Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
EPHA10	284656	broad.mit.edu	37	1	38227382	38227382	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38227382G>A	uc009vvi.2	-	3	631	c.545C>T	c.(544-546)CCG>CTG	p.P182L	EPHA10_uc001cbw.3_Missense_Mutation_p.P182L	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	182	Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCGGCTGAGCGGTCCGATCTC	0.657					328											0.233766	47.027378	52.010248	18	59	KEEP	---	---	---	---	10	11	25	41	-1	capture	Missense_Mutation	SNP	38227382	38227382	EPHA10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5121	125
SLC2A1	6513	broad.mit.edu	37	1	43396302	43396302	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43396302C>T	uc001cik.2	-	4	1036	c.511G>A	c.(511-513)GCC>ACC	p.A171T		NM_006516	NP_006507	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose	171	Helical; Name=5; (Potential).				carbohydrate metabolic process|energy reserve metabolic process|regulation of insulin secretion|water-soluble vitamin metabolic process	integral to membrane|melanosome|membrane fraction|midbody	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			central_nervous_system(2)|pancreas(2)|ovary(1)	5	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	CTTACCTGGGCGATGAGGATG	0.642																0.473684	28.590764	28.60054	9	10	KEEP	---	---	---	---	5	4	5	7	-1	capture	Missense_Mutation	SNP	43396302	43396302	SLC2A1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14430	125
KLF17	128209	broad.mit.edu	37	1	44595024	44595024	+	Splice_Site	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44595024G>A	uc001clp.2	+	2	140	c.82_splice	c.e2-1	p.D28_splice	KLF17_uc009vxf.1_Splice_Site	NM_173484	NP_775755	Q5JT82	KLF17_HUMAN	zinc finger protein 393						regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					TTTTCCCCAAGGATAACGAGA	0.483																0.344	132.867188	135.563252	43	82	KEEP	---	---	---	---	23	28	53	40	-1	capture	Splice_Site	SNP	44595024	44595024	KLF17	1	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	8266	125
EPHX4	253152	broad.mit.edu	37	1	92495767	92495767	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:92495767G>A	uc001don.2	+	1	235	c.131G>A	c.(130-132)GGC>GAC	p.G44D		NM_173567	NP_775838	Q8IUS5	EPHX4_HUMAN	abhydrolase domain containing 7	44						integral to membrane	hydrolase activity			central_nervous_system(1)	1						TGGAGCCTCGGCAAGGGGCCG	0.677	GBM(140;473 1857 5172 22066 49719)															0.444444	12.298976	12.323153	4	5	KEEP	---	---	---	---	0	4	4	3	-1	capture	Missense_Mutation	SNP	92495767	92495767	EPHX4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5137	125
NRAS	4893	broad.mit.edu	37	1	115256529	115256529	+	Missense_Mutation	SNP	T	A	A	rs11554290		TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115256529T>A	uc009wgu.2	-	3	436	c.182A>T	c.(181-183)CAA>CTA	p.Q61L		NM_002524	NP_002515	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61	GTP.		Q -> K (in neuroblastoma cell).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	Golgi membrane|plasma membrane	GTP binding|GTPase activity	p.Q61R(757)|p.Q61K(537)|p.Q61L(147)|p.Q61H(95)|p.Q61P(21)|p.Q61E(9)|p.Q61?(4)|p.Q61Q(3)|p.Q61_E62>HK(1)		haematopoietic_and_lymphoid_tissue(1008)|skin(956)|thyroid(334)|large_intestine(62)|NS(60)|soft_tissue(32)|lung(31)|upper_aerodigestive_tract(25)|urinary_tract(12)|liver(10)|adrenal_gland(9)|autonomic_ganglia(8)|testis(8)|central_nervous_system(8)|prostate(8)|breast(7)|biliary_tract(6)|ovary(6)|stomach(5)|pancreas(5)|endometrium(2)|kidney(2)|cervix(2)|eye(1)	2607	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACTCTTCTTGTCCAGCTGT	0.458		Q61L(HEPG2_LIVER)|Q61R(SKMEL2_SKIN)|Q61R(KMS27_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(IPC298_SKIN)|Q61P(TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MHHES1_BONE)|Q61R(HT1197_URINARY_TRACT)|Q61L(MELJUSO_SKIN)|Q61R(ONS76_CENTRAL_NERVOUS_SYSTEM)|Q61R(KU1919_URINARY_TRACT)|Q61L(C3A_LIVER)|Q61R(TT2609C02_THYROID)|Q61R(NCIH2347_LUNG)|Q61L(KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(OCIAML3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(SW1271_LUNG)|Q61L(HL60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MOLP8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	50	p.Q61L(KMS21BM-Tumor)|p.Q61L(SNU719-Tumor)|p.Q61R(ONS76-Tumor)|p.Q61R(HS940.T-Tumor)|p.Q61R(KMS27-Tumor)|p.Q61L(HCC1195-Tumor)|p.Q61R(NCIH2347-Tumor)|p.Q61R(TT2609C02-Tumor)|p.Q61L(OCIAML3-Tumor)|p.Q61L(MHHES1-Tumor)|p.Q61L(IPC298-Tumor)|p.Q61L(MELJUSO-Tumor)|p.Q61L(MOLP8-Tumor)|p.Q61R(KU1919-Tumor)|p.Q61R(SKMEL2-Tumor)|p.Q61L(HEPG2-Tumor)|p.Q61R(SW1271-Tumor)|p.Q61L(C3A-Tumor)	128	Mis		melanoma|MM|AML|thyroid				Noonan_syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)			0.347015	272.002202	277.535449	93	175	KEEP	---	---	---	---	59	40	95	94	-1	capture	Missense_Mutation	SNP	115256529	115256529	NRAS	1	T	A	A	A	1	0	0	0	0	1	0	0	0	819	63	4	4	10547	125
NBPF10	100132406	broad.mit.edu	37	1	145367739	145367739	+	Silent	SNP	A	G	G	rs146714035	by1000genomes	TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145367739A>G	uc001end.3	+	85	10595	c.10560A>G	c.(10558-10560)AAA>AAG	p.K3520K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3445											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ggaaggggaaaaaaagaaggg	0.244																0.02439	-23.175823	7.707829	3	120	KEEP	---	---	---	---	1	2	61	67	-1	capture	Silent	SNP	145367739	145367739	NBPF10	1	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	10100	125
NBPF10	100132406	broad.mit.edu	37	1	145367751	145367751	+	Silent	SNP	A	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145367751A>T	uc001end.3	+	85	10607	c.10572A>T	c.(10570-10572)GGA>GGT	p.G3524G	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3449											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		aaagaaggggaagaagatcaa	0.244																0.235294	52.742258	59.284772	24	78	KEEP	---	---	---	---	11	16	46	48	-1	capture	Silent	SNP	145367751	145367751	NBPF10	1	A	T	T	T	1	0	0	0	0	0	0	0	1	106	9	4	4	10100	125
OR6K2	81448	broad.mit.edu	37	1	158669760	158669760	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158669760C>T	uc001fsu.1	-	1	683	c.683G>A	c.(682-684)CGT>CAT	p.R228H		NM_001005279	NP_001005279	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K,	228	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					TGAATGAATACGTAGAATTAC	0.453																0.382609	129.272451	130.662245	44	71	KEEP	---	---	---	---	18	26	28	43	-1	capture	Missense_Mutation	SNP	158669760	158669760	OR6K2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11106	125
GPR161	23432	broad.mit.edu	37	1	168066138	168066138	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:168066138C>G	uc001gfc.2	-	5	1021	c.707G>C	c.(706-708)AGG>ACG	p.R236T	GPR161_uc001gfb.2_Missense_Mutation_p.R104T|GPR161_uc010pll.1_Missense_Mutation_p.R146T|GPR161_uc010plm.1_Missense_Mutation_p.R122T|GPR161_uc009wvo.2_Missense_Mutation_p.R253T|GPR161_uc001gfd.2_Missense_Mutation_p.R236T|GPR161_uc010pln.1_Missense_Mutation_p.R256T|GPR161_uc001gfe.1_Missense_Mutation_p.R236T	NM_153832	NP_722561	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161 isoform 2	236	Cytoplasmic (Potential).				multicellular organismal development	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_hematologic(923;0.215)					CCTCCCGGTCCTCTGAGCATC	0.597																0.3	107.471819	111.749782	36	84	KEEP	---	---	---	---	18	18	40	48	-1	capture	Missense_Mutation	SNP	168066138	168066138	GPR161	1	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	6599	125
CR2	1380	broad.mit.edu	37	1	207644110	207644110	+	Silent	SNP	C	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207644110C>A	uc001hfw.2	+	7	1345	c.1251C>A	c.(1249-1251)CTC>CTA	p.L417L	CR2_uc001hfv.2_Silent_p.L417L|CR2_uc009xch.2_Silent_p.L417L|CR2_uc009xci.1_5'Flank	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	417	Sushi 7.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8						CTAACATCCTCAATGGGCAAA	0.418																0.285714	72.953125	76.995366	28	70	KEEP	---	---	---	---	18	12	37	41	0.4	capture	Silent	SNP	207644110	207644110	CR2	1	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	3807	125
LYST	1130	broad.mit.edu	37	1	235866229	235866229	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235866229G>A	uc001hxj.2	-	45	10367	c.10192C>T	c.(10192-10194)CGA>TGA	p.R3398*	LYST_uc001hxi.2_Nonsense_Mutation_p.R622*	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	3398	BEACH.				defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCTAGCGCTCGTCTCTGAACT	0.453												Chediak-Higashi_syndrome				0.315603	247.147074	255.691388	89	193	KEEP	---	---	---	---	56	42	121	91	-1	capture	Nonsense_Mutation	SNP	235866229	235866229	LYST	1	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	9043	125
RYR2	6262	broad.mit.edu	37	1	237777418	237777418	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237777418G>A	uc001hyl.1	+	37	5110	c.4990G>A	c.(4990-4992)GTC>ATC	p.V1664I		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1664	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTACTCAGCCGTCTGTGCTCT	0.517																0.555556	115.031238	115.200524	35	28	KEEP	---	---	---	---	21	16	13	19	-1	capture	Missense_Mutation	SNP	237777418	237777418	RYR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13661	125
RYR2	6262	broad.mit.edu	37	1	237995876	237995876	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237995876C>G	uc001hyl.1	+	105	14953	c.14833C>G	c.(14833-14835)CAA>GAA	p.Q4945E	RYR2_uc010pyb.1_3'UTR	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4945					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAAGATGTATCAAGAAAGGTG	0.383																0.238095	28.511011	31.16204	10	32	KEEP	---	---	---	---	5	5	12	26	-1	capture	Missense_Mutation	SNP	237995876	237995876	RYR2	1	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	13661	125
CUBN	8029	broad.mit.edu	37	10	17146591	17146591	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:17146591C>T	uc001ioo.2	-	12	1296	c.1244G>A	c.(1243-1245)GGT>GAT	p.G415D		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	415	EGF-like 6.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACAAAAATAACCAGAGACAGT	0.373					2704											0.470588	25.498515	25.511349	8	9	KEEP	---	---	---	---	6	3	2	8	-1	capture	Missense_Mutation	SNP	17146591	17146591	CUBN	10	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	4011	125
TMEM26	219623	broad.mit.edu	37	10	63170497	63170497	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:63170497G>T	uc001jlo.2	-	6	1059	c.690C>A	c.(688-690)AAC>AAA	p.N230K	TMEM26_uc010qij.1_RNA|TMEM26_uc001jlp.1_RNA	NM_178505	NP_848600	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	230						integral to membrane					0	Prostate(12;0.0112)					GGCACACAACGTTCTGTACTG	0.473																0.580645	57.818453	57.989826	18	13	KEEP	---	---	---	---	10	8	6	9	0.555555555556	capture	Missense_Mutation	SNP	63170497	63170497	TMEM26	10	G	T	T	T	1	0	0	0	0	1	0	0	0	516	40	4	4	16034	125
PTEN	5728	broad.mit.edu	37	10	89725042	89725042	+	Splice_Site	SNP	A	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89725042A>G	uc001kfb.2	+	10	2058	c.1027_splice	c.e10-2	p.V343_splice		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(6)|p.R55fs*1(4)|p.Y27fs*1(2)|p.N212fs*1(2)|p.G165_*404del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTCTTTCTCTAGGTGAAGCTG	0.333			31	(HSC4-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.612903	73.228366	73.574252	19	12	KEEP	---	---	---	---	10	10	4	9	-1	capture	Splice_Site	SNP	89725042	89725042	PTEN	10	A	G	G	G	1	0	0	0	0	0	0	1	0	195	15	5	3	12633	125
CHRNA10	57053	broad.mit.edu	37	11	3687643	3687643	+	Silent	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3687643G>A	uc001lyf.2	-	5	1119	c.1047C>T	c.(1045-1047)TGC>TGT	p.C349C	CHRNA10_uc010qxt.1_Silent_p.C143C|CHRNA10_uc010qxu.1_Silent_p.C143C	NM_020402	NP_065135	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10	349	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration|regulation of cell proliferation|synaptic transmission, cholinergic	cell junction|postsynaptic membrane	calcium channel activity|receptor activity|receptor binding			ovary(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Procaine(DB00721)|Trimethaphan(DB01116)	TTTCCCGCACGCACAGGCCCC	0.667	Melanoma(153;17 1869 2949 7120 36888)															0.213333	34.75499	40.454305	16	59	KEEP	---	---	---	---	20	17	31	33	-1	capture	Silent	SNP	3687643	3687643	CHRNA10	11	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	3347	125
OR52I2	143502	broad.mit.edu	37	11	4608268	4608268	+	Missense_Mutation	SNP	G	A	A	rs138555035		TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4608268G>A	uc010qyh.1	+	1	226	c.226G>A	c.(226-228)GTG>ATG	p.V76M		NM_001005170	NP_001005170	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I,	76	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACCATCATCGTGACTGCAAT	0.507																0.28866	238.285868	249.935123	84	207	KEEP	---	---	---	---	48	58	134	123	-1	capture	Missense_Mutation	SNP	4608268	4608268	OR52I2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11025	125
OR52I1	390037	broad.mit.edu	37	11	4615416	4615416	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4615416G>A	uc010qyi.1	+	1	148	c.148G>A	c.(148-150)GTG>ATG	p.V50M		NM_001005169	NP_001005169	Q8NGK6	O52I1_HUMAN	olfactory receptor, family 52, subfamily I,	50	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;7.98e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACCCTCATCGTGACTGCAAT	0.517																0.06391	-14.441674	38.177925	17	249	KEEP	---	---	---	---	18	19	174	130	-1	capture	Missense_Mutation	SNP	4615416	4615416	OR52I1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11024	125
OR52H1	390067	broad.mit.edu	37	11	5566723	5566723	+	Missense_Mutation	SNP	T	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5566723T>G	uc010qzh.1	-	1	31	c.31A>C	c.(31-33)AAC>CAC	p.N11H	HBG2_uc001mak.1_Intron	NM_001005289	NP_001005289	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H,	11	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGCTCAGGTTGAAAATGATC	0.443																0.321739	127.038571	130.281808	37	78	KEEP	---	---	---	---	23	18	34	50	-1	capture	Missense_Mutation	SNP	5566723	5566723	OR52H1	11	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	11023	125
TRIM6-TRIM34	445372	broad.mit.edu	37	11	5626645	5626645	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5626645C>T	uc001mbf.2	+	4	926	c.682C>T	c.(682-684)CGG>TGG	p.R228W	HBG2_uc001mak.1_Intron|TRIM6_uc009yeo.1_Missense_Mutation_p.R174W|TRIM6_uc010qzj.1_Missense_Mutation_p.R25W|TRIM6_uc001mbc.1_Missense_Mutation_p.R200W|TRIM6_uc001mbe.2_Missense_Mutation_p.R25W|TRIM6_uc010qzk.1_Missense_Mutation_p.R25W|TRIM6_uc010qzl.1_Missense_Mutation_p.R25W|TRIM6_uc001mbd.2_Missense_Mutation_p.R228W|TRIM6_uc001mbg.1_Missense_Mutation_p.R25W|TRIM6_uc009yep.1_Missense_Mutation_p.R25W	NM_001003819	NP_001003819	B2RNG4	B2RNG4_HUMAN	tripartite motif-containing 6 and tripartite	228						intracellular	zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)		AGTGGAGCAACGGGAGCTGAA	0.488														OREG0003723	type=REGULATORY REGION|Gene=TRIM6|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.252252	72.950699	79.135917	28	83	KEEP	---	---	---	---	16	13	44	44	-1	capture	Missense_Mutation	SNP	5626645	5626645	TRIM6-TRIM34	11	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	16417	125
TRIM6-TRIM34	445372	broad.mit.edu	37	11	5631406	5631406	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5631406G>A	uc001mbf.2	+	6	1133	c.889G>A	c.(889-891)GCT>ACT	p.A297T	HBG2_uc001mak.1_Intron|TRIM6_uc009yeo.1_Missense_Mutation_p.A243T|TRIM6_uc010qzj.1_Missense_Mutation_p.A94T|TRIM6_uc001mbc.1_Missense_Mutation_p.A269T|TRIM6_uc001mbe.2_Missense_Mutation_p.A94T|TRIM6_uc010qzk.1_Missense_Mutation_p.A94T|TRIM6_uc010qzl.1_Missense_Mutation_p.A94T|TRIM6_uc001mbd.2_Missense_Mutation_p.A297T|TRIM6_uc001mbg.1_Missense_Mutation_p.A94T|TRIM6_uc009yep.1_Missense_Mutation_p.A94T	NM_001003819	NP_001003819	B2RNG4	B2RNG4_HUMAN	tripartite motif-containing 6 and tripartite	297						intracellular	zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)		GAAGCCAGAAGCTCTCCCTAC	0.517																0.324675	76.26712	78.357948	25	52	KEEP	---	---	---	---	14	15	26	35	-1	capture	Missense_Mutation	SNP	5631406	5631406	TRIM6-TRIM34	11	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	16417	125
MTNR1B	4544	broad.mit.edu	37	11	92714701	92714701	+	Silent	SNP	C	T	T	rs139515067		TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92714701C>T	uc001pdk.1	+	2	415	c.312C>T	c.(310-312)GAC>GAT	p.D104D		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	104	Extracellular (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	TCTTCTATGACGGCTGGGCCC	0.567																0.40942	349.442901	351.415179	113	163	KEEP	---	---	---	---	78	40	108	65	-1	capture	Silent	SNP	92714701	92714701	MTNR1B	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9862	125
OR8A1	390275	broad.mit.edu	37	11	124440668	124440668	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124440668C>A	uc010san.1	+	1	704	c.704C>A	c.(703-705)ACC>AAC	p.T235N		NM_001005194	NP_001005194	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A,	235	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		GTTTCTTACACCTTCATTCTC	0.493																0.380531	128.102588	129.515363	43	70	KEEP	---	---	---	---	19	27	32	42	0.586956521739	capture	Missense_Mutation	SNP	124440668	124440668	OR8A1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	11129	125
PLEKHA5	54477	broad.mit.edu	37	12	19436597	19436597	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:19436597G>A	uc001reb.2	+	11	1765	c.1679G>A	c.(1678-1680)CGA>CAA	p.R560Q	PLEKHA5_uc010sie.1_Missense_Mutation_p.R566Q|PLEKHA5_uc001rea.2_Missense_Mutation_p.R560Q|PLEKHA5_uc009zin.2_Missense_Mutation_p.R318Q|PLEKHA5_uc010sif.1_Missense_Mutation_p.R452Q|PLEKHA5_uc010sig.1_Missense_Mutation_p.R452Q|PLEKHA5_uc010sih.1_Missense_Mutation_p.R452Q|PLEKHA5_uc001rec.1_Missense_Mutation_p.R248Q	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	560							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					TCCCCTCAACGAACTTACAGA	0.468	Pancreas(196;329 2193 11246 14234 19524)				873											0.35443	84.103919	85.567627	28	51	KEEP	---	---	---	---	16	12	26	26	-1	capture	Missense_Mutation	SNP	19436597	19436597	PLEKHA5	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11962	125
ZFC3H1	196441	broad.mit.edu	37	12	72030416	72030416	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:72030416C>G	uc001swo.2	-	9	2313	c.1954G>C	c.(1954-1956)GAC>CAC	p.D652H		NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	652					RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						GAAGGTGGGTCACTATTACTG	0.363																0.357143	172.10934	174.62678	50	90	KEEP	---	---	---	---	26	28	55	49	-1	capture	Missense_Mutation	SNP	72030416	72030416	ZFC3H1	12	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	17513	125
CCDC60	160777	broad.mit.edu	37	12	119966451	119966451	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:119966451C>T	uc001txe.2	+	12	1726	c.1261C>T	c.(1261-1263)CGT>TGT	p.R421C	uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	421										ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		CCAGAAGTTCCGTGCTTTTGT	0.428																0.025271	-57.52904	11.869477	7	270	KEEP	---	---	---	---	4	3	130	151	-1	capture	Missense_Mutation	SNP	119966451	119966451	CCDC60	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2805	125
GCN1L1	10985	broad.mit.edu	37	12	120599767	120599767	+	Silent	SNP	A	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:120599767A>T	uc001txo.2	-	21	2272	c.2259T>A	c.(2257-2259)CCT>CCA	p.P753P		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	753					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGCGCAGTGCAGGGTTCTGCA	0.592																0.333333	89.446806	91.586657	29	58	KEEP	---	---	---	---	17	14	36	30	-1	capture	Silent	SNP	120599767	120599767	GCN1L1	12	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	6239	125
TUBA3C	7278	broad.mit.edu	37	13	19751200	19751200	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:19751200C>T	uc009zzj.2	-	4	972	c.923G>A	c.(922-924)CGC>CAC	p.R308H		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	308					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CTTGCCGTGGCGAGGGTCACA	0.587																0.348624	215.036497	219.4438	76	142	KEEP	---	---	---	---	43	45	92	78	-1	capture	Missense_Mutation	SNP	19751200	19751200	TUBA3C	13	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16628	125
KLHL1	57626	broad.mit.edu	37	13	70681808	70681808	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:70681808G>T	uc001vip.2	-	1	818	c.24C>A	c.(22-24)GAC>GAA	p.D8E	KLHL1_uc010thm.1_Missense_Mutation_p.D8E|ATXN8OS_uc010aej.1_RNA	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	8					actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TCACATCGAAGTCTTTTCGCC	0.632																0.311111	41.034278	42.46369	14	31	KEEP	---	---	---	---	6	9	13	23	0.4	capture	Missense_Mutation	SNP	70681808	70681808	KLHL1	13	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	8285	125
CLN5	1203	broad.mit.edu	37	13	77570066	77570066	+	Silent	SNP	A	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:77570066A>G	uc001vkc.2	+	3	544	c.516A>G	c.(514-516)AGA>AGG	p.R172R		NM_006493	NP_006484	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	123					brain development|cell death|lysosomal lumen acidification|neuron maturation|protein catabolic process	endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		TTGGATTCAGAAGTACATTAA	0.413																0.017647	-38.119854	6.483671	3	167	KEEP	---	---	---	---	3	0	87	99	-1	capture	Silent	SNP	77570066	77570066	CLN5	13	A	G	G	G	1	0	0	0	0	0	0	0	1	115	9	3	3	3509	125
SUPT16H	11198	broad.mit.edu	37	14	21822688	21822688	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21822688A>G	uc001wao.2	-	23	3011	c.2672T>C	c.(2671-2673)CTG>CCG	p.L891P	SUPT16H_uc001wan.2_Missense_Mutation_p.L35P	NM_007192	NP_009123	Q9Y5B9	SP16H_HUMAN	chromatin-specific transcription elongation	891					DNA repair|DNA replication|nucleosome disassembly|positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|nucleoplasm	GTP binding				0	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TGTGTATTTCAGGTCGCAGGA	0.338																0.021277	-29.10862	7.02829	3	138	KEEP	---	---	---	---	1	2	56	97	-1	capture	Missense_Mutation	SNP	21822688	21822688	SUPT16H	14	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	15284	125
SIPA1L1	26037	broad.mit.edu	37	14	72055814	72055814	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:72055814G>A	uc001xms.2	+	2	1573	c.1225G>A	c.(1225-1227)GAG>AAG	p.E409K	SIPA1L1_uc001xmt.2_Missense_Mutation_p.E409K|SIPA1L1_uc001xmu.2_Missense_Mutation_p.E409K|SIPA1L1_uc001xmv.2_Missense_Mutation_p.E409K	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	409					actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		TAAAAGCAATGAGCTTGTAAT	0.458																0.465116	122.790323	122.881645	40	46	KEEP	---	---	---	---	21	20	22	27	-1	capture	Missense_Mutation	SNP	72055814	72055814	SIPA1L1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	14222	125
C14orf115	55237	broad.mit.edu	37	14	74823988	74823988	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74823988A>G	uc001xpw.3	+	2	693	c.502A>G	c.(502-504)AGC>GGC	p.S168G		NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN	hypothetical protein LOC55237	168					transposition, DNA-mediated		DNA binding|transposase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00147)		CTGTTTCCCCAGCAGCTTCTC	0.597																0.357143	98.987689	100.753379	35	63	KEEP	---	---	---	---	23	15	39	27	-1	capture	Missense_Mutation	SNP	74823988	74823988	C14orf115	14	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	1726	125
CALM1	801	broad.mit.edu	37	14	90870850	90870850	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:90870850A>G	uc001xyl.1	+	5	615	c.413A>G	c.(412-414)AAC>AGC	p.N138S	CALM1_uc010atq.1_Missense_Mutation_p.N139S|CALM1_uc010atr.1_RNA|CALM1_uc001xym.1_Missense_Mutation_p.N102S	NM_006888	NP_008819	P62158	CALM_HUMAN	calmodulin 1 isoform 1	138	4.|EF-hand 4.				activation of phospholipase C activity|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen catabolic process|muscle contraction|negative regulation of ryanodine-sensitive calcium-release channel activity|nerve growth factor receptor signaling pathway|nitric oxide metabolic process|platelet activation|platelet degranulation|positive regulation of ryanodine-sensitive calcium-release channel activity|regulation of cytokinesis|regulation of nitric-oxide synthase activity|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to calcium ion|synaptic transmission	centrosome|cytosol|extracellular region|nucleoplasm|plasma membrane|spindle microtubule|spindle pole	calcium ion binding|N-terminal myristoylation domain binding|phospholipase binding|protein domain specific binding|thioesterase binding|titin binding			central_nervous_system(1)	1		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.208)	Aprindine(DB01429)|Bepridil(DB01244)|Dibucaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Miconazole(DB01110)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)	GGACAAGTCAACTATGAAGGT	0.383																0.338462	75.43166	76.930723	22	43	KEEP	---	---	---	---	10	12	22	24	-1	capture	Missense_Mutation	SNP	90870850	90870850	CALM1	14	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	2560	125
PPP4R4	57718	broad.mit.edu	37	14	94700063	94700063	+	Nonsense_Mutation	SNP	T	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94700063T>A	uc001ycs.1	+	6	744	c.590T>A	c.(589-591)TTA>TAA	p.L197*		NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1	197						cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4						TGTAAAATTTTAGGAAAATTG	0.308																0.363636	167.659761	170.178561	56	98	KEEP	---	---	---	---	30	33	46	69	-1	capture	Nonsense_Mutation	SNP	94700063	94700063	PPP4R4	14	T	A	A	A	1	0	0	0	0	0	1	0	0	793	61	5	4	12306	125
SERPINA11	256394	broad.mit.edu	37	14	94909543	94909543	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94909543G>A	uc001ydd.1	-	4	997	c.937C>T	c.(937-939)CCA>TCA	p.P313S		NM_001080451	NP_001073920	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1	313					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			kidney(1)	1				COAD - Colon adenocarcinoma(157;0.211)		GAAAACCTTGGCAAGTGCAAA	0.458																0.397959	115.300455	116.194513	39	59	KEEP	---	---	---	---	18	22	34	29	-1	capture	Missense_Mutation	SNP	94909543	94909543	SERPINA11	14	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13981	125
JAG2	3714	broad.mit.edu	37	14	105612833	105612833	+	Silent	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105612833G>A	uc001yqg.2	-	22	3002	c.2598C>T	c.(2596-2598)ATC>ATT	p.I866I	JAG2_uc010axf.2_5'UTR|JAG2_uc001yqf.2_Silent_p.I270I|JAG2_uc001yqh.2_Silent_p.I828I	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	866	Extracellular (Potential).				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		TCCCGAACCCGATCACTGTGG	0.682					501											0.477273	132.133337	132.173454	42	46	KEEP	---	---	---	---	20	25	20	29	-1	capture	Silent	SNP	105612833	105612833	JAG2	14	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	7858	125
JAG2	3714	broad.mit.edu	37	14	105618019	105618019	+	Missense_Mutation	SNP	G	A	A	rs140813175		TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105618019G>A	uc001yqg.2	-	8	1501	c.1097C>T	c.(1096-1098)CCG>CTG	p.P366L	JAG2_uc001yqf.2_5'Flank|JAG2_uc001yqh.2_Missense_Mutation_p.P366L	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	366	EGF-like 4.|Extracellular (Potential).				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GAAGCCGGACGGCACCTCATG	0.667					501											0.4	31.741579	31.960964	10	15	KEEP	---	---	---	---	6	6	8	9	-1	capture	Missense_Mutation	SNP	105618019	105618019	JAG2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7858	125
SLC27A2	11001	broad.mit.edu	37	15	50494831	50494831	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50494831G>A	uc001zxw.2	+	3	1068	c.836G>A	c.(835-837)TGT>TAT	p.C279Y	SLC27A2_uc010bes.2_Intron|SLC27A2_uc001zxx.2_Missense_Mutation_p.C44Y	NM_003645	NP_003636	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid	279	Helical; (Potential).				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)|skin(1)	2		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		ATTCACGGATGTATTGTGGCT	0.428																0.344828	173.141025	176.843998	60	114	KEEP	---	---	---	---	44	40	72	69	-1	capture	Missense_Mutation	SNP	50494831	50494831	SLC27A2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	14418	125
BLM	641	broad.mit.edu	37	15	91312761	91312761	+	Missense_Mutation	SNP	A	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91312761A>T	uc002bpr.2	+	12	2597	c.2500A>T	c.(2500-2502)AAT>TAT	p.N834Y	BLM_uc010uqh.1_Missense_Mutation_p.N834Y|BLM_uc010uqi.1_Missense_Mutation_p.N459Y|BLM_uc010bnx.2_Missense_Mutation_p.N834Y|BLM_uc002bps.1_Missense_Mutation_p.N396Y	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein	834	Helicase ATP-binding.				double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			GGCCACAGCTAATCCCAGGGT	0.478					462	Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				0.419048	131.982703	132.583051	44	61	KEEP	---	---	---	---	27	21	27	35	-1	capture	Missense_Mutation	SNP	91312761	91312761	BLM	15	A	T	T	T	1	0	0	0	0	1	0	0	0	169	13	4	4	1433	125
CDH16	1014	broad.mit.edu	37	16	66950022	66950022	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:66950022G>T	uc002eql.2	-	5	443	c.370C>A	c.(370-372)CCC>ACC	p.P124T	CDH16_uc010cdy.2_Missense_Mutation_p.P124T|CDH16_uc002eqm.2_Intron	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	124	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		GAGAAATGGGGCACCTGGTCA	0.582																0.416667	99.411907	99.919931	35	49	KEEP	---	---	---	---	18	17	27	24	0.514285714286	capture	Missense_Mutation	SNP	66950022	66950022	CDH16	16	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	3072	125
PHLPP2	23035	broad.mit.edu	37	16	71724459	71724459	+	Missense_Mutation	SNP	G	C	C			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:71724459G>C	uc002fax.2	-	3	578	c.572C>G	c.(571-573)ACT>AGT	p.T191S	PHLPP2_uc010cgf.2_Missense_Mutation_p.T191S|PHLPP2_uc002fay.1_Missense_Mutation_p.T191S	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	191	PH.					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						CATCTTTCCAGTTTGACAATC	0.408																0.103448	18.508637	36.671455	12	104	KEEP	---	---	---	---	5	10	52	64	-1	capture	Missense_Mutation	SNP	71724459	71724459	PHLPP2	16	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	11758	125
MYH3	4621	broad.mit.edu	37	17	10533648	10533648	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10533648G>A	uc002gmq.1	-	36	5491	c.5414C>T	c.(5413-5415)GCG>GTG	p.A1805V		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1805	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						GCCCTTCAGCGCCAGCTGCTC	0.607																0.311111	111.512109	115.796117	42	93	KEEP	---	---	---	---	31	22	68	49	-1	capture	Missense_Mutation	SNP	10533648	10533648	MYH3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9946	125
UBB	7314	broad.mit.edu	37	17	16285788	16285788	+	Silent	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:16285788C>T	uc002gpx.2	+	2	705	c.567C>T	c.(565-567)CCC>CCT	p.P189P	UBB_uc010vwe.1_Silent_p.P113P	NM_018955	NP_061828	P0CG47	UBB_HUMAN	ubiquitin B precursor	189	Ubiquitin-like 3.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		AAGGCATCCCCCCCGACCAGC	0.552	Melanoma(163;1126 3406 34901)															0.036585	-12.117302	6.945973	3	79	KEEP	---	---	---	---	3	0	44	56	-1	capture	Silent	SNP	16285788	16285788	UBB	17	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	16723	125
ANKRD13B	124930	broad.mit.edu	37	17	27939203	27939203	+	Silent	SNP	T	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27939203T>A	uc002hei.2	+	11	1283	c.1170T>A	c.(1168-1170)ATT>ATA	p.I390I	ANKRD13B_uc002heh.2_Silent_p.I258I|ANKRD13B_uc002hej.2_RNA|ANKRD13B_uc002hek.2_5'Flank	NM_152345	NP_689558	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	390											0						CCCCCATCATTGACCTCATGG	0.597																0.354839	127.209801	129.492435	44	80	KEEP	---	---	---	---	25	23	49	41	-1	capture	Silent	SNP	27939203	27939203	ANKRD13B	17	T	A	A	A	1	0	0	0	0	0	0	0	1	809	63	4	4	639	125
MEP1B	4225	broad.mit.edu	37	18	29787380	29787380	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29787380G>A	uc002kxj.3	+	8	760	c.713G>A	c.(712-714)CGA>CAA	p.R238Q		NM_005925	NP_005916	Q16820	MEP1B_HUMAN	meprin A beta precursor	238	Extracellular (Potential).|Metalloprotease.				digestion|proteolysis	extracellular space|integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)	2						ATCGGCCAACGAATGGATTTC	0.388																0.358974	43.038911	43.722053	14	25	KEEP	---	---	---	---	8	8	9	18	-1	capture	Missense_Mutation	SNP	29787380	29787380	MEP1B	18	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9389	125
CBLN2	147381	broad.mit.edu	37	18	70209243	70209243	+	Silent	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:70209243C>T	uc002lku.2	-	2	388	c.153G>A	c.(151-153)GCG>GCA	p.A51A	CBLN2_uc002lkv.2_Silent_p.A51A	NM_182511	NP_872317	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	51						integral to membrane					0		Esophageal squamous(42;0.131)				TGTCGTTCTGCGCCCGCACGG	0.607																0.411765	21.628033	21.741815	7	10	KEEP	---	---	---	---	1	7	8	4	-1	capture	Silent	SNP	70209243	70209243	CBLN2	18	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	2681	125
C19orf21	126353	broad.mit.edu	37	19	758162	758162	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:758162C>T	uc002lpo.2	+	2	1299	c.1216C>T	c.(1216-1218)CGT>TGT	p.R406C		NM_173481	NP_775752	Q8IVT2	CS021_HUMAN	hypothetical protein LOC126353	406										upper_aerodigestive_tract(1)	1		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000145)|all_lung(49;0.000236)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCAGATGCCCGTGCGGCCGA	0.682																0.134615	11.489177	18.219996	7	45	KEEP	---	---	---	---	4	3	23	28	-1	capture	Missense_Mutation	SNP	758162	758162	C19orf21	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1896	125
GADD45B	4616	broad.mit.edu	37	19	2477591	2477591	+	Missense_Mutation	SNP	G	C	C			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2477591G>C	uc002lwb.1	+	4	697	c.475G>C	c.(475-477)GAA>CAA	p.E159Q		NM_015675	NP_056490	O75293	GA45B_HUMAN	growth arrest and DNA-damage-inducible, beta	159					activation of MAPKKK activity|apoptosis|cell differentiation|multicellular organismal development|response to stress						0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTCTTCAGGAACGCTGAGG	0.562																0.128205	8.848042	14.100478	5	34	KEEP	---	---	---	---	3	3	16	19	-1	capture	Missense_Mutation	SNP	2477591	2477591	GADD45B	19	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	6124	125
CPAMD8	27151	broad.mit.edu	37	19	17086956	17086956	+	Silent	SNP	T	C	C			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17086956T>C	uc002nfb.2	-	16	1937	c.1905A>G	c.(1903-1905)TCA>TCG	p.S635S		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	588						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						AATACGTCACTGAAACCTTGG	0.393					1067											0.179104	24.756753	31.251202	12	55	KEEP	---	---	---	---	6	6	17	43	-1	capture	Silent	SNP	17086956	17086956	CPAMD8	19	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	3760	125
B3GNT3	10331	broad.mit.edu	37	19	17918748	17918748	+	Silent	SNP	C	T	T	rs79614823	byFrequency	TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17918748C>T	uc002nhk.1	+	2	217	c.132C>T	c.(130-132)CCC>CCT	p.P44P	B3GNT3_uc002nhl.1_Silent_p.P44P|B3GNT3_uc010ebd.1_Silent_p.P44P|B3GNT3_uc010ebe.1_Silent_p.P44P	NM_014256	NP_055071	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal	44	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to plasma membrane	galactosyltransferase activity			upper_aerodigestive_tract(1)	1						CGGCGATCCCCGAGGCCCTGG	0.687																0.3125	43.909516	45.410652	15	33	KEEP	---	---	---	---	6	13	11	29	-1	capture	Silent	SNP	17918748	17918748	B3GNT3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	1247	125
ZNF493	284443	broad.mit.edu	37	19	21606457	21606457	+	Silent	SNP	T	C	C			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:21606457T>C	uc002npx.2	+	2	892	c.612T>C	c.(610-612)ATT>ATC	p.I204I	ZNF493_uc002npw.2_Silent_p.I332I|ZNF493_uc002npy.2_Silent_p.I204I	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1	204	C2H2-type 7; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CCTTTAGTATTTTCTCAACCC	0.348																0.361111	139.101915	140.933067	39	69	KEEP	---	---	---	---	20	20	35	39	-1	capture	Silent	SNP	21606457	21606457	ZNF493	19	T	C	C	C	1	0	0	0	0	0	0	0	1	822	64	3	3	17823	125
ZNF208	7757	broad.mit.edu	37	19	22155346	22155346	+	Silent	SNP	T	C	C			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22155346T>C	uc002nqp.2	-	5	2339	c.2190A>G	c.(2188-2190)GAA>GAG	p.E730E	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGTAGGGCTTTTCTCCAGCAT	0.373																0.02963	-23.323243	9.487699	4	131	KEEP	---	---	---	---	1	3	79	65	-1	capture	Silent	SNP	22155346	22155346	ZNF208	19	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	17646	125
LSR	51599	broad.mit.edu	37	19	35757850	35757850	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35757850C>T	uc002nyl.2	+	8	1491	c.1268C>T	c.(1267-1269)CCC>CTC	p.P423L	LSR_uc002nym.2_Missense_Mutation_p.P404L|LSR_uc002nyn.2_Missense_Mutation_p.P355L|LSR_uc002nyo.2_Missense_Mutation_p.P403L|LSR_uc010xsr.1_Missense_Mutation_p.P315L|LSR_uc002nyp.2_Missense_Mutation_p.P365L|USF2_uc010xss.1_5'Flank|USF2_uc002nyq.1_5'Flank|USF2_uc002nyr.1_5'Flank|USF2_uc002nys.1_5'Flank|USF2_uc002nyt.1_5'Flank|USF2_uc002nyu.1_5'Flank|USF2_uc002nyv.1_5'Flank	NM_205834	NP_991403	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	423	Cytoplasmic (Potential).				embryo development|liver development	chylomicron|integral to membrane|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle	receptor activity				0	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCTGGCCCCCCCAGTGGCCGT	0.622																0.328947	74.549347	76.520627	25	51	KEEP	---	---	---	---	13	16	27	27	-1	capture	Missense_Mutation	SNP	35757850	35757850	LSR	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	8979	125
CEACAM18	729767	broad.mit.edu	37	19	51986389	51986389	+	Silent	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51986389G>A	uc002pwv.1	+	5	975	c.975G>A	c.(973-975)AAG>AAA	p.K325K		NM_001080405	NP_001073874	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion	325	Ig-like C2-type.					integral to membrane				skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TGGATCTCAAGTACCACTGGA	0.512																0.268707	205.0836	219.287501	79	215	KEEP	---	---	---	---	43	41	116	113	-1	capture	Silent	SNP	51986389	51986389	CEACAM18	19	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	3158	125
ZNF534	147658	broad.mit.edu	37	19	52942423	52942423	+	Missense_Mutation	SNP	T	A	A	rs112113280		TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52942423T>A	uc002pzk.2	+	4	1810	c.1749T>A	c.(1747-1749)AAT>AAA	p.N583K	ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Missense_Mutation_p.N570K	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2	583	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GACATAGGAATATTCATACTG	0.438																0.081081	0.896256	7.510937	3	34	KEEP	---	---	---	---	2	1	19	18	-1	capture	Missense_Mutation	SNP	52942423	52942423	ZNF534	19	T	A	A	A	1	0	0	0	0	1	0	0	0	634	49	4	4	17852	125
ZNF845	91664	broad.mit.edu	37	19	53855879	53855879	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53855879C>G	uc010ydv.1	+	4	2068	c.1951C>G	c.(1951-1953)CAA>GAA	p.Q651E	ZNF845_uc010ydw.1_Missense_Mutation_p.Q651E	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	651	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATCAAACCTTCAAAGACATAG	0.398																0.028571	-19.073176	6.621513	3	102	KEEP	---	---	---	---	1	3	60	45	-1	capture	Missense_Mutation	SNP	53855879	53855879	ZNF845	19	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	18067	125
ZSCAN5B	342933	broad.mit.edu	37	19	56704064	56704064	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56704064G>A	uc010ygh.1	-	1	358	c.358C>T	c.(358-360)CGA>TGA	p.R120*		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	120	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						CTGTTATTTCGTAGCAGGTCC	0.537																0.139073	35.771003	54.779071	21	130	KEEP	---	---	---	---	10	20	90	81	-1	capture	Nonsense_Mutation	SNP	56704064	56704064	ZSCAN5B	19	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	18115	125
GRHL1	29841	broad.mit.edu	37	2	10102621	10102621	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:10102621G>A	uc002raa.2	+	5	878	c.707G>A	c.(706-708)GGC>GAC	p.G236D	GRHL1_uc002rab.2_RNA|GRHL1_uc002rad.2_Intron|GRHL1_uc010yjb.1_Missense_Mutation_p.G85D	NM_198182	NP_937825	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1	236					cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding			pancreas(1)|skin(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		CGGATGCCTGGCATGAATTCA	0.358																0.076923	-0.408058	6.740154	3	36	KEEP	---	---	---	---	2	1	24	17	-1	capture	Missense_Mutation	SNP	10102621	10102621	GRHL1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	6696	125
CCDC85A	114800	broad.mit.edu	37	2	56420095	56420095	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:56420095G>A	uc002rzn.2	+	2	1262	c.760G>A	c.(760-762)GCC>ACC	p.A254T		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	254	His-rich.									breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GCACAGGAGCGCCAGCCCCGA	0.657																0.42	64.374756	64.65167	21	29	KEEP	---	---	---	---	6	16	11	19	-1	capture	Missense_Mutation	SNP	56420095	56420095	CCDC85A	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2833	125
SULT1C3	442038	broad.mit.edu	37	2	108872031	108872031	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108872031G>T	uc010ywo.1	+	4	403	c.403G>T	c.(403-405)GTC>TTC	p.V135F		NM_001008743	NP_001008743	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member	135						cytoplasm	alcohol sulfotransferase activity			skin(1)	1						ATTTCAGATTGTCTATGTGGC	0.413																0.34375	167.087688	170.532784	55	105	KEEP	---	---	---	---	43	19	59	68	0.693548387097	capture	Missense_Mutation	SNP	108872031	108872031	SULT1C3	2	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	15266	125
SLC4A10	57282	broad.mit.edu	37	2	162813661	162813661	+	Nonsense_Mutation	SNP	A	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:162813661A>T	uc002ubx.3	+	20	2888	c.2704A>T	c.(2704-2706)AAA>TAA	p.K902*	SLC4A10_uc002uby.3_Nonsense_Mutation_p.K872*|SLC4A10_uc010zcs.1_Nonsense_Mutation_p.K883*	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	902	Extracellular (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						AGAACAACCCAAATTTCTCGG	0.448																0.580645	59.654181	59.830026	18	13	KEEP	---	---	---	---	11	7	6	7	-1	capture	Nonsense_Mutation	SNP	162813661	162813661	SLC4A10	2	A	T	T	T	1	0	0	0	0	0	1	0	0	65	5	5	4	14543	125
SCN9A	6335	broad.mit.edu	37	2	167141278	167141278	+	Missense_Mutation	SNP	A	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167141278A>T	uc010fpl.2	-	12	2000	c.1659T>A	c.(1657-1659)AGT>AGA	p.S553R	uc002udp.2_Intron|SCN9A_uc002udr.1_Missense_Mutation_p.S424R|SCN9A_uc002uds.1_Missense_Mutation_p.S424R|SCN9A_uc002udt.1_Missense_Mutation_p.S424R	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	553						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	AACTAAAAAGACTTGTTCTGC	0.443																0.355556	46.68889	47.515416	16	29	KEEP	---	---	---	---	6	11	13	17	-1	capture	Missense_Mutation	SNP	167141278	167141278	SCN9A	2	A	T	T	T	1	0	0	0	0	1	0	0	0	128	10	4	4	13818	125
TTN	7273	broad.mit.edu	37	2	179456812	179456812	+	Missense_Mutation	SNP	T	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179456812T>A	uc010zfg.1	-	251	52339	c.52115A>T	c.(52114-52116)CAT>CTT	p.H17372L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.H11067L|TTN_uc010zfi.1_Missense_Mutation_p.H11000L|TTN_uc010zfj.1_Missense_Mutation_p.H10875L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18299							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCATTCAGATGCTTAGCGAA	0.463					8722											0.384615	82.662245	83.420118	25	40	KEEP	---	---	---	---	13	12	26	15	-1	capture	Missense_Mutation	SNP	179456812	179456812	TTN	2	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	16617	125
ACTR5	79913	broad.mit.edu	37	20	37383758	37383758	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:37383758C>T	uc002xjd.2	+	4	959	c.934C>T	c.(934-936)CGG>TGG	p.R312W		NM_024855	NP_079131	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog	312	Potential.				DNA recombination|double-strand break repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent|UV-damage excision repair	cytoplasm|Ino80 complex	ATP binding|protein binding				0		Myeloproliferative disorder(115;0.00878)				CAATGCCCGGCGGCGGGAGGA	0.597																0.326923	46.765779	48.143031	17	35	KEEP	---	---	---	---	8	12	14	22	-1	capture	Missense_Mutation	SNP	37383758	37383758	ACTR5	20	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	215	125
SALL4	57167	broad.mit.edu	37	20	50400910	50400910	+	Missense_Mutation	SNP	G	C	C			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50400910G>C	uc002xwh.3	-	4	3157	c.3056C>G	c.(3055-3057)TCC>TGC	p.S1019C	SALL4_uc010gii.2_Missense_Mutation_p.S582C|SALL4_uc002xwi.3_Missense_Mutation_p.S242C	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	1019					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						ACCCGACTGGGAGCCATCCAT	0.542																0.25	139.447064	149.423831	44	132	KEEP	---	---	---	---	26	25	63	75	-1	capture	Missense_Mutation	SNP	50400910	50400910	SALL4	20	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	13705	125
PRIC285	85441	broad.mit.edu	37	20	62195800	62195800	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62195800C>T	uc002yfm.2	-	9	5267	c.4375G>A	c.(4375-4377)GAG>AAG	p.E1459K	PRIC285_uc002yfl.1_Missense_Mutation_p.E890K	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	1459					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			TCCGCCTCCTCGTAGGACAGC	0.682																0.4	6.349018	6.392749	2	3	KEEP	---	---	---	---	2	0	2	1	-1	capture	Missense_Mutation	SNP	62195800	62195800	PRIC285	20	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12381	125
PMM1	5372	broad.mit.edu	37	22	41974860	41974860	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:41974860A>G	uc003bal.2	-	6	562	c.500T>C	c.(499-501)GTG>GCG	p.V167A		NM_002676	NP_002667	Q92871	PMM1_HUMAN	phosphomannomutase 1	167					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	metal ion binding|phosphomannomutase activity			ovary(1)	1						CAGGGCTTCCACGAACTTCTC	0.468																0.346154	57.835449	58.921582	18	34	KEEP	---	---	---	---	10	12	26	12	-1	capture	Missense_Mutation	SNP	41974860	41974860	PMM1	22	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	12039	125
SLC4A7	9497	broad.mit.edu	37	3	27431585	27431585	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:27431585C>T	uc003cdv.2	-	22	3241	c.3170G>A	c.(3169-3171)CGT>CAT	p.R1057H	SLC4A7_uc011awu.1_RNA|SLC4A7_uc011awv.1_RNA|SLC4A7_uc003cdu.3_Missense_Mutation_p.R938H|SLC4A7_uc011aww.1_Missense_Mutation_p.R1066H|SLC4A7_uc011awx.1_Missense_Mutation_p.R1053H|SLC4A7_uc011awy.1_Missense_Mutation_p.R1049H|SLC4A7_uc011awz.1_RNA|SLC4A7_uc011axa.1_Missense_Mutation_p.R938H|SLC4A7_uc011axb.1_Missense_Mutation_p.R1053H|SLC4A7_uc010hfl.2_Missense_Mutation_p.R607H|SLC4A7_uc003cdw.2_Missense_Mutation_p.R933H	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate	1057	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5						TAATTTTATACGGTCAAATAA	0.328																0.021053	-42.167708	6.608843	4	186	KEEP	---	---	---	---	2	2	88	113	-1	capture	Missense_Mutation	SNP	27431585	27431585	SLC4A7	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14550	125
MST1R	4486	broad.mit.edu	37	3	49939965	49939965	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49939965C>T	uc003cxy.3	-	1	1342	c.1078G>A	c.(1078-1080)GTG>ATG	p.V360M	MST1R_uc011bdd.1_Missense_Mutation_p.V360M|MST1R_uc011bde.1_Missense_Mutation_p.V360M|MST1R_uc011bdf.1_Missense_Mutation_p.V360M|MST1R_uc011bdg.1_Missense_Mutation_p.V360M	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	360	Extracellular (Potential).|Sema.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TTGGGGCCCACGCCAGGACCA	0.587				p.V360M(MFE319-Tumor)	205											0.376068	256.512969	259.640526	88	146	KEEP	---	---	---	---	47	47	74	83	-1	capture	Missense_Mutation	SNP	49939965	49939965	MST1R	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9801	125
ITIH1	3697	broad.mit.edu	37	3	52816072	52816072	+	Silent	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52816072C>T	uc003dfs.2	+	7	828	c.804C>T	c.(802-804)TGC>TGT	p.C268C	ITIH1_uc010hmn.1_RNA|ITIH1_uc003dft.2_5'Flank|ITIH1_uc010hmo.1_5'Flank	NM_002215	NP_002206	P19827	ITIH1_HUMAN	inter-alpha (globulin) inhibitor H1	268					hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		ACAAGATCTGCGACCTCCTGG	0.587																0.357143	119.168853	121.182166	40	72	KEEP	---	---	---	---	17	23	33	43	-1	capture	Silent	SNP	52816072	52816072	ITIH1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	7826	125
SORCS2	57537	broad.mit.edu	37	4	7666134	7666134	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:7666134C>T	uc003gkb.3	+	7	1007	c.1007C>T	c.(1006-1008)GCC>GTC	p.A336V	SORCS2_uc011bwi.1_Missense_Mutation_p.A164V	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor	336	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						ATGCTGACAGCCCCATTCGCA	0.557																0.083333	0.441804	6.753258	3	33	KEEP	---	---	---	---	1	2	24	16	-1	capture	Missense_Mutation	SNP	7666134	7666134	SORCS2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14823	125
GC	2638	broad.mit.edu	37	4	72618353	72618353	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:72618353A>G	uc003hge.2	-	11	1430	c.1277T>C	c.(1276-1278)CTA>CCA	p.L426P	GC_uc003hgd.2_Missense_Mutation_p.L304P|GC_uc010iie.2_Missense_Mutation_p.L426P|GC_uc010iif.2_Missense_Mutation_p.L445P	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor	426	Albumin 3.				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)	TTTTGCTTTTAGTCGCTCTGC	0.388																0.31068	111.364672	114.651152	32	71	KEEP	---	---	---	---	29	23	41	41	-1	capture	Missense_Mutation	SNP	72618353	72618353	GC	4	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	6222	125
FAM190A	401145	broad.mit.edu	37	4	91230163	91230163	+	Missense_Mutation	SNP	A	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:91230163A>T	uc003hsv.3	+	2	1068	c.728A>T	c.(727-729)CAA>CTA	p.Q243L	FAM190A_uc003hsu.3_Missense_Mutation_p.Q243L|FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Missense_Mutation_p.Q243L	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1	243										large_intestine(1)|ovary(1)	2						AGCTCTTTACAATCTCCTTTG	0.418																0.372263	164.600425	166.560063	51	86	KEEP	---	---	---	---	25	27	39	47	-1	capture	Missense_Mutation	SNP	91230163	91230163	FAM190A	4	A	T	T	T	1	0	0	0	0	1	0	0	0	65	5	4	4	5473	125
C4orf21	55345	broad.mit.edu	37	4	113481967	113481967	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:113481967G>T	uc003iau.2	-	19	5093	c.4882C>A	c.(4882-4884)CAA>AAA	p.Q1628K	C4orf21_uc003iav.2_RNA|C4orf21_uc003iat.2_Missense_Mutation_p.Q86K	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	450						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		GCCATCATTTGAGCTATTTGA	0.378																0.050314	-17.743871	16.354956	8	151	KEEP	---	---	---	---	1	7	90	65	0.125	capture	Missense_Mutation	SNP	113481967	113481967	C4orf21	4	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	2232	125
ANK2	287	broad.mit.edu	37	4	114251469	114251469	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:114251469C>G	uc003ibe.3	+	27	3068	c.2968C>G	c.(2968-2970)CGA>GGA	p.R990G	ANK2_uc003ibd.3_Missense_Mutation_p.R981G|ANK2_uc003ibf.3_Missense_Mutation_p.R990G|ANK2_uc011cgc.1_Missense_Mutation_p.R199G|ANK2_uc003ibg.3_Missense_Mutation_p.R18G|ANK2_uc003ibc.2_Missense_Mutation_p.R966G|ANK2_uc011cgb.1_Missense_Mutation_p.R1005G	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	990	ZU5.|Interaction with SPTBN1.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CAATGGGCTCCGAATCATTAT	0.473																0.362069	64.258749	65.229895	21	37	KEEP	---	---	---	---	11	11	19	19	-1	capture	Missense_Mutation	SNP	114251469	114251469	ANK2	4	C	G	G	G	1	0	0	0	0	1	0	0	0	295	23	4	4	618	125
C4orf43	55319	broad.mit.edu	37	4	164415798	164415798	+	Translation_Start_Site	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:164415798C>T	uc003iqq.3	+	1	126	c.-155C>T	c.(-157--153)AACGC>AATGC			NM_018352	NP_060822	Q96EY4	CD043_HUMAN	hypothetical protein LOC55319												0						TTTAGAGAAACGCACTCGCCT	0.632																0.478261	31.621398	31.630977	11	12	KEEP	---	---	---	---	6	5	10	3	-1	capture	Translation_Start_Site	SNP	164415798	164415798	C4orf43	4	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	2249	125
MYO10	4651	broad.mit.edu	37	5	16769271	16769271	+	Silent	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:16769271C>T	uc003jft.3	-	10	1440	c.972G>A	c.(970-972)CGG>CGA	p.R324R	MYO10_uc010itx.2_5'Flank	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	324	Myosin head-like.				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						TCGACACTTCCCGAACTTCCT	0.413																0.291667	20.214589	21.147981	7	17	KEEP	---	---	---	---	2	5	9	8	-1	capture	Silent	SNP	16769271	16769271	MYO10	5	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	9972	125
TSSK1B	83942	broad.mit.edu	37	5	112769636	112769636	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:112769636C>T	uc003kqm.2	-	1	1093	c.901G>A	c.(901-903)GAA>AAA	p.E301K	MCC_uc003kql.3_Intron	NM_032028	NP_114417	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1	301					cell differentiation|multicellular organismal development|spermatogenesis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|skin(2)|stomach(1)	5		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		GAGCCAGGTTCGGGGGTCCAC	0.622					32											0.243902	25.831507	28.280713	10	31	KEEP	---	---	---	---	9	2	21	15	-1	capture	Missense_Mutation	SNP	112769636	112769636	TSSK1B	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16550	125
PCDHGA1	56114	broad.mit.edu	37	5	140711854	140711854	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140711854C>T	uc003lji.1	+	1	1603	c.1603C>T	c.(1603-1605)CGG>TGG	p.R535W	PCDHGA1_uc011dan.1_Missense_Mutation_p.R535W	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	535	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTGATGGCGCGGGACAGTGG	0.602																0.325228	290.105479	299.028558	107	222	KEEP	---	---	---	---	61	55	120	137	-1	capture	Missense_Mutation	SNP	140711854	140711854	PCDHGA1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	11453	125
FBXO38	81545	broad.mit.edu	37	5	147782003	147782003	+	Silent	SNP	A	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:147782003A>G	uc003lpf.1	+	5	639	c.519A>G	c.(517-519)GGA>GGG	p.G173G	FBXO38_uc003lpg.1_Silent_p.G173G|FBXO38_uc003lph.2_Silent_p.G173G	NM_205836	NP_995308	Q6PIJ6	FBX38_HUMAN	F-box protein 38 isoform b	173						cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCGTAATGGAGCTTTTCCAA	0.363																0.015464	-45.256976	6.410119	3	191	KEEP	---	---	---	---	2	1	111	91	-1	capture	Silent	SNP	147782003	147782003	FBXO38	5	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	5692	125
EXOC2	55770	broad.mit.edu	37	6	619481	619481	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:619481C>T	uc003mtd.2	-	5	619	c.485G>A	c.(484-486)AGT>AAT	p.S162N	EXOC2_uc003mte.2_Missense_Mutation_p.S162N|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein	162					exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		GAAATTCTCACTTGTAAAATC	0.378																0.055556	-7.845729	14.602333	6	102	KEEP	---	---	---	---	5	4	51	65	-1	capture	Missense_Mutation	SNP	619481	619481	EXOC2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	5257	125
HLA-DQA2	3118	broad.mit.edu	37	6	32713607	32713607	+	Missense_Mutation	SNP	C	T	T	rs144060347		TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32713607C>T	uc003obx.2	+	3	429	c.371C>T	c.(370-372)ACG>ATG	p.T124M		NM_020056	NP_064440	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ	124	Alpha-2.|Extracellular (Potential).|Ig-like C1-type.				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTTCCTGTGACGCTGGGTCAG	0.507																0.42953	196.970956	197.617211	64	85	KEEP	---	---	---	---	42	29	60	34	-1	capture	Missense_Mutation	SNP	32713607	32713607	HLA-DQA2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7130	125
BMP5	653	broad.mit.edu	37	6	55620351	55620351	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55620351G>A	uc003pcq.2	-	7	2057	c.1345C>T	c.(1345-1347)CGC>TGC	p.R449C	BMP5_uc011dxf.1_Missense_Mutation_p.R412C	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein	449					cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			CCACATGAGCGTACTACCATA	0.328																0.360656	63.842894	64.881289	22	39	KEEP	---	---	---	---	10	15	22	22	-1	capture	Missense_Mutation	SNP	55620351	55620351	BMP5	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1451	125
C6orf167	253714	broad.mit.edu	37	6	97613246	97613246	+	Nonsense_Mutation	SNP	G	A	A	rs146474162	by1000genomes	TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:97613246G>A	uc003ppb.2	-	21	3363	c.3097C>T	c.(3097-3099)CGA>TGA	p.R1033*	C6orf167_uc011eaf.1_Nonsense_Mutation_p.R993*	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714	1033					double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		GGAAGAAATCGCCCAATATAC	0.393																0.333333	105.028091	107.763739	37	74	KEEP	---	---	---	---	22	19	41	34	-1	capture	Nonsense_Mutation	SNP	97613246	97613246	C6orf167	6	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	2319	125
GRIK2	2898	broad.mit.edu	37	6	102483322	102483322	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:102483322C>G	uc003pqp.3	+	14	2441	c.2192C>G	c.(2191-2193)TCT>TGT	p.S731C	GRIK2_uc003pqo.3_Missense_Mutation_p.S731C|GRIK2_uc010kcw.2_Missense_Mutation_p.S731C	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	731	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	GTCCTCACCTCTGATTATGCT	0.443																0.342857	342.01592	348.12419	96	184	KEEP	---	---	---	---	50	55	100	99	-1	capture	Missense_Mutation	SNP	102483322	102483322	GRIK2	6	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	6707	125
PCLO	27445	broad.mit.edu	37	7	82508670	82508670	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82508670G>A	uc003uhx.2	-	10	13926	c.13637C>T	c.(13636-13638)ACG>ATG	p.T4546M	PCLO_uc003uhv.2_Missense_Mutation_p.T4546M|PCLO_uc003uht.1_Translation_Start_Site|PCLO_uc003uhu.1_Translation_Start_Site	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						AAGCTTCCCCGTCTGTTCCGC	0.358																0.27451	39.028243	41.363617	14	37	KEEP	---	---	---	---	8	9	23	18	-1	capture	Missense_Mutation	SNP	82508670	82508670	PCLO	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11486	125
CSMD1	64478	broad.mit.edu	37	8	4277522	4277522	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:4277522G>A	uc011kwk.1	-	3	758	c.368C>T	c.(367-369)ACG>ATG	p.T123M		NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	123	Extracellular (Potential).|CUB 1.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GAAGTCTGTCGTGAACCACAG	0.403																0.411765	21.321435	21.437159	7	10	KEEP	---	---	---	---	3	5	4	8	-1	capture	Missense_Mutation	SNP	4277522	4277522	CSMD1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3909	125
ADAM7	8756	broad.mit.edu	37	8	24357714	24357714	+	Nonsense_Mutation	SNP	C	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24357714C>A	uc003xeb.2	+	18	2060	c.1947C>A	c.(1945-1947)TGC>TGA	p.C649*	ADAM7_uc003xec.2_Nonsense_Mutation_p.C421*	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN	a disintegrin and metalloproteinase domain 7	649	Extracellular (Potential).|Cys-rich.				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		gaCTCCAGTGCCACTGTGAGG	0.328																0.333333	26.72504	27.470601	10	20	KEEP	---	---	---	---	3	8	10	12	0.727272727273	capture	Nonsense_Mutation	SNP	24357714	24357714	ADAM7	8	C	A	A	A	1	0	0	0	0	0	1	0	0	337	26	5	4	251	125
XKR9	389668	broad.mit.edu	37	8	71646034	71646034	+	Missense_Mutation	SNP	C	T	T	rs140711820		TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:71646034C>T	uc003xyq.2	+	5	1031	c.497C>T	c.(496-498)GCG>GTG	p.A166V	XKR9_uc010lze.2_Missense_Mutation_p.A166V|XKR9_uc010lzd.2_Missense_Mutation_p.A34V	NM_001011720	NP_001011720	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related	166	Helical; (Potential).					integral to membrane				ovary(1)|skin(1)	2	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)			TTTGTAGATGCGGCCATCATG	0.274																0.369863	77.102613	78.190414	27	46	KEEP	---	---	---	---	13	16	29	18	-1	capture	Missense_Mutation	SNP	71646034	71646034	XKR9	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17319	125
GLIS3	169792	broad.mit.edu	37	9	4117963	4117963	+	Silent	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:4117963G>A	uc003zhw.1	-	3	1244	c.1050C>T	c.(1048-1050)ATC>ATT	p.I350I	GLIS3_uc003zhx.1_Silent_p.I505I|GLIS3_uc003zic.1_Silent_p.I505I|GLIS3_uc003zie.1_Silent_p.I505I|GLIS3_uc010mhh.1_Silent_p.I380I|GLIS3_uc003zid.1_Silent_p.I283I|GLIS3_uc010mhi.1_Silent_p.I312I|GLIS3_uc003zif.1_Silent_p.I283I|GLIS3_uc003zig.1_Silent_p.I349I|GLIS3_uc003zih.1_Silent_p.I283I|GLIS3_uc003zhy.1_Silent_p.I283I|GLIS3_uc003zhz.1_Silent_p.I283I|GLIS3_uc003zib.1_Silent_p.I349I|GLIS3_uc010mhg.1_Silent_p.I283I	NM_152629	NP_689842	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3 isoform b	350	C2H2-type 1.				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		CGCTGCAGTCGATCCAGCGGC	0.667																0.3	66.769852	69.628251	24	56	KEEP	---	---	---	---	17	14	40	30	-1	capture	Silent	SNP	4117963	4117963	GLIS3	9	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	6383	125
TESK1	7016	broad.mit.edu	37	9	35609198	35609198	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35609198G>A	uc003zxa.2	+	10	1676	c.1340G>A	c.(1339-1341)CGT>CAT	p.R447H	TESK1_uc003zwz.1_RNA|TESK1_uc010mks.2_Missense_Mutation_p.R287H	NM_006285	NP_006276	Q15569	TESK1_HUMAN	testis-specific protein kinase 1	447					cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CTCCCCCGCCGTATGGAGACA	0.687					56											0.463158	134.698729	134.809294	44	51	KEEP	---	---	---	---	30	35	60	51	-1	capture	Missense_Mutation	SNP	35609198	35609198	TESK1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15652	125
FBP2	8789	broad.mit.edu	37	9	97333806	97333806	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:97333806C>T	uc004auv.2	-	4	572	c.505G>A	c.(505-507)GGT>AGT	p.G169S	uc004auu.2_Intron	NM_003837	NP_003828	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	169					fructose metabolic process|gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)				GTTGCACTACCGTACAGCGCA	0.552																0.385417	116.560932	117.662596	37	59	KEEP	---	---	---	---	19	20	33	32	-1	capture	Missense_Mutation	SNP	97333806	97333806	FBP2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5652	125
USP20	10868	broad.mit.edu	37	9	132638480	132638480	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:132638480C>T	uc004bys.2	+	22	2583	c.2372C>T	c.(2371-2373)GCC>GTC	p.A791V	USP20_uc004byr.2_Missense_Mutation_p.A791V|USP20_uc004byt.1_Missense_Mutation_p.A791V	NM_001110303	NP_001103773	Q9Y2K6	UBP20_HUMAN	ubiquitin specific protease 20	791	DUSP 2.				endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|ubiquitin thiolesterase activity|zinc ion binding			lung(1)|breast(1)	2		Ovarian(14;0.00556)				GAGGCACTGGCCAAGCGCAGG	0.677																0.432432	47.914762	48.057217	16	21	KEEP	---	---	---	---	11	8	12	11	-1	capture	Missense_Mutation	SNP	132638480	132638480	USP20	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16934	125
DMD	1756	broad.mit.edu	37	X	31165414	31165414	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:31165414C>G	uc004dda.1	-	75	11019	c.10775G>C	c.(10774-10776)AGG>ACG	p.R3592T	DMD_uc004dcq.1_Missense_Mutation_p.R863T|DMD_uc004dcr.1_Missense_Mutation_p.R1012T|DMD_uc004dcs.1_Missense_Mutation_p.R1022T|DMD_uc004dct.1_Missense_Mutation_p.R1132T|DMD_uc004dcu.1_Missense_Mutation_p.R1132T|DMD_uc004dcv.1_Missense_Mutation_p.R1119T|DMD_uc004dcw.2_Missense_Mutation_p.R2248T|DMD_uc004dcx.2_Missense_Mutation_p.R2251T|DMD_uc004dcz.2_Missense_Mutation_p.R3469T|DMD_uc004dcy.1_Missense_Mutation_p.R3588T|DMD_uc004ddb.1_Missense_Mutation_p.R3584T|DMD_uc004dcm.1_Missense_Mutation_p.R524T|DMD_uc004dcn.1_Missense_Mutation_p.R511T|DMD_uc004dco.1_Missense_Mutation_p.R524T|DMD_uc004dcp.1_Missense_Mutation_p.R511T|DMD_uc011mkb.1_Missense_Mutation_p.R414T	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	3592					muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTGCCTTAGCCTGTGTAACTG	0.458																0.696078	254.251775	257.747483	71	31	KEEP	---	---	---	---	51	31	20	15	-1	capture	Missense_Mutation	SNP	31165414	31165414	DMD	23	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	4538	125
MAGEB16	139604	broad.mit.edu	37	X	35820765	35820765	+	Missense_Mutation	SNP	T	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:35820765T>A	uc010ngt.1	+	2	731	c.452T>A	c.(451-453)TTC>TAC	p.F151Y		NM_001099921	NP_001093391	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	151	MAGE.									lung(3)|ovary(2)|breast(1)|skin(1)	7						GAGAGCCACTTCTCTGAGATC	0.448					43											0.703125	144.396072	146.755993	45	19	KEEP	---	---	---	---	26	22	6	15	-1	capture	Missense_Mutation	SNP	35820765	35820765	MAGEB16	23	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	9088	125
TGIF2LX	90316	broad.mit.edu	37	X	89177576	89177576	+	Silent	SNP	G	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:89177576G>A	uc004efe.2	+	2	541	c.492G>A	c.(490-492)AAG>AAA	p.K164K		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	164						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						CCTTGCCAAAGGGCCAGATGT	0.592																0.733333	75.861535	77.335679	22	8	KEEP	---	---	---	---	9	17	7	9	-1	capture	Silent	SNP	89177576	89177576	TGIF2LX	23	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	15712	125
DIAPH2	1730	broad.mit.edu	37	X	96212894	96212894	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:96212894G>T	uc004efu.3	+	16	2078	c.1682G>T	c.(1681-1683)GGG>GTG	p.G561V	DIAPH2_uc004eft.3_Missense_Mutation_p.G561V	NM_006729	NP_006720	O60879	DIAP2_HUMAN	diaphanous 2 isoform 156	561	FH1.				cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4						CCAGGTGTAGGGCCGCCTCCA	0.537																0.733333	36.331205	37.069489	11	4	KEEP	---	---	---	---	7	7	1	3	0.5	capture	Missense_Mutation	SNP	96212894	96212894	DIAPH2	23	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	4477	125
MAGEC2	51438	broad.mit.edu	37	X	141291061	141291061	+	Missense_Mutation	SNP	A	T	T			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:141291061A>T	uc004fbu.1	-	3	1061	c.713T>A	c.(712-714)TTC>TAC	p.F238Y		NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	238	MAGE.					cytoplasm|nucleus				breast(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					GCCCTTTATGAAGATCACACT	0.512													HNSCC(46;0.14)			0.71223	320.572363	326.183955	99	40	KEEP	---	---	---	---	58	49	21	23	-1	capture	Missense_Mutation	SNP	141291061	141291061	MAGEC2	23	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	9095	125
MAGEA12	4111	broad.mit.edu	37	X	151900207	151900207	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151900207C>A	uc010ntp.2	-	3	948	c.594G>T	c.(592-594)AAG>AAT	p.K198N	MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Missense_Mutation_p.K198N	NM_005367	NP_005358	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	198	MAGE.									skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GGAGGCCTGTCTTGGGCACGA	0.577																0.823077	340.279876	353.055709	107	23	KEEP	---	---	---	---	56	58	16	8	0.508771929825	capture	Missense_Mutation	SNP	151900207	151900207	MAGEA12	23	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	9080	125
SPRY3	10251	broad.mit.edu	37	X	155003952	155003952	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:155003952C>A	uc004fnq.1	+	2	873	c.419C>A	c.(418-420)CCT>CAT	p.P140H	SPRY3_uc010nvl.1_Intron	NM_005840	NP_005831	O43610	SPY3_HUMAN	sprouty homolog 3	140					multicellular organismal development|regulation of signal transduction	cytoplasm|membrane					0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCAGGGCACCCTAGTGAGCAC	0.612																0.301471	117.219992	122.00822	41	95	KEEP	---	---	---	---	20	23	54	45	0.53488372093	capture	Missense_Mutation	SNP	155003952	155003952	SPRY3	23	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	14999	125
C12orf50	160419	broad.mit.edu	37	12	88388465	88388466	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:88388465_88388466delTA	uc001tam.1	-	7	704_705	c.536_537delTA	c.(535-537)ATAfs	p.I179fs	C12orf50_uc001tan.2_Frame_Shift_Del_p.I233fs	NM_152589	NP_689802	Q8NA57	CL050_HUMAN	hypothetical protein LOC160419	179										skin(2)|ovary(1)	3						ATGATGTTTTTATTTCACCTTG	0.347																0.33			64	128		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	88388465	88388466	C12orf50	12	TA	-	-	-	1	0	1	0	1	0	0	0	0	784	61	5	5	1681	125
BRPF3	27154	broad.mit.edu	37	6	36175096	36175096	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-3649-01	TCGA-12-3649-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:36175096delC	uc003olv.3	+	4	1836	c.1612delC	c.(1612-1614)CAGfs	p.Q538fs	BRPF3_uc010jwb.2_Frame_Shift_Del_p.Q538fs|BRPF3_uc011dtj.1_RNA|BRPF3_uc010jwc.2_RNA|BRPF3_uc011dtk.1_Frame_Shift_Del_p.Q538fs	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	538					histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2						GTAGCGAGAGCAGGATGAGAA	0.547																0.25			19	56		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	36175096	36175096	BRPF3	6	C	-	-	-	1	0	1	0	1	0	0	0	0	325	25	5	5	1509	125
