Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GBP4	115361	broad.mit.edu	37	1	89655829	89655829	+	Silent	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89655829C>T	uc001dnb.2	-	7	1205	c.1089G>A	c.(1087-1089)ACG>ACA	p.T363T		NM_052941	NP_443173	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	363						cytoplasm	GTP binding|GTPase activity				0				all cancers(265;0.00723)|Epithelial(280;0.0291)		GCTCCTGGAGCGTGTCTGTGG	0.577																0.407407	95.761591	96.367372	33	48	KEEP	---	---	---	---	22	15	35	27	-1	capture	Silent	SNP	89655829	89655829	GBP4	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6216	89
NBPF9	400818	broad.mit.edu	37	1	144825416	144825416	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144825416G>T	uc009wig.1	+	19	2218	c.2142G>T	c.(2140-2142)TGG>TGT	p.W714C	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Missense_Mutation_p.W639C|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Missense_Mutation_p.W515C|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Missense_Mutation_p.W374C	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	714	NBPF 5.					cytoplasm					0						TGGGTAGATGGTATTCGACTC	0.498					20											0.026042	-39.56659	8.139523	5	187	KEEP	---	---	---	---	2	3	107	100	0.4	capture	Missense_Mutation	SNP	144825416	144825416	NBPF9	1	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	10106	89
TCHH	7062	broad.mit.edu	37	1	152082760	152082760	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152082760G>A	uc001ezp.2	-	2	2933	c.2933C>T	c.(2932-2934)CCG>CTG	p.P978L	TCHH_uc009wne.1_Missense_Mutation_p.P978L	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	978	10 X 30 AA tandem repeats.|4-3.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			tctcttctccggttcctctcc	0.134																0.174603	111.430468	142.91958	55	260	KEEP	---	---	---	---	25	33	141	131	-1	capture	Missense_Mutation	SNP	152082760	152082760	TCHH	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15585	89
TOMM20	9804	broad.mit.edu	37	1	235291954	235291954	+	Missense_Mutation	SNP	C	T	T	rs1130507		TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235291954C>T	uc001hwl.2	-	1	303	c.77G>A	c.(76-78)CGC>CAC	p.R26H	SNORA14B_uc001hwm.1_5'Flank	NM_014765	NP_055580	Q15388	TOM20_HUMAN	translocase of outer mitochondrial membrane 20	26	Cytoplasmic (Potential).				protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane translocase complex	P-P-bond-hydrolysis-driven protein transmembrane transporter activity|unfolded protein binding				0	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;6.33e-05)|Epithelial(3;8.26e-05)			TCGTCTTTTGCGGTCGAAGTA	0.597																0.022831	-49.002511	6.589739	5	214	KEEP	---	---	---	---	2	3	115	115	-1	capture	Missense_Mutation	SNP	235291954	235291954	TOMM20	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16237	89
OR2M5	127059	broad.mit.edu	37	1	248308935	248308935	+	Silent	SNP	G	A	A	rs138472974	byFrequency	TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248308935G>A	uc010pze.1	+	1	486	c.486G>A	c.(484-486)GCG>GCA	p.A162A		NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M,	162	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|kidney(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			ATGCTGTAGCGACATTTTCCT	0.448																0.012891	-136.744938	10.339315	7	536	KEEP	---	---	---	---	4	3	275	293	-1	capture	Silent	SNP	248308935	248308935	OR2M5	1	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	10917	89
OR2M3	127062	broad.mit.edu	37	1	248367072	248367072	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248367072C>T	uc010pzg.1	+	1	703	c.703C>T	c.(703-705)CGC>TGC	p.R235C		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	235	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AGAGGGTCGTCGCAAAGCTTT	0.473																0.369606	577.851905	585.809323	197	336	KEEP	---	---	---	---	119	84	183	168	-1	capture	Missense_Mutation	SNP	248367072	248367072	OR2M3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10915	89
DLG5	9231	broad.mit.edu	37	10	79581860	79581860	+	Splice_Site	SNP	C	G	G			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:79581860C>G	uc001jzk.2	-	15	2453	c.2383_splice	c.e15-1	p.V795_splice	DLG5_uc001jzi.2_5'Flank|DLG5_uc001jzj.2_Intron|DLG5_uc009xru.1_Splice_Site|DLG5_uc001jzl.3_Splice_Site_p.V399_splice	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5						cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GAGGGAATACCTAGGCAGGGA	0.512																0.046875	-6.433126	7.57362	3	61	KEEP	---	---	---	---	0	3	33	43	-1	capture	Splice_Site	SNP	79581860	79581860	DLG5	10	C	G	G	G	1	0	0	0	0	0	0	1	0	312	24	5	4	4516	89
HSPA12A	259217	broad.mit.edu	37	10	118464692	118464692	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:118464692G>A	uc001lct.2	-	3	329	c.224C>T	c.(223-225)ACC>ATC	p.T75I	HSPA12A_uc001lcu.2_5'UTR	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	75							ATP binding			ovary(1)	1				all cancers(201;0.0158)		CGGCTCCTTGGTGAAGCTGTA	0.582																0.465116	61.396071	61.441624	20	23	KEEP	---	---	---	---	9	15	12	13	-1	capture	Missense_Mutation	SNP	118464692	118464692	HSPA12A	10	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	7329	89
DNHD1	144132	broad.mit.edu	37	11	6589084	6589084	+	Nonsense_Mutation	SNP	T	G	G			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6589084T>G	uc001mdw.3	+	36	12909	c.12345T>G	c.(12343-12345)TAT>TAG	p.Y4115*	DNHD1_uc001mea.3_Nonsense_Mutation_p.Y384*|DNHD1_uc001meb.2_Nonsense_Mutation_p.Y383*|DNHD1_uc001mec.2_Nonsense_Mutation_p.Y383*|DNHD1_uc010rao.1_Nonsense_Mutation_p.Y373*|DNHD1_uc009yfg.2_5'Flank	NM_144666	NP_653267	Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1 isoform 1	4115					microtubule-based movement	dynein complex	microtubule motor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CTGCCAAGTATCAGCAGGTTT	0.562																0.3125	32.344092	33.342404	10	22	KEEP	---	---	---	---	10	5	15	10	-1	capture	Nonsense_Mutation	SNP	6589084	6589084	DNHD1	11	T	G	G	G	1	0	0	0	0	0	1	0	0	647	50	5	4	4624	89
OR5M1	390168	broad.mit.edu	37	11	56380101	56380101	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56380101C>T	uc001nja.1	-	1	878	c.878G>A	c.(877-879)CGG>CAG	p.R293Q		NM_001004740	NP_001004740	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M,	293	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						ATCTGTGTTCCGTAGGCTATA	0.398																0.35	399.654867	406.795706	126	234	KEEP	---	---	---	---	72	72	126	139	-1	capture	Missense_Mutation	SNP	56380101	56380101	OR5M1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11076	89
OR5AR1	219493	broad.mit.edu	37	11	56431862	56431862	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56431862G>A	uc010rjm.1	+	1	701	c.701G>A	c.(700-702)CGC>CAC	p.R234H		NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR,	234	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCTGAAGGCCGCCTTAAGGCT	0.483																0.42616	292.942998	294.067119	101	136	KEEP	---	---	---	---	45	65	69	74	-1	capture	Missense_Mutation	SNP	56431862	56431862	OR5AR1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11049	89
SORL1	6653	broad.mit.edu	37	11	121444999	121444999	+	Silent	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:121444999G>A	uc001pxx.2	+	24	3467	c.3387G>A	c.(3385-3387)GGG>GGA	p.G1129G	SORL1_uc010rzp.1_5'Flank	NM_003105	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor containing LDLR class	1129	Extracellular (Potential).|LDL-receptor class A 2.				cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		AGGAGTCTGGGACTTGTATCC	0.453					937											0.421818	353.557135	355.023048	116	159	KEEP	---	---	---	---	68	61	89	94	-1	capture	Silent	SNP	121444999	121444999	SORL1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	14826	89
PIP4K2C	79837	broad.mit.edu	37	12	57988971	57988971	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57988971G>A	uc001sou.2	+	3	466	c.335G>A	c.(334-336)CGT>CAT	p.R112H	PIP4K2C_uc001sot.2_Missense_Mutation_p.R112H|PIP4K2C_uc010srs.1_Missense_Mutation_p.R94H|PIP4K2C_uc010srt.1_Missense_Mutation_p.R112H	NM_001146258	NP_001139730	Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	112	PIPK.					cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding			central_nervous_system(2)|lung(1)	3	Melanoma(17;0.122)					AGGAACCTCCGTGATCGATTT	0.438					258											0.346049	369.080253	376.729675	127	240	KEEP	---	---	---	---	58	91	139	143	-1	capture	Missense_Mutation	SNP	57988971	57988971	PIP4K2C	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11841	89
KCNC2	3747	broad.mit.edu	37	12	75441962	75441962	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:75441962G>A	uc001sxg.1	-	4	2295	c.1751C>T	c.(1750-1752)ACG>ATG	p.T584M	KCNC2_uc009zry.2_Missense_Mutation_p.T584M|KCNC2_uc001sxe.2_Missense_Mutation_p.T584M|KCNC2_uc001sxf.2_Intron|KCNC2_uc010stw.1_Intron	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel	584	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						AGAAGCACACGTGTAATCACC	0.448																0.382872	459.411483	464.185552	152	245	KEEP	---	---	---	---	76	107	136	145	-1	capture	Missense_Mutation	SNP	75441962	75441962	KCNC2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7937	89
SCYL2	55681	broad.mit.edu	37	12	100711649	100711649	+	Silent	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100711649C>T	uc001thn.2	+	10	1391	c.1341C>T	c.(1339-1341)AAC>AAT	p.N447N	SCYL2_uc009ztw.1_Silent_p.N274N|SCYL2_uc001thm.1_Silent_p.N447N	NM_017988	NP_060458	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 protein	447	HEAT.				endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding			lung(3)|ovary(2)|skin(1)	6						AGATAAAGAACAGTGTTCTAC	0.333					647											0.379845	138.036277	139.672612	49	80	KEEP	---	---	---	---	29	24	50	35	-1	capture	Silent	SNP	100711649	100711649	SCYL2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	13841	89
PIWIL1	9271	broad.mit.edu	37	12	130841563	130841563	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130841563G>A	uc001uik.2	+	13	1595	c.1505G>A	c.(1504-1506)CGA>CAA	p.R502Q	PIWIL1_uc001uij.1_Missense_Mutation_p.R502Q	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	502					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		ATCTATACGCGAAGAAATTAT	0.348																0.301075	73.880519	77.158311	28	65	KEEP	---	---	---	---	13	19	42	29	-1	capture	Missense_Mutation	SNP	130841563	130841563	PIWIL1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11860	89
HEATR4	399671	broad.mit.edu	37	14	73974950	73974950	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:73974950C>T	uc010tub.1	-	9	2091	c.1769G>A	c.(1768-1770)GGT>GAT	p.G590D	HEATR4_uc010tua.1_Missense_Mutation_p.G543D	NM_203309	NP_976054			HEAT repeat containing 4											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		AGTAGCAGTACCTTCCAGAGC	0.478																0.288462	116.871459	123.096185	45	111	KEEP	---	---	---	---	28	22	52	66	-1	capture	Missense_Mutation	SNP	73974950	73974950	HEATR4	14	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	6957	89
C15orf43	145645	broad.mit.edu	37	15	45249150	45249150	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45249150G>C	uc001zuk.2	+	2	138	c.121G>C	c.(121-123)GAT>CAT	p.D41H		NM_152448	NP_689661	Q8NHR7	CO043_HUMAN	hypothetical protein LOC145645	41											0		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)		GTTCAGCTGTGATGCCTCGCA	0.577																0.342105	88.325472	90.00035	26	50	KEEP	---	---	---	---	16	16	24	35	-1	capture	Missense_Mutation	SNP	45249150	45249150	C15orf43	15	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	1783	89
CYP11A1	1583	broad.mit.edu	37	15	74637444	74637444	+	Missense_Mutation	SNP	G	A	A	rs121912811		TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74637444G>A	uc002axt.2	-	3	721	c.566C>T	c.(565-567)GCG>GTG	p.A189V	CYP11A1_uc002axs.2_Missense_Mutation_p.A31V|CYP11A1_uc010bjm.1_Missense_Mutation_p.A31V|CYP11A1_uc010bjn.1_RNA|CYP11A1_uc010bjo.1_Missense_Mutation_p.A189V|CYP11A1_uc010bjp.1_5'Flank|CYP11A1_uc010ulj.1_Intron|CYP11A1_uc010bjq.2_Missense_Mutation_p.A189V	NM_000781	NP_000772	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A,	189			A -> V (in AICSR; no loss of activity).		C21-steroid hormone biosynthetic process|cholesterol metabolic process|vitamin D metabolic process|xenobiotic metabolic process	mitochondrial matrix	cholesterol monooxygenase (side-chain-cleaving) activity|electron carrier activity|heme binding			ovary(2)	2					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Clotrimazole(DB00257)|Digitoxin(DB01396)|Digoxin(DB00390)|Medroxyprogesterone(DB00603)|Ouabain(DB01092)|Progesterone(DB00396)|Testosterone(DB00624)|Trilostane(DB01108)	TCCGGAGCCCGCCTTCTTGAT	0.587	Esophageal Squamous(87;818 1337 4093 9268 37314)															0.457447	127.521577	127.66807	43	51	KEEP	---	---	---	---	18	32	23	32	-1	capture	Missense_Mutation	SNP	74637444	74637444	CYP11A1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4104	89
ZNF213	7760	broad.mit.edu	37	16	3187509	3187509	+	Silent	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3187509C>T	uc010uws.1	+	2	675	c.228C>T	c.(226-228)CCC>CCT	p.P76P	ZNF213_uc002cud.2_RNA|ZNF213_uc010btf.2_Silent_p.P76P|ZNF213_uc010bth.2_Silent_p.P76P|ZNF213_uc010uwt.1_Silent_p.P76P	NM_004220	NP_004211	O14771	ZN213_HUMAN	zinc finger protein 213	76	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GGCTGCGGCCCGAGCTGCGTA	0.662																0.53125	104.193455	104.253702	34	30	KEEP	---	---	---	---	30	18	36	18	-1	capture	Silent	SNP	3187509	3187509	ZNF213	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17649	89
CLN3	1201	broad.mit.edu	37	16	28489096	28489096	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28489096C>T	uc002dpo.2	-	14	1482	c.1159G>A	c.(1159-1161)GCA>ACA	p.A387T	uc010vct.1_Intron|CLN3_uc002dpl.2_Missense_Mutation_p.A309T|CLN3_uc010vcu.1_Missense_Mutation_p.A287T|CLN3_uc002dpn.2_Missense_Mutation_p.A288T|CLN3_uc002dpm.2_Missense_Mutation_p.A333T|CLN3_uc010vcv.1_Missense_Mutation_p.A363T|CLN3_uc010byd.2_Intron|CLN3_uc002dpp.2_Missense_Mutation_p.A387T|CLN3_uc002dpt.1_Missense_Mutation_p.A287T|CLN3_uc002dpq.1_Missense_Mutation_p.A339T|CLN3_uc010bye.1_Missense_Mutation_p.A370T|CLN3_uc002dpr.1_RNA|CLN3_uc010byf.1_RNA|CLN3_uc002dps.1_Missense_Mutation_p.A260T|CLN3_uc002dpu.1_Missense_Mutation_p.A285T	NM_000086	NP_000077	Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	387					amyloid precursor protein catabolic process|arginine transport|associative learning|autophagic vacuole fusion|cell death|cellular amino acid metabolic process|cytosolic calcium ion homeostasis|galactosylceramide metabolic process|globoside metabolic process|glucosylceramide metabolic process|ionotropic glutamate receptor signaling pathway|lysosomal lumen acidification|lysosomal lumen pH elevation|negative regulation of catalytic activity|negative regulation of macroautophagy|negative regulation of neuron apoptosis|negative regulation of proteolysis|neuromuscular process controlling balance|neurotransmitter metabolic process|protein catabolic process|protein folding|protein processing|receptor-mediated endocytosis|regulation of action potential|sphingomyelin metabolic process|vacuolar transport	autophagic vacuole|caveola|cytosol|early endosome|Golgi membrane|Golgi stack|integral to endoplasmic reticulum membrane|late endosome|lysosomal membrane|membrane fraction|mitochondrion|neuron projection|nucleus|synaptic vesicle|trans-Golgi network	unfolded protein binding				0						ACGTAGGCTGCGCCTCCCAGG	0.612																0.017544	-53.060326	6.777025	4	224	KEEP	---	---	---	---	1	4	121	122	-1	capture	Missense_Mutation	SNP	28489096	28489096	CLN3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3508	89
ORAI3	93129	broad.mit.edu	37	16	30960835	30960835	+	Silent	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30960835C>T	uc002eac.2	+	1	431	c.225C>T	c.(223-225)GCC>GCT	p.A75A		NM_152288	NP_689501	Q9BRQ5	ORAI3_HUMAN	ORAI calcium release-activated calcium modulator	75	Helical; (Potential).					integral to membrane	protein binding				0						CGGGCTTCGCCATGGTGAGGG	0.692																0.375	15.644442	15.864482	6	10	KEEP	---	---	---	---	3	4	4	9	-1	capture	Silent	SNP	30960835	30960835	ORAI3	16	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	11163	89
CHST5	23563	broad.mit.edu	37	16	75563755	75563755	+	Silent	SNP	C	T	T	rs77436937		TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75563755C>T	uc002fei.2	-	3	1923	c.528G>A	c.(526-528)ACG>ACA	p.T176T	CHST5_uc002fej.1_Silent_p.T182T	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	176	Lumenal (Potential).				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						ATGGCTGCCGCGTGCACAGTG	0.667																0.03268	-26.44358	10.030696	5	148	KEEP	---	---	---	---	3	2	103	89	-1	capture	Silent	SNP	75563755	75563755	CHST5	16	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3372	89
SLC13A5	284111	broad.mit.edu	37	17	6604344	6604344	+	Missense_Mutation	SNP	T	G	G	rs77405963		TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:6604344T>G	uc002gdj.2	-	6	906	c.818A>C	c.(817-819)CAG>CCG	p.Q273P	SLC13A5_uc010vtf.1_Missense_Mutation_p.Q273P|SLC13A5_uc010clq.2_Missense_Mutation_p.Q230P|SLC13A5_uc002gdk.2_Missense_Mutation_p.Q256P|SLC13A5_uc002gdl.1_Missense_Mutation_p.Q255P	NM_177550	NP_808218	Q86YT5	S13A5_HUMAN	solute carrier family 13, member 5 isoform a	273						integral to membrane	citrate transmembrane transporter activity				0						GTAAACAAACTGGAGCCACAG	0.473																0.108696	0.156182	7.146279	5	41	KEEP	---	---	---	---	7	5	23	25	-1	capture	Missense_Mutation	SNP	6604344	6604344	SLC13A5	17	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	14288	89
TP53	7157	broad.mit.edu	37	17	7577127	7577127	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577127C>T	uc002gim.2	-	8	1005	c.811G>A	c.(811-813)GAG>AAG	p.E271K	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E271K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E139K|TP53_uc010cng.1_Missense_Mutation_p.E139K|TP53_uc002gii.1_Missense_Mutation_p.E139K|TP53_uc010cnh.1_Missense_Mutation_p.E271K|TP53_uc010cni.1_Missense_Mutation_p.E271K|TP53_uc002gij.2_Missense_Mutation_p.E271K	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	271	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> V (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> A (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E271K(22)|p.E271*(14)|p.0?(7)|p.E271V(5)|p.E271Q(3)|p.E271G(3)|p.E271D(3)|p.?(2)|p.G266_E271delGRNSFE(2)|p.E271E(2)|p.E271fs*73(1)|p.E258fs*71(1)|p.E271_R273delEVR(1)|p.F270fs*72(1)|p.S269fs*21(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.E271P(1)|p.E271del(1)|p.S269fs*34(1)|p.E271fs*34(1)|p.E271fs*35(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ACACGCACCTCAAAGCTGTTC	0.537	Pancreas(47;798 1329 9957 10801)		111	p.E271K(HUH28-Tumor)|p.F270fs(EFM192A-Tumor)|p.E271K(J82-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.265306	31.255293	33.693147	13	36	KEEP	---	---	---	---	8	6	18	20	-1	capture	Missense_Mutation	SNP	7577127	7577127	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	16264	89
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578263G>A	uc002gim.2	-	6	780	c.586C>T	c.(586-588)CGA>TGA	p.R196*	TP53_uc002gig.1_Nonsense_Mutation_p.R196*|TP53_uc002gih.2_Nonsense_Mutation_p.R196*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R64*|TP53_uc010cng.1_Nonsense_Mutation_p.R64*|TP53_uc002gii.1_Nonsense_Mutation_p.R64*|TP53_uc010cnh.1_Nonsense_Mutation_p.R196*|TP53_uc010cni.1_Nonsense_Mutation_p.R196*|TP53_uc002gij.2_Nonsense_Mutation_p.R196*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.R103*|TP53_uc002gio.2_Nonsense_Mutation_p.R64*|TP53_uc010vug.1_Nonsense_Mutation_p.R157*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	196	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R196*(125)|p.R196P(12)|p.0?(7)|p.R196R(5)|p.R196fs*51(4)|p.A189_V197delAPPQHLIRV(4)|p.R196Q(3)|p.K164_P219del(1)|p.R196L(1)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.R64*(1)|p.I195fs*12(1)|p.R103*(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CCTTCCACTCGGATAAGATGC	0.552	Pancreas(47;798 1329 9957 10801)		111	p.R196*(P31FUJ-Tumor)|p.R196*(CALU6-Tumor)|p.R196*(HUT78-Tumor)|p.H193fs(59M-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.371134	114.574857	115.990105	36	61	KEEP	---	---	---	---	19	21	30	36	-1	capture	Nonsense_Mutation	SNP	7578263	7578263	TP53	17	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	16264	89
MYH13	8735	broad.mit.edu	37	17	10206539	10206539	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10206539A>G	uc002gmk.1	-	39	5731	c.5641T>C	c.(5641-5643)TCT>CCT	p.S1881P		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1881	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						CTCTTGTAAGACTTCACTTTG	0.612																0.388462	341.433082	344.26121	101	159	KEEP	---	---	---	---	55	61	106	82	-1	capture	Missense_Mutation	SNP	10206539	10206539	MYH13	17	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	9942	89
CCDC144A	9720	broad.mit.edu	37	17	16593762	16593762	+	Silent	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:16593762G>A	uc002gqk.1	+	1	124	c.48G>A	c.(46-48)CCG>CCA	p.P16P		NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	16											0						AGGGGTCTCCGAAGCCGGCAG	0.672																0.173913	6.693375	8.999598	4	19	KEEP	---	---	---	---	1	3	10	13	-1	capture	Silent	SNP	16593762	16593762	CCDC144A	17	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	2751	89
HELZ	9931	broad.mit.edu	37	17	65104714	65104714	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:65104714G>A	uc010wqk.1	-	30	4808	c.4621C>T	c.(4621-4623)CTC>TTC	p.L1541F	HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.L1540F|HELZ_uc010der.2_Missense_Mutation_p.L84F	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					AGATGCTGGAGGTGAGGATGG	0.577																0.388889	110.828343	111.793062	35	55	KEEP	---	---	---	---	20	22	27	39	-1	capture	Missense_Mutation	SNP	65104714	65104714	HELZ	17	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	6975	89
DSG1	1828	broad.mit.edu	37	18	28934952	28934952	+	Silent	SNP	C	T	T	rs147922509	byFrequency	TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28934952C>T	uc002kwp.2	+	15	3005	c.2793C>T	c.(2791-2793)TCC>TCT	p.S931S	DSG1_uc010xbp.1_Silent_p.S290S	NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	931	Desmoglein repeat 5.|Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			AACCAACTTCCGGCATGATAG	0.463																0.369615	510.124843	516.707761	163	278	KEEP	---	---	---	---	98	78	155	150	-1	capture	Silent	SNP	28934952	28934952	DSG1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4731	89
STXBP2	6813	broad.mit.edu	37	19	7707328	7707328	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7707328G>A	uc002mha.3	+	10	853	c.808G>A	c.(808-810)GGG>AGG	p.G270R	STXBP2_uc002mhb.3_Missense_Mutation_p.G267R|STXBP2_uc010dvj.2_RNA|STXBP2_uc010xjr.1_Missense_Mutation_p.G281R|STXBP2_uc010dvk.2_Missense_Mutation_p.G238R|STXBP2_uc002mhc.3_Missense_Mutation_p.G38R|STXBP2_uc002mhe.1_5'Flank	NM_006949	NP_008880	Q15833	STXB2_HUMAN	syntaxin binding protein 2 isoform a	270					leukocyte mediated cytotoxicity|neutrophil degranulation|protein transport|regulation of mast cell degranulation|vesicle docking involved in exocytosis	azurophil granule|cytolytic granule|cytosol|specific granule|tertiary granule	syntaxin-3 binding			central_nervous_system(1)	1						TGAGACCACCGGGCTGAGCGA	0.632																0.068548	-8.21372	39.51363	17	231	KEEP	---	---	---	---	13	5	136	142	-1	capture	Missense_Mutation	SNP	7707328	7707328	STXBP2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15243	89
ATG4D	84971	broad.mit.edu	37	19	10659590	10659590	+	Silent	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10659590G>A	uc002mov.2	+	6	966	c.846G>A	c.(844-846)GCG>GCA	p.A282A	ATG4D_uc010xlh.1_Silent_p.A219A|ATG4D_uc010dxh.2_RNA|ATG4D_uc010dxi.2_RNA|ATG4D_uc010dxj.2_Intron	NM_032885	NP_116274	Q86TL0	ATG4D_HUMAN	APG4 autophagy 4 homolog D	282					autophagy|protein transport	cytoplasm	cysteine-type endopeptidase activity				0			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TGTACAAGGCGGATGTGGCAC	0.647																0.4125	107.162806	107.697205	33	47	KEEP	---	---	---	---	23	17	25	30	-1	capture	Silent	SNP	10659590	10659590	ATG4D	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	1090	89
ZNF676	163223	broad.mit.edu	37	19	22363176	22363176	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22363176G>T	uc002nqs.1	-	3	1661	c.1343C>A	c.(1342-1344)CCC>CAC	p.P448H		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	448					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				ACATTTGTAGGGTTTCTCTCC	0.433																0.389831	272.274308	274.773542	92	144	KEEP	---	---	---	---	57	42	100	81	0.575757575758	capture	Missense_Mutation	SNP	22363176	22363176	ZNF676	19	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	17961	89
GRIK5	2901	broad.mit.edu	37	19	42558502	42558502	+	Silent	SNP	G	A	A	rs140981334	by1000genomes	TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42558502G>A	uc002osj.1	-	8	1061	c.1026C>T	c.(1024-1026)CAC>CAT	p.H342H	GRIK5_uc010eib.1_Silent_p.H261H	NM_002088	NP_002079	Q16478	GRIK5_HUMAN	glutamate receptor KA2 precursor	342	Extracellular (Potential).					cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity				0		Prostate(69;0.059)			L-Glutamic Acid(DB00142)	GGCTGGTCCCGTGGGGCCAAA	0.652																0.306931	80.635173	83.966007	31	70	KEEP	---	---	---	---	17	23	42	46	-1	capture	Silent	SNP	42558502	42558502	GRIK5	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6710	89
ZNF28	7576	broad.mit.edu	37	19	53303413	53303413	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53303413C>T	uc002qad.2	-	4	1805	c.1685G>A	c.(1684-1686)CGC>CAC	p.R562H	ZNF28_uc002qac.2_Missense_Mutation_p.R509H|ZNF28_uc010eqe.2_Missense_Mutation_p.R508H	NM_006969	NP_008900	P17035	ZNF28_HUMAN	zinc finger protein 28	562	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		GTGTGATTTGCGACTGAAAAC	0.413																0.019417	-46.784238	6.655901	4	202	KEEP	---	---	---	---	0	4	109	103	-1	capture	Missense_Mutation	SNP	53303413	53303413	ZNF28	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17693	89
CACNG8	59283	broad.mit.edu	37	19	54466519	54466519	+	Silent	SNP	T	G	G			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54466519T>G	uc002qcs.1	+	1	226	c.120T>G	c.(118-120)ACT>ACG	p.T40T		NM_031895	NP_114101	Q8WXS5	CCG8_HUMAN	voltage-dependent calcium channel gamma-8	41					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic density|postsynaptic membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		CCATCAGCACTGACTACTGGC	0.711																0.297297	28.609347	29.969496	11	26	KEEP	---	---	---	---	7	6	12	17	-1	capture	Silent	SNP	54466519	54466519	CACNG8	19	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	2539	89
NLRP4	147945	broad.mit.edu	37	19	56370584	56370584	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56370584G>A	uc002qmd.3	+	3	2247	c.1825G>A	c.(1825-1827)GTC>ATC	p.V609I	NLRP4_uc002qmf.2_Missense_Mutation_p.V534I|NLRP4_uc010etf.2_Missense_Mutation_p.V440I	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	609							ATP binding	p.V609F(1)		ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CGTTCAAAATGTCTTTAAGAA	0.408																0.324324	121.635373	125.696469	48	100	KEEP	---	---	---	---	28	25	63	49	-1	capture	Missense_Mutation	SNP	56370584	56370584	NLRP4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	10386	89
PROC	5624	broad.mit.edu	37	2	128177527	128177527	+	Silent	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128177527G>A	uc002tok.2	+	2	82	c.9G>A	c.(7-9)CAG>CAA	p.Q3Q	PROC_uc002tol.2_Silent_p.Q24Q|PROC_uc010yzi.1_Silent_p.Q24Q|PROC_uc010yzj.1_5'UTR|PROC_uc010yzk.1_Silent_p.Q24Q|PROC_uc002tom.2_Silent_p.Q3Q	NM_000312	NP_000303	P04070	PROC_HUMAN	protein C	3					blood coagulation|leukocyte migration|negative regulation of apoptosis|negative regulation of blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|protein binding|serine-type endopeptidase activity				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0673)	Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	GAATGTGGCAGCTCACAAGCC	0.652																0.044776	-8.221066	6.614589	3	64	KEEP	---	---	---	---	0	4	40	53	-1	capture	Silent	SNP	128177527	128177527	PROC	2	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	12441	89
SPEG	10290	broad.mit.edu	37	2	220349266	220349266	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220349266G>A	uc010fwg.2	+	30	7081	c.7081G>A	c.(7081-7083)GGC>AGC	p.G2361S		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	2361	Arg-rich.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GGAGGAGCGCGGCCCCTTCCG	0.731					482											0.444444	12.298865	12.32306	4	5	KEEP	---	---	---	---	4	2	8	5	-1	capture	Missense_Mutation	SNP	220349266	220349266	SPEG	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14928	89
IQCA1	79781	broad.mit.edu	37	2	237374203	237374203	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:237374203C>T	uc002vvz.1	-	6	1053	c.871G>A	c.(871-873)GTG>ATG	p.V291M	IQCA1_uc002vwb.2_Missense_Mutation_p.V298M|IQCA1_uc002vwa.1_RNA|IQCA1_uc010zni.1_Missense_Mutation_p.V291M	NM_024726	NP_079002	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	291							ATP binding			ovary(1)	1						TTGATATCCACGCCTTCTATC	0.473																0.404255	114.031036	114.784463	38	56	KEEP	---	---	---	---	19	24	29	35	-1	capture	Missense_Mutation	SNP	237374203	237374203	IQCA1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7725	89
DYNLRB1	83658	broad.mit.edu	37	20	33122583	33122583	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:33122583A>T	uc002xal.2	+	3	291	c.231A>T	c.(229-231)GAA>GAT	p.E77D	DYNLRB1_uc010zuk.1_Missense_Mutation_p.E77D|DYNLRB1_uc002xam.2_RNA|DYNLRB1_uc002xan.2_RNA	NM_014183	NP_054902	Q9NP97	DLRB1_HUMAN	Roadblock-1	77					microtubule-based movement|transport|visual behavior	centrosome|cytoplasmic dynein complex|microtubule	microtubule motor activity				0						AGAAAAATGAAATTATGGTTG	0.532																0.262295	38.069239	41.189894	16	45	KEEP	---	---	---	---	11	7	26	28	-1	capture	Missense_Mutation	SNP	33122583	33122583	DYNLRB1	20	A	T	T	T	1	0	0	0	0	1	0	0	0	11	1	4	4	4805	89
C21orf91	54149	broad.mit.edu	37	21	19169012	19169012	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:19169012C>T	uc002yko.3	-	3	642	c.551G>A	c.(550-552)CGT>CAT	p.R184H	C21orf91_uc002ykq.3_Missense_Mutation_p.R184H|C21orf91_uc002ykp.3_Missense_Mutation_p.R184H	NM_001100420	NP_001093890	Q9NYK6	EURL_HUMAN	early undifferentiated retina and lens isoform	184										ovary(1)	1				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		TACACTGTTACGACATAAAGT	0.433																0.296399	296.145945	309.494552	107	254	KEEP	---	---	---	---	57	58	136	133	-1	capture	Missense_Mutation	SNP	19169012	19169012	C21orf91	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2115	89
WDR4	10785	broad.mit.edu	37	21	44296865	44296865	+	Silent	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:44296865G>A	uc002zci.2	-	2	175	c.102C>T	c.(100-102)AGC>AGT	p.S34S	WDR4_uc002zck.1_Silent_p.S34S|WDR4_uc002zcl.1_5'UTR|WDR4_uc010gpg.1_Silent_p.S34S|WDR4_uc011aew.1_5'UTR|WDR4_uc010gph.1_5'UTR	NM_033661	NP_387510	P57081	WDR4_HUMAN	WD repeat domain 4 protein	34					tRNA modification	cytoplasm|nucleoplasm	protein binding			ovary(1)	1				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		AGATGAAGAGGCTGTCATCAT	0.303																0.365854	86.838092	88.131582	30	52	KEEP	---	---	---	---	7	26	26	33	-1	capture	Silent	SNP	44296865	44296865	WDR4	21	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	17174	89
RFPL3	10738	broad.mit.edu	37	22	32756314	32756314	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32756314G>A	uc003amj.2	+	2	654	c.449G>A	c.(448-450)GGG>GAG	p.G150E	RFPL3_uc010gwn.2_Missense_Mutation_p.G121E|RFPL3S_uc003amk.2_RNA|RFPL3S_uc003aml.2_RNA	NM_001098535	NP_001092005	O75679	RFPL3_HUMAN	ret finger protein-like 3 isoform 1	150	B30.2/SPRY.						zinc ion binding			ovary(1)	1						GTCCGAAGTGGGCTCATCACA	0.542																0.052239	-13.792309	14.618891	7	127	KEEP	---	---	---	---	4	4	66	72	-1	capture	Missense_Mutation	SNP	32756314	32756314	RFPL3	22	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	13150	89
CSPG5	10675	broad.mit.edu	37	3	47619240	47619240	+	Silent	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47619240C>T	uc003crp.3	-	2	452	c.276G>A	c.(274-276)TCG>TCA	p.S92S	CSPG5_uc003crn.2_5'UTR|CSPG5_uc003cro.3_Silent_p.S92S|CSPG5_uc011bbb.1_5'UTR	NM_006574	NP_006565	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan	92	Extracellular (Potential).				cell differentiation|intracellular transport|nervous system development|regulation of growth	endoplasmic reticulum membrane|Golgi-associated vesicle membrane|integral to plasma membrane|membrane fraction	growth factor activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TCACCGCAGCCGACTCCTGCA	0.726																0.391892	86.358721	87.115747	29	45	KEEP	---	---	---	---	12	22	31	32	-1	capture	Silent	SNP	47619240	47619240	CSPG5	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3926	89
OR5K1	26339	broad.mit.edu	37	3	98188663	98188663	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98188663G>A	uc003dsm.2	+	1	243	c.243G>A	c.(241-243)ATG>ATA	p.M81I		NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K,	81	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)	1						CCCCCAAAATGTTAGAGAACT	0.413																0.363636	420.158408	427.008008	152	266	KEEP	---	---	---	---	84	93	163	157	-1	capture	Missense_Mutation	SNP	98188663	98188663	OR5K1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	11070	89
SLC15A2	6565	broad.mit.edu	37	3	121647354	121647354	+	Silent	SNP	G	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121647354G>T	uc003eep.2	+	15	1446	c.1293G>T	c.(1291-1293)GTG>GTT	p.V431V	SLC15A2_uc011bjn.1_Silent_p.V400V	NM_021082	NP_066568	Q16348	S15A2_HUMAN	peptide transporter 2 isoform a	431					protein transport	integral to plasma membrane	peptide:hydrogen symporter activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.0967)	Cefadroxil(DB01140)	TGACAGTGGTGGGAAATGAAA	0.443																0.393939	315.249549	317.847014	104	160	KEEP	---	---	---	---	55	54	92	81	0.504587155963	capture	Silent	SNP	121647354	121647354	SLC15A2	3	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	14292	89
COPB2	9276	broad.mit.edu	37	3	139098010	139098010	+	Silent	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:139098010G>A	uc003etf.3	-	4	364	c.234C>T	c.(232-234)GAC>GAT	p.D78D	COPB2_uc011bmv.1_Silent_p.D49D|COPB2_uc010hui.2_Silent_p.D49D|COPB2_uc011bmw.1_Silent_p.D78D	NM_004766	NP_004757	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta	78	WD 2.				COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(2)	2						TAATCTGCATGTCATCCTAGA	0.363																0.269841	43.844503	46.857189	17	46	KEEP	---	---	---	---	7	11	24	25	-1	capture	Silent	SNP	139098010	139098010	COPB2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	3694	89
BST1	683	broad.mit.edu	37	4	15717416	15717416	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:15717416C>G	uc003goh.3	+	6	893	c.698C>G	c.(697-699)CCC>CGC	p.P233R	BST1_uc003goi.2_Missense_Mutation_p.P44R	NM_004334	NP_004325	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1 precursor	233					humoral immune response|multicellular organismal development	anchored to membrane|extrinsic to membrane|plasma membrane	binding|NAD+ nucleosidase activity			central_nervous_system(1)	1						ATTGGGGGACCCAATGTGTAA	0.328																0.025	-23.352912	6.642447	3	117	KEEP	---	---	---	---	2	2	57	77	-1	capture	Missense_Mutation	SNP	15717416	15717416	BST1	4	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	1521	89
AREG	374	broad.mit.edu	37	4	75312298	75312298	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:75312298C>T	uc011cbl.1	+	2	319	c.109C>T	c.(109-111)CGT>TGT	p.R37C		NM_001657	NP_001648	P15514	AREG_HUMAN	amphiregulin preproprotein	37					cell proliferation|cell-cell signaling|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|positive regulation of DNA replication	cell surface|extracellular space|integral to membrane	cytokine activity|growth factor activity				0			Lung(101;0.196)			CTCTGGGAAGCGTGAACCATT	0.483																0.724638	342.869374	349.156992	100	38	KEEP	---	---	---	---	87	74	75	53	-1	capture	Missense_Mutation	SNP	75312298	75312298	AREG	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	836	89
ADH6	130	broad.mit.edu	37	4	100130080	100130080	+	Silent	SNP	A	G	G			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:100130080A>G	uc003hup.3	-	6	667	c.573T>C	c.(571-573)ACT>ACC	p.T191T	uc003hum.1_Intron|ADH6_uc003huo.2_Silent_p.T191T|ADH6_uc011cef.1_5'UTR|ADH6_uc010ile.2_Silent_p.T191T	NM_000672	NP_000663	P28332	ADH6_HUMAN	class V alcohol dehydrogenase isoform 2	191					ethanol oxidation|response to ethanol|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|electron carrier activity|zinc ion binding			ovary(1)|kidney(1)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)|NADH(DB00157)	TAGAACCTGGAGTCACCTAAA	0.458																0.01462	-82.15074	9.472928	5	337	KEEP	---	---	---	---	4	1	183	204	-1	capture	Silent	SNP	100130080	100130080	ADH6	4	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	312	89
ITGA1	3672	broad.mit.edu	37	5	52183784	52183784	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:52183784G>A	uc003jou.2	+	8	963	c.911G>A	c.(910-912)CGG>CAG	p.R304Q	ITGA1_uc003jov.2_RNA	NM_181501	NP_852478	P56199	ITA1_HUMAN	integrin, alpha 1 precursor	304	Extracellular (Potential).|VWFA.				axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity			ovary(2)|lung(1)	3		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				AACATTCAACGGTTTTCCATA	0.388																0.369231	152.278068	154.226948	48	82	KEEP	---	---	---	---	29	31	51	45	-1	capture	Missense_Mutation	SNP	52183784	52183784	ITGA1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7795	89
DSP	1832	broad.mit.edu	37	6	7569486	7569486	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7569486C>T	uc003mxp.1	+	12	1766	c.1487C>T	c.(1486-1488)ACG>ATG	p.T496M	DSP_uc003mxq.1_Missense_Mutation_p.T496M	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	496	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TGGTACGTGACGGGCCCGGGA	0.552																0.368421	158.97737	161.283259	56	96	KEEP	---	---	---	---	26	33	54	51	-1	capture	Missense_Mutation	SNP	7569486	7569486	DSP	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4736	89
COL11A2	1302	broad.mit.edu	37	6	33153497	33153497	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33153497C>T	uc003ocx.1	-	6	1085	c.857G>A	c.(856-858)GGG>GAG	p.G286E	COL11A2_uc003ocy.1_Intron|COL11A2_uc003ocz.1_Intron	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	286	Nonhelical region.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						AGGGGTTGTCCCCGTAGTCAT	0.493	Melanoma(1;90 116 3946 5341 17093)															0.402985	86.331667	86.876661	27	40	KEEP	---	---	---	---	17	14	29	22	-1	capture	Missense_Mutation	SNP	33153497	33153497	COL11A2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	3633	89
ASCC3	10973	broad.mit.edu	37	6	101054729	101054729	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:101054729A>G	uc003pqk.2	-	32	5260	c.4931T>C	c.(4930-4932)ATT>ACT	p.I1644T		NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1644	Helicase C-terminal 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GCTTGTAGCAATAAGAACCTA	0.294																0.365385	130.527069	132.182724	38	66	KEEP	---	---	---	---	18	22	36	35	-1	capture	Missense_Mutation	SNP	101054729	101054729	ASCC3	6	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	1024	89
CITED2	10370	broad.mit.edu	37	6	139694947	139694947	+	Silent	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:139694947C>T	uc003qip.1	-	2	379	c.135G>A	c.(133-135)CAG>CAA	p.Q45Q		NM_006079	NP_006070	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with	45	His-rich.				adrenal cortex formation|anti-apoptosis|cell proliferation|determination of left/right symmetry|heart development|liver development|negative regulation of cell migration|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell cycle|positive regulation of cell-cell adhesion|positive regulation of male gonad development|positive regulation of peroxisome proliferator activated receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of organ formation|response to estrogen stimulus|response to fluid shear stress|response to hypoxia|sex determination	cytoplasm|nuclear chromatin|nucleus	chromatin binding|LBD domain binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity				0	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		TGAAGGCGTGCTGGGGCTGCT	0.662	NSCLC(98;1219 1550 33720 43229 49330)															0.365854	41.924484	42.56891	15	26	KEEP	---	---	---	---	12	9	25	13	-1	capture	Silent	SNP	139694947	139694947	CITED2	6	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	3405	89
HOXA6	3203	broad.mit.edu	37	7	27185382	27185382	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:27185382G>C	uc003syo.1	-	2	597	c.597C>G	c.(595-597)ATC>ATG	p.I199M	HOXA5_uc003syn.1_5'Flank|uc003syp.1_5'Flank	NM_024014	NP_076919	P31267	HXA6_HUMAN	homeobox A6	199	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						ACCAGATCTTGATCTGGCGCT	0.597																0.215152	193.469516	218.164332	71	259	KEEP	---	---	---	---	39	49	144	173	-1	capture	Missense_Mutation	SNP	27185382	27185382	HOXA6	7	G	C	C	C	1	0	0	0	0	1	0	0	0	577	45	4	4	7221	89
TXNDC3	51314	broad.mit.edu	37	7	37934142	37934142	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37934142C>T	uc003tfn.2	+	16	1846	c.1474C>T	c.(1474-1476)CAA>TAA	p.Q492*		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	492	NDK 3.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						AACTCCTGAGCAAATAGAGAA	0.303	Ovarian(108;903 1537 27096 29907 47400)											Kartagener_syndrome				0.322835	107.822325	111.366055	41	86	KEEP	---	---	---	---	16	31	43	47	-1	capture	Nonsense_Mutation	SNP	37934142	37934142	TXNDC3	7	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	16680	89
COBL	23242	broad.mit.edu	37	7	51096735	51096735	+	Silent	SNP	T	C	C			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:51096735T>C	uc003tpr.3	-	10	2243	c.2058A>G	c.(2056-2058)ACA>ACG	p.T686T	COBL_uc003tps.2_Silent_p.T743T|COBL_uc011kcl.1_Silent_p.T686T|COBL_uc003tpp.3_Silent_p.T472T|COBL_uc003tpq.3_Silent_p.T627T|COBL_uc003tpo.3_Silent_p.T228T	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	686										skin(3)|ovary(2)	5	Glioma(55;0.08)					GGTGCCATGATGTTGGTGCCA	0.498	NSCLC(189;2119 2138 12223 30818 34679)															0.26749	187.178223	199.032547	65	178	KEEP	---	---	---	---	39	29	106	91	-1	capture	Silent	SNP	51096735	51096735	COBL	7	T	C	C	C	1	0	0	0	0	0	0	0	1	652	51	3	3	3618	89
POM121L12	285877	broad.mit.edu	37	7	53104084	53104084	+	Silent	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53104084C>T	uc003tpz.2	+	1	736	c.720C>T	c.(718-720)CTC>CTT	p.L240L		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	240											0						AGCCGAGCCTCGGCCCCTGGA	0.647																0.448598	142.703982	142.946344	48	59	KEEP	---	---	---	---	22	28	41	30	-1	capture	Silent	SNP	53104084	53104084	POM121L12	7	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	12143	89
EGFR	1956	broad.mit.edu	37	7	55233036	55233036	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233036C>T	uc003tqk.2	+	15	2032	c.1786C>T	c.(1786-1788)CCG>TCG	p.P596S	EGFR_uc003tqi.2_Missense_Mutation_p.P596S|EGFR_uc003tqj.2_Missense_Mutation_p.P596S|EGFR_uc010kzg.1_Missense_Mutation_p.P551S|EGFR_uc011kco.1_Missense_Mutation_p.P543S|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	596	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.P596L(2)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAAGACCTGCCCGGCAGGAGT	0.567			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.043651	-35.155908	21.059154	11	241	KEEP	---	---	---	---	5	8	132	146	-1	capture	Missense_Mutation	SNP	55233036	55233036	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	4922	89
CALN1	83698	broad.mit.edu	37	7	71571150	71571150	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71571150C>T	uc003twa.3	-	3	775	c.248G>A	c.(247-249)CGC>CAC	p.R83H	CALN1_uc003twb.3_Missense_Mutation_p.R125H|CALN1_uc003twc.3_Missense_Mutation_p.R83H	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	83	EF-hand 2.|Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				CATGTCCAAGCGCTGCATGAT	0.587																0.229508	33.81718	37.910351	14	47	KEEP	---	---	---	---	9	8	23	28	-1	capture	Missense_Mutation	SNP	71571150	71571150	CALN1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2567	89
SLC26A5	375611	broad.mit.edu	37	7	103050930	103050930	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103050930A>T	uc003vbz.2	-	7	873	c.637T>A	c.(637-639)TTT>ATT	p.F213I	SLC26A5_uc003vbt.1_Missense_Mutation_p.F213I|SLC26A5_uc003vbu.1_Missense_Mutation_p.F213I|SLC26A5_uc003vbv.1_Missense_Mutation_p.F213I|SLC26A5_uc003vbw.2_RNA|SLC26A5_uc003vbx.2_Missense_Mutation_p.F213I|SLC26A5_uc003vby.2_RNA|SLC26A5_uc010liy.2_RNA	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a	213	Helical; Name=5; (Potential).				regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						GCGGTGGTAAACCCACGGACC	0.408																0.285714	85.775498	90.699466	34	85	KEEP	---	---	---	---	21	15	45	45	-1	capture	Missense_Mutation	SNP	103050930	103050930	SLC26A5	7	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	14412	89
COPG2	26958	broad.mit.edu	37	7	130297070	130297070	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:130297070T>C	uc003vqh.1	-	8	622	c.532A>G	c.(532-534)ATC>GTC	p.I178V		NM_012133	NP_036265	Q9UBF2	COPG2_HUMAN	coatomer protein complex, subunit gamma 2	178					intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)					GCTTCATTGATCCAGCGCTTA	0.353																0.313953	89.7172	92.353457	27	59	KEEP	---	---	---	---	19	16	37	31	-1	capture	Missense_Mutation	SNP	130297070	130297070	COPG2	7	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	3697	89
SH2D4A	63898	broad.mit.edu	37	8	19177081	19177081	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:19177081A>G	uc003wzb.2	+	2	359	c.23A>G	c.(22-24)GAG>GGG	p.E8G	SH2D4A_uc011kym.1_Intron|SH2D4A_uc003wzc.2_Missense_Mutation_p.E8G	NM_022071	NP_071354	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	8						cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)		ATACTGTCGGAGATGTACATA	0.463																0.358974	98.084406	99.447874	28	50	KEEP	---	---	---	---	13	21	25	32	-1	capture	Missense_Mutation	SNP	19177081	19177081	SH2D4A	8	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	14128	89
PREX2	80243	broad.mit.edu	37	8	69030839	69030839	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:69030839C>A	uc003xxv.1	+	27	3408	c.3381C>A	c.(3379-3381)AGC>AGA	p.S1127R		NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1127					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TCTGCAGCAGCCAGTGCAGCT	0.463					1011											0.486486	167.655285	167.672382	54	57	KEEP	---	---	---	---	37	37	43	45	0.5	capture	Missense_Mutation	SNP	69030839	69030839	PREX2	8	C	A	A	A	1	0	0	0	0	1	0	0	0	337	26	4	4	12373	89
CSMD3	114788	broad.mit.edu	37	8	113529374	113529374	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:113529374T>A	uc003ynu.2	-	28	4804	c.4645A>T	c.(4645-4647)ACT>TCT	p.T1549S	CSMD3_uc003yns.2_Missense_Mutation_p.T821S|CSMD3_uc003ynt.2_Missense_Mutation_p.T1509S|CSMD3_uc011lhx.1_Missense_Mutation_p.T1445S	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1549	Extracellular (Potential).|Sushi 8.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AAAACAACAGTGTCCCCAGGT	0.498					2888								HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			0.375	177.438532	179.523234	57	95	KEEP	---	---	---	---	30	31	48	56	-1	capture	Missense_Mutation	SNP	113529374	113529374	CSMD3	8	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	3911	89
SAMD12	401474	broad.mit.edu	37	8	119391929	119391929	+	Silent	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:119391929C>T	uc003yom.2	-	4	462	c.333G>A	c.(331-333)CTG>CTA	p.L111L	SAMD12_uc010mda.1_Silent_p.L111L|SAMD12_uc010mdb.1_RNA	NM_207506	NP_997389	Q8N8I0	SAM12_HUMAN	sterile alpha motif domain containing 12 isoform	111	SAM.									ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)			TAAGTCTCAGCAGGGCTCGCC	0.488																0.35	134.125649	136.908118	49	91	KEEP	---	---	---	---	35	25	51	52	-1	capture	Silent	SNP	119391929	119391929	SAMD12	8	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	13709	89
COL22A1	169044	broad.mit.edu	37	8	139791753	139791753	+	Missense_Mutation	SNP	C	T	T	rs149163176	byFrequency;by1000genomes	TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:139791753C>T	uc003yvd.2	-	14	2150	c.1703G>A	c.(1702-1704)CGG>CAG	p.R568Q		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	568	Pro-rich.|Gly-rich.|Collagen-like 3.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AACACTCACCCGCATGCCGAC	0.592													HNSCC(7;0.00092)			0.330275	109.275338	112.051945	36	73	KEEP	---	---	---	---	23	17	45	42	-1	capture	Missense_Mutation	SNP	139791753	139791753	COL22A1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3646	89
OR1N1	138883	broad.mit.edu	37	9	125289116	125289116	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125289116C>T	uc004bmn.1	-	1	457	c.457G>A	c.(457-459)GTT>ATT	p.V153I		NM_012363	NP_036495	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)|breast(1)|skin(1)	3						GTCAGGGCAACGATATTGGTG	0.537																0.122449	7.41431	14.255175	6	43	KEEP	---	---	---	---	6	5	29	26	-1	capture	Missense_Mutation	SNP	125289116	125289116	OR1N1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10873	89
DBH	1621	broad.mit.edu	37	9	136508597	136508597	+	Silent	SNP	C	T	T	rs141816448		TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136508597C>T	uc004cel.2	+	4	816	c.807C>T	c.(805-807)TGC>TGT	p.C269C		NM_000787	NP_000778	P09172	DOPO_HUMAN	dopamine beta hydroxylase precursor	269	Intragranular (Potential).				hormone biosynthetic process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Dopamine(DB00988)|Vitamin C(DB00126)	TCTTCCAGTGCGCCCCCGAGA	0.662																0.318182	93.611856	96.831068	35	75	KEEP	---	---	---	---	12	25	42	44	-1	capture	Silent	SNP	136508597	136508597	DBH	9	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	4209	89
WWC3	55841	broad.mit.edu	37	X	10096666	10096666	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:10096666G>T	uc004csx.3	+	17	2548	c.2350G>T	c.(2350-2352)GAG>TAG	p.E784*	WWC3_uc010nds.2_Nonsense_Mutation_p.E448*|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	784	Potential.									ovary(4)	4						ACTGGCCGAGGAGCGGGCCAA	0.662																0.666667	17.149639	17.370131	6	3	KEEP	---	---	---	---	4	10	4	0	0.285714285714	capture	Nonsense_Mutation	SNP	10096666	10096666	WWC3	23	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	17294	89
CCNT1	904	broad.mit.edu	37	12	49087434	49087436	+	In_Frame_Del	DEL	ATG	-	-			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49087434_49087436delATG	uc001rse.1	-	9	1884_1886	c.1561_1563delCAT	c.(1561-1563)CATdel	p.H521del	LOC144438_uc001rsd.3_5'Flank|CCNT1_uc009zkz.1_In_Frame_Del_p.H236del	NM_001240	NP_001231	O60563	CCNT1_HUMAN	cyclin T1	521	His-rich.				cell cycle|cell division|interspecies interaction between organisms|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	DNA binding|protein kinase binding			ovary(3)|lung(1)|breast(1)|skin(1)	6						AGTGGTGATTATGATGATGATGA	0.443				p.H521Y(HT1376-Tumor)	169											0.01			7	813		---	---	---	---						capture_indel	In_Frame_Del	DEL	49087434	49087436	CCNT1	12	ATG	-	-	-	1	0	1	0	1	0	0	0	0	206	16	5	5	2905	89
KSR2	283455	broad.mit.edu	37	12	117977605	117977605	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117977605delG	uc001two.2	-	10	1574	c.1519delC	c.(1519-1521)CTCfs	p.L507fs		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	536	Pro-rich.				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTAGGAGGGAGGGGGGGTGCT	0.632				p.L507F(TE5-Tumor)	623											0.26			21	60		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	117977605	117977605	KSR2	12	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	8502	89
B2M	567	broad.mit.edu	37	15	45007798	45007801	+	Frame_Shift_Del	DEL	TCTA	-	-			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45007798_45007801delTCTA	uc001zuc.2	+	2	305_308	c.245_248delTCTA	c.(244-249)TTCTATfs	p.F82fs	B2M_uc010uek.1_Frame_Shift_Del_p.F82fs|B2M_uc010bdx.1_Intron	NM_004048	NP_004039	P61769	B2MG_HUMAN	beta-2-microglobulin precursor	82_83	Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of defense response to virus by virus|viral reproduction	early endosome membrane|Golgi membrane|MHC class I protein complex	protein binding			ovary(2)|skin(1)	3		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		GACTGGTCTTTCTATCTCTTGTAC	0.436																0.35			91	169		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	45007798	45007801	B2M	15	TCTA	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	1234	89
EDEM1	9695	broad.mit.edu	37	3	5248941	5248941	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:5248941delT	uc003bqi.2	+	7	1453	c.1321delT	c.(1321-1323)TTTfs	p.F441fs	EDEM1_uc011asz.1_Frame_Shift_Del_p.F219fs|EDEM1_uc003bqh.2_Frame_Shift_Del_p.F441fs	NM_014674	NP_055489	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like	441	Lumenal (Potential).				ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			ovary(2)|breast(1)	3				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		TCTGCAGGCCTTTTTCCCTGG	0.463																0.03			7	227		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	5248941	5248941	EDEM1	3	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	4866	89
DMRT1	1761	broad.mit.edu	37	9	842164	842164	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:842164delC	uc003zgv.2	+	1	475	c.326delC	c.(325-327)GCCfs	p.A109fs	DMRT1_uc003zgu.1_Frame_Shift_Del_p.A109fs	NM_021951	NP_068770	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor	109	DM.				cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		AACCTGATCGCCGAGAGGCAG	0.567																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	842164	842164	DMRT1	9	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	4543	89
CNTNAP3	79937	broad.mit.edu	37	9	39078395	39078396	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:39078395_39078396delAG	uc004abi.2	-	23	3970_3971	c.3731_3732delCT	c.(3730-3732)TCTfs	p.S1244fs	CNTNAP3_uc004abj.2_Frame_Shift_Del_p.S1163fs|CNTNAP3_uc011lqr.1_RNA	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor	1244	Extracellular (Potential).				cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CGATGACAGCAGAGTCTCTTCT	0.416																0.32			13	28		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	39078395	39078396	CNTNAP3	9	AG	-	-	-	1	0	1	0	1	0	0	0	0	80	7	5	5	3613	89
MSL3	10943	broad.mit.edu	37	X	11780954	11780957	+	Splice_Site	DEL	AGTT	-	-			TCGA-06-2567-01	TCGA-06-2567-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:11780954_11780957delAGTT	uc004cuw.2	+	7	694	c.589_splice	c.e7-1	p.L197_splice	MSL3_uc004cuv.1_Splice_Site_p.L197_splice|MSL3_uc004cux.2_Splice_Site_p.L138_splice|MSL3_uc011mig.1_Splice_Site_p.L48_splice|MSL3_uc011mih.1_Splice_Site_p.L185_splice|MSL3_uc004cuy.2_Splice_Site_p.L31_splice|MSL3_uc011mii.1_Splice_Site_p.L31_splice	NM_078629	NP_523353	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3-like 1 isoform a						histone H4-K16 acetylation|multicellular organismal development|transcription from RNA polymerase II promoter	MSL complex	DNA binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TTTTGTTAACAGTTAGTGAAACTT	0.368																0.69			55	25		---	---	---	---						capture_indel	Splice_Site	DEL	11780954	11780957	MSL3	23	AGTT	-	-	-	1	0	1	0	1	0	0	1	0	91	7	5	5	9789	89
