Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MIB2	142678	broad.mit.edu	37	1	1563750	1563750	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1563750C>T	uc001agg.2	+	15	2240	c.2113C>T	c.(2113-2115)CGC>TGC	p.R705C	MIB2_uc001agh.2_Missense_Mutation_p.R691C|MIB2_uc001agi.2_Missense_Mutation_p.R701C|MIB2_uc001agj.2_Missense_Mutation_p.R546C|MIB2_uc001agk.2_Missense_Mutation_p.R640C|MIB2_uc001agl.1_Missense_Mutation_p.R661C|MIB2_uc001agm.2_Missense_Mutation_p.R582C|MIB2_uc010nyq.1_Missense_Mutation_p.R661C|MIB2_uc009vkh.2_Missense_Mutation_p.R511C|MIB2_uc001agn.2_Missense_Mutation_p.R337C|MIB2_uc001ago.2_5'Flank	NM_080875	NP_543151	Q96AX9	MIB2_HUMAN	mindbomb homolog 2	705	ANK 6.				Notch signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade	endosome	actin binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CAACAACCACCGCGAGGTGGC	0.692																0.466667	43.150648	43.179223	14	16	KEEP	---	---	---	---	10	6	14	6	-1	capture	Missense_Mutation	SNP	1563750	1563750	MIB2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9479	98
PLEKHG5	57449	broad.mit.edu	37	1	6537601	6537601	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6537601G>C	uc001ano.1	-	3	300	c.199C>G	c.(199-201)CTT>GTT	p.L67V	PLEKHG5_uc001ann.1_Missense_Mutation_p.L48V|PLEKHG5_uc001anq.1_Missense_Mutation_p.L88V|PLEKHG5_uc001anp.1_Missense_Mutation_p.L88V|PLEKHG5_uc009vma.1_5'UTR|PLEKHG5_uc010nzr.1_Missense_Mutation_p.L80V|PLEKHG5_uc001ank.1_Missense_Mutation_p.L11V|PLEKHG5_uc009vmb.1_Missense_Mutation_p.L11V|PLEKHG5_uc001anl.1_Missense_Mutation_p.L11V|PLEKHG5_uc001anm.1_Missense_Mutation_p.L11V	NM_001042663	NP_001036128	O94827	PKHG5_HUMAN	pleckstrin homology domain containing family G	67					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		TGTGGGGGAAGGTCGAAGCGG	0.537																0.32381	97.714053	100.607044	34	71	KEEP	---	---	---	---	18	29	38	51	-1	capture	Missense_Mutation	SNP	6537601	6537601	PLEKHG5	1	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	11976	98
CD53	963	broad.mit.edu	37	1	111435024	111435024	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:111435024G>A	uc001dzw.2	+	4	292	c.121G>A	c.(121-123)GGA>AGA	p.G41R	CD53_uc001dzx.2_Missense_Mutation_p.G41R|CD53_uc010owa.1_Missense_Mutation_p.G41R|CD53_uc001dzy.2_Missense_Mutation_p.G41R	NM_001040033	NP_001035122	P19397	CD53_HUMAN	CD53 antigen	41	Extracellular (Potential).				signal transduction	integral to membrane|plasma membrane					0		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		CAACAACTTCGGAGTGCTCTT	0.507																0.368932	110.621418	112.177037	38	65	KEEP	---	---	---	---	20	20	33	34	-1	capture	Missense_Mutation	SNP	111435024	111435024	CD53	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2994	98
HSD3B2	3284	broad.mit.edu	37	1	119985580	119985580	+	Silent	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:119985580C>T	uc001ehu.2	+	4	529	c.387C>T	c.(385-387)GAC>GAT	p.D129D				P26439	3BHS2_HUMAN	RecName: Full=3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 2; AltName: Full=3-beta-HSD II; Includes:   RecName: Full=3-beta-hydroxy-Delta(5)-steroid dehydrogenase;            EC=1.1.1.145;   AltName: Full=3-beta-hydroxy-5-ene steroid dehydrogenase;   AltName: Full=Progesterone reductase; Includes:   RecName: Full=Steroid Delta-isomerase;            EC=5.3.3.1;   AltName: Full=Delta-5-3-ketosteroid isomerase;	Error:Variant_position_missing_in_P26439_after_alignment					androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	NADH(DB00157)|Trilostane(DB01108)	CCTGCCAGGACGTGTCGGTCG	0.507																0.214286	18.750291	21.9185	9	33	KEEP	---	---	---	---	7	2	20	18	-1	capture	Silent	SNP	119985580	119985580	HSD3B2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	235	19	1	1	7316	98
HRNR	388697	broad.mit.edu	37	1	152188024	152188024	+	Silent	SNP	C	G	G	rs142170860		TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152188024C>G	uc001ezt.1	-	3	6157	c.6081G>C	c.(6079-6081)TCG>TCC	p.S2027S		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2027	22.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCCACAGCTCGATGACTGTC	0.562																0.08575	58.111461	196.014134	68	725	KEEP	---	---	---	---	30	39	429	501	-1	capture	Silent	SNP	152188024	152188024	HRNR	1	C	G	G	G	1	0	0	0	0	0	0	0	1	392	31	4	4	7284	98
NUP210L	91181	broad.mit.edu	37	1	154090286	154090286	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154090286C>T	uc001fdw.2	-	12	1607	c.1535G>A	c.(1534-1536)GGA>GAA	p.G512E	NUP210L_uc009woq.2_5'UTR|NUP210L_uc010peh.1_Missense_Mutation_p.G512E	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	512						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			AGTCACCACTCCTTTCGTGGT	0.433																0.36	183.468453	186.491523	63	112	KEEP	---	---	---	---	31	41	60	69	-1	capture	Missense_Mutation	SNP	154090286	154090286	NUP210L	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	10668	98
TIPRL	261726	broad.mit.edu	37	1	168165850	168165850	+	Silent	SNP	C	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:168165850C>A	uc001gfg.2	+	5	727	c.582C>A	c.(580-582)ATC>ATA	p.I194I	TIPRL_uc001gfh.2_Silent_p.I194I	NM_152902	NP_690866	O75663	TIPRL_HUMAN	TIP41, TOR signalling pathway regulator-like	194	Interaction with PPP2CA.				DNA damage checkpoint|negative regulation of protein phosphatase type 2A activity	cytoplasm	protein binding			ovary(1)	1	all_hematologic(923;0.215)					GGGTGCTTATCAGAATGAATG	0.323																0.022599	-37.869891	7.117386	4	173	KEEP	---	---	---	---	4	1	97	128	0.2	capture	Silent	SNP	168165850	168165850	TIPRL	1	C	A	A	A	1	0	0	0	0	0	0	0	1	369	29	4	4	15811	98
USH2A	7399	broad.mit.edu	37	1	215933077	215933077	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:215933077C>T	uc001hku.1	-	57	11543	c.11156G>A	c.(11155-11157)CGT>CAT	p.R3719H		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3719	Fibronectin type-III 22.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTTTCCATTACGACTCAATTG	0.408													HNSCC(13;0.011)			0.405229	184.520787	185.721646	62	91	KEEP	---	---	---	---	28	40	43	53	-1	capture	Missense_Mutation	SNP	215933077	215933077	USH2A	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16918	98
EPHX1	2052	broad.mit.edu	37	1	226027611	226027611	+	Silent	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:226027611C>T	uc001hpk.2	+	6	884	c.804C>T	c.(802-804)TTC>TTT	p.F268F	EPHX1_uc001hpl.2_Silent_p.F268F	NM_001136018	NP_001129490	P07099	HYEP_HUMAN	epoxide hydrolase 1	268					aromatic compound catabolic process|response to toxin	endoplasmic reticulum membrane|integral to membrane|microsome	cis-stilbene-oxide hydrolase activity|epoxide hydrolase activity			ovary(3)|lung(1)	4	Breast(184;0.197)					GACAGCGTTTCGGGAGGTTTC	0.552																0.052	-26.826965	26.238023	13	237	KEEP	---	---	---	---	9	7	105	163	-1	capture	Silent	SNP	226027611	226027611	EPHX1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	5134	98
RYR2	6262	broad.mit.edu	37	1	237838075	237838075	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237838075G>A	uc001hyl.1	+	60	8879	c.8759G>A	c.(8758-8760)CGA>CAA	p.R2920Q	RYR2_uc010pxz.1_5'UTR	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2920	Modulator (Potential).|Cytoplasmic (By similarity).|4 X approximate repeats.|4.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATTGAGAAACGATTTGCCTAT	0.423																0.328125	61.155425	62.83069	21	43	KEEP	---	---	---	---	12	13	22	26	-1	capture	Missense_Mutation	SNP	237838075	237838075	RYR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13661	98
MKX	283078	broad.mit.edu	37	10	27964299	27964299	+	Silent	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:27964299C>T	uc001ity.3	-	7	1143	c.918G>A	c.(916-918)AAG>AAA	p.K306K	MKX_uc001itx.3_Silent_p.K306K	NM_173576	NP_775847	Q8IYA7	MKX_HUMAN	mohawk homeobox	306					muscle organ development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CGTTGATCTCCTTCCAATACG	0.458																0.028902	-31.186465	11.055092	5	168	KEEP	---	---	---	---	1	4	73	115	-1	capture	Silent	SNP	27964299	27964299	MKX	10	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	9522	98
C10orf12	26148	broad.mit.edu	37	10	98741746	98741746	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98741746G>A	uc001kmv.2	+	1	706	c.599G>A	c.(598-600)TGT>TAT	p.C200Y	C10orf12_uc009xvg.1_Missense_Mutation_p.C510Y	NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	200										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AATGGTGACTGTTGTGAGCTG	0.423																0.632812	245.489125	247.469096	81	47	KEEP	---	---	---	---	45	44	31	28	-1	capture	Missense_Mutation	SNP	98741746	98741746	C10orf12	10	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	1577	98
MMP10	4319	broad.mit.edu	37	11	102647144	102647144	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102647144C>T	uc001phg.1	-	6	821	c.799G>A	c.(799-801)GCC>ACC	p.A267T		NM_002425	NP_002416	P09238	MMP10_HUMAN	matrix metalloproteinase 10 preproprotein	267					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			kidney(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)		TCAGTAGAGGCAGGGGGAGGT	0.468																0.483871	127.55941	127.580888	45	48	KEEP	---	---	---	---	24	22	23	34	-1	capture	Missense_Mutation	SNP	102647144	102647144	MMP10	11	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	9561	98
DDX25	29118	broad.mit.edu	37	11	125787056	125787056	+	Silent	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:125787056C>T	uc001qcz.3	+	9	1089	c.948C>T	c.(946-948)TAC>TAT	p.Y316Y	DDX25_uc010sbk.1_Silent_p.Y316Y	NM_013264	NP_037396	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 25	316	Helicase C-terminal.				mRNA export from nucleus|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|nucleus	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(1)	1	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		GGCAATATTACGTGCTGTGTG	0.478																0.5	37.298932	37.298932	12	12	KEEP	---	---	---	---	7	5	4	8	-1	capture	Silent	SNP	125787056	125787056	DDX25	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4310	98
ITPR2	3709	broad.mit.edu	37	12	26864181	26864181	+	Silent	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:26864181G>A	uc001rhg.2	-	9	1293	c.876C>T	c.(874-876)TGC>TGT	p.C292C		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	292	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CACCCCCACGGCATGGGTCAT	0.433					1600											0.040404	-14.891952	7.639787	4	95	KEEP	---	---	---	---	0	5	47	68	-1	capture	Silent	SNP	26864181	26864181	ITPR2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	7844	98
PRPF40B	25766	broad.mit.edu	37	12	50028946	50028946	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:50028946G>C	uc001rur.1	+	12	1064	c.1000G>C	c.(1000-1002)GAG>CAG	p.E334Q	PRPF40B_uc001rup.1_Missense_Mutation_p.E356Q|PRPF40B_uc001ruq.1_Missense_Mutation_p.E328Q|PRPF40B_uc001rus.1_Missense_Mutation_p.E277Q	NM_001031698	NP_001026868	Q6NWY9	PR40B_HUMAN	Huntingtin interacting protein C isoform 1	334					mRNA processing|RNA splicing	nuclear speck				skin(2)|ovary(1)|pancreas(1)|kidney(1)	5						GCGGGAGAAGGAGGAGAAGGA	0.582																0.468085	153.69078	153.774119	44	50	KEEP	---	---	---	---	14	33	30	25	-1	capture	Missense_Mutation	SNP	50028946	50028946	PRPF40B	12	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	12468	98
CAPS2	84698	broad.mit.edu	37	12	75692734	75692734	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:75692734A>C	uc001sxk.3	-	11	1121	c.924T>G	c.(922-924)GAT>GAG	p.D308E	CAPS2_uc001sxm.3_Missense_Mutation_p.D76E|CAPS2_uc009zsa.2_Intron|CAPS2_uc001sxi.3_Intron|CAPS2_uc001sxj.3_Intron|CAPS2_uc001sxl.3_Missense_Mutation_p.D289E	NM_032606	NP_115995	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	308							calcium ion binding			ovary(2)	2						CTCTGCAAGCATCACGTCCAT	0.308																0.443038	131.325201	131.546709	35	44	KEEP	---	---	---	---	11	27	27	23	-1	capture	Missense_Mutation	SNP	75692734	75692734	CAPS2	12	A	C	C	C	1	0	0	0	0	1	0	0	0	102	8	4	4	2614	98
NT5DC3	51559	broad.mit.edu	37	12	104186945	104186945	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104186945C>T	uc010swe.1	-	9	1057	c.1016G>A	c.(1015-1017)CGG>CAG	p.R339Q		NM_001031701	NP_001026871	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	339							hydrolase activity|metal ion binding			ovary(2)|skin(1)	3						CACTCACCTCCGCTTATCATT	0.403																0.275081	250.590137	264.636627	85	224	KEEP	---	---	---	---	48	44	116	133	-1	capture	Missense_Mutation	SNP	104186945	104186945	NT5DC3	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10599	98
NOS1	4842	broad.mit.edu	37	12	117710315	117710315	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117710315C>T	uc001twm.1	-	10	2400	c.1714G>A	c.(1714-1716)GTG>ATG	p.V572M		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	572					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	ATGTTGGACACGGCGGGGAGG	0.617	Esophageal Squamous(162;1748 2599 51982 52956)															0.481132	151.264662	151.294011	51	55	KEEP	---	---	---	---	34	45	37	41	-1	capture	Missense_Mutation	SNP	117710315	117710315	NOS1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10448	98
TMEM132D	121256	broad.mit.edu	37	12	130015732	130015732	+	Silent	SNP	G	A	A	rs147002439		TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130015732G>A	uc009zyl.1	-	3	1315	c.987C>T	c.(985-987)GGC>GGT	p.G329G		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	329	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TGATGTTCACGCCTTTCTTCA	0.557																0.670732	171.046934	173.166451	55	27	KEEP	---	---	---	---	34	31	10	18	-1	capture	Silent	SNP	130015732	130015732	TMEM132D	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	15931	98
SERPINA10	51156	broad.mit.edu	37	14	94756360	94756360	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94756360C>T	uc001yct.2	-	2	1037	c.571G>A	c.(571-573)GTG>ATG	p.V191M	SERPINA10_uc001ycu.3_Missense_Mutation_p.V191M	NM_016186	NP_057270	Q9UK55	ZPI_HUMAN	serine (or cysteine) proteinase inhibitor, clade	191					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		TTCATAGGCACGCACTCTGTA	0.418																0.045455	-20.390462	13.586969	7	147	KEEP	---	---	---	---	2	5	74	89	-1	capture	Missense_Mutation	SNP	94756360	94756360	SERPINA10	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13980	98
CILP	8483	broad.mit.edu	37	15	65489345	65489345	+	Silent	SNP	G	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:65489345G>T	uc002aon.2	-	9	3460	c.3279C>A	c.(3277-3279)GGC>GGA	p.G1093G		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	1093					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						CAAAGCACCGGCCGAGCGCGA	0.582																0.382716	86.28848	87.270962	31	50	KEEP	---	---	---	---	19	15	26	27	0.558823529412	capture	Silent	SNP	65489345	65489345	CILP	15	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	3394	98
SV2B	9899	broad.mit.edu	37	15	91835641	91835641	+	Silent	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91835641C>T	uc002bqv.2	+	12	2302	c.1911C>T	c.(1909-1911)GGC>GGT	p.G637G	SV2B_uc010uqv.1_Silent_p.G486G|SV2B_uc002bqu.3_RNA	NM_014848	NP_055663	Q7L1I2	SV2B_HUMAN	synaptic vesicle protein 2B homolog	637	Helical; (Potential).				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			GCAAATTTGGCGCCATCCTGG	0.463																0.237288	65.749337	73.185894	28	90	KEEP	---	---	---	---	13	18	47	57	-1	capture	Silent	SNP	91835641	91835641	SV2B	15	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15306	98
MSLNL	401827	broad.mit.edu	37	16	822701	822701	+	Silent	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:822701G>A	uc002cjz.1	-	12	2406	c.2406C>T	c.(2404-2406)ATC>ATT	p.I802I		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	451	Extracellular (Potential).				cell adhesion	integral to membrane				breast(3)|ovary(1)	4						CCTGGGGATGGATGGTCTGGA	0.647																0.714286	15.168645	15.454149	5	2	KEEP	---	---	---	---	1	4	1	2	-1	capture	Silent	SNP	822701	822701	MSLNL	16	G	A	A	A	1	0	0	0	0	0	0	0	1	525	41	2	2	9792	98
ERCC4	2072	broad.mit.edu	37	16	14024621	14024621	+	Missense_Mutation	SNP	T	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:14024621T>A	uc002dce.2	+	5	856	c.847T>A	c.(847-849)TCC>ACC	p.S283T	ERCC4_uc010bva.2_Missense_Mutation_p.S283T	NM_005236	NP_005227	Q92889	XPF_HUMAN	excision repair cross-complementing rodent	283	Leucine-zipper 2.				double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10						CAAGACTAAATCCTTAGTTCA	0.363					153	Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				0.465909	129.372014	129.46041	41	47	KEEP	---	---	---	---	23	24	33	23	-1	capture	Missense_Mutation	SNP	14024621	14024621	ERCC4	16	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	5170	98
ITPRIPL2	162073	broad.mit.edu	37	16	19126333	19126333	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:19126333C>G	uc002dfu.3	+	1	1080	c.550C>G	c.(550-552)CCG>GCG	p.P184A	ITPRIPL2_uc002dft.2_5'UTR	NM_001034841	NP_001030013	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-triphosphate receptor interacting	184	Cytoplasmic (Potential).					integral to membrane				skin(2)	2						GCGCCTCCCGCCGCTTGTGGC	0.697														OREG0023657	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.157895	5.411684	7.533191	3	16	KEEP	---	---	---	---	3	2	13	12	-1	capture	Missense_Mutation	SNP	19126333	19126333	ITPRIPL2	16	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	7848	98
RANBP10	57610	broad.mit.edu	37	16	67763893	67763893	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67763893G>C	uc002eud.2	-	8	1062	c.946C>G	c.(946-948)CGC>GGC	p.R316G	RANBP10_uc010ceo.2_Missense_Mutation_p.R87G|RANBP10_uc010vju.1_Missense_Mutation_p.R260G|RANBP10_uc010vjv.1_Missense_Mutation_p.R199G|RANBP10_uc010vjw.1_5'UTR	NM_020850	NP_065901	Q6VN20	RBP10_HUMAN	RAN binding protein 10	316	CTLH.									ovary(1)	1		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		GGGTAGAAGCGCTGGGTGGTC	0.632																0.424779	169.387243	169.94126	48	65	KEEP	---	---	---	---	22	35	38	34	-1	capture	Missense_Mutation	SNP	67763893	67763893	RANBP10	16	G	C	C	C	1	0	0	0	0	1	0	0	0	494	38	4	4	12921	98
DNAH2	146754	broad.mit.edu	37	17	7671485	7671485	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7671485C>T	uc002giu.1	+	23	3855	c.3841C>T	c.(3841-3843)CGA>TGA	p.R1281*		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1281	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGCTCAGGACCGAAACTGGGA	0.547																0.412	324.732143	326.407651	103	147	KEEP	---	---	---	---	57	58	68	103	-1	capture	Nonsense_Mutation	SNP	7671485	7671485	DNAH2	17	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	4559	98
DSG1	1828	broad.mit.edu	37	18	28913591	28913591	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28913591C>T	uc002kwp.2	+	7	936	c.724C>T	c.(724-726)CGA>TGA	p.R242*		NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	242	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			AGGCTCTGACCGAGATGGCGG	0.428																0.355072	141.463854	144.005447	49	89	KEEP	---	---	---	---	15	37	52	43	-1	capture	Nonsense_Mutation	SNP	28913591	28913591	DSG1	18	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	4731	98
MUC16	94025	broad.mit.edu	37	19	8996490	8996490	+	Silent	SNP	A	G	G			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8996490A>G	uc002mkp.2	-	61	41286	c.41082T>C	c.(41080-41082)CCT>CCC	p.P13694P	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.P511P|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13696	Extracellular (Potential).|SEA 11.			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CATCCTTTTCAGGCCTGGAGA	0.542																0.030612	-16.064508	7.607744	3	95	KEEP	---	---	---	---	1	2	49	68	-1	capture	Silent	SNP	8996490	8996490	MUC16	19	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	9883	98
RASAL3	64926	broad.mit.edu	37	19	15571922	15571922	+	Silent	SNP	A	G	G			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15571922A>G	uc002nbe.2	-	5	641	c.555T>C	c.(553-555)CCT>CCC	p.P185P		NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	185					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						CTGTTTTTCCAGGCATCCGAT	0.582																0.042254	-9.12474	6.836938	3	68	KEEP	---	---	---	---	1	3	44	41	-1	capture	Silent	SNP	15571922	15571922	RASAL3	19	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	12960	98
OPA3	80207	broad.mit.edu	37	19	46056784	46056784	+	Silent	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46056784C>T	uc002pck.3	-	2	628	c.528G>A	c.(526-528)GCG>GCA	p.A176A	OPA3_uc002pcj.3_Intron|OPA3_uc010xxk.1_Silent_p.A123A	NM_025136	NP_079412	Q9H6K4	OPA3_HUMAN	OPA3 protein isoform b	176					response to stimulus|visual perception	mitochondrion					0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00778)|GBM - Glioblastoma multiforme(486;0.0976)|Epithelial(262;0.242)		ATTTCTTGGACGCAGGCACTG	0.637																0.393333	170.787368	172.282884	59	91	KEEP	---	---	---	---	29	48	48	60	-1	capture	Silent	SNP	46056784	46056784	OPA3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	10776	98
CCDC114	93233	broad.mit.edu	37	19	48805978	48805978	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48805978G>A	uc002pir.2	-	10	1785	c.1102C>T	c.(1102-1104)CGG>TGG	p.R368W	CCDC114_uc002piq.2_Missense_Mutation_p.R177W|CCDC114_uc002pio.2_Missense_Mutation_p.R405W|CCDC114_uc002pis.1_Missense_Mutation_p.R48W|CCDC114_uc002pit.1_Missense_Mutation_p.R405W	NM_144577	NP_653178	Q96M63	CC114_HUMAN	coiled-coil domain containing 114 isoform 2	368	Potential.									ovary(1)	1		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		AGCTGTCCCCGCACATCCTGG	0.647																0.03937	-21.12701	7.9637	5	122	KEEP	---	---	---	---	3	2	50	81	-1	capture	Missense_Mutation	SNP	48805978	48805978	CCDC114	19	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	2725	98
CA11	770	broad.mit.edu	37	19	49143426	49143426	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49143426G>C	uc002pjz.1	-	4	959	c.397C>G	c.(397-399)CTG>GTG	p.L133V	SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|DBP_uc002pjx.3_5'Flank|DBP_uc002pjy.2_5'Flank|DBP_uc010elz.1_5'Flank	NM_001217	NP_001208	O75493	CAH11_HUMAN	carbonic anhydrase XI precursor	133						extracellular region					0		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)		AGCAGCCGCAGTTCACTGAGT	0.592																0.275362	118.189723	124.460191	38	100	KEEP	---	---	---	---	26	30	65	86	-1	capture	Missense_Mutation	SNP	49143426	49143426	CA11	19	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	2488	98
SIGLEC10	89790	broad.mit.edu	37	19	51919569	51919569	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51919569G>A	uc002pwo.2	-	4	1365	c.749C>T	c.(748-750)ACG>ATG	p.T250M	SIGLEC10_uc002pwp.2_Missense_Mutation_p.T192M|SIGLEC10_uc002pwq.2_Missense_Mutation_p.T192M|SIGLEC10_uc002pwr.2_Missense_Mutation_p.T250M|SIGLEC10_uc010ycy.1_Missense_Mutation_p.T250M|SIGLEC10_uc010ycz.1_Missense_Mutation_p.T202M|SIGLEC10_uc010eow.2_Missense_Mutation_p.R15C|SIGLEC10_uc002pws.1_Missense_Mutation_p.T176M	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	250	Extracellular (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		AGTACCTGGCGTGTTGTCACG	0.483																0.392562	277.506075	279.939935	95	147	KEEP	---	---	---	---	44	74	82	88	-1	capture	Missense_Mutation	SNP	51919569	51919569	SIGLEC10	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14199	98
LILRB4	11006	broad.mit.edu	37	19	55175317	55175317	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55175317G>A	uc002qgp.2	+	3	538	c.176G>A	c.(175-177)CGT>CAT	p.R59H	LILRB4_uc002qgo.1_Missense_Mutation_p.R100H|LILRB4_uc002qgq.2_Missense_Mutation_p.R59H|LILRB4_uc010ers.1_5'UTR|LILRB4_uc002qgr.2_Missense_Mutation_p.R100H|LILRB4_uc010ert.2_Missense_Mutation_p.R100H|LILRB4_uc010eru.2_Missense_Mutation_p.R88H	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,	59	Ig-like C2-type 1.|Extracellular (Potential).					integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		CGGGAGTACCGTCTGGATAAA	0.587																0.386598	203.388118	205.57063	75	119	KEEP	---	---	---	---	39	39	65	66	-1	capture	Missense_Mutation	SNP	55175317	55175317	LILRB4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8713	98
NLRP7	199713	broad.mit.edu	37	19	55450816	55450816	+	Silent	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55450816G>A	uc002qih.3	-	4	1447	c.1371C>T	c.(1369-1371)GAC>GAT	p.D457D	NLRP7_uc002qig.3_Silent_p.D457D|NLRP7_uc002qii.3_Silent_p.D457D|NLRP7_uc010esk.2_Silent_p.D457D|NLRP7_uc010esl.2_Silent_p.D485D	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	457	NACHT.						ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		TGGAGACTCTGTCCTGGCGGA	0.617																0.16092	21.087467	30.619456	14	73	KEEP	---	---	---	---	6	14	56	50	-1	capture	Silent	SNP	55450816	55450816	NLRP7	19	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	10389	98
PTPRH	5794	broad.mit.edu	37	19	55708508	55708508	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55708508G>A	uc002qjq.2	-	9	2040	c.1967C>T	c.(1966-1968)ACG>ATG	p.T656M	PTPRH_uc010esv.2_Missense_Mutation_p.T478M|PTPRH_uc002qjs.2_Missense_Mutation_p.T663M	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	656	Extracellular (Potential).|Fibronectin type-III 7.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		GAGGCTCTGCGTGGAACTGGC	0.547																0.23913	52.802202	58.520651	22	70	KEEP	---	---	---	---	12	16	36	45	-1	capture	Missense_Mutation	SNP	55708508	55708508	PTPRH	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12698	98
SNTG2	54221	broad.mit.edu	37	2	1271318	1271318	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:1271318C>T	uc002qwq.2	+	14	1387	c.1259C>T	c.(1258-1260)ACG>ATG	p.T420M	SNTG2_uc010ewi.2_Missense_Mutation_p.T293M	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	420	PH.				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CAAAGAGCCACGTTCATGGAA	0.527																0.5	56.949349	56.949349	18	18	KEEP	---	---	---	---	9	12	10	9	-1	capture	Missense_Mutation	SNP	1271318	1271318	SNTG2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14767	98
TTN	7273	broad.mit.edu	37	2	179425883	179425883	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179425883G>A	uc010zfg.1	-	275	77496	c.77272C>T	c.(77272-77274)CGG>TGG	p.R25758W	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R19453W|TTN_uc010zfi.1_Missense_Mutation_p.R19386W|TTN_uc010zfj.1_Missense_Mutation_p.R19261W	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26685							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAAAAACCCGGAATTCATAA	0.403				p.R25758W(HEC6-Tumor)	8722											0.402685	192.3751	193.607507	60	89	KEEP	---	---	---	---	31	32	41	52	-1	capture	Missense_Mutation	SNP	179425883	179425883	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16617	98
NMUR1	10316	broad.mit.edu	37	2	232393454	232393454	+	Missense_Mutation	SNP	G	A	A	rs143358901	by1000genomes	TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:232393454G>A	uc002vry.3	-	2	388	c.278C>T	c.(277-279)ACG>ATG	p.T93M		NM_006056	NP_006047	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	93	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|calcium ion transport|calcium-mediated signaling|chloride transport|smooth muscle contraction	integral to plasma membrane|membrane fraction	neuromedin U receptor activity			lung(3)|central_nervous_system(1)|pancreas(1)	5		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GTTGGTAGGCGTGCGCATGGC	0.612																0.369748	120.966237	122.741361	44	75	KEEP	---	---	---	---	21	26	34	45	-1	capture	Missense_Mutation	SNP	232393454	232393454	NMUR1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10413	98
PCSK2	5126	broad.mit.edu	37	20	17445987	17445987	+	Missense_Mutation	SNP	C	T	T	rs138900084		TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:17445987C>T	uc002wpm.2	+	11	1539	c.1219C>T	c.(1219-1221)CGG>TGG	p.R407W	PCSK2_uc002wpl.2_Missense_Mutation_p.R388W|PCSK2_uc010zrm.1_Missense_Mutation_p.R372W|PCSK2_uc002wpn.2_Missense_Mutation_p.R61W	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	407	Catalytic.				enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TCTGACCTGGCGGGACATGCA	0.552																0.258065	37.868258	41.159091	16	46	KEEP	---	---	---	---	8	11	26	27	-1	capture	Missense_Mutation	SNP	17445987	17445987	PCSK2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	11504	98
TPX2	22974	broad.mit.edu	37	20	30371716	30371716	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30371716G>T	uc002wwp.1	+	12	2103	c.1405G>T	c.(1405-1407)GAT>TAT	p.D469Y	TPX2_uc010gdv.1_Missense_Mutation_p.D505Y	NM_012112	NP_036244	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated protein homolog	469					activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			GATTTTGGAAGATGTTGTGGT	0.333																0.283582	93.582654	99.226471	38	96	KEEP	---	---	---	---	22	20	41	63	0.52380952381	capture	Missense_Mutation	SNP	30371716	30371716	TPX2	20	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	16315	98
BPI	671	broad.mit.edu	37	20	36932646	36932646	+	Silent	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36932646C>T	uc002xib.2	+	1	95	c.33C>T	c.(31-33)AAC>AAT	p.N11N		NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	11					defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)				GCCCTTGCAACGCGCCGAGAT	0.627																0.027397	-44.072241	9.849259	6	213	KEEP	---	---	---	---	4	2	108	122	-1	capture	Silent	SNP	36932646	36932646	BPI	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1478	98
KRTAP10-9	386676	broad.mit.edu	37	21	46047200	46047200	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46047200G>A	uc002zfp.3	+	1	161	c.112G>A	c.(112-114)GCC>ACC	p.A38T	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198690	NP_941963	P60411	KR109_HUMAN	keratin associated protein 10-9	38	3.|25 X 5 AA repeats of C-C-X(3).					keratin filament					0						CAGCTGCTGCGCCCCGGCCCC	0.687																0.119048	8.305373	20.271704	10	74	KEEP	---	---	---	---	7	5	40	48	-1	capture	Missense_Mutation	SNP	46047200	46047200	KRTAP10-9	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8436	98
KRTAP10-11	386678	broad.mit.edu	37	21	46066382	46066382	+	Missense_Mutation	SNP	G	A	A	rs150246805	by1000genomes	TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46066382G>A	uc002zfr.3	+	1	52	c.7G>A	c.(7-9)GCG>ACG	p.A3T	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198692	NP_941965	P60412	KR10B_HUMAN	keratin associated protein 10-11	3						keratin filament				ovary(1)	1						CAGCATGGCCGCGTCCACCAT	0.542																0.391753	105.848048	106.835979	38	59	KEEP	---	---	---	---	22	26	38	47	-1	capture	Missense_Mutation	SNP	46066382	46066382	KRTAP10-11	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8427	98
TMPRSS6	164656	broad.mit.edu	37	22	37491997	37491997	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37491997C>T	uc003aqs.1	-	5	679	c.565G>A	c.(565-567)GTC>ATC	p.V189I	TMPRSS6_uc003aqt.1_Missense_Mutation_p.V180I|TMPRSS6_uc003aqu.2_Missense_Mutation_p.V180I	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	189	Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						CTGTAGGGGACGGCAGCCGAG	0.642																0.15625	16.950905	24.136776	10	54	KEEP	---	---	---	---	7	6	43	39	-1	capture	Missense_Mutation	SNP	37491997	37491997	TMPRSS6	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16134	98
PTPRG	5793	broad.mit.edu	37	3	62188854	62188854	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:62188854C>T	uc003dlb.2	+	12	2104	c.1385C>T	c.(1384-1386)GCG>GTG	p.A462V	PTPRG_uc003dlc.2_Missense_Mutation_p.A462V	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	462	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CAGCCCACAGCGTCTCCTGCC	0.547																0.053571	-21.374711	14.010103	9	159	KEEP	---	---	---	---	5	4	75	88	-1	capture	Missense_Mutation	SNP	62188854	62188854	PTPRG	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12697	98
BMP3	651	broad.mit.edu	37	4	81952456	81952456	+	Silent	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:81952456G>A	uc003hmg.3	+	1	338	c.18G>A	c.(16-18)AGG>AGA	p.R6R		NM_001201	NP_001192	P12645	BMP3_HUMAN	bone morphogenetic protein 3 preproprotein	6					cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(4)|central_nervous_system(1)	5						GGGCGAGCAGGCTGCTCTTTC	0.706																0.75	17.839151	18.288871	6	2	KEEP	---	---	---	---	7	4	3	2	-1	capture	Silent	SNP	81952456	81952456	BMP3	4	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	1449	98
MTTP	4547	broad.mit.edu	37	4	100534247	100534247	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:100534247G>A	uc003hvc.3	+	16	2423	c.2167G>A	c.(2167-2169)GAC>AAC	p.D723N	MTTP_uc011cej.1_Missense_Mutation_p.D750N	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large	723					lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	AGCATCTGGCGACCCTATCAG	0.338																0.427083	124.558341	125.003849	41	55	KEEP	---	---	---	---	17	24	32	27	-1	capture	Missense_Mutation	SNP	100534247	100534247	MTTP	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9874	98
TLL1	7092	broad.mit.edu	37	4	166915601	166915601	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:166915601C>T	uc003irh.1	+	4	1077	c.430C>T	c.(430-432)CGA>TGA	p.R144*	TLL1_uc011cjn.1_Nonsense_Mutation_p.R144*|TLL1_uc011cjo.1_5'UTR	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	144					cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TGAGAAAAATCGAGTTCCCAG	0.423																0.346667	72.527554	74.084119	26	49	KEEP	---	---	---	---	7	19	26	24	-1	capture	Nonsense_Mutation	SNP	166915601	166915601	TLL1	4	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	15830	98
PDE8B	8622	broad.mit.edu	37	5	76640735	76640735	+	Silent	SNP	A	G	G			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:76640735A>G	uc003kfa.2	+	7	900	c.855A>G	c.(853-855)ACA>ACG	p.T285T	PDE8B_uc003kfb.2_Silent_p.T265T|PDE8B_uc003kfc.2_Silent_p.T285T|PDE8B_uc003kfd.2_Silent_p.T285T|PDE8B_uc003kfe.2_Silent_p.T285T	NM_003719	NP_003710	O95263	PDE8B_HUMAN	phosphodiesterase 8B isoform 1	285	PAS.				cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity				0		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)		TAGAAATAACAAGCGATGACC	0.353																0.017341	-39.133152	6.360813	3	170	KEEP	---	---	---	---	2	1	91	107	-1	capture	Silent	SNP	76640735	76640735	PDE8B	5	A	G	G	G	1	0	0	0	0	0	0	0	1	54	5	3	3	11557	98
RASA1	5921	broad.mit.edu	37	5	86659220	86659220	+	Silent	SNP	A	G	G			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:86659220A>G	uc003kiw.2	+	11	1627	c.1509A>G	c.(1507-1509)CAA>CAG	p.Q503Q	RASA1_uc010jav.2_RNA|RASA1_uc003kix.2_Silent_p.Q326Q|RASA1_uc011ctv.1_Silent_p.Q336Q|RASA1_uc011ctw.1_Silent_p.Q337Q|RASA1_uc010jaw.2_Silent_p.Q325Q	NM_002890	NP_002881	P20936	RASA1_HUMAN	RAS p21 protein activator 1 isoform 1	503	PH.				cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		GTGATGCCCAACTTATTTATT	0.323					386											0.384615	164.453049	165.816955	45	72	KEEP	---	---	---	---	26	21	53	23	-1	capture	Silent	SNP	86659220	86659220	RASA1	5	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	12955	98
GPR98	84059	broad.mit.edu	37	5	89986845	89986845	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89986845C>T	uc003kju.2	+	31	7034	c.6938C>T	c.(6937-6939)CCG>CTG	p.P2313L	GPR98_uc003kjt.2_Intron|GPR98_uc003kjv.2_5'Flank	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2313	Calx-beta 16.|Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GACGACGTTCCGGAGATTGAA	0.468																0.385965	135.575053	136.873979	44	70	KEEP	---	---	---	---	33	28	49	48	-1	capture	Missense_Mutation	SNP	89986845	89986845	GPR98	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6654	98
TRPC7	57113	broad.mit.edu	37	5	135583350	135583350	+	Silent	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:135583350G>A	uc003lbn.1	-	6	1653	c.1650C>T	c.(1648-1650)AGC>AGT	p.S550S	TRPC7_uc010jef.1_Silent_p.S487S|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Silent_p.S481S|TRPC7_uc010jei.1_Silent_p.S426S|TRPC7_uc010jej.1_Silent_p.S102S	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	551	Helical; (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGCGAGAGAAGCTCAGCACGA	0.502																0.458333	191.628262	191.846393	66	78	KEEP	---	---	---	---	29	39	43	41	-1	capture	Silent	SNP	135583350	135583350	TRPC7	5	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	16467	98
GABRA1	2554	broad.mit.edu	37	5	161324264	161324264	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161324264G>A	uc010jiw.2	+	11	1675	c.1207G>A	c.(1207-1209)GAA>AAA	p.E403K	GABRA1_uc010jix.2_Missense_Mutation_p.E403K|GABRA1_uc010jiy.2_Missense_Mutation_p.E403K|GABRA1_uc003lyx.3_Missense_Mutation_p.E403K|GABRA1_uc010jiz.2_Missense_Mutation_p.E403K|GABRA1_uc010jja.2_Missense_Mutation_p.E403K|GABRA1_uc010jjb.2_Missense_Mutation_p.E403K	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	403	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	GGTCAAGCCCGAAACAAAACC	0.473																0.4	269.227769	271.246062	92	138	KEEP	---	---	---	---	45	57	68	91	-1	capture	Missense_Mutation	SNP	161324264	161324264	GABRA1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6102	98
CUL9	23113	broad.mit.edu	37	6	43181519	43181519	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43181519G>A	uc003ouk.2	+	29	5632	c.5557G>A	c.(5557-5559)GCA>ACA	p.A1853T	CUL9_uc003oul.2_Intron|CUL9_uc010jyk.2_Missense_Mutation_p.A1005T|CUL9_uc003oun.2_5'Flank	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	1853				Missing (in Ref. 3; CAH18696).	ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						ACCTCCCCAGGCATACCTGAA	0.577																0.033058	-21.804195	6.989563	4	117	KEEP	---	---	---	---	1	3	56	61	-1	capture	Missense_Mutation	SNP	43181519	43181519	CUL9	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4021	98
CLIC5	53405	broad.mit.edu	37	6	45882070	45882070	+	Silent	SNP	G	A	A	rs146052023		TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:45882070G>A	uc003oxv.3	-	5	1066	c.960C>T	c.(958-960)GAC>GAT	p.D320D	CLIC5_uc003oxu.3_Silent_p.D161D|CLIC5_uc003oxw.2_RNA|CLIC5_uc003oxx.2_Silent_p.D161D	NM_001114086	NP_001107558	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5 isoform a	320	GST C-terminal.				female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2						AAGTGTTGGCGTCAATCTCCT	0.537																0.342105	146.25143	149.600865	52	100	KEEP	---	---	---	---	28	38	65	49	-1	capture	Silent	SNP	45882070	45882070	CLIC5	6	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3494	98
STX7	8417	broad.mit.edu	37	6	132792715	132792715	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:132792715G>A	uc003qdg.2	-	5	524	c.274C>T	c.(274-276)CGC>TGC	p.R92C	STX7_uc011ecg.1_Intron|STX7_uc011ech.1_Intron	NM_003569	NP_003560	O15400	STX7_HUMAN	syntaxin 7	92	Cytoplasmic (Potential).				intracellular protein transport|post-Golgi vesicle-mediated transport	early endosome membrane|integral to membrane	SNAP receptor activity				0	Breast(56;0.0615)			OV - Ovarian serous cystadenocarcinoma(155;0.00532)|GBM - Glioblastoma multiforme(226;0.0114)		GCCACTAAGCGATCCTTCTGT	0.453																0.590551	242.642893	243.551637	75	52	KEEP	---	---	---	---	35	52	30	26	-1	capture	Missense_Mutation	SNP	132792715	132792715	STX7	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15240	98
PDE1C	5137	broad.mit.edu	37	7	31890345	31890345	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31890345G>A	uc003tcm.1	-	8	1230	c.761C>T	c.(760-762)ACG>ATG	p.T254M	PDE1C_uc003tcn.1_Missense_Mutation_p.T254M|PDE1C_uc003tco.1_Missense_Mutation_p.T314M|PDE1C_uc003tcr.2_Missense_Mutation_p.T254M|PDE1C_uc003tcs.2_Missense_Mutation_p.T254M	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	254	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			CTCCAGCTCCGTCAGCCAGTT	0.463																0.360656	114.604194	116.672745	44	78	KEEP	---	---	---	---	23	30	44	60	-1	capture	Missense_Mutation	SNP	31890345	31890345	PDE1C	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11538	98
ABCA13	154664	broad.mit.edu	37	7	48556332	48556332	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48556332T>C	uc003toq.2	+	52	13677	c.13652T>C	c.(13651-13653)CTT>CCT	p.L4551P	ABCA13_uc010kys.1_Missense_Mutation_p.L1626P|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Missense_Mutation_p.L281P	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	4551	Helical; (Potential).				transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TATGCAACTCTTCCATGGATG	0.294																0.025641	-90.163027	26.831383	12	456	KEEP	---	---	---	---	5	7	266	252	-1	capture	Missense_Mutation	SNP	48556332	48556332	ABCA13	7	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	31	98
STEAP2	261729	broad.mit.edu	37	7	89856794	89856794	+	Silent	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:89856794C>T	uc003ujz.2	+	3	1395	c.1002C>T	c.(1000-1002)CTC>CTT	p.L334L	STEAP2_uc003ujy.2_Silent_p.L376L|STEAP2_uc010len.2_Silent_p.L334L|STEAP2_uc003uka.2_Silent_p.L334L|STEAP2_uc003ukb.2_Silent_p.L334L|STEAP2_uc003ukc.2_Silent_p.L334L|STEAP2_uc003ukd.2_Silent_p.L334L	NM_152999	NP_694544	Q8NFT2	STEA2_HUMAN	six transmembrane epithelial antigen of the	334	Ferric oxidoreductase.				electron transport chain|endocytosis|Golgi to plasma membrane transport|ion transport|iron ion homeostasis|regulated secretory pathway|response to hormone stimulus	cytosol|early endosome|endosome membrane|integral to Golgi membrane|plasma membrane|trans-Golgi network transport vesicle|vesicular fraction	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity|transporter activity			ovary(2)	2	all_hematologic(106;0.112)					ATTTGTTTCTCAACATGGCTT	0.338																0.082192	-1.024429	24.923898	12	134	KEEP	---	---	---	---	6	7	72	88	-1	capture	Silent	SNP	89856794	89856794	STEAP2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	15168	98
ZAN	7455	broad.mit.edu	37	7	100382333	100382333	+	Silent	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100382333C>T	uc003uwj.2	+	37	6876	c.6711C>T	c.(6709-6711)GGC>GGT	p.G2237G	ZAN_uc003uwk.2_Silent_p.G2237G|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kke.1_Silent_p.G287G	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	2237	Extracellular (Potential).|TIL 4.				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGTGTGAGGGCGCCAAAGTCC	0.612																0.240506	42.280946	47.141118	19	60	KEEP	---	---	---	---	10	13	31	35	-1	capture	Silent	SNP	100382333	100382333	ZAN	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	17394	98
FLNC	2318	broad.mit.edu	37	7	128490536	128490536	+	Silent	SNP	A	G	G			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128490536A>G	uc003vnz.3	+	32	5606	c.5397A>G	c.(5395-5397)ACA>ACG	p.T1799T	FLNC_uc003voa.3_Silent_p.T1766T	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1799	Filamin 16.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GGGAGCTCACAGGTACTGCCC	0.463					892											0.013333	-54.285624	6.515356	3	222	KEEP	---	---	---	---	1	2	114	116	-1	capture	Silent	SNP	128490536	128490536	FLNC	7	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	5879	98
FLNC	2318	broad.mit.edu	37	7	128493857	128493857	+	Silent	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128493857C>T	uc003vnz.3	+	39	6659	c.6450C>T	c.(6448-6450)ATC>ATT	p.I2150I	FLNC_uc003voa.3_Silent_p.I2117I	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	2150					cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						TCGCCACCATCGGCAGCACCT	0.662				p.I2150I(LMSU-Tumor)|p.I2150I(JHOS2-Tumor)	892											0.348837	84.02166	85.756893	30	56	KEEP	---	---	---	---	18	14	27	42	-1	capture	Silent	SNP	128493857	128493857	FLNC	7	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	5879	98
C7orf49	78996	broad.mit.edu	37	7	134851619	134851619	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134851619C>T	uc003vsl.2	-	4	485	c.218G>A	c.(217-219)CGC>CAC	p.R73H	C7orf49_uc003vsh.2_Intron|C7orf49_uc003vsj.2_Missense_Mutation_p.R44H|C7orf49_uc003vsk.2_RNA|C7orf49_uc003vsm.2_RNA|C7orf49_uc003vsn.2_Missense_Mutation_p.R72H|C7orf49_uc003vso.2_Missense_Mutation_p.R18H	NM_024033	NP_076938	Q9BWK5	MRI_HUMAN	modulator of retrovirus infection	73						cytoplasm				large_intestine(1)|ovary(1)	2						TTCCTGTTTGCGGCTCTGTGG	0.552																0.0199	-45.382282	6.598229	4	197	KEEP	---	---	---	---	1	3	111	126	-1	capture	Missense_Mutation	SNP	134851619	134851619	C7orf49	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2375	98
ATP6V0A4	50617	broad.mit.edu	37	7	138453573	138453573	+	Silent	SNP	G	A	A	rs137955459		TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138453573G>A	uc003vuf.2	-	4	481	c.243C>T	c.(241-243)CTC>CTT	p.L81L	ATP6V0A4_uc003vug.2_Silent_p.L81L|ATP6V0A4_uc003vuh.2_Silent_p.L81L	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	81	Cytoplasmic (Potential).				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						GGCTTTTCTCGAGCAACTGAA	0.483																0.264151	74.653374	79.982944	28	78	KEEP	---	---	---	---	17	16	52	38	-1	capture	Silent	SNP	138453573	138453573	ATP6V0A4	7	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	1161	98
KEL	3792	broad.mit.edu	37	7	142658446	142658446	+	Splice_Site	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142658446C>T	uc003wcb.2	-	3	433	c.223_splice	c.e3+1	p.R75_splice		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					ATCTTGCTTACGAGGGCCACA	0.602																0.285714	85.290577	89.884037	32	80	KEEP	---	---	---	---	14	22	54	38	-1	capture	Splice_Site	SNP	142658446	142658446	KEL	7	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	8064	98
FAM83H	286077	broad.mit.edu	37	8	144810766	144810766	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144810766C>T	uc003yzk.2	-	5	934	c.865G>A	c.(865-867)GCG>ACG	p.A289T	FAM83H_uc010mfk.1_RNA	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	289					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GCCAGGGCCGCGGCCGAGGGC	0.711																0.6	18.054566	18.143625	6	4	KEEP	---	---	---	---	2	8	2	6	-1	capture	Missense_Mutation	SNP	144810766	144810766	FAM83H	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5586	98
EPPK1	83481	broad.mit.edu	37	8	144940597	144940597	+	Silent	SNP	G	A	A			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144940597G>A	uc003zaa.1	-	2	14848	c.14835C>T	c.(14833-14835)CCC>CCT	p.P4945P		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	4945	Plectin 62.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGTTGCGCACGGGGTCGATGA	0.721																0.111111	4.580274	9.957132	4	32	KEEP	---	---	---	---	2	5	21	30	-1	capture	Silent	SNP	144940597	144940597	EPPK1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5145	98
ZNF507	22847	broad.mit.edu	37	19	32847587	32847609	+	Frame_Shift_Del	DEL	TAATGAGCCAAGAATTTCCAGTG	-	-			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:32847587_32847609delTAATGAGCCAAGAATTTCCAGTG	uc002nte.2	+	4	2465_2487	c.2193_2215delTAATGAGCCAAGAATTTCCAGTG	c.(2191-2217)TCTAATGAGCCAAGAATTTCCAGTGATfs	p.S731fs	ZNF507_uc002ntc.2_Frame_Shift_Del_p.S731fs|ZNF507_uc010xrn.1_Frame_Shift_Del_p.S731fs|ZNF507_uc002ntd.2_Frame_Shift_Del_p.S731fs	NM_001136156	NP_001129628	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	731_739					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)|kidney(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(110;0.162)					TAGCAACTTCTAATGAGCCAAGAATTTCCAGTGATACAGCTGA	0.381																0.07			10	139		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	32847587	32847609	ZNF507	19	TAATGAGCCAAGAATTTCCAGTG	-	-	-	1	0	1	0	1	0	0	0	0	678	53	5	5	17832	98
STAG1	10274	broad.mit.edu	37	3	136076625	136076625	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:136076625delA	uc003era.1	-	28	3294	c.3002delT	c.(3001-3003)CTGfs	p.L1001fs	STAG1_uc003erb.1_Frame_Shift_Del_p.L1001fs	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1	1001					cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2						AAGAAAAGCCAGATTAGGAGG	0.333																0.75			67	22		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	136076625	136076625	STAG1	3	A	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	15132	98
IFRD1	3475	broad.mit.edu	37	7	112097053	112097053	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-5415-01	TCGA-06-5415-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:112097053delA	uc003vgh.2	+	5	812	c.369delA	c.(367-369)AGAfs	p.R123fs	IFRD1_uc011kmn.1_Frame_Shift_Del_p.R73fs|IFRD1_uc003vgi.2_Frame_Shift_Del_p.R123fs|IFRD1_uc003vgj.2_Frame_Shift_Del_p.R123fs|IFRD1_uc011kmo.1_RNA|IFRD1_uc011kmp.1_Frame_Shift_Del_p.R73fs	NM_001007245	NP_001007246	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1	123					multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2						TGGAAAGGAGAATGACTTTAA	0.368																0.26			38	110		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	112097053	112097053	IFRD1	7	A	-	-	-	1	0	1	0	1	0	0	0	0	115	9	5	5	7478	98
