Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
FUCA1	2517	broad.mit.edu	37	1	24189688	24189688	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24189688C>T	uc001bie.2	-	3	643	c.598G>A	c.(598-600)GGC>AGC	p.G200S	FUCA1_uc009vqt.1_RNA|FUCA1_uc010oed.1_RNA	NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor	200					fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		GTTTTGAAGCCATTTTTCTTA	0.388																0.607692	242.725301	244.039673	79	51	KEEP	---	---	---	---	49	40	21	36	-1	capture	Missense_Mutation	SNP	24189688	24189688	FUCA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	6036	141
FUCA1	2517	broad.mit.edu	37	1	24189727	24189727	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24189727C>T	uc001bie.2	-	3	604	c.559G>A	c.(559-561)GAG>AAG	p.E187K	FUCA1_uc009vqt.1_RNA|FUCA1_uc010oed.1_RNA	NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor	187					fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		TGGAACCACTCTAAGAGTGAG	0.358																0.177215	32.300189	40.055181	14	65	KEEP	---	---	---	---	8	8	33	38	-1	capture	Missense_Mutation	SNP	24189727	24189727	FUCA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	6036	141
LRRC41	10489	broad.mit.edu	37	1	46745257	46745257	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46745257C>G	uc001cpn.2	-	8	2094	c.2050G>C	c.(2050-2052)GAG>CAG	p.E684Q	LRRC41_uc010omb.1_Missense_Mutation_p.E684Q	NM_006369	NP_006360	Q15345	LRC41_HUMAN	MUF1 protein	684										ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(166;0.155)					GGGCGCTTCTCAAACAGACGG	0.552																0.145215	92.488881	129.183707	44	259	KEEP	---	---	---	---	27	21	160	142	-1	capture	Missense_Mutation	SNP	46745257	46745257	LRRC41	1	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	8914	141
IFI16	3428	broad.mit.edu	37	1	158986412	158986412	+	Silent	SNP	C	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158986412C>G	uc001ftf.1	+	5	1078	c.471C>G	c.(469-471)GCC>GCG	p.A157A	IFI16_uc001ftg.2_Silent_p.A157A|IFI16_uc010pis.1_Intron	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	157					cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)					CTGCAGGAGCCGGCATGTCCA	0.522																0.1375	29.814345	50.213785	22	138	KEEP	---	---	---	---	10	15	83	74	-1	capture	Silent	SNP	158986412	158986412	IFI16	1	C	G	G	G	1	0	0	0	0	0	0	0	1	288	23	4	4	7436	141
NR5A2	2494	broad.mit.edu	37	1	200017711	200017711	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:200017711G>C	uc001gvb.2	+	5	1081	c.875G>C	c.(874-876)AGT>ACT	p.S292T	NR5A2_uc001gvc.2_Missense_Mutation_p.S246T|NR5A2_uc009wzh.2_Missense_Mutation_p.S252T|NR5A2_uc010pph.1_Missense_Mutation_p.S220T	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	292					embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)					TATATGGATAGTTACCAGACG	0.488	Melanoma(179;1138 2773 15678 26136)															0.4375	343.909953	344.729809	105	135	KEEP	---	---	---	---	55	60	73	74	-1	capture	Missense_Mutation	SNP	200017711	200017711	NR5A2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	10543	141
OR2T3	343173	broad.mit.edu	37	1	248637231	248637231	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248637231T>C	uc001iel.1	+	1	580	c.580T>C	c.(580-582)TGC>CGC	p.C194R		NM_001005495	NP_001005495	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T,	194	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GAAGCTCTCCTGCTCTGACGT	0.517																0.567881	1232.877575	1235.298724	343	261	KEEP	---	---	---	---	213	182	179	141	-1	capture	Missense_Mutation	SNP	248637231	248637231	OR2T3	1	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	10927	141
OR5AR1	219493	broad.mit.edu	37	11	56431364	56431364	+	Missense_Mutation	SNP	T	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56431364T>G	uc010rjm.1	+	1	203	c.203T>G	c.(202-204)TTT>TGT	p.F68C		NM_001004730	NP_001004730	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR,	68	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AACCTCTCCTTTGTTGACCTG	0.463																0.331081	503.995676	515.211154	147	297	KEEP	---	---	---	---	86	74	176	145	-1	capture	Missense_Mutation	SNP	56431364	56431364	OR5AR1	11	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	11049	141
OSBP	5007	broad.mit.edu	37	11	59376014	59376014	+	Silent	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59376014G>A	uc001noc.1	-	3	1245	c.765C>T	c.(763-765)ATC>ATT	p.I255I		NM_002556	NP_002547	P22059	OSBP1_HUMAN	oxysterol binding protein	255					lipid transport	Golgi membrane	oxysterol binding			large_intestine(1)	1		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TGACCTGTTTGATCTTTTCAT	0.478																0.274131	187.802739	199.71216	71	188	KEEP	---	---	---	---	46	25	106	83	-1	capture	Silent	SNP	59376014	59376014	OSBP	11	G	A	A	A	1	0	0	0	0	0	0	0	1	577	45	2	2	11177	141
CTSF	8722	broad.mit.edu	37	11	66333870	66333870	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66333870G>C	uc001oip.2	-	5	703	c.613C>G	c.(613-615)CGG>GGG	p.R205G		NM_003793	NP_003784	Q9UBX1	CATF_HUMAN	cathepsin F precursor	205					proteolysis	lysosome	cysteine-type endopeptidase activity				0						AGGCGCCACCGGGCTTCTGAG	0.587																0.415385	78.62029	79.024384	27	38	KEEP	---	---	---	---	17	12	23	16	-1	capture	Missense_Mutation	SNP	66333870	66333870	CTSF	11	G	C	C	C	1	0	0	0	0	1	0	0	0	506	39	4	4	3995	141
WNT11	7481	broad.mit.edu	37	11	75907584	75907584	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:75907584G>A	uc001oxe.2	-	2	385	c.262C>T	c.(262-264)CGC>TGC	p.R88C	WNT11_uc001oxf.1_Missense_Mutation_p.R88C	NM_004626	NP_004617	O96014	WNT11_HUMAN	wingless-type MMTV integration site family,	88					adrenal gland development|anterior/posterior pattern formation|artery morphogenesis|axis specification|bone mineralization|cellular response to retinoic acid|cloacal septation|embryonic skeletal system development|endoderm development|lung-associated mesenchyme development|mesonephric duct development|negative regulation of apoptosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cartilage development|negative regulation of cell growth|negative regulation of cell migration|negative regulation of transcription, DNA-dependent|neuroendocrine cell differentiation|neuron differentiation|osteoblast differentiation|outflow tract morphogenesis|palate development|positive regulation of cell migration|positive regulation of protein kinase C signaling cascade|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor-beta2 production|protein localization at cell surface|protein phosphorylation|tight junction assembly|ureteric bud morphogenesis|ventricular septum morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|protein kinase activator activity|Ras GTPase activator activity|transcription regulatory region DNA binding			lung(1)|skin(1)	2						CAGTTCCAGCGCATGTCGGCA	0.632																0.021622	-40.970197	6.346445	4	181	KEEP	---	---	---	---	1	5	91	118	-1	capture	Missense_Mutation	SNP	75907584	75907584	WNT11	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17265	141
SLC2A14	144195	broad.mit.edu	37	12	7970576	7970576	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7970576C>A	uc001qtk.2	-	15	1988	c.1195G>T	c.(1195-1197)GCC>TCC	p.A399S	SLC2A14_uc001qtl.2_Missense_Mutation_p.A376S|SLC2A14_uc001qtm.2_Missense_Mutation_p.A376S|SLC2A14_uc010sgg.1_Missense_Mutation_p.A290S|SLC2A14_uc001qtn.2_Missense_Mutation_p.A399S|SLC2A14_uc001qto.2_Missense_Mutation_p.A34S|SLC2A14_uc010sgh.1_Missense_Mutation_p.A414S	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14	399	Helical; Name=10; (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)		TCAAAACAGGCCACAAAGACC	0.498																0.558824	116.151614	116.355745	38	30	KEEP	---	---	---	---	22	20	20	14	0.47619047619	capture	Missense_Mutation	SNP	7970576	7970576	SLC2A14	12	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	14435	141
WIF1	11197	broad.mit.edu	37	12	65460443	65460443	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:65460443G>T	uc001ssk.2	-	6	853	c.708C>A	c.(706-708)TTC>TTA	p.F236L		NM_007191	NP_009122	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1 precursor	236	EGF-like 2.				multicellular organismal development|Wnt receptor signaling pathway	extracellular region	protein tyrosine kinase activity			ovary(2)|lung(1)|skin(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		TCACTCCATAGAATCCAGGTG	0.373	Esophageal Squamous(148;1595 1816 48559 49439 49664)				284	T	HMGA2	pleomorphic salivary gland adenoma								0.213333	35.558782	41.253527	16	59	KEEP	---	---	---	---	9	8	24	38	0.529411764706	capture	Missense_Mutation	SNP	65460443	65460443	WIF1	12	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	17247	141
SCARB1	949	broad.mit.edu	37	12	125296422	125296422	+	Silent	SNP	C	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:125296422C>T	uc001ugo.3	-	5	973	c.720G>A	c.(718-720)CTG>CTA	p.L240L	SCARB1_uc001ugn.3_Silent_p.L240L|SCARB1_uc001ugm.3_Silent_p.L240L|SCARB1_uc010tbd.1_Silent_p.L240L|SCARB1_uc010tbe.1_Silent_p.L199L|SCARB1_uc001ugp.3_Silent_p.L240L	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1	240	Extracellular (Potential).				adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	TCACCTTGCTCAGCCCGTTCC	0.652																0.37931	31.516806	31.887832	11	18	KEEP	---	---	---	---	3	11	11	9	-1	capture	Silent	SNP	125296422	125296422	SCARB1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	13773	141
TMEM132B	114795	broad.mit.edu	37	12	126138507	126138507	+	Nonsense_Mutation	SNP	G	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:126138507G>T	uc001uhe.1	+	9	2496	c.2488G>T	c.(2488-2490)GAA>TAA	p.E830*	TMEM132B_uc001uhf.1_Nonsense_Mutation_p.E342*	NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	830	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AGCAGTCCAGGAATGGTTCCA	0.488																0.215054	44.346088	51.319317	20	73	KEEP	---	---	---	---	9	11	44	38	0.45	capture	Nonsense_Mutation	SNP	126138507	126138507	TMEM132B	12	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	15930	141
GPC6	10082	broad.mit.edu	37	13	94680086	94680086	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:94680086A>G	uc001vlt.2	+	4	1447	c.815A>G	c.(814-816)AAC>AGC	p.N272S	GPC6_uc010tig.1_Missense_Mutation_p.N272S	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor	272						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				TACTGTCTCAACGTCATGAAG	0.527																0.959707	1072.390156	1095.232367	262	11	KEEP	---	---	---	---	152	139	2	9	-1	capture	Missense_Mutation	SNP	94680086	94680086	GPC6	13	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	6536	141
FANCM	57697	broad.mit.edu	37	14	45620712	45620712	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:45620712A>T	uc001wwd.3	+	5	1130	c.1031A>T	c.(1030-1032)AAC>ATC	p.N344I	FANCM_uc001wwc.2_Missense_Mutation_p.N344I|FANCM_uc010anf.2_Missense_Mutation_p.N318I	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	344					DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						TTTAGGAAAAACCCATCTCCG	0.318					793						Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				0.977528	322.936296	326.541012	87	2	KEEP	---	---	---	---	47	47	3	0	-1	capture	Missense_Mutation	SNP	45620712	45620712	FANCM	14	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	5617	141
ACTN1	87	broad.mit.edu	37	14	69349623	69349623	+	Silent	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:69349623G>A	uc001xkl.2	-	15	2095	c.1785C>T	c.(1783-1785)ATC>ATT	p.I595I	ACTN1_uc001xkk.2_Silent_p.I191I|ACTN1_uc010ttb.1_Silent_p.I530I|ACTN1_uc001xkm.2_Silent_p.I595I|ACTN1_uc001xkn.2_Silent_p.I595I|ACTN1_uc010ttc.1_Silent_p.I180I	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b	595	Interaction with DDN.|Spectrin 3.				focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CCTGAGGCGTGATGGTTGTGT	0.517																0.141593	22.927356	36.927622	16	97	KEEP	---	---	---	---	9	9	49	59	-1	capture	Silent	SNP	69349623	69349623	ACTN1	14	G	A	A	A	1	0	0	0	0	0	0	0	1	577	45	2	2	204	141
DICER1	23405	broad.mit.edu	37	14	95557629	95557629	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95557629T>C	uc001ydw.2	-	26	5620	c.5438A>G	c.(5437-5439)GAG>GGG	p.E1813G	DICER1_uc010avh.1_Missense_Mutation_p.E711G|DICER1_uc001ydv.2_Missense_Mutation_p.E1803G|DICER1_uc001ydx.2_Missense_Mutation_p.E1813G	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	1813	RNase III 2.	Magnesium or manganese 2.		E->A: Decreased activity. Loss of activity; when associated with E-1444.	negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AGCAAGCGACTCAAAAATATC	0.458					741	Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				0.958333	1789.063056	1828.963888	437	19	KEEP	---	---	---	---	239	248	7	15	-1	capture	Missense_Mutation	SNP	95557629	95557629	DICER1	14	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	4479	141
LCTL	197021	broad.mit.edu	37	15	66853375	66853375	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:66853375C>A	uc002aqc.2	-	6	806	c.674G>T	c.(673-675)GGC>GTC	p.G225V	LCTL_uc002aqd.3_Missense_Mutation_p.G52V|LCTL_uc010bhw.2_Intron	NM_207338	NP_997221	Q6UWM7	LCTL_HUMAN	lactase-like precursor	225	Extracellular (Potential).				carbohydrate metabolic process	endoplasmic reticulum membrane|integral to membrane	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(2)	2						CTTGTACAGGCCGGTGCCGCG	0.602																0.07767	-9.852132	8.961037	8	95	KEEP	---	---	---	---	10	4	66	64	0.285714285714	capture	Missense_Mutation	SNP	66853375	66853375	LCTL	15	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	8614	141
NOX5	79400	broad.mit.edu	37	15	69347743	69347743	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:69347743T>A	uc002ars.1	+	15	2089	c.2069T>A	c.(2068-2070)CTG>CAG	p.L690Q	NOX5_uc002arp.1_Missense_Mutation_p.L672Q|NOX5_uc002arq.1_Missense_Mutation_p.L644Q|NOX5_uc010bid.1_Missense_Mutation_p.L655Q|NOX5_uc002arr.1_Missense_Mutation_p.L662Q|NOX5_uc010bie.1_Missense_Mutation_p.L490Q|NOX5_uc010bif.1_RNA	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	690	Extracellular (Potential).				angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2						GCCATTGGCCTGCAGATGGCC	0.597																0.11828	14.055747	27.37572	11	82	KEEP	---	---	---	---	6	6	42	43	-1	capture	Missense_Mutation	SNP	69347743	69347743	NOX5	15	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	10466	141
UNC45A	55898	broad.mit.edu	37	15	91488293	91488293	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91488293A>G	uc002bqg.2	+	9	1539	c.1199A>G	c.(1198-1200)AAG>AGG	p.K400R	UNC45A_uc002bqd.2_Missense_Mutation_p.K385R|UNC45A_uc010uqr.1_5'Flank	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	smooth muscle cell associated protein-1 isoform	400					cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			AACTACATCAAGTAAGGAAGT	0.478																0.048077	-10.018022	12.579314	5	99	KEEP	---	---	---	---	2	3	66	46	-1	capture	Missense_Mutation	SNP	91488293	91488293	UNC45A	15	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	16870	141
RUNDC2A	84127	broad.mit.edu	37	16	12145796	12145796	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:12145796G>A	uc002dbw.1	+	8	903	c.841G>A	c.(841-843)GTG>ATG	p.V281M	SNX29_uc002dby.3_5'Flank	NM_032167	NP_115543	Q9HA26	RUN2A_HUMAN	RUN domain containing 2A	281										ovary(1)	1						CTCTGGGGACGTGTTTAAAAA	0.483						T	CIITA	PMBL|Hodgkin Lymphona|								0.02381	-35.745798	6.612934	4	164	KEEP	---	---	---	---	2	2	104	75	-1	capture	Missense_Mutation	SNP	12145796	12145796	RUNDC2A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13635	141
AKTIP	64400	broad.mit.edu	37	16	53528141	53528141	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53528141G>A	uc002ehk.2	-	8	830	c.619C>T	c.(619-621)CAG>TAG	p.Q207*	AKTIP_uc002ehl.2_Nonsense_Mutation_p.Q207*|AKTIP_uc002ehm.2_Nonsense_Mutation_p.Q207*	NM_001012398	NP_001012398	Q9H8T0	AKTIP_HUMAN	AKT interacting protein	207					apoptosis|early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|positive regulation of protein binding|positive regulation of protein phosphorylation|protein transport	FHF complex|plasma membrane	acid-amino acid ligase activity|protein binding				0		all_cancers(37;0.14)				TTAAAAAGCTGAATATCTTTT	0.308																0.054054	-10.848911	12.43257	6	105	KEEP	---	---	---	---	5	1	61	48	-1	capture	Nonsense_Mutation	SNP	53528141	53528141	AKTIP	16	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	482	141
CDH16	1014	broad.mit.edu	37	16	66946227	66946227	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:66946227G>A	uc002eql.2	-	12	1539	c.1466C>T	c.(1465-1467)GCC>GTC	p.A489V	CDH16_uc010cdy.2_Missense_Mutation_p.A489V|CDH16_uc002eqm.2_Missense_Mutation_p.A392V	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	489	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		CCTCTCAATGGCAAAATCCAT	0.577																0.028777	-27.188374	6.747937	4	135	KEEP	---	---	---	---	1	3	81	69	-1	capture	Missense_Mutation	SNP	66946227	66946227	CDH16	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3072	141
WWP2	11060	broad.mit.edu	37	16	69973830	69973830	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:69973830T>C	uc002exu.1	+	25	2689	c.2600T>C	c.(2599-2601)TTT>TCT	p.F867S	WWP2_uc002exv.1_Missense_Mutation_p.F867S|WWP2_uc010vlm.1_Missense_Mutation_p.F751S|WWP2_uc010vln.1_Missense_Mutation_p.F485S|WWP2_uc002exw.1_Missense_Mutation_p.F428S	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase	867	HECT.				entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						ACCGAGGGCTTTGGACAGGAG	0.612																0.954545	77.826374	79.836944	21	1	KEEP	---	---	---	---	11	12	0	2	-1	capture	Missense_Mutation	SNP	69973830	69973830	WWP2	16	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	17297	141
NF1	4763	broad.mit.edu	37	17	29557336	29557336	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29557336C>T	uc002hgg.2	+	23	3382	c.3049C>T	c.(3049-3051)CAA>TAA	p.Q1017*	NF1_uc002hgh.2_Nonsense_Mutation_p.Q1017*|NF1_uc010csn.1_Nonsense_Mutation_p.Q877*|NF1_uc002hgi.1_Nonsense_Mutation_p.Q50*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1017					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)|p.Q1017*(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GAAACTGTGTCAATTAGTTGA	0.338					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.942029	217.676598	228.553232	65	4	KEEP	---	---	---	---	32	38	3	1	-1	capture	Nonsense_Mutation	SNP	29557336	29557336	NF1	17	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	10263	141
GAS2L2	246176	broad.mit.edu	37	17	34072639	34072639	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34072639C>G	uc002hjv.1	-	6	1905	c.1877G>C	c.(1876-1878)AGG>ACG	p.R626T		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	626					cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GACCCCAGACCTTGTGCCCTG	0.582																0.925926	712.816688	753.032293	200	16	KEEP	---	---	---	---	108	127	11	7	-1	capture	Missense_Mutation	SNP	34072639	34072639	GAS2L2	17	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	6187	141
TUBG2	27175	broad.mit.edu	37	17	40817702	40817702	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40817702A>G	uc010wgr.1	+	8	956	c.700A>G	c.(700-702)ACC>GCC	p.T234A	TUBG2_uc002iaq.2_Missense_Mutation_p.T76A|TUBG2_uc002iar.2_Missense_Mutation_p.T81A|TUBG2_uc002ias.2_Missense_Mutation_p.T76A|TUBG2_uc002iap.2_Missense_Mutation_p.T81A	NM_016437	NP_057521	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2	234					G2/M transition of mitotic cell cycle|microtubule-based process|protein polymerization	cytosol	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		CCAGGTGTCCACCATCATGTC	0.637																0.210937	56.347937	66.251311	27	101	KEEP	---	---	---	---	11	19	50	61	-1	capture	Missense_Mutation	SNP	40817702	40817702	TUBG2	17	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	16647	141
WNK4	65266	broad.mit.edu	37	17	40939868	40939868	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40939868C>A	uc002ibj.2	+	8	1835	c.1814C>A	c.(1813-1815)CCT>CAT	p.P605H	WNK4_uc010wgx.1_Missense_Mutation_p.P269H|WNK4_uc002ibk.1_Missense_Mutation_p.P377H|WNK4_uc010wgy.1_Intron	NM_032387	NP_115763	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	605					intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity			ovary(3)|skin(3)|stomach(1)	7		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CTTCAGCCCCCTGGGGGGGTG	0.632	Esophageal Squamous(6;201 374 4964 23855 42828)				263											0.292135	64.704726	68.15493	26	63	KEEP	---	---	---	---	13	15	45	34	0.535714285714	capture	Missense_Mutation	SNP	40939868	40939868	WNK4	17	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	17261	141
C18orf34	374864	broad.mit.edu	37	18	30873224	30873224	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:30873224T>A	uc002kxn.2	-	11	1217	c.1075A>T	c.(1075-1077)ATA>TTA	p.I359L	C18orf34_uc010xbr.1_Missense_Mutation_p.I359L|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Missense_Mutation_p.I359L|C18orf34_uc002kxp.2_Missense_Mutation_p.I359L	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	359	Potential.									ovary(1)	1						TTAACATTTATCACTGATGAA	0.274																0.534413	432.215076	432.469468	132	115	KEEP	---	---	---	---	75	65	66	56	-1	capture	Missense_Mutation	SNP	30873224	30873224	C18orf34	18	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	1886	141
C19orf2	8725	broad.mit.edu	37	19	30476136	30476136	+	Silent	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:30476136G>A	uc002nsr.2	+	3	189	c.159G>A	c.(157-159)AAG>AAA	p.K53K	C19orf2_uc002nsq.2_Silent_p.K35K|C19orf2_uc002nss.2_Silent_p.K13K|C19orf2_uc002nst.2_5'UTR	NM_003796	NP_003787	O94763	RMP_HUMAN	RPB5-mediating protein isoform a	53					protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)		ACAGGAAGAAGGTAGATAATG	0.244	Melanoma(75;661 1306 1472 28422 37948)															0.294479	440.122844	458.59586	144	345	KEEP	---	---	---	---	82	82	186	220	-1	capture	Silent	SNP	30476136	30476136	C19orf2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	1895	141
WDR88	126248	broad.mit.edu	37	19	33651345	33651345	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33651345T>A	uc002nui.2	+	8	1101	c.1023T>A	c.(1021-1023)TTT>TTA	p.F341L		NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing	341	WD 6.									ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)					CTGGAGGGTTTGATAGGACTG	0.493																0.321053	521.017422	537.234308	183	387	KEEP	---	---	---	---	126	96	244	212	-1	capture	Missense_Mutation	SNP	33651345	33651345	WDR88	19	T	A	A	A	1	0	0	0	0	1	0	0	0	816	63	4	4	17216	141
LRP3	4037	broad.mit.edu	37	19	33695616	33695616	+	Silent	SNP	A	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33695616A>C	uc010edh.2	+	4	426	c.333A>C	c.(331-333)CCA>CCC	p.P111P	LRP3_uc010xrp.1_5'UTR|LRP3_uc002nuk.3_5'UTR	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	111	Extracellular (Potential).|CUB 1.				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					CAGCAGCCCCACCCCGCCAGG	0.662																0.103704	-11.975584	10.294594	14	121	KEEP	---	---	---	---	33	24	96	99	-1	capture	Silent	SNP	33695616	33695616	LRP3	19	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	8874	141
KCTD15	79047	broad.mit.edu	37	19	34292103	34292103	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:34292103C>T	uc002nuy.3	+	4	366	c.98C>T	c.(97-99)ACC>ATC	p.T33I	KCTD15_uc002nuv.2_Missense_Mutation_p.T33I|KCTD15_uc002nuw.3_Missense_Mutation_p.T33I|KCTD15_uc010xrt.1_Missense_Mutation_p.T33I|KCTD15_uc002nux.3_Missense_Mutation_p.T33I	NM_001129994	NP_001123466	Q96SI1	KCD15_HUMAN	potassium channel tetramerisation domain	33						voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1	Esophageal squamous(110;0.162)					CTGTCTCTCACCCGGTCGCCT	0.582	Melanoma(36;646 1094 5145 14504 45302)|GBM(25;193 541 1518 14388 52178)															0.112179	30.999288	77.398819	35	277	KEEP	---	---	---	---	23	16	182	130	-1	capture	Missense_Mutation	SNP	34292103	34292103	KCTD15	19	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	8024	141
ZNF470	388566	broad.mit.edu	37	19	57088457	57088457	+	Silent	SNP	A	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57088457A>G	uc002qnl.3	+	6	1336	c.660A>G	c.(658-660)CAA>CAG	p.Q220Q	ZNF470_uc010etn.2_Intron	NM_001001668	NP_001001668	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	220					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		AACACAAGCAAGACCGTGGAG	0.308																0.165354	54.492055	67.987385	21	106	KEEP	---	---	---	---	12	11	60	56	-1	capture	Silent	SNP	57088457	57088457	ZNF470	19	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	17808	141
ZNF324	25799	broad.mit.edu	37	19	58983498	58983498	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58983498G>A	uc002qsw.1	+	4	1733	c.1639G>A	c.(1639-1641)GTC>ATC	p.V547I	ZNF324_uc002qsx.1_Missense_Mutation_p.V324I	NM_014347	NP_055162	O75467	Z324A_HUMAN	zinc finger protein 324	547					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CCCAGCCGCCGTCTCGCAGCC	0.652																0.37931	31.718141	32.088664	11	18	KEEP	---	---	---	---	16	10	19	24	-1	capture	Missense_Mutation	SNP	58983498	58983498	ZNF324	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17724	141
APOB	338	broad.mit.edu	37	2	21247830	21247830	+	Missense_Mutation	SNP	C	T	T	rs148190577	byFrequency	TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21247830C>T	uc002red.2	-	16	2539	c.2411G>A	c.(2410-2412)CGC>CAC	p.R804H		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	804				LQLLGKLLLMGARTLQGI -> SSSWKAASHGCPHSAGD (in Ref. 12; AAA51759).	cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTGCAGAGTGCGGGCACCCAT	0.587																0.122172	30.161822	61.078968	27	194	KEEP	---	---	---	---	17	15	114	108	-1	capture	Missense_Mutation	SNP	21247830	21247830	APOB	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	778	141
NRXN1	9378	broad.mit.edu	37	2	50765702	50765702	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:50765702T>A	uc010fbq.2	-	10	3429	c.1952A>T	c.(1951-1953)GAT>GTT	p.D651V	NRXN1_uc002rxb.3_Missense_Mutation_p.D283V|NRXN1_uc002rxe.3_Missense_Mutation_p.D611V|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GTACAACTCATCATCCAGGTC	0.527																0.757062	429.824227	440.489764	134	43	KEEP	---	---	---	---	72	65	27	18	-1	capture	Missense_Mutation	SNP	50765702	50765702	NRXN1	2	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	10572	141
ARHGAP25	9938	broad.mit.edu	37	2	69046427	69046427	+	Silent	SNP	T	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:69046427T>C	uc002seu.2	+	9	1537	c.1173T>C	c.(1171-1173)TCT>TCC	p.S391S	ARHGAP25_uc010fdg.2_Silent_p.S392S|ARHGAP25_uc010yql.1_Silent_p.S352S|ARHGAP25_uc002sev.2_Silent_p.S385S|ARHGAP25_uc002sew.2_Silent_p.S384S|ARHGAP25_uc002sex.2_Silent_p.S385S|ARHGAP25_uc002sey.2_Silent_p.S118S	NM_001007231	NP_001007232	P42331	RHG25_HUMAN	Rho GTPase activating protein 25 isoform a	391					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|breast(2)	4						TCCGAATTTCTAGGACAGACA	0.532																0.204545	133.170719	150.972222	45	175	KEEP	---	---	---	---	23	25	93	95	-1	capture	Silent	SNP	69046427	69046427	ARHGAP25	2	T	C	C	C	1	0	0	0	0	0	0	0	1	678	53	3	3	867	141
LMAN2L	81562	broad.mit.edu	37	2	97400183	97400183	+	Silent	SNP	G	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:97400183G>C	uc002swu.2	-	3	423	c.387C>G	c.(385-387)GGC>GGG	p.G129G	LMAN2L_uc002swv.2_Silent_p.G129G|LMAN2L_uc010yut.1_Missense_Mutation_p.A12G|LMAN2L_uc010yuu.1_5'UTR|LMAN2L_uc010yuv.1_5'UTR|LMAN2L_uc010yuw.1_Missense_Mutation_p.A12G|LMAN2L_uc002sww.2_5'UTR|LMAN2L_uc010yux.1_Missense_Mutation_p.A12G	NM_030805	NP_110432	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like isoform 2	129	L-type lectin-like.|Lumenal (Potential).				ER to Golgi vesicle-mediated transport|protein folding|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle|Golgi membrane|integral to membrane	mannose binding|metal ion binding				0						AGATTGCCAAGCCATCCCCAT	0.473																0.076754	2.398084	86.324646	35	421	KEEP	---	---	---	---	16	23	243	264	-1	capture	Silent	SNP	97400183	97400183	LMAN2L	2	G	C	C	C	1	0	0	0	0	0	0	0	1	431	34	4	4	8759	141
MFSD9	84804	broad.mit.edu	37	2	103340253	103340253	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103340253G>C	uc002tcb.2	-	5	611	c.543C>G	c.(541-543)ATC>ATG	p.I181M	MFSD9_uc010fja.2_RNA	NM_032718	NP_116107	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing	181	Helical; (Potential).				transmembrane transport	integral to membrane|plasma membrane	transporter activity			ovary(2)|breast(2)	4						CGGGGCCCAAGATGAAGCCCA	0.502																0.184466	200.040254	238.522099	76	336	KEEP	---	---	---	---	41	44	189	183	-1	capture	Missense_Mutation	SNP	103340253	103340253	MFSD9	2	G	C	C	C	1	0	0	0	0	1	0	0	0	421	33	4	4	9451	141
FIGN	55137	broad.mit.edu	37	2	164466661	164466661	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:164466661C>T	uc002uck.1	-	3	1992	c.1681G>A	c.(1681-1683)GGA>AGA	p.G561R		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	561						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						TCTGCTTCTCCTAACCACTTG	0.493																0.177143	72.518544	89.700155	31	144	KEEP	---	---	---	---	19	17	80	72	-1	capture	Missense_Mutation	SNP	164466661	164466661	FIGN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	5837	141
CPO	130749	broad.mit.edu	37	2	207827161	207827161	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207827161A>T	uc002vby.2	+	7	646	c.600A>T	c.(598-600)CAA>CAT	p.Q200H		NM_173077	NP_775100	Q8IVL8	CBPO_HUMAN	carboxypeptidase O precursor	200					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		GAAACTGCCAAGATCAAACAT	0.448																0.794574	677.704058	698.469631	205	53	KEEP	---	---	---	---	104	124	32	23	-1	capture	Missense_Mutation	SNP	207827161	207827161	CPO	2	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	3785	141
SPHKAP	80309	broad.mit.edu	37	2	228881144	228881144	+	Missense_Mutation	SNP	C	T	T	rs150119101		TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:228881144C>T	uc002vpq.2	-	7	4473	c.4426G>A	c.(4426-4428)GTG>ATG	p.V1476M	SPHKAP_uc002vpp.2_Missense_Mutation_p.V1476M|SPHKAP_uc010zlx.1_Missense_Mutation_p.V1476M	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1476						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CAAGCGCTCACGGCTGTGTCT	0.463																0.046025	-30.879641	21.694116	11	228	KEEP	---	---	---	---	7	6	161	122	-1	capture	Missense_Mutation	SNP	228881144	228881144	SPHKAP	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14940	141
KRTAP10-9	386676	broad.mit.edu	37	21	46047750	46047750	+	Missense_Mutation	SNP	C	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46047750C>A	uc002zfp.3	+	1	711	c.662C>A	c.(661-663)ACC>AAC	p.T221N	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198690	NP_941963	P60411	KR109_HUMAN	keratin associated protein 10-9	221	22.|25 X 5 AA repeats of C-C-X(3).					keratin filament					0						GCTTGCTGCACCACCTCCTGC	0.657																0.121547	42.712364	93.487907	44	318	KEEP	---	---	---	---	32	29	244	234	0.475409836066	capture	Missense_Mutation	SNP	46047750	46047750	KRTAP10-9	21	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	8436	141
COL7A1	1294	broad.mit.edu	37	3	48612126	48612126	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48612126C>G	uc003ctz.2	-	77	6378	c.6377G>C	c.(6376-6378)GGT>GCT	p.G2126A		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2126	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCCTTTGGGACCTTGGTCACC	0.607																0.032468	-26.24719	10.516482	5	149	KEEP	---	---	---	---	4	1	86	76	-1	capture	Missense_Mutation	SNP	48612126	48612126	COL7A1	3	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	3669	141
C3orf38	285237	broad.mit.edu	37	3	88205314	88205314	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:88205314G>A	uc003dqw.2	+	4	830	c.519G>A	c.(517-519)TGG>TGA	p.W173*		NM_173824	NP_776185	Q5JPI3	CC038_HUMAN	hypothetical protein LOC285237	173					apoptosis						0		Lung NSC(201;0.17)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		AGCACTTCTGGCATGATGTGA	0.418																0.649533	451.072878	455.288803	139	75	KEEP	---	---	---	---	79	68	39	40	-1	capture	Nonsense_Mutation	SNP	88205314	88205314	C3orf38	3	G	A	A	A	1	0	0	0	0	0	1	0	0	546	42	5	2	2208	141
DRD3	1814	broad.mit.edu	37	3	113847759	113847759	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:113847759C>T	uc003ebd.2	-	8	1430	c.1007G>A	c.(1006-1008)GGG>GAG	p.G336E	DRD3_uc010hqn.1_Missense_Mutation_p.G336E|DRD3_uc003ebb.1_Missense_Mutation_p.G303E|DRD3_uc003ebc.1_Missense_Mutation_p.G336E	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a	336	Helical; Name=6.				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)	AATGAAGGCCCCTAAGTTGCC	0.428																0.494048	263.683545	263.687309	83	85	KEEP	---	---	---	---	59	43	62	39	-1	capture	Missense_Mutation	SNP	113847759	113847759	DRD3	3	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	4713	141
PPM1L	151742	broad.mit.edu	37	3	160786689	160786689	+	Missense_Mutation	SNP	A	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:160786689A>G	uc003fdr.2	+	4	928	c.827A>G	c.(826-828)AAC>AGC	p.N276S	PPM1L_uc003fds.2_Missense_Mutation_p.N97S|PPM1L_uc003fdt.2_Missense_Mutation_p.N149S|PPM1L_uc010hwf.2_RNA	NM_139245	NP_640338	Q5SGD2	PPM1L_HUMAN	protein phosphatase 1 (formerly 2C)-like	276	Cytoplasmic (Potential).|PP2C-like.				protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			AAAAATCTCAACGTGGTCATC	0.522	Pancreas(86;250 1994 13715 43211)															0.021739	-28.902663	6.359824	3	135	KEEP	---	---	---	---	2	1	78	62	-1	capture	Missense_Mutation	SNP	160786689	160786689	PPM1L	3	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	12245	141
PCYT1A	5130	broad.mit.edu	37	3	195969479	195969479	+	Nonsense_Mutation	SNP	A	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195969479A>C	uc003fwg.2	-	7	692	c.519T>G	c.(517-519)TAT>TAG	p.Y173*	PCYT1A_uc003fwh.2_Nonsense_Mutation_p.Y173*	NM_005017	NP_005008	P49585	PCY1A_HUMAN	choline phosphate cytidylyltransferase 1 alpha	173	Catalytic (Potential).					cytosol|soluble fraction	choline-phosphate cytidylyltransferase activity				0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)	CAGCAGATGAATAAGGAATAT	0.428																0.19375	87.835543	101.833328	31	129	KEEP	---	---	---	---	13	21	76	85	-1	capture	Nonsense_Mutation	SNP	195969479	195969479	PCYT1A	3	A	C	C	C	1	0	0	0	0	0	1	0	0	50	4	5	4	11513	141
CYP2U1	113612	broad.mit.edu	37	4	108866315	108866315	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:108866315C>T	uc003hyp.2	+	2	763	c.680C>T	c.(679-681)GCC>GTC	p.A227V	CYP2U1_uc011cfi.1_Missense_Mutation_p.A18V	NM_183075	NP_898898	Q7Z449	CP2U1_HUMAN	cytochrome P450, family 2, subfamily U,	227					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000128)		ATCAGCAATGCCGTCTCTAAC	0.438																0.019802	-68.583906	9.78729	6	297	KEEP	---	---	---	---	3	4	157	159	-1	capture	Missense_Mutation	SNP	108866315	108866315	CYP2U1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4135	141
ANK2	287	broad.mit.edu	37	4	114279919	114279919	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:114279919T>C	uc003ibe.3	+	38	10245	c.10145T>C	c.(10144-10146)ATC>ACC	p.I3382T	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.I684T|ANK2_uc011cgb.1_Missense_Mutation_p.I3397T	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	3349					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATGGCAAGCATCGCACCAGAT	0.463																0.042553	-27.644613	14.587101	8	180	KEEP	---	---	---	---	4	4	102	90	-1	capture	Missense_Mutation	SNP	114279919	114279919	ANK2	4	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	618	141
MLF1IP	79682	broad.mit.edu	37	4	185631267	185631267	+	Silent	SNP	A	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:185631267A>G	uc003iwq.2	-	8	826	c.756T>C	c.(754-756)AAT>AAC	p.N252N	MLF1IP_uc003iwp.2_RNA|MLF1IP_uc003iwr.1_Silent_p.N252N	NM_024629	NP_078905	Q71F23	CENPU_HUMAN	MLF1 interacting protein	252					CenH3-containing nucleosome assembly at centromere|interspecies interaction between organisms|mitotic prometaphase|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|condensed chromosome kinetochore|cytosol|nucleoplasm					0		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Hepatocellular(41;0.000519)|Colorectal(36;0.00172)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.0299)|all_hematologic(60;0.0592)|Medulloblastoma(177;0.146)		all cancers(43;7.83e-28)|Epithelial(43;2.56e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-11)|Colorectal(24;3.27e-06)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.16e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000252)|COAD - Colon adenocarcinoma(29;0.000512)|LUSC - Lung squamous cell carcinoma(40;0.01)|READ - Rectum adenocarcinoma(43;0.0419)		GCAAAACAATATTCAACTCCT	0.303																0.4	142.987453	143.859736	40	60	KEEP	---	---	---	---	24	23	45	28	-1	capture	Silent	SNP	185631267	185631267	MLF1IP	4	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	9527	141
MTRR	4552	broad.mit.edu	37	5	7875377	7875377	+	Missense_Mutation	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:7875377G>A	uc003jed.2	+	4	401	c.371G>A	c.(370-372)GGT>GAT	p.G124D	MTRR_uc010itn.1_RNA|MTRR_uc003jee.3_Missense_Mutation_p.G97D|MTRR_uc003jef.3_RNA|MTRR_uc003jeg.3_RNA|MTRR_uc010ito.2_RNA	NM_024010	NP_076915	Q9UBK8	MTRR_HUMAN	methionine synthase reductase isoform 2	124	FMN (By similarity).|Flavodoxin-like.				methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	CTAGGTCTCGGTGATTCAGAA	0.348																0.163347	78.659733	105.654745	41	210	KEEP	---	---	---	---	21	24	129	106	-1	capture	Missense_Mutation	SNP	7875377	7875377	MTRR	5	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	9871	141
RAB24	53917	broad.mit.edu	37	5	176729179	176729179	+	Missense_Mutation	SNP	T	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176729179T>C	uc003mfv.2	-	7	803	c.434A>G	c.(433-435)AAT>AGT	p.N145S	RAB24_uc003mfu.2_Missense_Mutation_p.N116S|RAB24_uc003mfw.2_Missense_Mutation_p.N145S|PRELID1_uc003mfx.2_5'Flank|PRELID1_uc003mfy.2_5'Flank	NM_130781	NP_570137	Q969Q5	RAB24_HUMAN	RAB24 gene product	145					autophagy|protein transport|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|protein binding				0	all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCTTTGATATCTGTAAAGAG	0.502																0.431507	218.407464	219.003605	63	83	KEEP	---	---	---	---	40	29	56	35	-1	capture	Missense_Mutation	SNP	176729179	176729179	RAB24	5	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	12806	141
HUS1B	135458	broad.mit.edu	37	6	656375	656375	+	Silent	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:656375G>A	uc003mtg.2	-	1	590	c.570C>T	c.(568-570)ACC>ACT	p.T190T	EXOC2_uc003mtd.2_Intron|EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_148959	NP_683762	Q8NHY5	HUS1B_HUMAN	HUS1 checkpoint protein B	190											0	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)		CTATACTCAGGGTCATCCTGC	0.562																0.022222	-48.903017	8.392241	5	220	KEEP	---	---	---	---	6	0	149	107	-1	capture	Silent	SNP	656375	656375	HUS1B	6	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	7385	141
TTBK1	84630	broad.mit.edu	37	6	43250498	43250498	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43250498G>T	uc003ouq.1	+	14	2299	c.2020G>T	c.(2020-2022)GGC>TGC	p.G674C		NM_032538	NP_115927	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	674						cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity	p.G674G(1)		lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			TGAGGTGAATGGCCTCCCACG	0.612					85											0.324111	217.964371	224.966021	82	171	KEEP	---	---	---	---	50	51	103	90	0.49504950495	capture	Missense_Mutation	SNP	43250498	43250498	TTBK1	6	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	16558	141
SYNE1	23345	broad.mit.edu	37	6	152779932	152779932	+	Missense_Mutation	SNP	C	G	G			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152779932C>G	uc010kiw.2	-	22	3130	c.2528G>C	c.(2527-2529)CGT>CCT	p.R843P	SYNE1_uc003qot.3_Missense_Mutation_p.R850P|SYNE1_uc003qou.3_Missense_Mutation_p.R843P|SYNE1_uc010kjb.1_Missense_Mutation_p.R826P|SYNE1_uc003qow.2_Missense_Mutation_p.R138P|SYNE1_uc003qox.1_Missense_Mutation_p.R359P|SYNE1_uc003qoz.2_Missense_Mutation_p.R275P|SYNE1_uc003qoy.2_Missense_Mutation_p.R410P	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	843	Cytoplasmic (Potential).|Potential.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTGTGCCTCACGCTCAAGAAC	0.403													HNSCC(10;0.0054)			0.132075	44.56866	65.470829	21	138	KEEP	---	---	---	---	16	6	72	81	-1	capture	Missense_Mutation	SNP	152779932	152779932	SYNE1	6	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	15333	141
GIMAP2	26157	broad.mit.edu	37	7	150390248	150390248	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150390248C>T	uc003who.2	+	3	962	c.874C>T	c.(874-876)CAC>TAC	p.H292Y	GIMAP1_uc003whp.2_Intron	NM_015660	NP_056475	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	292						integral to membrane	GTP binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTGCATACTGCACAGCATGTG	0.328																0.07732	-5.040804	30.44386	15	179	KEEP	---	---	---	---	7	9	116	76	-1	capture	Missense_Mutation	SNP	150390248	150390248	GIMAP2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	6319	141
GIMAP5	55340	broad.mit.edu	37	7	150440111	150440111	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150440111T>A	uc003whr.1	+	3	1236	c.884T>A	c.(883-885)CTT>CAT	p.L295H	GIMAP5_uc010lpu.2_Missense_Mutation_p.L153H	NM_018384	NP_060854	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5	295	Helical; Anchor for type IV membrane protein; (Potential).					integral to membrane|mitochondrial outer membrane	GTP binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCAGCATACTTTTTTTCATT	0.368																0.310526	162.247485	168.327378	59	131	KEEP	---	---	---	---	37	22	70	68	-1	capture	Missense_Mutation	SNP	150440111	150440111	GIMAP5	7	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	6321	141
XKR5	389610	broad.mit.edu	37	8	6681094	6681094	+	Missense_Mutation	SNP	T	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:6681094T>A	uc003wqp.2	-	4	608	c.586A>T	c.(586-588)AGT>TGT	p.S196C	XKR5_uc003wqq.2_Missense_Mutation_p.S33C|XKR5_uc003wqr.1_RNA	NM_207411	NP_997294	Q6UX68	XKR5_HUMAN	XK-related protein 5a	196						integral to membrane					0			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		AGAACCAGACTCAGCACGCGG	0.483																0.208333	11.361261	13.252377	5	19	KEEP	---	---	---	---	3	2	9	10	-1	capture	Missense_Mutation	SNP	6681094	6681094	XKR5	8	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	17315	141
PTPRD	5789	broad.mit.edu	37	9	8389318	8389318	+	Missense_Mutation	SNP	C	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:8389318C>T	uc003zkk.2	-	36	5011	c.4300G>A	c.(4300-4302)GAA>AAA	p.E1434K	PTPRD_uc003zkp.2_Missense_Mutation_p.E1028K|PTPRD_uc003zkq.2_Missense_Mutation_p.E1027K|PTPRD_uc003zkr.2_Missense_Mutation_p.E1018K|PTPRD_uc003zks.2_Missense_Mutation_p.E1027K|PTPRD_uc003zkl.2_Missense_Mutation_p.E1425K|PTPRD_uc003zkm.2_Missense_Mutation_p.E1421K|PTPRD_uc003zkn.2_Missense_Mutation_p.E1023K|PTPRD_uc003zko.2_Missense_Mutation_p.E1024K	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1434	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CCAAATGTTTCGGGGAGAGAT	0.418					1253								TSP Lung(15;0.13)			0.285714	85.952035	90.568325	32	80	KEEP	---	---	---	---	22	12	43	41	-1	capture	Missense_Mutation	SNP	8389318	8389318	PTPRD	9	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12694	141
SLC28A3	64078	broad.mit.edu	37	9	86924627	86924627	+	Missense_Mutation	SNP	A	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:86924627A>T	uc010mpz.2	-	3	284	c.159T>A	c.(157-159)GAT>GAA	p.D53E	SLC28A3_uc011lsy.1_5'UTR|SLC28A3_uc004anu.1_Missense_Mutation_p.D53E|SLC28A3_uc010mqb.2_5'UTR	NM_022127	NP_071410	Q9HAS3	S28A3_HUMAN	concentrative Na+-nucleoside cotransporter	53	Cytoplasmic (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						CCTGTTCTTCATCCTGGAAAT	0.428	Ovarian(106;425 1539 34835 42413 43572)															0.247191	125.720526	136.067409	44	134	KEEP	---	---	---	---	27	19	76	72	-1	capture	Missense_Mutation	SNP	86924627	86924627	SLC28A3	9	A	T	T	T	1	0	0	0	0	1	0	0	0	102	8	4	4	14425	141
KIAA1958	158405	broad.mit.edu	37	9	115336719	115336719	+	Missense_Mutation	SNP	G	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:115336719G>T	uc004bgf.1	+	2	534	c.359G>T	c.(358-360)TGT>TTT	p.C120F	KIAA1958_uc011lwx.1_Missense_Mutation_p.C120F	NM_133465	NP_597722	Q8N8K9	K1958_HUMAN	hypothetical protein LOC158405	120										skin(1)	1						AGAGACTCTTGTGACTTCTCC	0.473																0.04321	-21.520123	14.724218	7	155	KEEP	---	---	---	---	6	3	98	85	0.666666666667	capture	Missense_Mutation	SNP	115336719	115336719	KIAA1958	9	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	8186	141
NUP62CL	54830	broad.mit.edu	37	X	106397360	106397360	+	Missense_Mutation	SNP	G	C	C			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:106397360G>C	uc004ena.2	-	5	570	c.311C>G	c.(310-312)GCT>GGT	p.A104G	NUP62CL_uc004enb.2_Intron	NM_017681	NP_060151	Q9H1M0	N62CL_HUMAN	nucleoporin 62kDa C-terminal like	104					protein transport	nuclear pore	structural constituent of nuclear pore				0						ATGGTCCCAAGCATTGACCTG	0.388																0.206897	96.033036	109.977266	36	138	KEEP	---	---	---	---	24	16	80	79	-1	capture	Missense_Mutation	SNP	106397360	106397360	NUP62CL	23	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	10676	141
UBE2NL	389898	broad.mit.edu	37	X	142967486	142967487	+	Missense_Mutation	DNP	AG	TA	TA			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142967486_142967487AG>TA	uc004fca.2	+	1	314_315	c.284_285AG>TA	c.(283-285)AAG>ATA	p.K95I		NM_001012989	NP_001013007	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like	95							acid-amino acid ligase activity				0	Acute lymphoblastic leukemia(192;6.56e-05)					TTGAAAGATAAGTGGTCCCCAG	0.421																0.95302	479.860742	496.742973	142	7	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	142967486	142967487	UBE2NL	23	AG	TA	TA	TA	1	0	0	0	0	1	0	0	0	39	3	4	4	16749	141
GABRQ	55879	broad.mit.edu	37	X	151808911	151808911	+	Silent	SNP	G	A	A			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151808911G>A	uc004ffp.1	+	2	242	c.222G>A	c.(220-222)CTG>CTA	p.L74L		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	74	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ATGTCCGCCTGAGACCGAATT	0.463																0.065657	-11.998622	26.787372	13	185	KEEP	---	---	---	---	8	6	122	90	-1	capture	Silent	SNP	151808911	151808911	GABRQ	23	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	6117	141
TP53	7157	broad.mit.edu	37	17	7577035	7577036	+	Frame_Shift_Ins	INS	-	G	G	rs72661120		TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577035_7577036insG	uc002gim.2	-	8	1096_1097	c.902_903insC	c.(901-903)CCAfs	p.P301fs	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Frame_Shift_Ins_p.P301fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Ins_p.P169fs|TP53_uc010cng.1_Frame_Shift_Ins_p.P169fs|TP53_uc002gii.1_Frame_Shift_Ins_p.P169fs|TP53_uc010cnh.1_Frame_Shift_Ins_p.P301fs|TP53_uc010cni.1_Frame_Shift_Ins_p.P301fs|TP53_uc002gij.2_Frame_Shift_Ins_p.P301fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	301	Interaction with HIPK1 (By similarity).|Interaction with CARM1.		P -> T (in a sporadic cancer; somatic mutation).|P -> A (in sporadic cancers; somatic mutation).|P -> Q (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.P301fs*44(9)|p.0?(7)|p.G302fs*4(4)|p.?(3)|p.P301fs*5(3)|p.P301S(3)|p.P301_S303delPGS(1)|p.L299fs*2(1)|p.L265_K305del41(1)|p.P301Q(1)|p.P301P(1)|p.P301fs*45(1)|p.P301T(1)|p.G293fs*1(1)|p.P301L(1)|p.P301A(1)|p.E298_P301delELPP(1)|p.H296_S303delHHELPPGS(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TAGTGCTCCCTGGGGGCAGCTC	0.559	Pancreas(47;798 1329 9957 10801)		111	p.P301fs(KCL22-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.84			108	21		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	7577035	7577036	TP53	17	-	G	G	G	1	0	1	1	0	0	0	0	0	704	55	5	5	16264	141
C2orf71	388939	broad.mit.edu	37	2	29295647	29295649	+	In_Frame_Del	DEL	TCC	-	-			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:29295647_29295649delTCC	uc002rmt.1	-	1	1479_1481	c.1479_1481delGGA	c.(1477-1482)GAGGAA>GAA	p.493_494EE>E		NM_001029883	NP_001025054	A6NGG8	CB071_HUMAN	hypothetical protein LOC388939	493_494					response to stimulus|visual perception	photoreceptor outer segment				skin(1)	1						CATTTTGTCTTCCTCCTCCTCCT	0.542																0.02			7	446		---	---	---	---						capture_indel	In_Frame_Del	DEL	29295647	29295649	C2orf71	2	TCC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	2171	141
MARCH6	10299	broad.mit.edu	37	5	10423856	10423857	+	Frame_Shift_Ins	INS	-	T	T			TCGA-14-0871-01	TCGA-14-0871-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:10423856_10423857insT	uc003jet.1	+	23	2476_2477	c.2293_2294insT	c.(2293-2295)CTTfs	p.L765fs	MARCH6_uc011cmu.1_Frame_Shift_Ins_p.L717fs|MARCH6_uc003jeu.1_Frame_Shift_Ins_p.L463fs|MARCH6_uc011cmv.1_Frame_Shift_Ins_p.L660fs	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	765	Helical; (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						GGACTGGGCACTTGGAGTCCTG	0.361																0.13			13	87		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	10423856	10423857	MARCH6	5	-	T	T	T	1	0	1	1	0	0	0	0	0	260	20	5	5	9218	141
