Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA1751	85452	broad.mit.edu	37	1	1900084	1900084	+	Missense_Mutation	SNP	G	A	A	rs150108692	by1000genomes	TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1900084G>A	uc001aim.1	-	11	1391	c.1235C>T	c.(1234-1236)ACG>ATG	p.T412M	KIAA1751_uc009vkz.1_Missense_Mutation_p.T412M	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	412										pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CAGTGTGTACGTGTTGGTTGG	0.582																0.437811	263.560781	264.23885	88	113	KEEP	---	---	---	---	56	43	73	58	-1	capture	Missense_Mutation	SNP	1900084	1900084	KIAA1751	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8178	128
MTF1	4520	broad.mit.edu	37	1	38323155	38323155	+	Missense_Mutation	SNP	T	C	C			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38323155T>C	uc001cce.1	-	2	317	c.176A>G	c.(175-177)GAG>GGG	p.E59G	MTF1_uc009vvj.1_5'UTR	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	59						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ATCTTCATCCTCCAAAGTGCC	0.488																0.017544	-38.026155	6.875028	3	168	KEEP	---	---	---	---	2	1	90	81	-1	capture	Missense_Mutation	SNP	38323155	38323155	MTF1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	9832	128
WDR65	149465	broad.mit.edu	37	1	43649424	43649424	+	Missense_Mutation	SNP	G	A	A	rs142914910		TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43649424G>A	uc001cip.1	+	4	758	c.637G>A	c.(637-639)GTT>ATT	p.V213I	EBNA1BP2_uc001cio.2_Intron|WDR65_uc010ojz.1_Missense_Mutation_p.V202I|WDR65_uc001ciq.1_Missense_Mutation_p.V213I	NM_152498	NP_689711	Q96MR6	WDR65_HUMAN	WD repeat domain 65	213	WD 3.									skin(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CAAGATTGTCGTTGGCACTGA	0.502																0.511312	356.972482	356.996945	113	108	KEEP	---	---	---	---	53	68	46	69	-1	capture	Missense_Mutation	SNP	43649424	43649424	WDR65	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17197	128
RAD54L	8438	broad.mit.edu	37	1	46726266	46726266	+	Missense_Mutation	SNP	C	T	T	rs149141765		TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46726266C>T	uc009vye.2	+	7	574	c.460C>T	c.(460-462)CGG>TGG	p.R154W	RAD54L_uc001cpl.2_Missense_Mutation_p.R154W|RAD54L_uc001cpm.1_5'UTR	NM_001142548	NP_001136020	Q92698	RAD54_HUMAN	RAD54-like protein	154					meiosis	nucleus	ATP binding|DNA binding|helicase activity			ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		TAAGGTTTTGCGGCCTCATCA	0.537											Direct_reversal_of_damage|Homologous_recombination					0.021739	-39.866572	7.149411	4	180	KEEP	---	---	---	---	1	3	114	91	-1	capture	Missense_Mutation	SNP	46726266	46726266	RAD54L	1	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	12888	128
LMX1A	4009	broad.mit.edu	37	1	165177351	165177351	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:165177351G>A	uc001gcy.1	-	6	987	c.766C>T	c.(766-768)CGA>TGA	p.R256*	LMX1A_uc001gcz.1_Nonsense_Mutation_p.R256*|LMX1A_uc001gcw.1_5'UTR|LMX1A_uc001gcx.1_Nonsense_Mutation_p.R7*	NM_177398	NP_796372	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	256	Gln-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)					TGCTGCTGTCGCCTGGCCAGC	0.562																0.474576	80.695464	80.728523	28	31	KEEP	---	---	---	---	21	10	18	21	-1	capture	Nonsense_Mutation	SNP	165177351	165177351	LMX1A	1	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	8781	128
KIF20B	9585	broad.mit.edu	37	10	91498196	91498196	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:91498196A>G	uc001kgs.1	+	20	3670	c.3598A>G	c.(3598-3600)AAT>GAT	p.N1200D	KIF20B_uc001kgr.1_Missense_Mutation_p.N1160D|KIF20B_uc001kgt.1_Missense_Mutation_p.N411D|KIF20B_uc009xtw.1_RNA	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	1200					cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						GCTAGAAAGAAATTTGAAGGA	0.318																0.309859	75.525413	77.811163	22	49	KEEP	---	---	---	---	11	12	29	21	-1	capture	Missense_Mutation	SNP	91498196	91498196	KIF20B	10	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	8209	128
ZNF518A	9849	broad.mit.edu	37	10	97916083	97916083	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:97916083C>T	uc001klp.2	+	6	861	c.4C>T	c.(4-6)CCA>TCA	p.P2S	ZNF518A_uc001klo.1_Intron|ZNF518A_uc001klq.2_Missense_Mutation_p.P2S|ZNF518A_uc001klr.2_Missense_Mutation_p.P2S	NM_014803	NP_055618	Q6AHZ1	Z518A_HUMAN	zinc finger protein 518	2					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TTAAATCATGCCATCTGAACA	0.308																0.057692	-4.320137	6.353382	3	49	KEEP	---	---	---	---	1	4	28	27	-1	capture	Missense_Mutation	SNP	97916083	97916083	ZNF518A	10	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	17841	128
HEPHL1	341208	broad.mit.edu	37	11	93826783	93826783	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:93826783G>A	uc001pep.2	+	13	2568	c.2411G>A	c.(2410-2412)CGA>CAA	p.R804Q	uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	804	Plastocyanin-like 5.|Extracellular (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CGACCACCACGAGAGGAGCAC	0.483																0.681034	263.861713	267.238635	79	37	KEEP	---	---	---	---	44	38	18	21	-1	capture	Missense_Mutation	SNP	93826783	93826783	HEPHL1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6981	128
PGR	5241	broad.mit.edu	37	11	100920711	100920711	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:100920711C>A	uc001pgh.2	-	6	3180	c.2437G>T	c.(2437-2439)GTT>TTT	p.V813F	PGR_uc001pgg.2_Missense_Mutation_p.V194F|PGR_uc001pgi.2_Missense_Mutation_p.V711F|PGR_uc009yww.1_Intron|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	813	Steroid-binding.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)	TCTTGGCTAACTTGAAGCTTG	0.368	Pancreas(124;2271 2354 21954 22882)				429											0.307692	78.563646	81.564987	28	63	KEEP	---	---	---	---	11	20	37	27	0.645161290323	capture	Missense_Mutation	SNP	100920711	100920711	PGR	11	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	11708	128
NTF3	4908	broad.mit.edu	37	12	5603770	5603770	+	Silent	SNP	G	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5603770G>A	uc001qnl.3	+	1	473	c.390G>A	c.(388-390)GCG>GCA	p.A130A	NTF3_uc001qnk.3_Silent_p.A143A	NM_002527	NP_002518	P20783	NTF3_HUMAN	neurotrophin 3 isoform 2 preproprotein	130					signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1						CCGTGGTGGCGAACAGAACAT	0.602	GBM(194;1104 2182 8339 9578 18493)															0.191781	57.713832	70.682407	28	118	KEEP	---	---	---	---	18	12	70	62	-1	capture	Silent	SNP	5603770	5603770	NTF3	12	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	10603	128
C1S	716	broad.mit.edu	37	12	7177641	7177641	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7177641G>A	uc001qsj.2	+	15	2472	c.1753G>A	c.(1753-1755)GCA>ACA	p.A585T	C1S_uc001qsk.2_Missense_Mutation_p.A585T|C1S_uc001qsl.2_Missense_Mutation_p.A585T|C1S_uc009zfr.2_Missense_Mutation_p.A418T|C1S_uc009zfs.2_RNA	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent	585	Peptidase S1.				complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	CCTCAAGGCGGCAAGGTTACC	0.512	GBM(156;750 1943 12971 24779 31015)															0.032	-22.514606	7.428628	4	121	KEEP	---	---	---	---	2	2	60	66	-1	capture	Missense_Mutation	SNP	7177641	7177641	C1S	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	1956	128
SPPL2A	84888	broad.mit.edu	37	15	51041869	51041869	+	Silent	SNP	A	G	G			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:51041869A>G	uc001zyv.2	-	2	321	c.141T>C	c.(139-141)CCT>CCC	p.P47P		NM_032802	NP_116191	Q8TCT8	PSL2_HUMAN	signal peptide peptidase-like 2A	47	Cytoplasmic (Potential).					integral to membrane	aspartic-type endopeptidase activity				0				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		CTGTCCAATAAGGGTTATAAA	0.363	Melanoma(50;790 1209 4069 22965 33125)															0.010169	-74.860246	6.659957	3	292	KEEP	---	---	---	---	3	1	199	143	-1	capture	Silent	SNP	51041869	51041869	SPPL2A	15	A	G	G	G	1	0	0	0	0	0	0	0	1	28	3	3	3	14980	128
ACAP1	9744	broad.mit.edu	37	17	7250193	7250193	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7250193C>A	uc002ggd.2	+	13	1280	c.1074C>A	c.(1072-1074)AGC>AGA	p.S358R		NM_014716	NP_055531	Q15027	ACAP1_HUMAN	centaurin beta1	358	PH.|Required for formation of endosomal tubules when overexpressed with PIP5K1C.				intracellular signal transduction|lipid metabolic process|protein transport|regulation of ARF GTPase activity		ARF GTPase activator activity|phospholipase C activity|protein binding|zinc ion binding			breast(2)|large_intestine(1)	3						TGCAGAGCAGCATTGCTTCTG	0.637																0.646259	306.953184	309.721079	95	52	KEEP	---	---	---	---	56	41	22	31	0.422680412371	capture	Missense_Mutation	SNP	7250193	7250193	ACAP1	17	C	A	A	A	1	0	0	0	0	1	0	0	0	324	25	4	4	118	128
TNS4	84951	broad.mit.edu	37	17	38635988	38635988	+	Silent	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38635988C>T	uc010cxb.2	-	10	2012	c.1848G>A	c.(1846-1848)ACG>ACA	p.T616T	TNS4_uc002huu.3_Intron	NM_032865	NP_116254	Q8IZW8	TENS4_HUMAN	tensin 4 precursor	616	Phosphatase tensin-type.				apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			CCACGGTGGGCGTGGGGAGGA	0.617																0.25	45.875477	50.414949	20	60	KEEP	---	---	---	---	11	10	36	34	-1	capture	Silent	SNP	38635988	38635988	TNS4	17	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	16228	128
KRTAP4-11	653240	broad.mit.edu	37	17	39274446	39274446	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274446C>T	uc002hvz.2	-	1	161	c.122G>A	c.(121-123)CGC>CAC	p.R41H		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	41	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCAGCTGGGGCGACAGTAGGT	0.667																0.597015	126.307669	126.859022	40	27	KEEP	---	---	---	---	25	18	22	13	-1	capture	Missense_Mutation	SNP	39274446	39274446	KRTAP4-11	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8469	128
ARL4D	379	broad.mit.edu	37	17	41477126	41477126	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41477126C>T	uc002idt.2	+	2	207	c.26C>T	c.(25-27)GCG>GTG	p.A9V		NM_001661	NP_001652	P49703	ARL4D_HUMAN	ADP-ribosylation factor-like 4D	9					protein secretion|small GTPase mediated signal transduction	cytoplasm|nucleolus|plasma membrane	GTP binding|GTPase activity|protein binding			ovary(1)	1		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.155)		ACTGAGATGGCGCCCACTGCC	0.572																0.336449	101.978217	104.504633	36	71	KEEP	---	---	---	---	21	17	35	39	-1	capture	Missense_Mutation	SNP	41477126	41477126	ARL4D	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	931	128
TUBB4	10382	broad.mit.edu	37	19	6495656	6495656	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6495656G>A	uc002mfg.1	-	4	961	c.854C>T	c.(853-855)ACG>ATG	p.T285M	TUBB4_uc002mff.1_Missense_Mutation_p.T213M|MIR220B_hsa-mir-220b|MI0005529_5'Flank	NM_006087	NP_006078	P04350	TBB4_HUMAN	tubulin, beta 4	285					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(2)	2		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)		CTCGGGCACCGTCAGGGCCCG	0.672																0.386364	143.199005	144.69053	51	81	KEEP	---	---	---	---	35	31	53	42	-1	capture	Missense_Mutation	SNP	6495656	6495656	TUBB4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16640	128
VAV1	7409	broad.mit.edu	37	19	6843162	6843162	+	Missense_Mutation	SNP	T	C	C			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6843162T>C	uc002mfu.1	+	22	2094	c.1997T>C	c.(1996-1998)CTG>CCG	p.L666P	VAV1_uc010xjh.1_Missense_Mutation_p.L634P|VAV1_uc010dva.1_Missense_Mutation_p.L644P|VAV1_uc002mfv.1_Missense_Mutation_p.L611P	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	666					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						CCTCAGGACCTGTCTGTTCAT	0.468					494											0.016287	-72.11365	9.205741	5	302	KEEP	---	---	---	---	2	5	202	147	-1	capture	Missense_Mutation	SNP	6843162	6843162	VAV1	19	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	17013	128
CDC42EP3	10602	broad.mit.edu	37	2	37873026	37873026	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:37873026C>A	uc002rqi.1	-	2	1698	c.705G>T	c.(703-705)CAG>CAT	p.Q235H		NM_006449	NP_006440	Q9UKI2	BORG2_HUMAN	Cdc42 effector protein 3	235					regulation of cell shape|signal transduction	actin cytoskeleton|cytoplasm|endomembrane system|membrane	cytoskeletal regulatory protein binding				0		all_hematologic(82;0.172)				CAAGATCAAGCTGCAGGGAGA	0.463																0.019139	-47.597293	6.731586	4	205	KEEP	---	---	---	---	3	1	103	105	0.25	capture	Missense_Mutation	SNP	37873026	37873026	CDC42EP3	2	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	3048	128
LRP1B	53353	broad.mit.edu	37	2	141130669	141130669	+	Missense_Mutation	SNP	C	T	T	rs145915063		TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:141130669C>T	uc002tvj.1	-	69	11648	c.10676G>A	c.(10675-10677)CGG>CAG	p.R3559Q		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3559	Extracellular (Potential).|LDL-receptor class A 27.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATTGGAACACCGGAACTGATC	0.368	Colon(99;50 2074 2507 20106)			p.R3559L(AML193-Tumor)	2546								TSP Lung(27;0.18)			0.483092	319.899114	319.950031	100	107	KEEP	---	---	---	---	39	64	48	60	-1	capture	Missense_Mutation	SNP	141130669	141130669	LRP1B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8871	128
DFNB59	494513	broad.mit.edu	37	2	179323290	179323290	+	Silent	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179323290C>T	uc002umi.3	+	5	959	c.603C>T	c.(601-603)TTC>TTT	p.F201F	DFNB59_uc002umj.3_Silent_p.F201F	NM_001042702	NP_001036167	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	201					sensory perception of sound						0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			CTATTGTTTTCCCAGCACATA	0.343																0.418182	283.258541	284.545158	92	128	KEEP	---	---	---	---	52	42	71	61	-1	capture	Silent	SNP	179323290	179323290	DFNB59	2	C	T	T	T	1	0	0	0	0	0	0	0	1	389	30	2	2	4414	128
ITSN1	6453	broad.mit.edu	37	21	35206635	35206635	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:35206635G>A	uc002yta.1	+	28	3644	c.3376G>A	c.(3376-3378)GGC>AGC	p.G1126S	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Missense_Mutation_p.G1050S|ITSN1_uc010gmg.2_Missense_Mutation_p.G1013S|ITSN1_uc010gmh.2_RNA|ITSN1_uc002ysw.2_Missense_Mutation_p.G1126S|ITSN1_uc010gmi.2_Missense_Mutation_p.G1089S|ITSN1_uc010gmj.2_Missense_Mutation_p.G1005S|ITSN1_uc002ysy.2_Missense_Mutation_p.G1121S|ITSN1_uc002ysx.2_Missense_Mutation_p.G1084S|ITSN1_uc002ytb.1_Missense_Mutation_p.G1121S|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Missense_Mutation_p.G1018S|ITSN1_uc010gml.2_RNA|ITSN1_uc002ytj.2_Missense_Mutation_p.G1121S|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Missense_Mutation_p.G989S|ITSN1_uc002yti.1_RNA	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	1126	SH3 4.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						GCGCCAGATAGGCTGGTTCCC	0.423																0.588235	142.01203	142.474041	40	28	KEEP	---	---	---	---	18	27	10	20	-1	capture	Missense_Mutation	SNP	35206635	35206635	ITSN1	21	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	7849	128
KRTAP10-3	386682	broad.mit.edu	37	21	45978262	45978262	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45978262C>T	uc002zfj.1	-	1	382	c.337G>A	c.(337-339)GTC>ATC	p.V113I	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198696	NP_941969	P60369	KR103_HUMAN	keratin associated protein 10-3	113	9.|18 X 5 AA repeats of C-C-X(3).					keratin filament				skin(1)	1						ttgcagcagacgggcacacag	0.189																0.648045	373.544079	377.008242	116	63	KEEP	---	---	---	---	66	70	33	40	-1	capture	Missense_Mutation	SNP	45978262	45978262	KRTAP10-3	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8430	128
P4HTM	54681	broad.mit.edu	37	3	49042445	49042445	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49042445G>A	uc003cvg.2	+	6	1388	c.1039G>A	c.(1039-1041)GCC>ACC	p.A347T	P4HTM_uc003cvh.2_Missense_Mutation_p.A347T|WDR6_uc011bbx.1_5'Flank|WDR6_uc003cvj.2_5'Flank|WDR6_uc011bby.1_5'Flank|WDR6_uc010hkn.2_5'Flank|WDR6_uc011bbz.1_5'Flank	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase	347	Lumenal (Potential).|Fe2OG dioxygenase.					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)	CAAGCTGGTAGCCAACGAGTC	0.587																0.138462	14.730394	22.944599	9	56	KEEP	---	---	---	---	2	9	40	26	-1	capture	Missense_Mutation	SNP	49042445	49042445	P4HTM	3	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	11264	128
ATR	545	broad.mit.edu	37	3	142281611	142281611	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142281611C>T	uc003eux.3	-	4	755	c.633G>A	c.(631-633)ATG>ATA	p.M211I		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	211					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						GAGTAAGAACCATTAATAAAG	0.318					936						Other_conserved_DNA_damage_response_genes					0.054795	-5.663332	9.577118	4	69	KEEP	---	---	---	---	2	2	24	46	-1	capture	Missense_Mutation	SNP	142281611	142281611	ATR	3	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	1195	128
PCYT1A	5130	broad.mit.edu	37	3	195965646	195965646	+	Silent	SNP	G	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195965646G>A	uc003fwg.2	-	10	1190	c.1017C>T	c.(1015-1017)TCC>TCT	p.S339S	uc003fwf.1_5'Flank|PCYT1A_uc003fwh.2_Silent_p.S339S	NM_005017	NP_005008	P49585	PCY1A_HUMAN	choline phosphate cytidylyltransferase 1 alpha	339	3 X repeats.					cytosol|soluble fraction	choline-phosphate cytidylyltransferase activity				0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)	AAGTCTTGCCGGAGAAGGGCC	0.607																0.033333	-15.051931	6.322988	3	87	KEEP	---	---	---	---	2	1	47	44	-1	capture	Silent	SNP	195965646	195965646	PCYT1A	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11513	128
CDH9	1007	broad.mit.edu	37	5	26881547	26881547	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:26881547G>A	uc003jgs.1	-	12	2237	c.2068C>T	c.(2068-2070)CGG>TGG	p.R690W	CDH9_uc011cnv.1_Missense_Mutation_p.R283W	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	690	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						ATTACATCCCGTCTAAGTTTA	0.408	Melanoma(8;187 585 15745 40864 52829)															0.535865	400.269945	400.530145	127	110	KEEP	---	---	---	---	64	69	75	38	-1	capture	Missense_Mutation	SNP	26881547	26881547	CDH9	5	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	3088	128
GDNF	2668	broad.mit.edu	37	5	37815950	37815950	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:37815950C>T	uc011cpi.1	-	3	639	c.439G>A	c.(439-441)GGC>AGC	p.G147S	GDNF_uc011cpc.1_Missense_Mutation_p.G69S|GDNF_uc011cpd.1_Missense_Mutation_p.G95S|GDNF_uc011cpe.1_Missense_Mutation_p.G121S|GDNF_uc011cpf.1_Missense_Mutation_p.G121S|GDNF_uc011cpg.1_Missense_Mutation_p.G164S|GDNF_uc011cph.1_Missense_Mutation_p.G138S	NM_000514	NP_000505	P39905	GDNF_HUMAN	glial cell derived neurotrophic factor isoform 1	147					adult locomotory behavior|anti-apoptosis|axon guidance|branching involved in ureteric bud morphogenesis|enteric nervous system development|mRNA stabilization|negative regulation of neuron apoptosis|neural crest cell migration|peristalsis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of dopamine secretion|positive regulation of monooxygenase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of ureteric bud formation|postganglionic parasympathetic nervous system development|regulation of dopamine uptake|signal transduction|sympathetic nervous system development	extracellular region	growth factor activity|protein homodimerization activity				0	all_lung(31;0.00118)					TCGCAAGAGCCGCTGCAGTAC	0.443																0.025478	-30.933352	8.224259	4	153	KEEP	---	---	---	---	4	0	90	68	-1	capture	Missense_Mutation	SNP	37815950	37815950	GDNF	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6262	128
LNPEP	4012	broad.mit.edu	37	5	96341853	96341853	+	Missense_Mutation	SNP	T	C	C			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:96341853T>C	uc003kmv.1	+	10	2376	c.1862T>C	c.(1861-1863)GTT>GCT	p.V621A	LNPEP_uc003kmw.1_Missense_Mutation_p.V607A	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1	621	Extracellular (Potential).				cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		TTAGTGACTGTTCAAAAGAAA	0.333																0.021739	-28.896306	6.358535	3	135	KEEP	---	---	---	---	1	2	67	77	-1	capture	Missense_Mutation	SNP	96341853	96341853	LNPEP	5	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	8784	128
PCDHB5	26167	broad.mit.edu	37	5	140516870	140516870	+	Silent	SNP	G	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140516870G>A	uc003liq.2	+	1	2071	c.1854G>A	c.(1852-1854)GCG>GCA	p.A618A		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	618	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCATGTGGGCGCACAATGGCG	0.687																0.035714	-18.691423	7.523166	4	108	KEEP	---	---	---	---	2	2	54	66	-1	capture	Silent	SNP	140516870	140516870	PCDHB5	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11448	128
F13A1	2162	broad.mit.edu	37	6	6196068	6196068	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:6196068C>T	uc003mwv.2	-	10	1390	c.1267G>A	c.(1267-1269)GTC>ATC	p.V423I	F13A1_uc011dib.1_Missense_Mutation_p.V360I	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	423					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	TGGAAGCAGACATGGCCGTGC	0.498																0.282609	32.752753	34.707512	13	33	KEEP	---	---	---	---	9	10	20	22	-1	capture	Missense_Mutation	SNP	6196068	6196068	F13A1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	5294	128
GPX5	2880	broad.mit.edu	37	6	28497279	28497279	+	Missense_Mutation	SNP	G	A	A	rs60523386		TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28497279G>A	uc003nll.2	+	2	141	c.139G>A	c.(139-141)GCA>ACA	p.A47T	GPX5_uc003nlm.2_Missense_Mutation_p.A47T|GPX5_uc003nln.2_RNA	NM_001509	NP_001500	O75715	GPX5_HUMAN	glutathione peroxidase 5 isoform 1 precursor	47					lipid metabolic process|response to oxidative stress	extracellular region	glutathione peroxidase activity			skin(1)	1					Glutathione(DB00143)	TGAGGCCATCGCACTTAATAA	0.428																0.511765	271.426056	271.446575	87	83	KEEP	---	---	---	---	50	43	45	48	-1	capture	Missense_Mutation	SNP	28497279	28497279	GPX5	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6676	128
PKHD1	5314	broad.mit.edu	37	6	51609339	51609339	+	Missense_Mutation	SNP	T	C	C			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51609339T>C	uc003pah.1	-	60	10276	c.10000A>G	c.(10000-10002)AAA>GAA	p.K3334E	PKHD1_uc010jzn.1_Missense_Mutation_p.K1317E|PKHD1_uc003pai.2_Missense_Mutation_p.K3334E	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3334	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CCTAAATCTTTCCTGTGAAGA	0.383					1537											0.466292	302.614304	302.789977	83	95	KEEP	---	---	---	---	36	59	47	63	-1	capture	Missense_Mutation	SNP	51609339	51609339	PKHD1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	11874	128
COL28A1	340267	broad.mit.edu	37	7	7483281	7483281	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:7483281C>T	uc003src.1	-	20	1702	c.1585G>A	c.(1585-1587)GAA>AAA	p.E529K	COL28A1_uc011jxe.1_Missense_Mutation_p.E212K|COL28A1_uc003srd.2_Missense_Mutation_p.E84K	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor	529	Collagen-like 4.				cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		AGCCCCGCTTCTCCCTAGAGA	0.517																0.301676	161.981231	168.267851	54	125	KEEP	---	---	---	---	30	31	70	70	-1	capture	Missense_Mutation	SNP	7483281	7483281	COL28A1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	3651	128
GRM3	2913	broad.mit.edu	37	7	86415877	86415877	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86415877G>A	uc003uid.2	+	3	1868	c.769G>A	c.(769-771)GAC>AAC	p.D257N	GRM3_uc010lef.2_Missense_Mutation_p.D255N|GRM3_uc010leg.2_Missense_Mutation_p.D129N|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	257	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	CAAGTCCTACGACAGCGTGAT	0.647	GBM(52;969 1098 3139 52280)															0.11875	21.717033	44.554524	19	141	KEEP	---	---	---	---	10	10	83	66	-1	capture	Missense_Mutation	SNP	86415877	86415877	GRM3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6731	128
ABCB1	5243	broad.mit.edu	37	7	87179839	87179839	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87179839C>G	uc003uiz.1	-	12	1587	c.1169G>C	c.(1168-1170)GGA>GCA	p.G390A	ABCB1_uc011khc.1_Missense_Mutation_p.G326A	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	390	Cytoplasmic (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	TTCCAAATTTCCCTTAATATT	0.313																0.09375	29.705693	77.476145	27	261	KEEP	---	---	---	---	18	13	168	137	-1	capture	Missense_Mutation	SNP	87179839	87179839	ABCB1	7	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	40	128
NPTX2	4885	broad.mit.edu	37	7	98256632	98256632	+	Silent	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98256632C>T	uc003upl.2	+	4	1221	c.1044C>T	c.(1042-1044)GGC>GGT	p.G348G		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor	348	Pentaxin.				synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			AGCCCGGGGGCGTGCTGATCC	0.677																0.323944	63.602844	65.554928	23	48	KEEP	---	---	---	---	9	16	27	24	-1	capture	Silent	SNP	98256632	98256632	NPTX2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	10510	128
FOXP2	93986	broad.mit.edu	37	7	114282648	114282648	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:114282648A>G	uc003vhb.2	+	7	1333	c.959A>G	c.(958-960)CAG>CGG	p.Q320R	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Missense_Mutation_p.Q345R|FOXP2_uc003vha.2_Missense_Mutation_p.Q228R|FOXP2_uc011kmu.1_Missense_Mutation_p.Q337R|FOXP2_uc011kmv.1_Missense_Mutation_p.Q319R|FOXP2_uc010ljz.1_Missense_Mutation_p.Q228R|FOXP2_uc003vgx.2_Missense_Mutation_p.Q320R|FOXP2_uc003vhd.2_Missense_Mutation_p.Q320R|FOXP2_uc003vhc.2_Missense_Mutation_p.Q345R	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	320					camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						GTGAATGGACAGTCTTCAGTT	0.388																0.013423	-72.884386	7.60502	4	294	KEEP	---	---	---	---	1	3	176	150	-1	capture	Missense_Mutation	SNP	114282648	114282648	FOXP2	7	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	5971	128
PLXNA4	91584	broad.mit.edu	37	7	131887591	131887591	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131887591G>T	uc003vra.3	-	12	2629	c.2400C>A	c.(2398-2400)CAC>CAA	p.H800Q		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	800	Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						ACTTGTAGAGGTGAACTGCAG	0.632																0.085714	1.196217	7.286537	3	32	KEEP	---	---	---	---	0	3	14	19	-1	capture	Missense_Mutation	SNP	131887591	131887591	PLXNA4	7	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	12025	128
TRPV6	55503	broad.mit.edu	37	7	142573429	142573429	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142573429C>T	uc003wbx.1	-	8	1130	c.914G>A	c.(913-915)CGC>CAC	p.R305H	TRPV6_uc003wbw.1_Missense_Mutation_p.R91H|TRPV6_uc010lou.1_Missense_Mutation_p.R176H	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	305	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					CAGGATCTGGCGAGCCTGCAA	0.607																0.485714	256.759663	256.785672	85	90	KEEP	---	---	---	---	40	51	61	66	-1	capture	Missense_Mutation	SNP	142573429	142573429	TRPV6	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16483	128
ZYX	7791	broad.mit.edu	37	7	143080299	143080299	+	Missense_Mutation	SNP	T	C	C			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143080299T>C	uc003wcw.2	+	5	1062	c.907T>C	c.(907-909)TCT>CCT	p.S303P	ZYX_uc011ktd.1_Missense_Mutation_p.S146P|ZYX_uc003wcx.2_Missense_Mutation_p.S303P|ZYX_uc011kte.1_Missense_Mutation_p.S272P|ZYX_uc011ktf.1_Missense_Mutation_p.S146P	NM_001010972	NP_001010972	Q15942	ZYX_HUMAN	zyxin	303					cell adhesion|cell-cell signaling|interspecies interaction between organisms|signal transduction	cell-cell adherens junction|cytoplasm|focal adhesion|integral to plasma membrane|nucleus|stress fiber	protein binding|zinc ion binding				0	Melanoma(164;0.205)					CGAAGCTCTTTCTGCTGGCAC	0.597																0.291667	213.211614	222.647793	70	170	KEEP	---	---	---	---	38	34	81	97	-1	capture	Missense_Mutation	SNP	143080299	143080299	ZYX	7	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	18130	128
ZFAT	57623	broad.mit.edu	37	8	135612748	135612748	+	Silent	SNP	G	A	A	rs144002982	by1000genomes	TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:135612748G>A	uc003yup.2	-	7	2581	c.2406C>T	c.(2404-2406)ACC>ACT	p.T802T	ZFAT_uc003yun.2_Silent_p.T790T|ZFAT_uc003yuo.2_Silent_p.T790T|ZFAT_uc010meh.2_Silent_p.T790T|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Silent_p.T790T|ZFAT_uc010mej.2_Silent_p.T740T|ZFAT_uc003yur.2_Silent_p.T790T|ZFATAS_uc003yus.1_RNA	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1	802	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CACAGCCATCGGTGGGACACT	0.448																0.014577	-83.501101	8.36878	5	338	KEEP	---	---	---	---	3	3	206	183	-1	capture	Silent	SNP	135612748	135612748	ZFAT	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17512	128
C9orf102	375748	broad.mit.edu	37	9	98683552	98683552	+	Silent	SNP	T	G	G			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:98683552T>G	uc004avt.3	+	7	1675	c.1287T>G	c.(1285-1287)CCT>CCG	p.P429P	C9orf102_uc010mrx.1_RNA|C9orf102_uc011lum.1_Silent_p.P131P|C9orf102_uc010mry.1_Silent_p.P131P|C9orf102_uc010mrz.2_Silent_p.P240P|C9orf102_uc004avu.2_5'Flank	NM_001010895	NP_001010895	Q5T890	RAD26_HUMAN	RAD26L hypothetical protein	429					DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)				CTTCTGAGCCTTGTACCTGTA	0.363																0.038462	-10.645862	7.310799	3	75	KEEP	---	---	---	---	1	2	35	48	-1	capture	Silent	SNP	98683552	98683552	C9orf102	9	T	G	G	G	1	0	0	0	0	0	0	0	1	717	56	4	4	2422	128
SMARCA1	6594	broad.mit.edu	37	X	128621040	128621040	+	Missense_Mutation	SNP	T	G	G			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:128621040T>G	uc004eun.3	-	17	2285	c.2172A>C	c.(2170-2172)CAA>CAC	p.Q724H	SMARCA1_uc004eup.3_Missense_Mutation_p.Q712H|SMARCA1_uc011muk.1_Missense_Mutation_p.Q724H|SMARCA1_uc011mul.1_Missense_Mutation_p.Q712H	NM_003069	NP_003060	P28370	SMCA1_HUMAN	SWI/SNF-related matrix-associated	724					ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding			ovary(3)|skin(1)	4						TGTATAAACTTTGTTCAATGT	0.348																0.295775	71.348241	73.996213	21	50	KEEP	---	---	---	---	13	9	24	30	-1	capture	Missense_Mutation	SNP	128621040	128621040	SMARCA1	23	T	G	G	G	1	0	0	0	0	1	0	0	0	829	64	4	4	14660	128
ZNF701	55762	broad.mit.edu	37	19	53086225	53086228	+	Frame_Shift_Del	DEL	AAGG	-	-			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53086225_53086228delAAGG	uc002pzs.1	+	4	1040_1043	c.913_916delAAGG	c.(913-918)AAGGTTfs	p.K305fs	ZNF701_uc010ydn.1_Frame_Shift_Del_p.K371fs	NM_018260	NP_060730	Q9NV72	ZN701_HUMAN	zinc finger protein 701	305_306	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)		TGAATGTGGCAAGGTTTTTAATCA	0.387	NSCLC(89;451 1475 9611 20673 52284)															0.38			50	82		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	53086225	53086228	ZNF701	19	AAGG	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	17983	128
YEATS2	55689	broad.mit.edu	37	3	183525871	183525871	+	Frame_Shift_Del	DEL	G	-	-			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183525871delG	uc003fly.2	+	29	4260	c.4065delG	c.(4063-4065)GTGfs	p.V1355fs	uc003fma.1_5'Flank	NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	1355					histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ATGCGTCCGTGGTGGAGGACA	0.562																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	183525871	183525871	YEATS2	3	G	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	17353	128
XK	7504	broad.mit.edu	37	X	37587132	37587133	+	Frame_Shift_Ins	INS	-	C	C			TCGA-12-3653-01	TCGA-12-3653-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37587132_37587133insC	uc004ddq.2	+	3	834_835	c.752_753insC	c.(751-753)TACfs	p.Y251fs		NM_021083	NP_066569	P51811	XK_HUMAN	membrane transport protein XK	251	Helical; (Potential).				amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)				TTCTTCTTGTACCCCTGGATCC	0.485																0.34			26	51		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	37587132	37587133	XK	23	-	C	C	C	1	0	1	1	0	0	0	0	0	182	14	5	5	17312	128
