Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
COL16A1	1307	broad.mit.edu	37	1	32164172	32164172	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32164172G>A	uc001btk.1	-	5	667	c.302C>T	c.(301-303)GCC>GTC	p.A101V	COL16A1_uc001btj.1_5'UTR|COL16A1_uc001btl.3_Missense_Mutation_p.A101V	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	101	TSP N-terminal.				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CAGCACCAGGGCAAACTCCTC	0.567	Colon(143;498 1786 21362 25193 36625)															0.026667	-30.639414	6.512888	4	146	KEEP	---	---	---	---	3	2	78	83	-1	capture	Missense_Mutation	SNP	32164172	32164172	COL16A1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3638	119
KLF17	128209	broad.mit.edu	37	1	44595136	44595136	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44595136G>A	uc001clp.2	+	2	251	c.193G>A	c.(193-195)GCA>ACA	p.A65T	KLF17_uc009vxf.1_Missense_Mutation_p.A28T	NM_173484	NP_775755	Q5JT82	KLF17_HUMAN	zinc finger protein 393	65					regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					TCCTCACAGCGCAGAGATGCT	0.557																0.443396	142.213903	142.50921	47	59	KEEP	---	---	---	---	27	24	34	28	-1	capture	Missense_Mutation	SNP	44595136	44595136	KLF17	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8266	119
FLG2	388698	broad.mit.edu	37	1	152324215	152324215	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152324215G>A	uc001ezw.3	-	3	6120	c.6047C>T	c.(6046-6048)ACA>ATA	p.T2016I	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	2016	Filaggrin 9.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCTCTCTGTGTGGACTGTCC	0.522																0.455621	873.75692	874.923292	308	368	KEEP	---	---	---	---	153	174	213	192	-1	capture	Missense_Mutation	SNP	152324215	152324215	FLG2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	5868	119
SPTA1	6708	broad.mit.edu	37	1	158585037	158585037	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158585037G>A	uc001fst.1	-	48	6956	c.6757C>T	c.(6757-6759)CAA>TAA	p.Q2253*		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2253	Spectrin 21.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AGGTTGTGTTGCATCCGCAAC	0.537																0.493766	571.729129	571.742362	198	203	KEEP	---	---	---	---	103	121	103	124	-1	capture	Nonsense_Mutation	SNP	158585037	158585037	SPTA1	1	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	15008	119
TNFSF4	7292	broad.mit.edu	37	1	173155865	173155865	+	Silent	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:173155865G>A	uc001giw.2	-	3	498	c.342C>T	c.(340-342)AAC>AAT	p.N114N	TNFSF4_uc001giv.2_Silent_p.N64N	NM_003326	NP_003317	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily,	114	Extracellular (Potential).				acute inflammatory response|cellular response to lipopolysaccharide|cellular response to prostaglandin E stimulus|chemokine (C-C motif) ligand 11 production|defense response to nematode|interleukin-4-dependent isotype switching to IgE isotypes|memory T cell activation|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of regulatory T cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T-helper 1 cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of alpha-beta T cell proliferation|positive regulation of B cell activation|positive regulation of immunoglobulin mediated immune response|positive regulation of immunoglobulin secretion|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-6 production|positive regulation of memory T cell differentiation|positive regulation of T cell cytokine production|positive regulation of T-helper 2 cell differentiation|positive regulation of type 2 immune response|response to virus|signal transduction|T-helper 2 cell activation	cell surface|extracellular space|integral to plasma membrane	cytokine activity			central_nervous_system(1)	1						GAAGGCTAATGTTGACTTCCT	0.468																0.058201	-17.337662	21.345033	11	178	KEEP	---	---	---	---	5	8	86	102	-1	capture	Silent	SNP	173155865	173155865	TNFSF4	1	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	16193	119
LIN9	286826	broad.mit.edu	37	1	226420896	226420896	+	Splice_Site	SNP	T	C	C			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:226420896T>C	uc001hqa.2	-	14	1784	c.1474_splice	c.e14-1	p.C492_splice	LIN9_uc001hqb.2_Splice_Site_p.C457_splice|LIN9_uc001hqc.2_Splice_Site_p.C424_splice|LIN9_uc009xel.1_Intron	NM_173083	NP_775106	Q5TKA1	LIN9_HUMAN	lin-9 homolog						cell cycle|DNA replication	nucleoplasm					0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		TGCTAGACACTAAAGGGAAAA	0.294	Ovarian(197;1696 2974 11248 14117)															0.487179	365.734945	365.762231	95	100	KEEP	---	---	---	---	49	57	47	56	-1	capture	Splice_Site	SNP	226420896	226420896	LIN9	1	T	C	C	C	1	0	0	0	0	0	0	1	0	689	53	5	3	8733	119
HBG2	3048	broad.mit.edu	37	11	5275527	5275527	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5275527A>G	uc001mai.1	-	2	747	c.310T>C	c.(310-312)TTC>CTC	p.F104L	HBG2_uc001mak.1_RNA|HBG2_uc001maj.1_Missense_Mutation_p.F104L	NM_000559	NP_000550	P69892	HBG2_HUMAN	A-gamma globin	104					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCACCTTGAAGTTCTCAGGA	0.498																0.03352	-27.213206	15.255872	6	173	KEEP	---	---	---	---	5	3	135	131	-1	capture	Missense_Mutation	SNP	5275527	5275527	HBG2	11	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	6910	119
INCENP	3619	broad.mit.edu	37	11	61898063	61898063	+	Splice_Site	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61898063G>A	uc001nsw.1	+	4	1265	c.1063_splice	c.e4+1	p.C355_splice	INCENP_uc009ynv.2_Splice_Site_p.C355_splice|INCENP_uc009ynw.1_Splice_Site_p.C355_splice|INCENP_uc001nsx.1_Splice_Site_p.C355_splice	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa						chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						CGCATCATCTGTGAGTCTGGG	0.537																0.460317	86.765432	86.852166	29	34	KEEP	---	---	---	---	28	35	31	30	-1	capture	Splice_Site	SNP	61898063	61898063	INCENP	11	G	A	A	A	1	0	0	0	0	0	0	1	0	624	48	5	2	7656	119
MYEOV	26579	broad.mit.edu	37	11	69063304	69063304	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:69063304C>A	uc001oov.2	+	3	837	c.387C>A	c.(385-387)GAC>GAA	p.D129E	MYEOV_uc001oox.2_Intron|MYEOV_uc009ysl.2_Missense_Mutation_p.D129E|MYEOV_uc001oow.2_Missense_Mutation_p.D71E	NM_138768	NP_620123	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	129											0	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		AAGACGTGGACGTGTCCCGGG	0.617																0.031496	-43.723559	17.294991	8	246	KEEP	---	---	---	---	5	3	108	162	0.375	capture	Missense_Mutation	SNP	69063304	69063304	MYEOV	11	C	A	A	A	1	0	0	0	0	1	0	0	0	246	19	4	4	9935	119
VWF	7450	broad.mit.edu	37	12	6127617	6127617	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6127617G>A	uc001qnn.1	-	28	5217	c.4967C>T	c.(4966-4968)ACG>ATG	p.T1656M	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1656	VWFA 2.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TCGGGGGAGCGTCTCAAAGTC	0.632																0.417582	115.544947	116.081488	38	53	KEEP	---	---	---	---	20	22	31	30	-1	capture	Missense_Mutation	SNP	6127617	6127617	VWF	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17128	119
MDM2	4193	broad.mit.edu	37	12	69229607	69229607	+	Splice_Site	SNP	A	G	G			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:69229607A>G	uc001sui.2	+	9	972	c.685_splice	c.e9-2	p.D229_splice	MDM2_uc009zri.2_Splice_Site_p.D184_splice|MDM2_uc009zqx.2_Splice_Site_p.D174_splice|MDM2_uc009zqw.2_Intron|MDM2_uc001suk.2_Intron|MDM2_uc009zqy.1_Splice_Site_p.D218_splice|MDM2_uc001sun.3_Splice_Site_p.D48_splice|MDM2_uc009zqz.2_Splice_Site_p.D223_splice|MDM2_uc009zra.2_Splice_Site_p.D53_splice|MDM2_uc001sum.1_Intron|MDM2_uc009zrd.2_Splice_Site|MDM2_uc009zrc.2_Intron|MDM2_uc009zre.2_Intron|MDM2_uc009zrf.2_Intron|MDM2_uc001suo.2_Splice_Site_p.D23_splice|MDM2_uc009zrg.2_Intron|MDM2_uc009zrh.2_Splice_Site_p.D23_splice	NM_002392	NP_002383	Q00987	MDM2_HUMAN	mouse double minute 2 homolog isoform MDM2						cellular response to hypoxia|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|establishment of protein localization|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein complex assembly|protein destabilization|protein localization to nucleus|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to antibiotic|synaptic transmission	cytosol|endocytic vesicle membrane|insoluble fraction|nucleolus|nucleoplasm|plasma membrane|protein complex	enzyme binding|identical protein binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|central_nervous_system(1)	3	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TTCTTGTTTTAGGATCTTGAT	0.398					221	A		sarcoma|glioma|colorectal|other								0.015873	-43.539783	6.644292	3	186	KEEP	---	---	---	---	2	1	92	113	-1	capture	Splice_Site	SNP	69229607	69229607	MDM2	12	A	G	G	G	1	0	0	0	0	0	0	1	0	195	15	5	3	9326	119
UHRF1BP1L	23074	broad.mit.edu	37	12	100491231	100491231	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100491231G>A	uc001tgq.2	-	6	810	c.581C>T	c.(580-582)GCC>GTC	p.A194V	UHRF1BP1L_uc001tgr.2_Missense_Mutation_p.A194V	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	194										ovary(2)	2						ACTTTGGGTGGCATCTGCCTC	0.353																0.034483	-25.326799	8.8535	5	140	KEEP	---	---	---	---	2	3	65	90	-1	capture	Missense_Mutation	SNP	100491231	100491231	UHRF1BP1L	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16851	119
OAS2	4939	broad.mit.edu	37	12	113447043	113447043	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113447043C>T	uc001tuj.2	+	10	2187	c.2047C>T	c.(2047-2049)CCG>TCG	p.P683S	OAS2_uc001tui.1_Missense_Mutation_p.P683S	NM_016817	NP_058197	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2 isoform 1	683	OAS domain 2.				interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	endoplasmic reticulum|membrane|microsome|mitochondrion|nucleus	ATP binding|nucleotidyltransferase activity|RNA binding			ovary(1)	1						TTGGAAAGTGCCGGTAAAAGT	0.458	Pancreas(199;709 2232 18410 33584 35052)															0.013158	-95.576762	7.252656	5	375	KEEP	---	---	---	---	2	4	198	218	-1	capture	Missense_Mutation	SNP	113447043	113447043	OAS2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10705	119
KIAA0564	23078	broad.mit.edu	37	13	42481750	42481750	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:42481750C>T	uc001uyj.2	-	4	525	c.455G>A	c.(454-456)CGT>CAT	p.R152H	KIAA0564_uc001uyk.2_Missense_Mutation_p.R152H	NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a	152						extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		TGTGCCTGCACGGATCTCTCG	0.458																0.031674	-39.674478	13.366718	7	214	KEEP	---	---	---	---	3	5	123	120	-1	capture	Missense_Mutation	SNP	42481750	42481750	KIAA0564	13	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8107	119
TRIM13	10206	broad.mit.edu	37	13	50587073	50587073	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:50587073A>T	uc001vdq.1	+	3	1310	c.997A>T	c.(997-999)ACC>TCC	p.T333S	DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|KCNRG_uc001vdt.2_5'Flank|KCNRG_uc001vdu.2_5'Flank|TRIM13_uc001vdp.1_Missense_Mutation_p.T336S|TRIM13_uc001vdr.1_Missense_Mutation_p.T333S|TRIM13_uc001vds.1_Missense_Mutation_p.T333S	NM_052811	NP_434698	O60858	TRI13_HUMAN	ret finger protein 2 isoform 1	333	Helical; (Potential).				anatomical structure morphogenesis|ER-associated protein catabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination	cytoplasm|endoplasmic reticulum membrane|integral to membrane	protein binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		CTTTGGTCCTACCATGTTCCT	0.408																0.437148	732.524791	734.354765	233	300	KEEP	---	---	---	---	142	112	192	150	-1	capture	Missense_Mutation	SNP	50587073	50587073	TRIM13	13	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	16371	119
SLITRK6	84189	broad.mit.edu	37	13	86369237	86369237	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:86369237G>T	uc001vll.1	-	2	1866	c.1407C>A	c.(1405-1407)AAC>AAA	p.N469K	SLITRK6_uc010afe.1_Intron	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	469	Extracellular (Potential).|LRR 10.			N -> H (in Ref. 1).		integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		CTTGGAGGAGGTTGTTATTTA	0.328																0.13964	53.668329	81.519439	31	191	KEEP	---	---	---	---	12	22	88	129	0.352941176471	capture	Missense_Mutation	SNP	86369237	86369237	SLITRK6	13	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	14639	119
SERPINA11	256394	broad.mit.edu	37	14	94912764	94912764	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94912764G>A	uc001ydd.1	-	3	881	c.821C>T	c.(820-822)GCG>GTG	p.A274V		NM_001080451	NP_001073920	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1	274					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			kidney(1)	1				COAD - Colon adenocarcinoma(157;0.211)		GACCAGCAGCGCCAAGGCATT	0.547																0.452555	369.761687	370.299074	124	150	KEEP	---	---	---	---	76	62	81	84	-1	capture	Missense_Mutation	SNP	94912764	94912764	SERPINA11	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13981	119
GATM	2628	broad.mit.edu	37	15	45658329	45658329	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45658329T>C	uc001zvc.2	-	6	1222	c.893A>G	c.(892-894)GAT>GGT	p.D298G	GATM_uc001zvb.2_Missense_Mutation_p.D169G|GATM_uc010uev.1_Missense_Mutation_p.D351G	NM_001482	NP_001473	P50440	GATM_HUMAN	L-arginine:glycine amidinotransferase precursor	298					creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding				0		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)	GGGATTGGGATCTTTAAAGGA	0.428																0.04878	-7.670153	10.070334	4	78	KEEP	---	---	---	---	3	1	47	37	-1	capture	Missense_Mutation	SNP	45658329	45658329	GATM	15	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	6203	119
NUP88	4927	broad.mit.edu	37	17	5322843	5322843	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5322843G>A	uc002gbo.1	-	1	154	c.128C>T	c.(127-129)GCT>GTT	p.A43V	NUP88_uc010vsx.1_Missense_Mutation_p.A43V|NUP88_uc010cle.1_Missense_Mutation_p.A43V|NUP88_uc010vsy.1_Missense_Mutation_p.A43V|RPAIN_uc010vsz.1_5'Flank|RPAIN_uc002gbp.1_5'Flank|RPAIN_uc010vta.1_5'Flank|RPAIN_uc002gbq.2_5'Flank|RPAIN_uc010vtb.1_5'Flank|RPAIN_uc002gbs.2_5'Flank|RPAIN_uc002gbt.2_5'Flank|RPAIN_uc002gbu.2_5'Flank|RPAIN_uc002gbv.2_5'Flank|RPAIN_uc002gbr.2_5'Flank|RPAIN_uc002gbw.2_5'Flank	NM_002532	NP_002523	Q99567	NUP88_HUMAN	nucleoporin 88kDa	43					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	transporter activity			kidney(1)	1						CGACGAAGAAGCTGGTTTCTC	0.602					6											0.937799	647.323494	682.184697	196	13	KEEP	---	---	---	---	104	120	8	6	-1	capture	Missense_Mutation	SNP	5322843	5322843	NUP88	17	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	10678	119
TP53	7157	broad.mit.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577568C>T	uc002gim.2	-	7	907	c.713G>A	c.(712-714)TGT>TAT	p.C238Y	TP53_uc002gig.1_Missense_Mutation_p.C238Y|TP53_uc002gih.2_Missense_Mutation_p.C238Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C106Y|TP53_uc010cng.1_Missense_Mutation_p.C106Y|TP53_uc002gii.1_Missense_Mutation_p.C106Y|TP53_uc010cnh.1_Missense_Mutation_p.C238Y|TP53_uc010cni.1_Missense_Mutation_p.C238Y|TP53_uc002gij.2_Missense_Mutation_p.C238Y|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.C145Y|TP53_uc002gio.2_Missense_Mutation_p.C106Y	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	238	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).	Zinc.	C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C238Y(47)|p.C238F(34)|p.C238S(18)|p.C238R(14)|p.0?(7)|p.C238*(4)|p.C238W(2)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.C238_N239insX(1)|p.C238_M246delCNSSCMGGM(1)|p.C238fs*9(1)|p.M237_N239delMCN(1)|p.C238fs*21(1)|p.C238del(1)|p.C238G(1)|p.C238C(1)|p.M237fs*1(1)|p.C145F(1)|p.H233fs*6(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.M237_C238insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGAACTGTTACACATGTAGTT	0.572	Pancreas(47;798 1329 9957 10801)		111	p.C238S(LN18-Tumor)|p.C238Y(MC116-Tumor)|p.C238S(MOLM16-Tumor)|p.C238S(SNU626-Tumor)|p.C238fs(SW1417-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.917647	255.20838	270.286753	78	7	KEEP	---	---	---	---	52	44	6	4	-1	capture	Missense_Mutation	SNP	7577568	7577568	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	16264	119
ZCCHC2	54877	broad.mit.edu	37	18	60243794	60243794	+	Silent	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:60243794G>A	uc002lip.3	+	14	3519	c.3519G>A	c.(3517-3519)ACG>ACA	p.T1173T	ZCCHC2_uc002lio.2_RNA|ZCCHC2_uc002liq.2_Silent_p.T643T	NM_017742	NP_060212	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	1173					cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding			lung(1)|prostate(1)	2						CTAATGATACGTTGGATTCTG	0.468																0.423729	75.464679	75.764271	25	34	KEEP	---	---	---	---	16	12	21	20	-1	capture	Silent	SNP	60243794	60243794	ZCCHC2	18	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	17467	119
ARHGEF18	23370	broad.mit.edu	37	19	7531967	7531967	+	Missense_Mutation	SNP	G	A	A	rs150543189		TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7531967G>A	uc002mgi.2	+	15	2661	c.2408G>A	c.(2407-2409)CGG>CAG	p.R803Q	ARHGEF18_uc010xjm.1_Missense_Mutation_p.R645Q|ARHGEF18_uc002mgh.2_Missense_Mutation_p.R645Q|ARHGEF18_uc002mgj.1_Missense_Mutation_p.R446Q	NM_001130955	NP_001124427	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor 18	803	Potential.				actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)				CTTGTCCAGCGGATCCAGACA	0.672																0.551471	247.946171	248.261556	75	61	KEEP	---	---	---	---	50	49	59	50	-1	capture	Missense_Mutation	SNP	7531967	7531967	ARHGEF18	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	894	119
ZNF492	57615	broad.mit.edu	37	19	22846654	22846654	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22846654T>A	uc002nqw.3	+	4	427	c.183T>A	c.(181-183)AAT>AAA	p.N61K		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	61					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				GCAAAAAAAATTATTTCCAAA	0.318																0.551724	55.20356	55.271167	16	13	KEEP	---	---	---	---	6	13	8	5	-1	capture	Missense_Mutation	SNP	22846654	22846654	ZNF492	19	T	A	A	A	1	0	0	0	0	1	0	0	0	673	52	4	4	17822	119
MAG	4099	broad.mit.edu	37	19	35801013	35801013	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35801013G>A	uc002nyy.1	+	8	1617	c.1468G>A	c.(1468-1470)GCG>ACG	p.A490T	MAG_uc002nyx.1_Missense_Mutation_p.A490T|MAG_uc010eds.1_Missense_Mutation_p.A465T|MAG_uc002nyz.1_Missense_Mutation_p.A490T	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a	490	Ig-like C2-type 4.|Extracellular (Potential).				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CATCTGCACCGCGAGGAACCT	0.706																0.512195	131.749339	131.759917	42	40	KEEP	---	---	---	---	26	33	29	41	-1	capture	Missense_Mutation	SNP	35801013	35801013	MAG	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9076	119
CYP2B6	1555	broad.mit.edu	37	19	41512932	41512932	+	Missense_Mutation	SNP	T	C	C	rs140578107	by1000genomes	TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41512932T>C	uc002opr.1	+	4	614	c.607T>C	c.(607-609)TAC>CAC	p.Y203H	CYP2A7_uc002opo.2_Intron|CYP2B6_uc010xvu.1_Intron	NM_000767	NP_000758	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B,	203					cellular ketone metabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(20;0.00322)		Bupropion(DB01156)|Butalbital(DB00241)|Carbamazepine(DB00564)|Clopidogrel(DB00758)|Cyclophosphamide(DB00531)|Efavirenz(DB00625)|Ifosfamide(DB01181)|Memantine(DB01043)|Meperidine(DB00454)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicotine(DB00184)|Orphenadrine(DB01173)|Phenytoin(DB00252)|Propofol(DB00818)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Ticlopidine(DB00208)|Troleandomycin(DB01361)	GAACTTGTTCTACCAGACTTT	0.512					56											0.03321	-41.567923	22.846969	9	262	KEEP	---	---	---	---	4	6	143	161	-1	capture	Missense_Mutation	SNP	41512932	41512932	CYP2B6	19	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	4124	119
TULP2	7288	broad.mit.edu	37	19	49398651	49398651	+	Silent	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49398651G>A	uc002pkz.2	-	5	472	c.321C>T	c.(319-321)CGC>CGT	p.R107R		NM_003323	NP_003314	O00295	TULP2_HUMAN	tubby like protein 2	107					visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		TCGGGAGGCCGCGCTCGCCCC	0.488																0.044444	-27.614765	12.388805	8	172	KEEP	---	---	---	---	4	6	108	101	-1	capture	Silent	SNP	49398651	49398651	TULP2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	16656	119
TRIB2	28951	broad.mit.edu	37	2	12858629	12858629	+	Silent	SNP	T	C	C	rs144421263	byFrequency	TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:12858629T>C	uc002rbv.3	+	1	1632	c.196T>C	c.(196-198)TTG>CTG	p.L66L	TRIB2_uc010yjp.1_Intron	NM_021643	NP_067675	Q92519	TRIB2_HUMAN	tribbles homolog 2	66	Protein kinase.				negative regulation of fat cell differentiation|negative regulation of interleukin-10 biosynthetic process|negative regulation of protein kinase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity	cytoplasm|cytoskeleton|nucleus	ATP binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			stomach(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GAAATACTTATTGTTGGAACC	0.577					61									OREG0014450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.018182	-36.490263	6.623208	3	162	KEEP	---	---	---	---	1	2	88	86	-1	capture	Silent	SNP	12858629	12858629	TRIB2	2	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	16366	119
IFT172	26160	broad.mit.edu	37	2	27682592	27682592	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27682592G>T	uc002rku.2	-	24	2677	c.2626C>A	c.(2626-2628)CAC>AAC	p.H876N		NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog	876	TPR 4.				cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)					TCGATGTAGTGATTAATGGCT	0.522																0.46371	692.564109	693.136451	230	266	KEEP	---	---	---	---	142	116	130	157	0.550387596899	capture	Missense_Mutation	SNP	27682592	27682592	IFT172	2	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	7482	119
PMS1	5378	broad.mit.edu	37	2	190728600	190728600	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:190728600C>T	uc002urh.3	+	10	2517	c.1988C>T	c.(1987-1989)GCC>GTC	p.A663V	PMS1_uc010zga.1_3'UTR|PMS1_uc010zgb.1_Missense_Mutation_p.A602V|PMS1_uc002urk.3_Missense_Mutation_p.A624V|PMS1_uc002uri.3_Intron|PMS1_uc010zgc.1_Missense_Mutation_p.A487V|PMS1_uc010zgd.1_Missense_Mutation_p.A487V|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_Missense_Mutation_p.A624V|PMS1_uc010frz.2_Intron|PMS1_uc002url.2_Intron|PMS1_uc002urm.2_RNA|PMS1_uc002urn.1_Missense_Mutation_p.A331V	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	663					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TGGAATTTGGCCCAGAAGCAC	0.363					236	Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					0.021739	-40.423062	6.555341	4	180	KEEP	---	---	---	---	2	4	97	102	-1	capture	Missense_Mutation	SNP	190728600	190728600	PMS1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12045	119
AOX1	316	broad.mit.edu	37	2	201523898	201523898	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201523898G>A	uc002uvx.2	+	28	3283	c.3182G>A	c.(3181-3183)CGT>CAT	p.R1061H	AOX1_uc010zhf.1_Missense_Mutation_p.R617H|AOX1_uc010fsu.2_Missense_Mutation_p.R427H	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	1061					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GTGGTCAGCCGTGAATTAAGA	0.453																0.429907	143.137039	143.594715	46	61	KEEP	---	---	---	---	29	25	26	40	-1	capture	Missense_Mutation	SNP	201523898	201523898	AOX1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	722	119
NEU2	4759	broad.mit.edu	37	2	233899564	233899564	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233899564C>T	uc010zmn.1	+	2	940	c.940C>T	c.(940-942)CGA>TGA	p.R314*		NM_005383	NP_005374	Q9Y3R4	NEUR2_HUMAN	neuraminidase 2	314							exo-alpha-sialidase activity				0		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)		CCTCAACCCGCGACCTCCAGC	0.692																0.470297	274.002926	274.157832	95	107	KEEP	---	---	---	---	43	62	62	62	-1	capture	Nonsense_Mutation	SNP	233899564	233899564	NEU2	2	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	10249	119
COL6A3	1293	broad.mit.edu	37	2	238280769	238280769	+	Silent	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238280769G>A	uc002vwl.2	-	9	4176	c.3891C>T	c.(3889-3891)AAC>AAT	p.N1297N	COL6A3_uc002vwo.2_Silent_p.N1091N|COL6A3_uc010znj.1_Silent_p.N690N|COL6A3_uc002vwq.2_Silent_p.N1091N|COL6A3_uc002vwr.2_Silent_p.N890N	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1297	VWFA 7.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity	p.N1297N(1)		ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCTGCACCGCGTTCTGCACTT	0.617																0.381679	142.412321	144.022683	50	81	KEEP	---	---	---	---	29	34	47	51	-1	capture	Silent	SNP	238280769	238280769	COL6A3	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3666	119
NEU4	129807	broad.mit.edu	37	2	242758284	242758284	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242758284C>G	uc010fzr.2	+	4	1451	c.1365C>G	c.(1363-1365)TTC>TTG	p.F455L	NEU4_uc002wcl.2_RNA|NEU4_uc002wcm.2_Missense_Mutation_p.F455L|NEU4_uc002wcn.1_Missense_Mutation_p.F467L|NEU4_uc002wco.1_Missense_Mutation_p.F455L|NEU4_uc002wcp.1_Missense_Mutation_p.F467L	NM_080741	NP_542779	Q8WWR8	NEUR4_HUMAN	sialidase 4	455						lysosomal lumen|organelle inner membrane	exo-alpha-sialidase activity|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		TTTGTACATTCTCCCTGCGTG	0.642																0.428571	71.0681	71.286014	21	28	KEEP	---	---	---	---	13	10	19	13	-1	capture	Missense_Mutation	SNP	242758284	242758284	NEU4	2	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	10251	119
RPN2	6185	broad.mit.edu	37	20	35865068	35865068	+	Silent	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35865068G>A	uc002xgp.2	+	16	2143	c.1839G>A	c.(1837-1839)ACG>ACA	p.T613T	RPN2_uc002xgq.2_Silent_p.T581T	NM_002951	NP_002942	P04844	RPN2_HUMAN	ribophorin II isoform 1 precursor	613	Helical; (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|nucleus|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				GCAGTGTGACGTTTCTGGCTG	0.532																0.469565	160.232797	160.325979	54	61	KEEP	---	---	---	---	31	28	42	28	-1	capture	Silent	SNP	35865068	35865068	RPN2	20	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	13500	119
TSHZ2	128553	broad.mit.edu	37	20	51870661	51870661	+	Missense_Mutation	SNP	G	A	A	rs141167641	by1000genomes	TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:51870661G>A	uc002xwo.2	+	2	1620	c.664G>A	c.(664-666)GCG>ACG	p.A222T		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	222	C2H2-type 1.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.A222T(1)		ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			ACAGTGCAGCGCGGCCTATGA	0.562																0.346154	74.297125	75.928972	27	51	KEEP	---	---	---	---	16	20	23	36	-1	capture	Missense_Mutation	SNP	51870661	51870661	TSHZ2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16507	119
INPP5J	27124	broad.mit.edu	37	22	31524557	31524557	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31524557C>T	uc003aju.3	+	9	2202	c.2110C>T	c.(2110-2112)CAG>TAG	p.Q704*	INPP5J_uc003ajv.3_Nonsense_Mutation_p.Q337*|INPP5J_uc003ajs.3_Nonsense_Mutation_p.Q337*|INPP5J_uc011alk.1_Nonsense_Mutation_p.Q637*|INPP5J_uc010gwg.2_Nonsense_Mutation_p.Q269*|INPP5J_uc003ajw.2_Nonsense_Mutation_p.Q140*|INPP5J_uc003ajt.3_Nonsense_Mutation_p.Q336*|INPP5J_uc003ajx.2_Nonsense_Mutation_p.Q69*|INPP5J_uc003ajy.2_Nonsense_Mutation_p.Q69*|INPP5J_uc003ajz.2_Nonsense_Mutation_p.Q144*	NM_001002837	NP_001002837	Q15735	PI5PA_HUMAN	phosphatidylinositol (4,5) bisphosphate	704	Catalytic (Potential).					cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding			skin(1)	1						CCACCGACTCCAGGTGACGCA	0.602																0.450704	211.884362	212.184942	64	78	KEEP	---	---	---	---	29	40	35	47	-1	capture	Nonsense_Mutation	SNP	31524557	31524557	INPP5J	22	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	7682	119
PHF5A	84844	broad.mit.edu	37	22	41863525	41863525	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:41863525C>T	uc003bab.2	-	3	221	c.170G>A	c.(169-171)CGC>CAC	p.R57H	ACO2_uc003bac.2_5'Flank|ACO2_uc003bad.2_5'Flank	NM_032758	NP_116147	Q7RTV0	PHF5A_HUMAN	PHD-finger 5A	57					nuclear mRNA splicing, via spliceosome|positive regulation of transcription, DNA-dependent	nuclear speck|U12-type spliceosomal complex|U2 snRNP	DNA binding|sequence-specific DNA binding transcription factor activity				0						GATCACACAGCGCCCCTGGTA	0.502	Ovarian(15;130 571 1826 2981 46141)															0.421053	165.576607	166.299968	56	77	KEEP	---	---	---	---	31	30	43	37	-1	capture	Missense_Mutation	SNP	41863525	41863525	PHF5A	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11740	119
NAGA	4668	broad.mit.edu	37	22	42456400	42456400	+	Silent	SNP	T	G	G			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42456400T>G	uc003bbx.2	-	10	1256	c.1119A>C	c.(1117-1119)TCA>TCC	p.S373S	NAGA_uc003bby.2_Silent_p.S373S|NAGA_uc003bbw.3_Silent_p.S373S	NM_000262	NP_000253	P17050	NAGAB_HUMAN	alpha-N-acetylgalactosaminidase precursor	373					glycoside catabolic process|glycosylceramide catabolic process|oligosaccharide metabolic process	lysosome	alpha-galactosidase activity|alpha-N-acetylgalactosaminidase activity|cation binding|protein homodimerization activity			central_nervous_system(1)	1						TGATGTCACCTGAGTAGACGT	0.557																0.052817	-23.719367	36.274624	15	269	KEEP	---	---	---	---	12	10	165	152	-1	capture	Silent	SNP	42456400	42456400	NAGA	22	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	10051	119
ATP2B2	491	broad.mit.edu	37	3	10413708	10413708	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10413708G>A	uc003bvt.2	-	12	1883	c.1444C>T	c.(1444-1446)CGC>TGC	p.R482C	ATP2B2_uc003bvv.2_Missense_Mutation_p.R437C|ATP2B2_uc003bvw.2_Missense_Mutation_p.R437C|ATP2B2_uc010hdo.2_Missense_Mutation_p.R187C	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	482	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						TCCAGGTGGCGTACCAGGTTG	0.587	Ovarian(125;1619 1709 15675 19819 38835)															0.023256	-37.044758	6.476798	4	168	KEEP	---	---	---	---	2	3	101	80	-1	capture	Missense_Mutation	SNP	10413708	10413708	ATP2B2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1131	119
RRP9	9136	broad.mit.edu	37	3	51969702	51969702	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:51969702C>T	uc003dbw.1	-	9	781	c.742G>A	c.(742-744)GCA>ACA	p.A248T		NM_004704	NP_004695	O43818	U3IP2_HUMAN	RNA, U3 small nucleolar interacting protein 2	248	WD 3.				rRNA processing	nucleolus|small nuclear ribonucleoprotein complex|small nucleolar ribonucleoprotein complex	RNA binding			breast(2)|ovary(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		CTGCGGAATGCCAGACCCTAA	0.592																0.03252	-21.508827	7.857533	4	119	KEEP	---	---	---	---	1	3	63	79	-1	capture	Missense_Mutation	SNP	51969702	51969702	RRP9	3	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13583	119
RETNLB	84666	broad.mit.edu	37	3	108474644	108474644	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108474644C>T	uc003dxh.2	-	3	415	c.317G>A	c.(316-318)CGC>CAC	p.R106H		NM_032579	NP_115968	Q9BQ08	RETNB_HUMAN	resistin like beta precursor	106					cell proliferation	extracellular region	hormone activity			skin(1)	1						GTGGCAGCAGCGGGCAGTGGT	0.552																0.371134	206.785883	209.601783	72	122	KEEP	---	---	---	---	37	54	65	85	-1	capture	Missense_Mutation	SNP	108474644	108474644	RETNLB	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13132	119
SEC62	7095	broad.mit.edu	37	3	169694809	169694809	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:169694809C>A	uc003fgg.2	+	3	252	c.221C>A	c.(220-222)ACC>AAC	p.T74N	SEC62_uc003fgh.2_Missense_Mutation_p.T74N	NM_003262	NP_003253	Q99442	SEC62_HUMAN	translocation protein 1	74	Cytoplasmic (Potential).				cotranslational protein targeting to membrane|transmembrane transport	aggresome|endoplasmic reticulum membrane|integral to membrane|intermediate filament cytoskeleton|rough endoplasmic reticulum	protein transporter activity|receptor activity			ovary(1)	1						TTATTTACAACCAGGGAGTCT	0.348																0.43299	129.732948	130.113083	42	55	KEEP	---	---	---	---	22	28	32	30	0.56	capture	Missense_Mutation	SNP	169694809	169694809	SEC62	3	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	13897	119
DKK2	27123	broad.mit.edu	37	4	107846994	107846994	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:107846994C>T	uc003hyi.2	-	2	1040	c.335G>A	c.(334-336)CGA>CAA	p.R112Q	DKK2_uc010ilw.1_RNA|DKK2_uc003hyj.1_Missense_Mutation_p.R112Q	NM_014421	NP_055236	Q9UBU2	DKK2_HUMAN	dickkopf homolog 2 precursor	112	DKK-type Cys-1.				multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space		p.R112G(1)		ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		CATGCCATCTCGGTGGCAGCG	0.498																0.456432	336.939535	337.335099	110	131	KEEP	---	---	---	---	74	68	70	83	-1	capture	Missense_Mutation	SNP	107846994	107846994	DKK2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4503	119
SH3RF2	153769	broad.mit.edu	37	5	145393517	145393517	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:145393517C>T	uc003lnt.2	+	5	1190	c.952C>T	c.(952-954)CGC>TGC	p.R318C	SH3RF2_uc011dbl.1_Missense_Mutation_p.R318C	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	318							ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCTTCAGGGCGCCATATGGT	0.577																0.458333	475.347686	475.887619	165	195	KEEP	---	---	---	---	82	95	101	111	-1	capture	Missense_Mutation	SNP	145393517	145393517	SH3RF2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14152	119
OR14J1	442191	broad.mit.edu	37	6	29275286	29275286	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29275286G>A	uc011dln.1	+	1	820	c.820G>A	c.(820-822)GTA>ATA	p.V274I		NM_030946	NP_112208	Q9UGF5	O14J1_HUMAN	olfactory receptor, family 5, subfamily U member	274	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TGTATTCTCCGTATTCTATAC	0.443																0.034783	-59.00771	22.227819	12	333	KEEP	---	---	---	---	6	7	182	183	-1	capture	Missense_Mutation	SNP	29275286	29275286	OR14J1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10852	119
HLA-DOA	3111	broad.mit.edu	37	6	32975995	32975995	+	Silent	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32975995G>A	uc003ocr.2	-	2	202	c.126C>T	c.(124-126)TAC>TAT	p.Y42Y	HLA-DOA_uc010juj.2_Silent_p.Y12Y|HLA-DOA_uc010jui.2_Silent_p.Y42Y	NM_002119	NP_002110	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO	42	Extracellular (Potential).|Alpha-1.				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endosome membrane|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0						CCGAGGCGCCGTAAGACTGGT	0.542																0.045977	-12.058249	7.075936	4	83	KEEP	---	---	---	---	0	5	54	40	-1	capture	Silent	SNP	32975995	32975995	HLA-DOA	6	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7125	119
CUL9	23113	broad.mit.edu	37	6	43163923	43163923	+	Silent	SNP	C	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43163923C>A	uc003ouk.2	+	10	2580	c.2505C>A	c.(2503-2505)ATC>ATA	p.I835I	CUL9_uc003oul.2_Silent_p.I835I|CUL9_uc010jyk.2_5'UTR	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	835					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						TCGCCAGCATCGACTCAGCCA	0.567																0.028169	-27.926591	6.915301	4	138	KEEP	---	---	---	---	2	2	81	103	0.5	capture	Silent	SNP	43163923	43163923	CUL9	6	C	A	A	A	1	0	0	0	0	0	0	0	1	395	31	4	4	4021	119
CRISP3	10321	broad.mit.edu	37	6	49696554	49696554	+	Silent	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:49696554G>A	uc003ozs.2	-	8	642	c.627C>T	c.(625-627)TAC>TAT	p.Y209Y		NM_006061	NP_006052	P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3 precursor	209					innate immune response	proteinaceous extracellular matrix|specific granule				skin(2)	2	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			AGAGATCTTCGTACTTGCAAC	0.358																0.340659	88.394287	90.437772	31	60	KEEP	---	---	---	---	20	15	27	36	-1	capture	Silent	SNP	49696554	49696554	CRISP3	6	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3846	119
ORC3L	23595	broad.mit.edu	37	6	88318866	88318866	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:88318866A>T	uc003pmh.2	+	7	676	c.632A>T	c.(631-633)CAG>CTG	p.Q211L	ORC3L_uc011dzl.1_Missense_Mutation_p.Q211L|ORC3L_uc011dzm.1_Missense_Mutation_p.Q211L|ORC3L_uc011dzn.1_RNA|ORC3L_uc003pmg.2_Missense_Mutation_p.Q211L|ORC3L_uc003pmi.2_Missense_Mutation_p.Q211L|ORC3L_uc011dzo.1_Missense_Mutation_p.Q68L|ORC3L_uc011dzp.1_Missense_Mutation_p.Q68L	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2	211					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		AGCCAATGGCAGTCTCCTCCT	0.398																0.480447	287.043615	287.103075	86	93	KEEP	---	---	---	---	39	56	48	57	-1	capture	Missense_Mutation	SNP	88318866	88318866	ORC3L	6	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	11167	119
ARID1B	57492	broad.mit.edu	37	6	157522507	157522507	+	Silent	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:157522507C>T	uc003qqn.2	+	18	4877	c.4725C>T	c.(4723-4725)ACC>ACT	p.T1575T	ARID1B_uc003qqo.2_Silent_p.T1535T|ARID1B_uc003qqp.2_Silent_p.T1522T	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1580	Pro-rich.				chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CCCAGGTCACCGGGCCACCAC	0.547																0.026087	-68.16808	17.505344	9	336	KEEP	---	---	---	---	1	8	167	204	-1	capture	Silent	SNP	157522507	157522507	ARID1B	6	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	907	119
OSBPL3	26031	broad.mit.edu	37	7	24874215	24874215	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:24874215G>A	uc003sxf.2	-	15	2041	c.1636C>T	c.(1636-1638)CCG>TCG	p.P546S	OSBPL3_uc003sxd.2_RNA|OSBPL3_uc003sxe.2_RNA|OSBPL3_uc003sxg.2_Missense_Mutation_p.P510S|OSBPL3_uc003sxh.2_Missense_Mutation_p.P515S|OSBPL3_uc003sxi.2_Missense_Mutation_p.P479S|OSBPL3_uc003sxj.1_Missense_Mutation_p.P275S|OSBPL3_uc003sxk.1_Missense_Mutation_p.P244S	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform	546					lipid transport		lipid binding|protein binding			skin(1)	1						AGCTCCACCGGCATGGCCACC	0.632																0.022989	-37.46339	6.65056	4	170	KEEP	---	---	---	---	0	4	91	107	-1	capture	Missense_Mutation	SNP	24874215	24874215	OSBPL3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11183	119
NSUN5	55695	broad.mit.edu	37	7	72721702	72721702	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72721702C>T	uc003txw.2	-	3	305	c.269G>A	c.(268-270)CGA>CAA	p.R90Q	FKBP6_uc003twz.2_Intron|NSUN5_uc003txv.2_Missense_Mutation_p.R90Q|NSUN5_uc003txx.2_Intron|NSUN5_uc011kev.1_Missense_Mutation_p.R90Q	NM_018044	NP_060514	Q96P11	NSUN5_HUMAN	NOL1/NOP2/Sun domain family, member 5 isoform 2	90							methyltransferase activity				0		Lung NSC(55;0.163)				AGCCTTCCATCGGCCCCCACC	0.552																0.073171	-0.795847	6.873402	3	38	KEEP	---	---	---	---	1	3	21	21	-1	capture	Missense_Mutation	SNP	72721702	72721702	NSUN5	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10588	119
ABCB4	5244	broad.mit.edu	37	7	87079357	87079357	+	Missense_Mutation	SNP	C	T	T	rs147998447	byFrequency	TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87079357C>T	uc003uiv.1	-	8	836	c.760G>A	c.(760-762)GCC>ACC	p.A254T	ABCB4_uc003uiw.1_Missense_Mutation_p.A254T|ABCB4_uc003uix.1_Missense_Mutation_p.A254T	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	254	ABC transmembrane type-1 1.|Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					TCTGCCACGGCGCCTGCTTTT	0.478																0.309038	286.724898	297.869867	106	237	KEEP	---	---	---	---	79	45	136	141	-1	capture	Missense_Mutation	SNP	87079357	87079357	ABCB4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	43	119
ORAI2	80228	broad.mit.edu	37	7	102086975	102086975	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:102086975G>A	uc010lhz.1	+	4	476	c.241G>A	c.(241-243)GTG>ATG	p.V81M	ORAI2_uc003uzj.2_Missense_Mutation_p.V81M|ORAI2_uc003uzk.2_Missense_Mutation_p.V81M|ORAI2_uc011kks.1_Missense_Mutation_p.V4M	NM_001126340	NP_001119812	Q96SN7	ORAI2_HUMAN	ORAI calcium release-activated calcium modulator	81	Helical; (Potential).					integral to membrane	protein binding			ovary(1)|kidney(1)	2						CATGGTGGAGGTGCAGCTGGA	0.677																0.295082	48.229839	50.519379	18	43	KEEP	---	---	---	---	10	21	34	35	-1	capture	Missense_Mutation	SNP	102086975	102086975	ORAI2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	11162	119
SLC26A3	1811	broad.mit.edu	37	7	107431671	107431671	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107431671G>A	uc003ver.2	-	5	603	c.392C>T	c.(391-393)CCG>CTG	p.P131L	SLC26A3_uc003ves.2_Missense_Mutation_p.P96L	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3	131	Helical; (Potential).		P -> R (in DIAR1).		excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						ACTCAGAATCGGAAACGGACC	0.428																0.018018	-50.308678	7.816902	4	218	KEEP	---	---	---	---	3	3	110	142	-1	capture	Missense_Mutation	SNP	107431671	107431671	SLC26A3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14410	119
BMP1	649	broad.mit.edu	37	8	22069181	22069181	+	Silent	SNP	A	G	G			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22069181A>G	uc003xbg.2	+	20	3145	c.2901A>G	c.(2899-2901)AAA>AAG	p.K967K	BMP1_uc011kzc.1_Silent_p.K716K|BMP1_uc003xbh.2_RNA|BMP1_uc003xbi.2_RNA	NM_006129	NP_006120	P13497	BMP1_HUMAN	bone morphogenetic protein 1 isoform 3	967	CUB 5.				cartilage condensation|cell differentiation|lipid metabolic process|lipoprotein metabolic process|ossification|positive regulation of cartilage development|proteolysis	extracellular space	calcium ion binding|cytokine activity|growth factor activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|breast(1)	3				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		TCACCAAAAAAGGTTTCCACC	0.577																0.015873	-58.536442	8.393417	4	248	KEEP	---	---	---	---	1	3	107	153	-1	capture	Silent	SNP	22069181	22069181	BMP1	8	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	1444	119
EYA1	2138	broad.mit.edu	37	8	72156896	72156896	+	Missense_Mutation	SNP	C	A	A	rs145219836	by1000genomes	TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:72156896C>A	uc003xys.3	-	11	1369	c.1082G>T	c.(1081-1083)CGA>CTA	p.R361L	EYA1_uc003xyr.3_Intron|EYA1_uc003xyt.3_Missense_Mutation_p.R328L|EYA1_uc010lzf.2_Missense_Mutation_p.R288L|EYA1_uc003xyu.2_Missense_Mutation_p.R361L|EYA1_uc011lfe.1_Missense_Mutation_p.R355L|EYA1_uc003xyv.2_Missense_Mutation_p.R239L	NM_172058	NP_742055	Q99502	EYA1_HUMAN	eyes absent 1 isoform b	361					double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity	p.R361L(1)		ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			TTCTTCCATTCGCAGTCCAAG	0.323																0.466667	70.472827	70.516221	21	24	KEEP	---	---	---	---	19	9	17	11	0.321428571429	capture	Missense_Mutation	SNP	72156896	72156896	EYA1	8	C	A	A	A	1	0	0	0	0	1	0	0	0	403	31	4	4	5283	119
DECR1	1666	broad.mit.edu	37	8	91031335	91031335	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:91031335G>A	uc003yek.1	+	4	493	c.352G>A	c.(352-354)GTG>ATG	p.V118M	DECR1_uc011lgc.1_Missense_Mutation_p.V109M|DECR1_uc011lgd.1_RNA	NM_001359	NP_001350	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1 precursor	118					fatty acid beta-oxidation|protein homotetramerization	mitochondrial matrix|nucleus|plasma membrane	2,4-dienoyl-CoA reductase (NADPH) activity|NADPH binding|oxidoreductase activity, acting on NADH or NADPH				0			BRCA - Breast invasive adenocarcinoma(11;0.00953)			TCAGTGTGATGTGAGGGATCC	0.363																0.05042	-14.76044	10.759555	6	113	KEEP	---	---	---	---	4	3	53	75	-1	capture	Missense_Mutation	SNP	91031335	91031335	DECR1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	4340	119
AQP7	364	broad.mit.edu	37	9	33385656	33385656	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33385656T>A	uc003zst.2	-	7	906	c.734A>T	c.(733-735)CAG>CTG	p.Q245L	SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Missense_Mutation_p.Q188L|AQP7_uc010mjs.2_Missense_Mutation_p.Q153L|AQP7_uc010mjt.2_Missense_Mutation_p.Q153L|AQP7_uc011lnx.1_Missense_Mutation_p.Q245L|AQP7_uc011lny.1_Missense_Mutation_p.Q244L|AQP7_uc003zss.3_Missense_Mutation_p.Q153L|AQP7_uc011lnz.1_Missense_Mutation_p.Q153L|AQP7_uc011loa.1_Silent_p.T113T	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7	245	Extracellular (Potential).				excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CCTGAAGACCTGTTTGCCCCA	0.597																0.02	-54.853282	9.750951	5	245	KEEP	---	---	---	---	5	1	141	142	-1	capture	Missense_Mutation	SNP	33385656	33385656	AQP7	9	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	824	119
PRDM12	59335	broad.mit.edu	37	9	133543671	133543671	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133543671G>A	uc004bzt.1	+	3	601	c.541G>A	c.(541-543)GGC>AGC	p.G181S		NM_021619	NP_067632	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	181	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		GGTCCAGATCGGCACCAGCAT	0.582																0.271375	201.962235	214.636974	73	196	KEEP	---	---	---	---	39	41	118	108	-1	capture	Missense_Mutation	SNP	133543671	133543671	PRDM12	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12349	119
PTEN	5728	broad.mit.edu	37	10	89653779	89653780	+	Splice_Site	INS	-	AGAT	AGAT			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89653779_89653780insAGAT	uc001kfb.2	+	3	1111	c.80_splice	c.e3-2	p.Y27_splice		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CTAAAGTACTCAGATATTTATC	0.312			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.80			49	12		---	---	---	---						capture_indel	Splice_Site	INS	89653779	89653780	PTEN	10	-	AGAT	AGAT	AGAT	1	0	1	1	0	0	0	1	0	365	29	5	5	12633	119
SPRYD5	84767	broad.mit.edu	37	11	55653609	55653610	+	Frame_Shift_Ins	INS	-	A	A			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55653609_55653610insA	uc010rip.1	+	3	514_515	c.422_423insA	c.(421-423)CTAfs	p.L141fs	SPRYD5_uc010riq.1_5'UTR	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	141						intracellular	zinc ion binding				0		all_epithelial(135;0.226)				GAGGAGCTCCTAAAAAAAATGC	0.401																0.37			31	52		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	55653609	55653610	SPRYD5	11	-	A	A	A	1	0	1	1	0	0	0	0	0	689	53	5	5	15003	119
C14orf174	161394	broad.mit.edu	37	14	77843838	77843839	+	Frame_Shift_Ins	INS	-	TG	TG			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:77843838_77843839insTG	uc001xtq.1	+	1	77_78	c.77_78insTG	c.(76-78)CCTfs	p.P26fs	TMED8_uc010ast.1_5'Flank|TMED8_uc001xto.1_5'Flank	NM_001010860	NP_001010860	Q9P1V8	SAM15_HUMAN	hypothetical protein LOC161394	26											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0278)		CCTGAACTGCCTGGACTTCATA	0.540																0.28			70	184		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	77843838	77843839	C14orf174	14	-	TG	TG	TG	1	0	1	1	0	0	0	0	0	312	24	5	5	1745	119
PDILT	204474	broad.mit.edu	37	16	20370700	20370702	+	In_Frame_Del	DEL	CCA	-	-			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20370700_20370702delCCA	uc002dhc.1	-	12	1917_1919	c.1694_1696delTGG	c.(1693-1698)GTGGCT>GCT	p.V565del		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	565					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						TTTGGCTTAGCCACCACCACCAC	0.478																0.01			8	572		---	---	---	---						capture_indel	In_Frame_Del	DEL	20370700	20370702	PDILT	16	CCA	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	11577	119
ABCA12	26154	broad.mit.edu	37	2	215843155	215843156	+	Frame_Shift_Ins	INS	-	T	T			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:215843155_215843156insT	uc002vew.2	-	33	5232_5233	c.5012_5013insA	c.(5011-5013)AATfs	p.N1671fs	ABCA12_uc002vev.2_Frame_Shift_Ins_p.N1353fs|ABCA12_uc010zjn.1_Frame_Shift_Ins_p.N598fs	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	1671					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCATAGCACTATTTTTTTGTGA	0.376	Ovarian(66;664 1488 5121 34295)															0.08			8	90		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	215843155	215843156	ABCA12	2	-	T	T	T	1	0	1	1	0	0	0	0	0	206	16	5	5	30	119
EZH2	2146	broad.mit.edu	37	7	148515006	148515009	+	Frame_Shift_Del	DEL	TTCT	-	-			TCGA-12-0618-01	TCGA-12-0618-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148515006_148515009delTTCT	uc003wfd.1	-	10	1351_1354	c.1185_1188delAGAA	c.(1183-1188)AAAGAAfs	p.K395fs	EZH2_uc011kug.1_Frame_Shift_Del_p.K386fs|EZH2_uc003wfb.1_Frame_Shift_Del_p.K400fs|EZH2_uc003wfc.1_Frame_Shift_Del_p.K356fs|EZH2_uc011kuh.1_Frame_Shift_Del_p.K386fs|EZH2_uc011kui.1_Frame_Shift_Del_p.K395fs|EZH2_uc011kuj.1_RNA	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	395_396					negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding	p.E401fs*22(1)		haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			TCTCTTCTTCTTCTTTATCATTGT	0.456						Mis		DLBCL								0.31			158	352		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	148515006	148515009	EZH2	7	TTCT	-	-	-	1	0	1	0	1	0	0	0	0	725	56	5	5	5288	119
