982-3984)ACC>AAC	p.T1328N	BDP1_uc003kbn.1_Missense_Mutation_p.T1328N|BDP1_uc003kbo.2_Missense_Mutation_p.T1328N	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	1328					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		GAGACCAGTACCTCAAGACAA	0.408																0.339535	219.111072	224.00434	73	142	KEEP	---	---	---	---	41	39	81	72	0.4875	capture	Missense_Mutation	SNP	70806902	70806902	BDP1	5	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	1384	78
SV2C	22987	broad.mit.edu	37	5	75428010	75428010	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:75428010C>T	uc003kei.1	+	2	569	c.435C>T	c.(433-435)TGC>TGT	p.C145C		NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	145	Cytoplasmic (Potential).				neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TCCAAGAATGCGGTCATGGTC	0.537																0.288372	159.876121	168.501997	62	153	KEEP	---	---	---	---	29	37	92	81	-1	capture	Silent	SNP	75428010	75428010	SV2C	5	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	15307	78
FAM81B	153643	broad.mit.edu	37	5	94749868	94749868	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:94749868G>A	uc003kla.1	+	4	557	c.511G>A	c.(511-513)GTC>ATC	p.V171I	FAM81B_uc010jbe.1_5'UTR	NM_152548	NP_689761	Q96LP2	FA81B_HUMAN	hypothetical protein LOC153643	171	Potential.									ovary(1)|skin(1)	2		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		CACCAGCATCGTCAAAAAACT	0.418																0.265432	112.647172	120.705071	43	119	KEEP	---	---	---	---	21	36	72	74	-1	capture	Missense_Mutation	SNP	94749868	94749868	FAM81B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5575	78
PCDHA1	56147	broad.mit.edu	37	5	140166149	140166149	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140166149C>T	uc003lhb.2	+	1	274	c.274C>T	c.(274-276)CGC>TGC	p.R92C	PCDHA1_uc003lha.2_Missense_Mutation_p.R92C|PCDHA1_uc003lgz.2_Missense_Mutation_p.R92C	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	92	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGGATCGATCGCGAGGAGCT	0.567																0.060773	-14.813708	21.659061	11	170	KEEP	---	---	---	---	7	5	96	109	-1	capture	Missense_Mutation	SNP	140166149	140166149	PCDHA1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11422	78
MED7	9443	broad.mit.edu	37	5	156565766	156565766	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156565766A>G	uc010jik.2	-	2	1069	c.677T>C	c.(676-678)ATT>ACT	p.I226T	MED7_uc003lwm.3_Missense_Mutation_p.I226T	NM_001100816	NP_001094286	O43513	MED7_HUMAN	mediator complex subunit 7	226					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	protein binding|transcription coactivator activity				0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CATCTCATCAATTAGGACACA	0.323																0.014963	-94.320983	12.83648	6	395	KEEP	---	---	---	---	5	3	234	264	-1	capture	Missense_Mutation	SNP	156565766	156565766	MED7	5	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	9365	78
ADAMTS2	9509	broad.mit.edu	37	5	178581109	178581109	+	Silent	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178581109G>A	uc003mjw.2	-	8	1323	c.1323C>T	c.(1321-1323)GCC>GCT	p.A441A	ADAMTS2_uc011dgm.1_Silent_p.A441A	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	441	Peptidase M12B.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GGTGGAAGGCGGCCTGCACCA	0.711					1974											0.25	7.318611	8.000978	3	9	KEEP	---	---	---	---	3	3	6	5	-1	capture	Silent	SNP	178581109	178581109	ADAMTS2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	265	78
MUT	4594	broad.mit.edu	37	6	49419405	49419405	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:49419405C>T	uc003ozg.3	-	6	1361	c.1106G>A	c.(1105-1107)CGT>CAT	p.R369H		NM_000255	NP_000246	P22033	MUTA_HUMAN	methylmalonyl Coenzyme A mutase precursor	369			R -> H (in MMAM; mut- and mut0).|R -> C (in MMAM; mut0).		fatty acid beta-oxidation	mitochondrial matrix	cobalamin binding|metal ion binding|methylmalonyl-CoA mutase activity				0	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TATTGCAGTACGGACAATATT	0.348																0.24	60.351287	66.520608	24	76	KEEP	---	---	---	---	13	15	35	47	-1	capture	Missense_Mutation	SNP	49419405	49419405	MUT	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9901	78
ZNF451	26036	broad.mit.edu	37	6	56963890	56963890	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56963890T>C	uc003pdm.1	+	3	361	c.137T>C	c.(136-138)ATT>ACT	p.I46T	ZNF451_uc003pdl.2_Missense_Mutation_p.I46T|ZNF451_uc003pdn.1_Missense_Mutation_p.I46T|ZNF451_uc011dxn.1_Missense_Mutation_p.I46T|ZNF451_uc003pdk.1_Missense_Mutation_p.I46T|ZNF451_uc003pdo.2_RNA|uc003pdp.2_5'Flank	NM_001031623	NP_001026794	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451 isoform 1	46					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CTTGAATACATTGATCTGGTC	0.338																0.254545	85.143414	91.161374	28	82	KEEP	---	---	---	---	10	31	46	62	-1	capture	Missense_Mutation	SNP	56963890	56963890	ZNF451	6	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	17801	78
SIM1	6492	broad.mit.edu	37	6	100896122	100896122	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:100896122C>T	uc003pqj.3	-	7	957	c.750G>A	c.(748-750)GCG>GCA	p.A250A	SIM1_uc010kcu.2_Silent_p.A250A	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	250	PAS 2.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		CCGTCAGCTCCGCCACCCTGA	0.627																0.162162	11.728589	15.742271	6	31	KEEP	---	---	---	---	3	4	22	11	-1	capture	Silent	SNP	100896122	100896122	SIM1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14216	78
AIM1	202	broad.mit.edu	37	6	107008787	107008787	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:107008787C>T	uc003prh.2	+	17	5228	c.4741C>T	c.(4741-4743)CGA>TGA	p.R1581*	AIM1_uc003pri.2_Nonsense_Mutation_p.R385*	NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	1581	Beta/gamma crystallin 'Greek key' 12.						sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AGGTTCTCTACGACCTTTTGT	0.378					659											0.253906	163.081281	177.13585	65	191	KEEP	---	---	---	---	20	51	95	113	-1	capture	Nonsense_Mutation	SNP	107008787	107008787	AIM1	6	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	430	78
HECA	51696	broad.mit.edu	37	6	139488187	139488187	+	Silent	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:139488187G>A	uc003qin.2	+	2	1323	c.1038G>A	c.(1036-1038)CGG>CGA	p.R346R		NM_016217	NP_057301	Q9UBI9	HDC_HUMAN	headcase	346					respiratory tube development						0				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)		TCCTTCGGCGGCTGGACCTCT	0.597																0.036364	-18.898806	6.757686	4	106	KEEP	---	---	---	---	3	2	80	58	-1	capture	Silent	SNP	139488187	139488187	HECA	6	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	6964	78
SNX9	51429	broad.mit.edu	37	6	158357061	158357061	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:158357061G>T	uc003qqv.1	+	14	1605	c.1432G>T	c.(1432-1434)GTG>TTG	p.V478L		NM_016224	NP_057308	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	478	BAR.				cell communication|intracellular protein transport|lipid tube assembly|positive regulation of GTPase activity|positive regulation of protein oligomerization|receptor-mediated endocytosis	clathrin-coated vesicle|cytoplasmic vesicle membrane|extrinsic to internal side of plasma membrane|ruffle|trans-Golgi network	1-phosphatidylinositol binding|protein homodimerization activity|ubiquitin protein ligase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		TGCCAGTCTCGTGGCAGAACA	0.348																0.247059	58.233001	63.182103	21	64	KEEP	---	---	---	---	15	10	37	43	0.6	capture	Missense_Mutation	SNP	158357061	158357061	SNX9	6	G	T	T	T	1	0	0	0	0	1	0	0	0	520	40	4	4	14801	78
STK31	56164	broad.mit.edu	37	7	23827708	23827708	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:23827708A>G	uc003sws.3	+	21	2664	c.2597A>G	c.(2596-2598)GAA>GGA	p.E866G	STK31_uc003swt.3_Missense_Mutation_p.E843G|STK31_uc011jze.1_Missense_Mutation_p.E866G|STK31_uc010kuq.2_Missense_Mutation_p.E843G|STK31_uc003swv.1_Missense_Mutation_p.E32G	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	866	Protein kinase.						ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						TTAAACCGTGAACAAGGAATT	0.353					598											0.138298	58.724574	82.497846	26	162	KEEP	---	---	---	---	11	24	90	97	-1	capture	Missense_Mutation	SNP	23827708	23827708	STK31	7	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	15186	78
C7orf10	79783	broad.mit.edu	37	7	40356417	40356417	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:40356417G>A	uc003thn.1	+	9	824	c.779G>A	c.(778-780)CGT>CAT	p.R260H	C7orf10_uc003thm.1_Missense_Mutation_p.R230H|C7orf10_uc003tho.1_Missense_Mutation_p.R212H	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13	267							transferase activity			ovary(2)	2						GAAGCAAAACGTTGGGGTACA	0.388																0.148148	6.581337	9.791097	4	23	KEEP	---	---	---	---	3	2	18	14	-1	capture	Missense_Mutation	SNP	40356417	40356417	C7orf10	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2353	78
MUC17	140453	broad.mit.edu	37	7	100679249	100679249	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100679249A>G	uc003uxp.1	+	3	4605	c.4552A>G	c.(4552-4554)AGT>GGT	p.S1518G	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1518	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|23.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TGCATTAACAAGTATACCTGT	0.483																0.209424	230.178318	260.042933	80	302	KEEP	---	---	---	---	40	49	158	191	-1	capture	Missense_Mutation	SNP	100679249	100679249	MUC17	7	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	9884	78
KCNU1	157855	broad.mit.edu	37	8	36768588	36768588	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:36768588C>T	uc010lvw.2	+	22	2559	c.2472C>T	c.(2470-2472)ATC>ATT	p.I824I	KCNU1_uc003xjw.2_RNA	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	824	Cytoplasmic (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		CCCTCACCATCGGATCCTTGC	0.512																0.232558	47.228822	52.893186	20	66	KEEP	---	---	---	---	11	11	38	40	-1	capture	Silent	SNP	36768588	36768588	KCNU1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	8015	78
ST18	9705	broad.mit.edu	37	8	53085003	53085003	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:53085003C>T	uc003xqz.2	-	5	574	c.418G>A	c.(418-420)GTA>ATA	p.V140I	ST18_uc011ldq.1_5'UTR|ST18_uc011ldr.1_Missense_Mutation_p.V105I|ST18_uc011lds.1_Missense_Mutation_p.V45I|ST18_uc003xra.2_Missense_Mutation_p.V140I|ST18_uc003xrb.2_Missense_Mutation_p.V140I	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	140						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGAACAGATACATTTTTTTCA	0.383																0.246914	89.513736	98.965318	40	122	KEEP	---	---	---	---	21	23	73	73	-1	capture	Missense_Mutation	SNP	53085003	53085003	ST18	8	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	15102	78
NSMAF	8439	broad.mit.edu	37	8	59548070	59548070	+	Missense_Mutation	SNP	G	A	A	rs35436008		TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:59548070G>A	uc003xtt.2	-	3	399	c.185C>T	c.(184-186)TCG>TTG	p.S62L	NSMAF_uc011lee.1_Missense_Mutation_p.S93L|NSMAF_uc003xtu.2_Missense_Mutation_p.S62L	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation	62					ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				AAAAATCACCGATTTTGAACA	0.323																0.301508	166.520519	173.523803	60	139	KEEP	---	---	---	---	31	38	83	86	-1	capture	Missense_Mutation	SNP	59548070	59548070	NSMAF	8	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	10581	78
SLCO5A1	81796	broad.mit.edu	37	8	70744273	70744273	+	Silent	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70744273G>A	uc003xyl.2	-	2	1343	c.636C>T	c.(634-636)TTC>TTT	p.F212F	SLCO5A1_uc010lzb.2_Silent_p.F212F|SLCO5A1_uc011lfa.1_RNA|SLCO5A1_uc003xyk.2_Silent_p.F212F|SLCO5A1_uc010lzc.2_Silent_p.F212F	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	212	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GAGGTAAGGCGAAGAGGGCTG	0.662																0.324324	31.30389	32.308719	12	25	KEEP	---	---	---	---	12	2	11	14	-1	capture	Silent	SNP	70744273	70744273	SLCO5A1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	14623	78
ASAP1	50807	broad.mit.edu	37	8	131414154	131414154	+	Silent	SNP	C	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:131414154C>A	uc003yta.1	-	1	64	c.36G>T	c.(34-36)TCG>TCT	p.S12S	ASAP1_uc011liw.1_5'UTR	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	12					cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						AATCTCTCGACGAAAAACTGG	0.502																0.032609	-15.552768	6.39421	3	89	KEEP	---	---	---	---	4	1	67	43	0.2	capture	Silent	SNP	131414154	131414154	ASAP1	8	C	A	A	A	1	0	0	0	0	0	0	0	1	236	19	4	4	1001	78
SLC45A4	57210	broad.mit.edu	37	8	142231734	142231734	+	Silent	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:142231734G>A	uc003ywd.1	-	2	527	c.219C>T	c.(217-219)CTC>CTT	p.L73L	SLC45A4_uc003ywc.1_Silent_p.L73L|SLC45A4_uc010meq.1_Silent_p.L71L	NM_001080431	NP_001073900	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4	124	Helical; (Potential).				transport	integral to membrane				ovary(2)	2	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CGCAGAGGGCGAGGATGAAGG	0.612																0.306667	123.392505	128.392732	46	104	KEEP	---	---	---	---	30	25	63	82	-1	capture	Silent	SNP	142231734	142231734	SLC45A4	8	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	14535	78
LRRC14	9684	broad.mit.edu	37	8	145746502	145746502	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145746502G>C	uc003zdk.1	+	4	1268	c.1122G>C	c.(1120-1122)GAG>GAC	p.E374D	LRRC14_uc003zdl.1_Missense_Mutation_p.E374D|LRRC14_uc003zdo.2_5'Flank	NM_014665	NP_055480	Q15048	LRC14_HUMAN	leucine rich repeat containing 14	374	LRR 4.										0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			AGCTGACTGAGTGTCAGCTCG	0.597																0.271186	51.175419	53.959791	16	43	KEEP	---	---	---	---	15	15	42	24	-1	capture	Missense_Mutation	SNP	145746502	145746502	LRRC14	8	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	8884	78
GDA	9615	broad.mit.edu	37	9	74863239	74863239	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:74863239C>T	uc004aiq.2	+	14	1529	c.1346C>T	c.(1345-1347)CCG>CTG	p.P449L	GDA_uc011lse.1_Missense_Mutation_p.P375L|GDA_uc011lsf.1_Missense_Mutation_p.P375L|GDA_uc004air.2_Missense_Mutation_p.P449L|GDA_uc010mow.1_RNA|GDA_uc004ais.2_Missense_Mutation_p.P371L	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase	449					nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		CAGGTGGTTCCGTTTTCCAGC	0.443																0.285	152.788028	161.089654	57	143	KEEP	---	---	---	---	23	46	91	72	-1	capture	Missense_Mutation	SNP	74863239	74863239	GDA	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6246	78
OR13C3	138803	broad.mit.edu	37	9	107298585	107298585	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107298585C>T	uc004bcb.1	-	1	510	c.510G>A	c.(508-510)GCG>GCA	p.A170A		NM_001001961	NP_001001961	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C,	170	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1						TCAATACATACGCCACCTTGC	0.468	GBM(86;1248 1274 14222 15028 46219)															0.03125	-65.365354	19.319879	11	341	KEEP	---	---	---	---	10	3	212	201	-1	capture	Silent	SNP	107298585	107298585	OR13C3	9	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	10839	78
FIGF	2277	broad.mit.edu	37	X	15364311	15364311	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:15364311G>A	uc004cwt.1	-	7	1518	c.1009C>T	c.(1009-1011)CGC>TGC	p.R337C		NM_004469	NP_004460	O43915	VEGFD_HUMAN	vascular endothelial growth factor D	337					angiogenesis|cell differentiation|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of mast cell chemotaxis|vascular endothelial growth factor receptor signaling pathway	extracellular space|membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity|platelet-derived growth factor receptor binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					TTTGGAAAGCGGCAATGCTTT	0.478					167											0.301205	142.021947	147.860516	50	116	KEEP	---	---	---	---	27	25	57	72	-1	capture	Missense_Mutation	SNP	15364311	15364311	FIGF	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5835	78
PTCHD1	139411	broad.mit.edu	37	X	23397772	23397772	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:23397772T>C	uc004dal.3	+	2	424	c.416T>C	c.(415-417)ATA>ACA	p.I139T	PTCHD1_uc010nfu.1_Missense_Mutation_p.I139T	NM_173495	NP_775766	Q96NR3	PTHD1_HUMAN	patched domain containing 1	139					cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity			ovary(4)|kidney(1)|skin(1)	6						TTTGCCCATATATGTATCCTG	0.433																0.367568	240.77845	243.620026	68	117	KEEP	---	---	---	---	36	36	66	69	-1	capture	Missense_Mutation	SNP	23397772	23397772	PTCHD1	23	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	12627	78
CYBB	1536	broad.mit.edu	37	X	37665738	37665738	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37665738C>T	uc004ddr.2	+	11	1474	c.1413C>T	c.(1411-1413)GCC>GCT	p.A471A	CYBB_uc011mkf.1_Silent_p.A439A|CYBB_uc011mkg.1_Silent_p.A204A	NM_000397	NP_000388	P04839	CY24B_HUMAN	cytochrome b-245 beta polypeptide	471	Cytoplasmic (Potential).				electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2						GGAACAATGCCGGCTTCCTCA	0.527																0.054054	-7.659213	7.857034	4	70	KEEP	---	---	---	---	2	2	35	46	-1	capture	Silent	SNP	37665738	37665738	CYBB	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4093	78
PAGE1	8712	broad.mit.edu	37	X	49455937	49455937	+	Silent	SNP	T	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49455937T>C	uc004dom.2	-	4	340	c.207A>G	c.(205-207)CCA>CCG	p.P69P		NM_003785	NP_003776	O75459	GAGB1_HUMAN	P antigen family, member 1	69					cellular defense response					skin(1)	1	Ovarian(276;0.236)					ACCCAGTCTTTGGCTGAACCA	0.438																0.25	49.330015	53.41058	18	54	KEEP	---	---	---	---	10	11	21	40	-1	capture	Silent	SNP	49455937	49455937	PAGE1	23	T	C	C	C	1	0	0	0	0	0	0	0	1	808	63	3	3	11293	78
FOXR2	139628	broad.mit.edu	37	X	55650496	55650496	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:55650496G>A	uc004duo.2	+	1	664	c.352G>A	c.(352-354)GAA>AAA	p.E118K		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	118					embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3						ACAAAAAGACGAAGGGTCTAA	0.527																0.336634	96.116919	98.502315	34	67	KEEP	---	---	---	---	16	21	29	43	-1	capture	Missense_Mutation	SNP	55650496	55650496	FOXR2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5976	78
SLC7A3	84889	broad.mit.edu	37	X	70148360	70148360	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70148360T>C	uc004dyn.2	-	4	811	c.653A>G	c.(652-654)AAG>AGG	p.K218R	SLC7A3_uc004dyo.2_Missense_Mutation_p.K218R	NM_032803	NP_116192	Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid	218	Extracellular (Potential).				cellular nitrogen compound metabolic process	integral to membrane|plasma membrane				ovary(1)|kidney(1)	2	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	TTCTGTGAGCTTCCAGTTGTG	0.507																0.042553	-4.190116	6.362758	2	45	KEEP	---	---	---	---	2	0	26	25	-1	capture	Missense_Mutation	SNP	70148360	70148360	SLC7A3	23	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	14590	78
ZCCHC5	203430	broad.mit.edu	37	X	77912605	77912605	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:77912605C>T	uc004edc.1	-	2	1609	c.1313G>A	c.(1312-1314)CGT>CAT	p.R438H		NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	438							nucleic acid binding|zinc ion binding			ovary(1)	1						TTTGTGCCAACGGACCCATTC	0.547																0.357616	149.399618	152.099238	54	97	KEEP	---	---	---	---	32	29	57	52	-1	capture	Missense_Mutation	SNP	77912605	77912605	ZCCHC5	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17471	78
RNF113A	7737	broad.mit.edu	37	X	119005259	119005259	+	Silent	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119005259C>T	uc004esb.2	-	1	533	c.318G>A	c.(316-318)GCG>GCA	p.A106A	NDUFA1_uc004esc.3_5'Flank	NM_006978	NP_008909	O15541	R113A_HUMAN	ring finger protein 113A	106							nucleic acid binding|zinc ion binding			breast(2)	2						CCACGGGTTTCGCCGAACGGG	0.552																0.319355	543.980348	561.934095	198	422	KEEP	---	---	---	---	92	123	239	239	-1	capture	Silent	SNP	119005259	119005259	RNF113A	23	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	13319	78
ENOX2	10495	broad.mit.edu	37	X	129759313	129759313	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129759313C>A	uc004evw.2	-	16	2226	c.1808G>T	c.(1807-1809)GGC>GTC	p.G603V	ENOX2_uc004evx.2_Missense_Mutation_p.G574V|ENOX2_uc004evy.2_Missense_Mutation_p.G574V|ENOX2_uc004evv.2_Missense_Mutation_p.G428V	NM_182314	NP_872114	Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2 isoform b	603					cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1						GCCCTCGAAGCCACAGAATTT	0.438	Ovarian(101;828 1506 2951 9500 35258)															0.059459	-14.820312	22.746091	11	174	KEEP	---	---	---	---	7	7	120	96	0.5	capture	Missense_Mutation	SNP	129759313	129759313	ENOX2	23	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	5082	78
SLITRK2	84631	broad.mit.edu	37	X	144904765	144904765	+	Silent	SNP	G	A	A			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:144904765G>A	uc004fcd.2	+	5	1812	c.822G>A	c.(820-822)AGG>AGA	p.R274R	SLITRK2_uc010nsp.2_Silent_p.R274R|SLITRK2_uc010nso.2_Silent_p.R274R|SLITRK2_uc011mwq.1_Silent_p.R274R|SLITRK2_uc011mwr.1_Silent_p.R274R|SLITRK2_uc011mws.1_Silent_p.R274R|SLITRK2_uc004fcg.2_Silent_p.R274R|SLITRK2_uc011mwt.1_Silent_p.R274R	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	274	Extracellular (Potential).					integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					CCAGTCAGAGGGGCAGCCATG	0.557																0.268722	160.251751	171.231154	61	166	KEEP	---	---	---	---	28	48	89	113	-1	capture	Silent	SNP	144904765	144904765	SLITRK2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	555	43	2	2	14635	78
MTM1	4534	broad.mit.edu	37	X	149832009	149832009	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:149832009C>T	uc004fef.3	+	14	1647	c.1571C>T	c.(1570-1572)CCA>CTA	p.P524L	MTM1_uc011mxx.1_RNA|MTM1_uc011mxy.1_Missense_Mutation_p.P487L|MTM1_uc011mxz.1_Missense_Mutation_p.P409L|MTM1_uc010nte.2_Missense_Mutation_p.P392L	NM_000252	NP_000243	Q13496	MTM1_HUMAN	myotubularin	524	Myotubularin phosphatase.				endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GTTTTATATCCAGTTGCCAGT	0.358																0.02459	-23.644904	6.920882	3	119	KEEP	---	---	---	---	1	3	70	67	-1	capture	Missense_Mutation	SNP	149832009	149832009	MTM1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	9847	78
HCFC1	3054	broad.mit.edu	37	X	153229664	153229664	+	Silent	SNP	G	T	T			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153229664G>T	uc004fjp.2	-	3	942	c.414C>A	c.(412-414)CTC>CTA	p.L138L		NM_005334	NP_005325	P51610	HCFC1_HUMAN	host cell factor 1	138	Kelch 2.				cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)	2	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGCTGTGCCCGAGTCGAGGAC	0.562																0.230576	226.695712	253.243764	92	307	KEEP	---	---	---	---	46	68	172	232	0.40350877193	capture	Silent	SNP	153229664	153229664	HCFC1	23	G	T	T	T	1	0	0	0	0	0	0	0	1	470	37	4	4	6917	78
TTN	7273	broad.mit.edu	37	2	179399105	179399108	+	Frame_Shift_Del	DEL	TCTT	-	-			TCGA-06-0939-01	TCGA-06-0939-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179399105_179399108delTCTT	uc010zfg.1	-	307	94754_94757	c.94530_94533delAAGA	c.(94528-94533)GAAAGAfs	p.E31510fs	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Frame_Shift_Del_p.E25205fs|TTN_uc010zfi.1_Frame_Shift_Del_p.E25138fs|TTN_uc010zfj.1_Frame_Shift_Del_p.E25013fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32437_32438							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAGTACTGACTCTTTCTATCTTCT	0.461					8722											0.21			37	138		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	179399105	179399108	TTN	2	TCTT	-	-	-	1	0	1	0	1	0	0	0	0	699	54	5	5	16617	78
