Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PTPRU	10076	broad.mit.edu	37	1	29602053	29602053	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:29602053G>A	uc001bru.2	+	8	1348	c.1238G>A	c.(1237-1239)CGT>CAT	p.R413H	PTPRU_uc001brv.2_Missense_Mutation_p.R413H|PTPRU_uc001brw.2_Missense_Mutation_p.R413H|PTPRU_uc009vtq.2_Missense_Mutation_p.R413H|PTPRU_uc009vtr.2_Missense_Mutation_p.R413H	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	413	Fibronectin type-III 2.|Extracellular (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		AACGTGACGCGTTGCCACACC	0.592					874											0.333333	118.735461	121.760607	41	82	KEEP	---	---	---	---	28	19	51	37	-1	capture	Missense_Mutation	SNP	29602053	29602053	PTPRU	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12708	120
CYP4B1	1580	broad.mit.edu	37	1	47282838	47282838	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47282838C>T	uc001cqm.3	+	9	1273	c.1189C>T	c.(1189-1191)CGG>TGG	p.R397W	CYP4B1_uc001cqn.3_Missense_Mutation_p.R398W|CYP4B1_uc009vym.2_Missense_Mutation_p.R383W|CYP4B1_uc010omk.1_Missense_Mutation_p.R234W	NM_000779	NP_000770	P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B,	397					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					TGTGGATGGCCGGTCTCTACC	0.567																0.443182	123.314947	123.562144	39	49	KEEP	---	---	---	---	34	25	45	35	-1	capture	Missense_Mutation	SNP	47282838	47282838	CYP4B1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	4145	120
LYST	1130	broad.mit.edu	37	1	235860518	235860518	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235860518T>C	uc001hxj.2	-	46	10604	c.10429A>G	c.(10429-10431)AGT>GGT	p.S3477G	LYST_uc001hxi.2_Missense_Mutation_p.S701G	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	3477					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ACTGGAGCACTGGGGGAACCC	0.473												Chediak-Higashi_syndrome				0.264151	107.973923	115.975135	42	117	KEEP	---	---	---	---	25	23	53	81	-1	capture	Missense_Mutation	SNP	235860518	235860518	LYST	1	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	9043	120
RYR2	6262	broad.mit.edu	37	1	237890471	237890471	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237890471C>T	uc001hyl.1	+	76	10930	c.10810C>T	c.(10810-10812)CGG>TGG	p.R3604W	RYR2_uc010pya.1_5'UTR	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3604					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGCCTGCTTCCGGATGGCCCC	0.403																0.416667	132.887137	133.468285	40	56	KEEP	---	---	---	---	19	31	29	41	-1	capture	Missense_Mutation	SNP	237890471	237890471	RYR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	13661	120
STAMBPL1	57559	broad.mit.edu	37	10	90674395	90674395	+	Nonsense_Mutation	SNP	G	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:90674395G>T	uc001kfk.2	+	7	1306	c.883G>T	c.(883-885)GGA>TGA	p.G295*	STAMBPL1_uc010qmx.1_Nonsense_Mutation_p.G295*|STAMBPL1_uc009xto.2_RNA|STAMBPL1_uc001kfl.2_Nonsense_Mutation_p.G295*|STAMBPL1_uc001kfn.2_Nonsense_Mutation_p.G129*	NM_020799	NP_065850	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	295	MPN.						metal ion binding|metallopeptidase activity|protein binding			ovary(1)	1		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		AGAAACCTGTGGAATACTCTG	0.333																0.808824	191.363538	197.421846	55	13	KEEP	---	---	---	---	28	28	8	8	0.5	capture	Nonsense_Mutation	SNP	90674395	90674395	STAMBPL1	10	G	T	T	T	1	0	0	0	0	0	1	0	0	611	47	5	4	15141	120
MUC5B	727897	broad.mit.edu	37	11	1266158	1266158	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1266158C>G	uc009ycr.1	+	48	10088	c.9962C>G	c.(9961-9963)ACC>AGC	p.T3321S	MUC5B_uc001ltb.2_Missense_Mutation_p.T2686S	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	2734	7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AGCACACAGACCAGTGGTACT	0.333																0.333333	6.948181	7.095694	2	4	KEEP	---	---	---	---	1	2	7	6	-1	capture	Missense_Mutation	SNP	1266158	1266158	MUC5B	11	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	9889	120
IGSF22	283284	broad.mit.edu	37	11	18731138	18731138	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18731138G>A	uc009yht.2	-	18	2984	c.2794C>T	c.(2794-2796)CCC>TCC	p.P932S	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	831	Fibronectin type-III 2.									ovary(4)|large_intestine(2)|kidney(1)	7						TAGCCAGAGGGTGGGTCTCCC	0.582																0.4875	119.819589	119.830549	39	41	KEEP	---	---	---	---	20	21	26	20	-1	capture	Missense_Mutation	SNP	18731138	18731138	IGSF22	11	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	7524	120
SLC2A14	144195	broad.mit.edu	37	12	7980153	7980153	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7980153G>A	uc001qtk.2	-	12	1664	c.871C>T	c.(871-873)CGA>TGA	p.R291*	SLC2A14_uc001qtl.2_Nonsense_Mutation_p.R268*|SLC2A14_uc001qtm.2_Nonsense_Mutation_p.R268*|SLC2A14_uc010sgg.1_Nonsense_Mutation_p.R182*|SLC2A14_uc001qtn.2_Nonsense_Mutation_p.R291*|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Nonsense_Mutation_p.R306*	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14	291	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)		ATGGGCTGTCGGTAGCTGGAC	0.478																0.39726	93.663212	94.336404	29	44	KEEP	---	---	---	---	20	11	26	28	-1	capture	Nonsense_Mutation	SNP	7980153	7980153	SLC2A14	12	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	14435	120
SLC2A3	6515	broad.mit.edu	37	12	8082342	8082342	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8082342G>A	uc001qtr.2	-	6	1061	c.799C>T	c.(799-801)CGA>TGA	p.R267*	SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose	267	Cytoplasmic (Potential).				carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		ATGGGCTGTCGGTAGCTGGAC	0.473	Colon(96;424 1461 14416 20933 23688)															0.098592	6.077298	17.515273	7	64	KEEP	---	---	---	---	7	2	37	37	-1	capture	Nonsense_Mutation	SNP	8082342	8082342	SLC2A3	12	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	14437	120
IGF1	3479	broad.mit.edu	37	12	102813354	102813354	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:102813354A>G	uc001tjp.3	-	3	554	c.335T>C	c.(334-336)CTC>CCC	p.L112P	IGF1_uc001tjn.2_Missense_Mutation_p.L96P|IGF1_uc001tjm.2_Missense_Mutation_p.L112P|IGF1_uc001tjo.2_Missense_Mutation_p.L112P	NM_001111285	NP_001104755	P05019	IGF1_HUMAN	insulin-like growth factor 1 isoform 3	112	D.				anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2						GGCAGGCTTGAGGGGTGCGCA	0.617																0.042254	-9.125092	6.83692	3	68	KEEP	---	---	---	---	1	2	39	38	-1	capture	Missense_Mutation	SNP	102813354	102813354	IGF1	12	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	7495	120
RASAL1	8437	broad.mit.edu	37	12	113565893	113565893	+	Nonsense_Mutation	SNP	G	C	C			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113565893G>C	uc001tum.1	-	4	506	c.213C>G	c.(211-213)TAC>TAG	p.Y71*	RASAL1_uc010syp.1_Nonsense_Mutation_p.Y71*|RASAL1_uc001tul.2_Nonsense_Mutation_p.Y71*|RASAL1_uc001tun.1_Nonsense_Mutation_p.Y71*|RASAL1_uc010syq.1_Nonsense_Mutation_p.Y71*|RASAL1_uc001tuo.3_Nonsense_Mutation_p.Y71*|RASAL1_uc010syr.1_Nonsense_Mutation_p.Y71*	NM_004658	NP_004649	O95294	RASL1_HUMAN	RAS protein activator like 1	71	C2 1.				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	metal ion binding|phospholipid binding|Ras GTPase activator activity			ovary(2)|skin(2)	4						CATCCAGCACGTAGAAGGCCA	0.607																0.037383	-57.770255	41.388042	16	412	KEEP	---	---	---	---	4	15	285	267	-1	capture	Nonsense_Mutation	SNP	113565893	113565893	RASAL1	12	G	C	C	C	1	0	0	0	0	0	1	0	0	516	40	5	4	12958	120
RB1	5925	broad.mit.edu	37	13	49033844	49033844	+	Missense_Mutation	SNP	C	T	T	rs137853294		TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49033844C>T	uc001vcb.2	+	20	2147	c.1981C>T	c.(1981-1983)CGG>TGG	p.R661W		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	661	Pocket; binds T and E1A.|Domain B.		R -> W (in RB; mild form).		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)|p.L660fs*2(3)|p.R661W(3)|p.R661fs*1(1)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AGCCTATCTCCGGCTAAATAC	0.383			6	p.R661W(HEC6-Tumor)	568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.333333	89.24935	91.387929	29	58	KEEP	---	---	---	---	12	23	31	44	-1	capture	Missense_Mutation	SNP	49033844	49033844	RB1	13	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	12993	120
OR10G2	26534	broad.mit.edu	37	14	22102746	22102746	+	Missense_Mutation	SNP	G	A	A	rs141025992	byFrequency	TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:22102746G>A	uc010tmc.1	-	1	253	c.253C>T	c.(253-255)CGG>TGG	p.R85W		NM_001005466	NP_001005466	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		AAAATAAGCCGAGGAACGGTG	0.527																0.460674	131.569441	131.688889	41	48	KEEP	---	---	---	---	23	22	20	33	-1	capture	Missense_Mutation	SNP	22102746	22102746	OR10G2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	10803	120
EAPP	55837	broad.mit.edu	37	14	35005432	35005432	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:35005432G>A	uc001wsd.1	-	2	233	c.124C>T	c.(124-126)CGA>TGA	p.R42*		NM_018453	NP_060923	Q56P03	EAPP_HUMAN	E2F-associated phosphoprotein	42					negative regulation of transcription elongation from RNA polymerase II promoter|positive regulation of cell proliferation|positive regulation of transcription elongation from RNA polymerase II promoter	Golgi apparatus|nucleus|plasma membrane				ovary(1)	1	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)		ATGAGTTTTCGTTTTTGGTCA	0.318																0.368421	104.698574	106.144974	35	60	KEEP	---	---	---	---	22	23	35	40	-1	capture	Nonsense_Mutation	SNP	35005432	35005432	EAPP	14	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	4832	120
C14orf49	161176	broad.mit.edu	37	14	95899695	95899695	+	Missense_Mutation	SNP	G	A	A	rs141951711		TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95899695G>A	uc001yei.3	-	15	2605	c.2590C>T	c.(2590-2592)CGT>TGT	p.R864C	C14orf49_uc010avi.2_Missense_Mutation_p.R859C	NM_152592	NP_689805	Q6ZMZ3	SYNE3_HUMAN	nesprin-3	864	Cytoplasmic (Potential).				cytoskeletal anchoring at nuclear membrane	integral to membrane|nuclear outer membrane|SUN-KASH complex	actin binding			central_nervous_system(1)	1		all_cancers(154;0.0937)		COAD - Colon adenocarcinoma(157;0.245)		GGCCCGAGACGAAGGAGGTTC	0.597																0.385714	246.123495	248.527979	81	129	KEEP	---	---	---	---	50	44	79	61	-1	capture	Missense_Mutation	SNP	95899695	95899695	C14orf49	14	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1762	120
ARIH1	25820	broad.mit.edu	37	15	72767077	72767077	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:72767077G>A	uc002aut.3	+	1	411	c.97G>A	c.(97-99)GAC>AAC	p.D33N		NM_005744	NP_005735	Q9Y4X5	ARI1_HUMAN	ariadne ubiquitin-conjugating enzyme E2 binding	33	Asp/Glu-rich (acidic).				ubiquitin-dependent protein catabolic process	cytoplasm|ubiquitin ligase complex	ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding				0						cgaagacgacgacgaGCCGGA	0.393																0.769231	69.51356	71.241773	20	6	KEEP	---	---	---	---	13	13	2	4	-1	capture	Missense_Mutation	SNP	72767077	72767077	ARIH1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	916	120
ACSM2A	123876	broad.mit.edu	37	16	20492162	20492162	+	Silent	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20492162G>A	uc010bwe.2	+	13	1667	c.1428G>A	c.(1426-1428)TCG>TCA	p.S476S	ACSM2A_uc010vax.1_Silent_p.S397S|ACSM2A_uc002dhf.3_Silent_p.S476S|ACSM2A_uc002dhg.3_Silent_p.S476S|ACSM2A_uc010vay.1_Silent_p.S397S|ACSM2A_uc002dhh.3_Silent_p.S106S	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	476					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						TTGGACCCTCGGAGGTAGAGA	0.567																0.346774	132.492999	135.060609	43	81	KEEP	---	---	---	---	28	18	62	45	-1	capture	Silent	SNP	20492162	20492162	ACSM2A	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	183	120
HS3ST4	9951	broad.mit.edu	37	16	26147419	26147419	+	Silent	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:26147419G>A	uc002dof.2	+	2	1613	c.1221G>A	c.(1219-1221)AGG>AGA	p.R407R		NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl	407	Lumenal (Potential).				heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		GTGCCCCGAGGTGCTTAGGCA	0.473																0.285714	27.837597	29.278514	10	25	KEEP	---	---	---	---	7	4	12	16	-1	capture	Silent	SNP	26147419	26147419	HS3ST4	16	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	7292	120
SEZ6L2	26470	broad.mit.edu	37	16	29897033	29897033	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29897033C>T	uc002duq.3	-	8	1486	c.1246G>A	c.(1246-1248)GTG>ATG	p.V416M	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Missense_Mutation_p.V346M|SEZ6L2_uc002dur.3_Missense_Mutation_p.V346M|SEZ6L2_uc002dus.3_Missense_Mutation_p.V302M|SEZ6L2_uc010vec.1_Missense_Mutation_p.V416M|SEZ6L2_uc010ved.1_Missense_Mutation_p.V372M	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform	416	CUB 2.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						TCATAGATCACGGGGGATAGG	0.612																0.444444	138.490481	138.756109	44	55	KEEP	---	---	---	---	26	23	27	32	-1	capture	Missense_Mutation	SNP	29897033	29897033	SEZ6L2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14037	120
LONP2	83752	broad.mit.edu	37	16	48303999	48303999	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:48303999G>A	uc002efi.1	+	7	1144	c.1055G>A	c.(1054-1056)AGA>AAA	p.R352K	LONP2_uc010vgm.1_RNA|LONP2_uc002efj.1_Missense_Mutation_p.R308K	NM_031490	NP_113678	Q86WA8	LONP2_HUMAN	peroxisomal LON protease-like	352					misfolded or incompletely synthesized protein catabolic process|protein targeting to peroxisome|signal peptide processing	nucleoid|peroxisomal matrix	ATP binding|ATP-dependent peptidase activity|enzyme binding|sequence-specific DNA binding|serine-type endopeptidase activity				0						TTGAAGAAAAGAGTACTGGAA	0.443																0.05	-10.114506	11.368406	5	95	KEEP	---	---	---	---	3	3	49	51	-1	capture	Missense_Mutation	SNP	48303999	48303999	LONP2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	8810	120
PMFBP1	83449	broad.mit.edu	37	16	72184650	72184650	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:72184650C>T	uc002fcc.3	-	5	665	c.493G>A	c.(493-495)GCC>ACC	p.A165T	PMFBP1_uc002fcd.2_Missense_Mutation_p.A165T|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Missense_Mutation_p.A20T	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	165	Potential.									ovary(2)	2		Ovarian(137;0.179)				CCGGCCAAGGCGAGTTGCTCC	0.493																0.411043	199.894362	201.02097	67	96	KEEP	---	---	---	---	44	34	53	62	-1	capture	Missense_Mutation	SNP	72184650	72184650	PMFBP1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12037	120
TP53	7157	broad.mit.edu	37	17	7578440	7578440	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578440T>C	uc002gim.2	-	5	684	c.490A>G	c.(490-492)AAG>GAG	p.K164E	TP53_uc002gig.1_Missense_Mutation_p.K164E|TP53_uc002gih.2_Missense_Mutation_p.K164E|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.K32E|TP53_uc010cng.1_Missense_Mutation_p.K32E|TP53_uc002gii.1_Missense_Mutation_p.K32E|TP53_uc010cnh.1_Missense_Mutation_p.K164E|TP53_uc010cni.1_Missense_Mutation_p.K164E|TP53_uc002gij.2_Missense_Mutation_p.K164E|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.K71E|TP53_uc002gio.2_Missense_Mutation_p.K32E|TP53_uc010vug.1_Missense_Mutation_p.K125E	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	164	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		K -> E (in sporadic cancers; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation).|K -> M (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.K164E(12)|p.K164*(9)|p.0?(7)|p.K164N(6)|p.K164M(4)|p.K164K(2)|p.K164fs*5(2)|p.K164Q(2)|p.K164fs*6(2)|p.K164fs*3(2)|p.K164T(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.Y163fs*1(1)|p.Y163_Q165delYKQ(1)|p.P151_V173del23(1)|p.S149fs*72(1)|p.K164_Q165insXXX(1)|p.K164fs*17(1)|p.K164R(1)|p.Y163fs*14(1)|p.A159_Q167delAMAIYKQSQ(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TGTGACTGCTTGTAGATGGCC	0.627	Pancreas(47;798 1329 9957 10801)		111	p.K164*(SNU387-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.696429	133.244186	135.171829	39	17	KEEP	---	---	---	---	26	21	7	12	-1	capture	Missense_Mutation	SNP	7578440	7578440	TP53	17	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	16264	120
MYOCD	93649	broad.mit.edu	37	17	12655804	12655804	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:12655804G>A	uc002gnn.2	+	10	1498	c.1199G>A	c.(1198-1200)CGG>CAG	p.R400Q	MYOCD_uc002gno.2_Missense_Mutation_p.R400Q|MYOCD_uc002gnp.1_Missense_Mutation_p.R304Q|MYOCD_uc002gnq.2_Missense_Mutation_p.R119Q	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	400	SAP.				cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CTCATGGACCGGCTTCGACCC	0.507																0.058824	-3.217738	7.178099	3	48	KEEP	---	---	---	---	1	2	29	27	-1	capture	Missense_Mutation	SNP	12655804	12655804	MYOCD	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9997	120
KRT12	3859	broad.mit.edu	37	17	39019850	39019850	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39019850G>A	uc002hvk.2	-	5	1006	c.982C>T	c.(982-984)CGT>TGT	p.R328C		NM_000223	NP_000214	Q99456	K1C12_HUMAN	keratin 12	328	Rod.|Coil 2.				visual perception	intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)				ATCTCCTTACGGAGCTCCCCG	0.567																0.581081	146.737498	147.162378	43	31	KEEP	---	---	---	---	21	30	18	17	-1	capture	Missense_Mutation	SNP	39019850	39019850	KRT12	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8369	120
COL1A1	1277	broad.mit.edu	37	17	48275131	48275131	+	Nonsense_Mutation	SNP	G	A	A	rs72667036		TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48275131G>A	uc002iqm.2	-	9	784	c.658C>T	c.(658-660)CGA>TGA	p.R220*		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	220	Triple-helical region.				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding	p.R220*(1)	COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	GGGGGACCTCGGGGACCCATG	0.507					504	T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						0.368	452.687554	458.417256	138	237	KEEP	---	---	---	---	70	89	133	143	-1	capture	Nonsense_Mutation	SNP	48275131	48275131	COL1A1	17	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	3642	120
ABCA6	23460	broad.mit.edu	37	17	67098976	67098976	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67098976C>A	uc002jhw.1	-	21	3049	c.2874G>T	c.(2872-2874)AAG>AAT	p.K958N		NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	958					transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					GCAAACATACCTTTTGTTTAC	0.313																0.411111	114.355301	114.977301	37	53	KEEP	---	---	---	---	17	26	24	38	0.604651162791	capture	Missense_Mutation	SNP	67098976	67098976	ABCA6	17	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	36	120
SDK2	54549	broad.mit.edu	37	17	71426663	71426663	+	Nonsense_Mutation	SNP	G	A	A	rs147877604		TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:71426663G>A	uc010dfm.2	-	12	1570	c.1570C>T	c.(1570-1572)CGA>TGA	p.R524*	SDK2_uc010dfn.2_Nonsense_Mutation_p.R203*	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	524	Extracellular (Potential).|Ig-like C2-type 6.				cell adhesion	integral to membrane				ovary(2)	2						ATGGTTACTCGGGGGTCGTGG	0.602																0.056604	-3.996188	6.928461	3	50	KEEP	---	---	---	---	1	3	30	31	-1	capture	Nonsense_Mutation	SNP	71426663	71426663	SDK2	17	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	13862	120
CELF4	56853	broad.mit.edu	37	18	34853005	34853005	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:34853005G>A	uc002lae.2	-	7	1319	c.923C>T	c.(922-924)GCG>GTG	p.A308V	CELF4_uc010dnd.1_Missense_Mutation_p.A306V|CELF4_uc002lag.2_Missense_Mutation_p.A298V|CELF4_uc002laf.2_Missense_Mutation_p.A303V|CELF4_uc002lai.2_Missense_Mutation_p.A293V|CELF4_uc002lah.1_Missense_Mutation_p.A33V|CELF4_uc002laj.1_Silent_p.G143G	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1	308	Ala-rich.				embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding	p.A308V(1)		ovary(2)	2						AGGTGCGGCCGCCAGGCCATT	0.652																0.357143	71.874738	73.124519	25	45	KEEP	---	---	---	---	15	17	22	31	-1	capture	Missense_Mutation	SNP	34853005	34853005	CELF4	18	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3186	120
MUC16	94025	broad.mit.edu	37	19	9067037	9067037	+	Silent	SNP	A	G	G			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9067037A>G	uc002mkp.2	-	3	20613	c.20409T>C	c.(20407-20409)TCT>TCC	p.S6803S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6805	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GCATCAGGGAAGAGGAGAAGC	0.473																0.038462	-17.242516	12.683983	5	125	KEEP	---	---	---	---	3	2	62	79	-1	capture	Silent	SNP	9067037	9067037	MUC16	19	A	G	G	G	1	0	0	0	0	0	0	0	1	28	3	3	3	9883	120
GLT25D1	79709	broad.mit.edu	37	19	17679388	17679388	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17679388C>T	uc002nhc.1	+	5	707	c.695C>T	c.(694-696)CCC>CTC	p.P232L	GLT25D1_uc010eax.1_5'UTR	NM_024656	NP_078932	Q8NBJ5	GT251_HUMAN	glycosyltransferase 25 domain containing 1	232					lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity				0						TTTGCAGTTCCCATGGTGCAC	0.617																0.241379	76.945137	84.020332	28	88	KEEP	---	---	---	---	16	15	51	47	-1	capture	Missense_Mutation	SNP	17679388	17679388	GLT25D1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	6402	120
RSPH6A	81492	broad.mit.edu	37	19	46318327	46318327	+	Silent	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46318327C>T	uc002pdm.2	-	1	251	c.108G>A	c.(106-108)CTG>CTA	p.L36L		NM_030785	NP_110412	Q9H0K4	RSH6A_HUMAN	radial spokehead-like 1	36						intracellular				ovary(1)|central_nervous_system(1)	2						GGTCCGCTGCCAGGGCCTGAG	0.687																0.511628	134.084227	134.093891	44	42	KEEP	---	---	---	---	34	21	27	28	-1	capture	Silent	SNP	46318327	46318327	RSPH6A	19	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	13599	120
SHANK1	50944	broad.mit.edu	37	19	51205808	51205808	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51205808G>A	uc002psx.1	-	11	1682	c.1663C>T	c.(1663-1665)CCC>TCC	p.P555S		NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	555	SH3.				cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GAGCGTCCGGGTACCGCTGAG	0.697																0.5	23.198166	23.198166	8	8	KEEP	---	---	---	---	9	4	1	12	-1	capture	Missense_Mutation	SNP	51205808	51205808	SHANK1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	14157	120
GPR32	2854	broad.mit.edu	37	19	51274077	51274077	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51274077C>T	uc010ycf.1	+	1	220	c.220C>T	c.(220-222)CGC>TGC	p.R74C		NM_001506	NP_001497	O75388	GPR32_HUMAN	G protein-coupled receptor 32	74	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CCGTATGGCACGCACGGTCTC	0.572	Esophageal Squamous(113;152 1581 5732 15840 44398)															0.45283	147.476047	147.682237	48	58	KEEP	---	---	---	---	27	24	25	36	-1	capture	Missense_Mutation	SNP	51274077	51274077	GPR32	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6622	120
SBK2	646643	broad.mit.edu	37	19	56047417	56047417	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56047417C>T	uc010ygc.1	-	1	245	c.245G>A	c.(244-246)CGT>CAT	p.R82H		NM_001101401	NP_001094871	P0C263	SBK2_HUMAN	SH3-binding domain kinase family, member 2	82	Protein kinase.						ATP binding|protein serine/threonine kinase activity				0						ACCTTTCTGACGATGGGTGAC	0.572					53											0.111111	5.642201	12.370428	5	40	KEEP	---	---	---	---	3	3	15	27	-1	capture	Missense_Mutation	SNP	56047417	56047417	SBK2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13753	120
ANKRD36	375248	broad.mit.edu	37	2	97869931	97869931	+	Missense_Mutation	SNP	A	T	T	rs76309140		TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:97869931A>T	uc010yva.1	+	50	3236	c.2992A>T	c.(2992-2994)ACA>TCA	p.T998S	ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	998											0						CATTCAGGCTACAAGTGATGA	0.289																0.181818	13.930422	17.06841	6	27	KEEP	---	---	---	---	6	3	18	13	-1	capture	Missense_Mutation	SNP	97869931	97869931	ANKRD36	2	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	661	120
MCM6	4175	broad.mit.edu	37	2	136630288	136630288	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:136630288G>C	uc002tuw.2	-	2	309	c.233C>G	c.(232-234)ACC>AGC	p.T78S		NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	78					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	CTCTTGAATGGTGGTGGAAAG	0.413	Ovarian(196;141 2104 8848 24991 25939)															0.027473	-33.190116	11.642638	5	177	KEEP	---	---	---	---	2	3	91	113	-1	capture	Missense_Mutation	SNP	136630288	136630288	MCM6	2	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	9304	120
HCK	3055	broad.mit.edu	37	20	30672225	30672225	+	Silent	SNP	G	A	A	rs147876395		TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30672225G>A	uc002wxh.2	+	8	885	c.714G>A	c.(712-714)TCG>TCA	p.S238S	HCK_uc010gdy.2_Silent_p.S217S|HCK_uc002wxi.2_Silent_p.S216S	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	238	SH2.				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding	p.S217S(1)		lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AGAAACTGTCGGTGCCCTGCA	0.587					262											0.478261	108.674528	108.702651	33	36	KEEP	---	---	---	---	16	18	21	18	-1	capture	Silent	SNP	30672225	30672225	HCK	20	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6920	120
RIMBP3	85376	broad.mit.edu	37	22	20458191	20458191	+	Silent	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:20458191G>A	uc002zsd.3	-	1	3596	c.3111C>T	c.(3109-3111)GGC>GGT	p.G1037G		NM_015672	NP_056487			RIMS binding protein 3												0	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			AGCAGCTCACGCCCGCTGGGG	0.642																0.181818	7.598723	9.682219	4	18	KEEP	---	---	---	---	7	3	13	13	-1	capture	Silent	SNP	20458191	20458191	RIMBP3	22	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13256	120
CSF2RB	1439	broad.mit.edu	37	22	37326752	37326752	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37326752G>A	uc003aqa.3	+	8	1109	c.892G>A	c.(892-894)GGC>AGC	p.G298S	CSF2RB_uc003aqc.3_Missense_Mutation_p.G304S	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta	298	Extracellular (Potential).				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)	GGAGGGGCTCGGCAGCCTCCA	0.647																0.62963	114.269157	115.07051	34	20	KEEP	---	---	---	---	18	18	14	21	-1	capture	Missense_Mutation	SNP	37326752	37326752	CSF2RB	22	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3900	120
SCN10A	6336	broad.mit.edu	37	3	38755494	38755494	+	Silent	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38755494G>A	uc003ciq.2	-	21	3759	c.3759C>T	c.(3757-3759)CGC>CGT	p.R1253R		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	1253	III.|Helical; Voltage-sensor; Name=S4 of repeat III; (Potential).				sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	GCCGCAGAGCGCGAAGGGTTC	0.443																0.309392	154.444814	160.297614	56	125	KEEP	---	---	---	---	26	42	61	84	-1	capture	Silent	SNP	38755494	38755494	SCN10A	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13805	120
ETV5	2119	broad.mit.edu	37	3	185823619	185823619	+	Silent	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:185823619G>A	uc003fpz.2	-	2	286	c.39C>T	c.(37-39)GTC>GTT	p.V13V	ETV5_uc003fpy.2_Silent_p.V55V	NM_004454	NP_004445	P41161	ETV5_HUMAN	ets variant gene 5 (ets-related molecule)	13					cellular response to oxidative stress	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|skin(2)|breast(1)	5	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			TTACCCCTGGGACCATAAAAG	0.453					170	T	TMPRSS2|SCL45A3	Prostate 								0.37931	67.338824	68.078993	22	36	KEEP	---	---	---	---	10	13	20	18	-1	capture	Silent	SNP	185823619	185823619	ETV5	3	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	5237	120
TACC3	10460	broad.mit.edu	37	4	1725208	1725208	+	Silent	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1725208C>T	uc003gdo.2	+	2	168	c.60C>T	c.(58-60)TGC>TGT	p.C20C	TMEM129_uc003gdn.2_5'Flank|TMEM129_uc003gdm.2_5'Flank|TACC3_uc010ibz.2_Silent_p.C20C|TACC3_uc003gdp.2_Silent_p.C20C	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing	20						centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			CAGAAAATTGCGACTTCCTGT	0.433	Ovarian(120;482 2294 11894 35824)				480											0.068182	-1.711345	6.777302	3	41	KEEP	---	---	---	---	2	1	19	31	-1	capture	Silent	SNP	1725208	1725208	TACC3	4	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	15391	120
TBC1D9	23158	broad.mit.edu	37	4	141580777	141580777	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:141580777C>T	uc010ioj.2	-	11	2158	c.1886G>A	c.(1885-1887)CGC>CAC	p.R629H		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	629	Rab-GAP TBC.					intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TGGGAGCATGCGCTCACACAA	0.448																0.411765	21.124223	21.239129	7	10	KEEP	---	---	---	---	5	2	8	3	-1	capture	Missense_Mutation	SNP	141580777	141580777	TBC1D9	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15514	120
GRIA2	2891	broad.mit.edu	37	4	158284178	158284178	+	Silent	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:158284178C>T	uc003ipm.3	+	15	3093	c.2634C>T	c.(2632-2634)ATC>ATT	p.I878I	GRIA2_uc011cit.1_Silent_p.I831I|GRIA2_uc003ipl.3_Silent_p.I878I|GRIA2_uc003ipk.3_Silent_p.I831I|GRIA2_uc011civ.1_RNA|GRIA2_uc011ciw.1_RNA|GRIA2_uc011cix.1_3'UTR|GRIA2_uc011ciy.1_3'UTR|GRIA2_uc011ciz.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	878	Cytoplasmic (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity	p.I878I(1)		central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	TATATGGCATCGAAAGTGTTA	0.378																0.250909	186.242238	201.746343	69	206	KEEP	---	---	---	---	41	42	118	126	-1	capture	Silent	SNP	158284178	158284178	GRIA2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	6701	120
DNAH5	1767	broad.mit.edu	37	5	13753418	13753418	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13753418C>G	uc003jfd.2	-	63	10838	c.10796G>C	c.(10795-10797)CGT>CCT	p.R3599P	DNAH5_uc003jfc.2_5'UTR	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3599	AAA 5 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CAAAGGGTAACGAGATGCCTT	0.368												Kartagener_syndrome				0.358209	170.462177	172.83498	48	86	KEEP	---	---	---	---	33	16	41	57	-1	capture	Missense_Mutation	SNP	13753418	13753418	DNAH5	5	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	4561	120
RNASEN	29102	broad.mit.edu	37	5	31468080	31468080	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:31468080G>A	uc003jhg.2	-	17	2691	c.2332C>T	c.(2332-2334)CGC>TGC	p.R778C	RNASEN_uc003jhh.2_Missense_Mutation_p.R741C|RNASEN_uc003jhi.2_Missense_Mutation_p.R741C	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1	778	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						TGTGCAGGGCGTATCCCAAAG	0.438																0.413793	37.795843	37.983777	12	17	KEEP	---	---	---	---	6	7	8	10	-1	capture	Missense_Mutation	SNP	31468080	31468080	RNASEN	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13309	120
MAP3K1	4214	broad.mit.edu	37	5	56160697	56160697	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:56160697C>T	uc003jqw.3	+	4	1472	c.971C>T	c.(970-972)CCT>CTT	p.P324L		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	324					cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CAGATAGGGCCTAACTCTTTC	0.468					201											0.336364	117.048137	119.650335	37	73	KEEP	---	---	---	---	16	24	44	42	-1	capture	Missense_Mutation	SNP	56160697	56160697	MAP3K1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	9157	120
GRAMD3	65983	broad.mit.edu	37	5	125821443	125821443	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:125821443A>T	uc003ktu.2	+	11	1466	c.1036A>T	c.(1036-1038)ATT>TTT	p.I346F	GRAMD3_uc011cwt.1_Missense_Mutation_p.I361F|GRAMD3_uc011cwv.1_Missense_Mutation_p.I354F|GRAMD3_uc011cww.1_Missense_Mutation_p.I242F|GRAMD3_uc011cwx.1_RNA|GRAMD3_uc011cwy.1_Missense_Mutation_p.I237F|GRAMD3_uc011cwz.1_Missense_Mutation_p.I330F	NM_023927	NP_076416	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3 isoform 2	346										central_nervous_system(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		GCTTCACCATATTCTTATATT	0.348																0.361905	122.32948	124.088326	38	67	KEEP	---	---	---	---	24	21	39	39	-1	capture	Missense_Mutation	SNP	125821443	125821443	GRAMD3	5	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	6684	120
PCDHA10	56139	broad.mit.edu	37	5	140236992	140236992	+	Silent	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140236992G>A	uc003lhx.2	+	1	1359	c.1359G>A	c.(1357-1359)GCG>GCA	p.A453A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Silent_p.A453A|PCDHA10_uc011dad.1_Silent_p.A453A	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	453	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding	p.A453A(2)		ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGCGCCTGCGTTCGCGCAGT	0.677																0.403727	187.142095	188.446279	65	96	KEEP	---	---	---	---	33	43	56	55	-1	capture	Silent	SNP	140236992	140236992	PCDHA10	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11423	120
PCDHB2	56133	broad.mit.edu	37	5	140475875	140475875	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140475875C>A	uc003lil.2	+	1	1639	c.1501C>A	c.(1501-1503)CCC>ACC	p.P501T	PCDHB2_uc003lim.1_Missense_Mutation_p.P162T	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	501	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCGCACCTGCCCCTCGCCTC	0.692																0.427419	143.824295	144.39864	53	71	KEEP	---	---	---	---	36	40	69	111	0.526315789474	capture	Missense_Mutation	SNP	140475875	140475875	PCDHB2	5	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	11445	120
GPR116	221395	broad.mit.edu	37	6	46856078	46856078	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46856078T>C	uc003oyo.3	-	4	611	c.322A>G	c.(322-324)ACA>GCA	p.T108A	GPR116_uc003oyp.3_Missense_Mutation_p.T108A|GPR116_uc003oyq.3_Missense_Mutation_p.T108A|GPR116_uc003oyr.2_Missense_Mutation_p.T108A	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	108	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			TCACCTGTTGTCACATTTATG	0.403	NSCLC(59;410 1274 8751 36715 50546)															0.353383	167.792804	170.310611	47	86	KEEP	---	---	---	---	25	32	51	48	-1	capture	Missense_Mutation	SNP	46856078	46856078	GPR116	6	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	6567	120
HTR1E	3354	broad.mit.edu	37	6	87725312	87725312	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:87725312G>A	uc003pli.2	+	2	963	c.260G>A	c.(259-261)CGC>CAC	p.R87H		NM_000865	NP_000856	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E	87	Extracellular (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity			ovary(2)|skin(1)	3		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Eletriptan(DB00216)	GTCATGGATCGCTGGAAGCTT	0.572																0.433333	286.199991	287.012446	91	119	KEEP	---	---	---	---	54	56	72	85	-1	capture	Missense_Mutation	SNP	87725312	87725312	HTR1E	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7364	120
SDK1	221935	broad.mit.edu	37	7	4169639	4169639	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4169639G>A	uc003smx.2	+	27	4178	c.4039G>A	c.(4039-4041)GTG>ATG	p.V1347M	SDK1_uc010kso.2_Missense_Mutation_p.V623M|SDK1_uc003smy.2_Translation_Start_Site	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1347	Fibronectin type-III 7.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GCGCAAGTTCGTGCTCTACGA	0.657																0.245283	64.099798	70.362325	26	80	KEEP	---	---	---	---	12	16	48	38	-1	capture	Missense_Mutation	SNP	4169639	4169639	SDK1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13861	120
SKAP2	8935	broad.mit.edu	37	7	26778465	26778465	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:26778465G>A	uc003syc.2	-	6	711	c.418C>T	c.(418-420)CGG>TGG	p.R140W	SKAP2_uc011jzi.1_Translation_Start_Site|SKAP2_uc011jzj.1_Missense_Mutation_p.R125W	NM_003930	NP_003921	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	140	PH.				B cell activation|cell junction assembly|protein complex assembly|signal transduction	cytosol|plasma membrane	SH3/SH2 adaptor activity			pancreas(1)	1						GCACACCACCGTTTCTGCCAT	0.274																0.25	110.293993	119.612051	41	123	KEEP	---	---	---	---	24	26	81	70	-1	capture	Missense_Mutation	SNP	26778465	26778465	SKAP2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	14249	120
ZPBP	11055	broad.mit.edu	37	7	50097662	50097662	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50097662A>G	uc003tou.2	-	4	480	c.410T>C	c.(409-411)ATT>ACT	p.I137T	ZPBP_uc011kci.1_Missense_Mutation_p.I63T|ZPBP_uc010kyw.2_Missense_Mutation_p.I136T	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1	137					binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					ACATGTATAAATTCCACTCAT	0.333																0.229167	106.202194	115.884703	33	111	KEEP	---	---	---	---	17	16	68	61	-1	capture	Missense_Mutation	SNP	50097662	50097662	ZPBP	7	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	18095	120
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.152505	214.967759	321.123805	140	778	KEEP	---	---	---	---	59	69	450	421	0.4609375	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	120
PTPN12	5782	broad.mit.edu	37	7	77256938	77256938	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:77256938A>G	uc003ugh.2	+	13	2033	c.1942A>G	c.(1942-1944)ATG>GTG	p.M648V	PTPN12_uc011kgp.1_Missense_Mutation_p.M529V|PTPN12_uc011kgq.1_Missense_Mutation_p.M518V|PTPN12_uc010lds.2_Missense_Mutation_p.M380V	NM_002835	NP_002826	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type	648						soluble fraction	non-membrane spanning protein tyrosine phosphatase activity|SH3 domain binding			ovary(1)|breast(1)|pancreas(1)	3						AGTATTGCCAATGTCCATTGC	0.313																0.261682	90.053755	95.550239	28	79	KEEP	---	---	---	---	22	11	49	44	-1	capture	Missense_Mutation	SNP	77256938	77256938	PTPN12	7	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	12676	120
PAX4	5078	broad.mit.edu	37	7	127254980	127254980	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:127254980C>T	uc010lld.1	-	2	496	c.290G>A	c.(289-291)CGC>CAC	p.R97H	PAX4_uc003vmf.2_Missense_Mutation_p.R95H|PAX4_uc003vmg.1_Missense_Mutation_p.R97H|PAX4_uc003vmh.2_Missense_Mutation_p.R95H	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4	105	Paired.				cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						ACAAAGCTGGCGTTGGATTTC	0.592	Ovarian(113;737 1605 7858 27720 34092)															0.263473	109.135042	117.577486	44	123	KEEP	---	---	---	---	21	29	70	59	-1	capture	Missense_Mutation	SNP	127254980	127254980	PAX4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11384	120
PLXNA4	91584	broad.mit.edu	37	7	131872333	131872333	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131872333C>T	uc003vra.3	-	15	3119	c.2890G>A	c.(2890-2892)GGG>AGG	p.G964R		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	964	IPT/TIG 2.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						GACATGGGCCCCCGGCTGGGC	0.587																0.21203	352.128299	403.09061	141	524	KEEP	---	---	---	---	75	88	317	291	-1	capture	Missense_Mutation	SNP	131872333	131872333	PLXNA4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	12025	120
DENND2A	27147	broad.mit.edu	37	7	140301257	140301257	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140301257G>A	uc010lnj.2	-	1	1086	c.941C>T	c.(940-942)TCC>TTC	p.S314F	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Missense_Mutation_p.S314F|DENND2A_uc003vvw.2_Missense_Mutation_p.S314F|DENND2A_uc003vvx.2_Missense_Mutation_p.S314F	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	314										ovary(3)|breast(1)	4	Melanoma(164;0.00956)					GTTCACagaggaaggtggggg	0.393																0.025806	-30.244839	8.34658	4	151	KEEP	---	---	---	---	3	2	102	110	-1	capture	Missense_Mutation	SNP	140301257	140301257	DENND2A	7	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	4387	120
ODF2	4957	broad.mit.edu	37	9	131233667	131233667	+	Silent	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:131233667C>T	uc011mbd.1	+	6	812	c.501C>T	c.(499-501)CAC>CAT	p.H167H	ODF2_uc011maz.1_Silent_p.H167H|ODF2_uc011mba.1_Intron|ODF2_uc010myb.2_Silent_p.H143H|ODF2_uc011mbb.1_Silent_p.H101H|ODF2_uc011mbc.1_Silent_p.H86H|ODF2_uc004bva.2_Silent_p.H120H|ODF2_uc004bvb.2_Silent_p.H143H|ODF2_uc011mbe.1_Silent_p.H162H|ODF2_uc004bvc.2_Silent_p.H143H|ODF2_uc010myc.2_Silent_p.H110H|ODF2_uc011mbf.1_Silent_p.H148H|ODF2_uc004bvd.3_Silent_p.H167H|ODF2_uc004bve.2_Silent_p.H148H	NM_002540	NP_002531	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2 isoform 1	167	Potential.				cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity			ovary(1)	1						AGGTGGCCCACGAACTGGCTG	0.577																0.106796	21.398263	53.010963	22	184	KEEP	---	---	---	---	12	12	99	117	-1	capture	Silent	SNP	131233667	131233667	ODF2	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10732	120
PRDM12	59335	broad.mit.edu	37	9	133540113	133540113	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133540113G>A	uc004bzt.1	+	1	133	c.73G>A	c.(73-75)GCC>ACC	p.A25T		NM_021619	NP_067632	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	25					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		ACTGGCGCTGGCCGAGGTTAT	0.577																0.521739	74.798562	74.817296	24	22	KEEP	---	---	---	---	14	15	11	16	-1	capture	Missense_Mutation	SNP	133540113	133540113	PRDM12	9	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12349	120
PRDM12	59335	broad.mit.edu	37	9	133540124	133540124	+	Silent	SNP	C	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133540124C>T	uc004bzt.1	+	1	144	c.84C>T	c.(82-84)ATC>ATT	p.I28I		NM_021619	NP_067632	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	28					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		CCGAGGTTATCACCTCCGACA	0.612																0.512821	61.898753	61.904271	20	19	KEEP	---	---	---	---	11	12	10	11	-1	capture	Silent	SNP	133540124	133540124	PRDM12	9	C	T	T	T	1	0	0	0	0	0	0	0	1	369	29	2	2	12349	120
KIAA0649	9858	broad.mit.edu	37	9	138379880	138379880	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138379880G>C	uc004cfr.1	+	4	4073	c.3524G>C	c.(3523-3525)AGG>ACG	p.R1175T		NM_014811	NP_055626	Q5T8A7	K0649_HUMAN	1A6/DRIM (down-regulated in metastasis)	1175						nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;6.91e-08)|Epithelial(140;4.69e-07)|all cancers(34;9.33e-06)		TATCGACGAAGGGTCAACAGG	0.607																0.163265	14.675342	19.951519	8	41	KEEP	---	---	---	---	3	5	22	21	-1	capture	Missense_Mutation	SNP	138379880	138379880	KIAA0649	9	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	8109	120
KLHL4	56062	broad.mit.edu	37	X	86887278	86887278	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:86887278C>A	uc004efb.2	+	7	1575	c.1393C>A	c.(1393-1395)CGT>AGT	p.R465S	KLHL4_uc004efa.2_Missense_Mutation_p.R465S	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1	465	Kelch 1.					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						CATGAATGGCCGTAGGCTTCA	0.393																0.759259	151.603503	154.915291	41	13	KEEP	---	---	---	---	20	25	9	9	0.555555555556	capture	Missense_Mutation	SNP	86887278	86887278	KLHL4	23	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	8311	120
MAGEC2	51438	broad.mit.edu	37	X	141291741	141291741	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:141291741G>T	uc004fbu.1	-	3	381	c.33C>A	c.(31-33)AAC>AAA	p.N11K		NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	11						cytoplasm|nucleus				breast(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CGTTGTCAACGTTGCGGAATG	0.537													HNSCC(46;0.14)			0.821429	592.091304	611.150499	161	35	KEEP	---	---	---	---	82	103	20	21	0.443243243243	capture	Missense_Mutation	SNP	141291741	141291741	MAGEC2	23	G	T	T	T	1	0	0	0	0	1	0	0	0	516	40	4	4	9095	120
CD99L2	83692	broad.mit.edu	37	X	149963729	149963729	+	Missense_Mutation	SNP	T	C	C			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:149963729T>C	uc004fel.2	-	6	498	c.380A>G	c.(379-381)GAT>GGT	p.D127G	CD99L2_uc004fek.2_RNA|CD99L2_uc004fem.2_Missense_Mutation_p.D78G|CD99L2_uc004fen.2_Missense_Mutation_p.D55G|CD99L2_uc004feo.2_RNA|CD99L2_uc011myb.1_Intron	NM_031462	NP_113650	Q8TCZ2	C99L2_HUMAN	CD99 antigen-like 2 isoform E3'-E4'-E3-E4	127	Extracellular (Potential).				cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ATCATTTCGATCATCCAGGGC	0.448																0.22179	167.64562	185.940012	57	200	KEEP	---	---	---	---	33	35	104	128	-1	capture	Missense_Mutation	SNP	149963729	149963729	CD99L2	23	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	3022	120
CDC27	996	broad.mit.edu	37	17	45219612	45219612	+	Frame_Shift_Del	DEL	A	-	-			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45219612delA	uc002ild.3	-	11	1488	c.1361delT	c.(1360-1362)CTAfs	p.L454fs	CDC27_uc002ile.3_Frame_Shift_Del_p.L460fs|CDC27_uc002ilf.3_Frame_Shift_Del_p.L454fs|CDC27_uc010wkp.1_Frame_Shift_Del_p.L393fs|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	454					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TGCTTTTTGTAGATTAAAGGC	0.308																0.11			10	77		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	45219612	45219612	CDC27	17	A	-	-	-	1	0	1	0	1	0	0	0	0	195	15	5	5	3037	120
TTYH1	57348	broad.mit.edu	37	19	54947301	54947304	+	Frame_Shift_Del	DEL	TCTA	-	-			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54947301_54947304delTCTA	uc002qfq.2	+	13	1437_1440	c.1345_1348delTCTA	c.(1345-1350)TCTATCfs	p.S449fs	TTYH1_uc010yey.1_3'UTR|TTYH1_uc002qfr.2_Frame_Shift_Del_p.R433fs|TTYH1_uc002qft.2_Frame_Shift_Del_p.S450fs	NM_020659	NP_065710	Q9H313	TTYH1_HUMAN	tweety 1 isoform 1	449_450	Cytoplasmic (Potential).				cell adhesion	chloride channel complex|plasma membrane	chloride channel activity|iron ion transmembrane transporter activity				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		GTGGCAGTCGTCTATCTGAGCCCC	0.632																0.37			106	181		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	54947301	54947304	TTYH1	19	TCTA	-	-	-	1	0	1	0	1	0	0	0	0	754	58	5	5	16621	120
SCN11A	11280	broad.mit.edu	37	3	38913127	38913128	+	Frame_Shift_Ins	INS	-	C	C			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38913127_38913128insC	uc011ays.1	-	21	3766_3767	c.3567_3568insG	c.(3565-3570)TGGCTCfs	p.W1189fs		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	1189_1190	Helical; Name=S5 of repeat III; (By similarity).|III.				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	CAAAATACGAGCCAGAAAATGA	0.361																0.23			20	66		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	38913127	38913128	SCN11A	3	-	C	C	C	1	0	1	1	0	0	0	0	0	442	34	5	5	13806	120
GNB4	59345	broad.mit.edu	37	3	179137188	179137189	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:179137188_179137189insG	uc003fjv.3	-	4	481_482	c.201_202insC	c.(199-204)TCCAGGfs	p.S67fs	GNB4_uc003fju.3_5'Flank	NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4	67_68	WD 1.				cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			GGTACAAACCTGGAATCGTATC	0.361	Melanoma(105;1405 1491 7265 20440 33721)															0.38			103	166		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	179137188	179137189	GNB4	3	-	G	G	G	1	0	1	1	0	0	0	0	0	713	55	5	5	6456	120
EPB41L2	2037	broad.mit.edu	37	6	131191073	131191075	+	In_Frame_Del	DEL	CTG	-	-			TCGA-12-0619-01	TCGA-12-0619-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:131191073_131191075delCTG	uc003qch.2	-	15	2417_2419	c.2235_2237delCAG	c.(2233-2238)AGCAGT>AGT	p.745_746SS>S	EPB41L2_uc003qce.1_In_Frame_Del_p.123_124SS>S|EPB41L2_uc003qcf.1_Intron|EPB41L2_uc003qcg.1_Intron|EPB41L2_uc011eby.1_Intron|EPB41L2_uc003qci.2_In_Frame_Del_p.675_676SS>S|EPB41L2_uc010kfk.2_Intron|EPB41L2_uc010kfl.1_In_Frame_Del_p.675_676SS>S|EPB41L2_uc003qcd.1_5'Flank|EPB41L2_uc003qcj.1_In_Frame_Del_p.142_143SS>S	NM_001431	NP_001422	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	745_746					cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		CTCACTCTCACTGCTGCTGCTGC	0.562																0.03			7	261		---	---	---	---						capture_indel	In_Frame_Del	DEL	131191073	131191075	EPB41L2	6	CTG	-	-	-	1	0	1	0	1	0	0	0	0	260	20	5	5	5108	120
