Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA1751	85452	broad.mit.edu	37	1	1902133	1902133	+	Silent	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1902133G>A	uc001aim.1	-	10	1167	c.1011C>T	c.(1009-1011)CAC>CAT	p.H337H	KIAA1751_uc009vkz.1_Silent_p.H337H	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	337	Potential.									pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		GCCGGCGCTGGTGGACAAGGT	0.677																0.2	12.131354	14.644225	6	24	KEEP	---	---	---	---	3	3	16	12	-1	capture	Silent	SNP	1902133	1902133	KIAA1751	1	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	8178	158
CHD5	26038	broad.mit.edu	37	1	6195434	6195434	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6195434G>A	uc001amb.1	-	18	2826	c.2726C>T	c.(2725-2727)GCT>GTT	p.A909V	CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	909					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GGAGATGTCAGCAAACTCCTC	0.602					2304											0.036585	-12.744043	6.346536	3	79	KEEP	---	---	---	---	2	1	48	51	-1	capture	Missense_Mutation	SNP	6195434	6195434	CHD5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	3294	158
ZMYM4	9202	broad.mit.edu	37	1	35836122	35836122	+	Missense_Mutation	SNP	G	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:35836122G>T	uc001byt.2	+	7	1155	c.1075G>T	c.(1075-1077)GGG>TGG	p.G359W	ZMYM4_uc009vuu.2_Missense_Mutation_p.G327W|ZMYM4_uc001byu.2_Missense_Mutation_p.G35W|ZMYM4_uc009vuv.2_Missense_Mutation_p.G98W|uc001byv.2_5'Flank	NM_005095	NP_005086	Q5VZL5	ZMYM4_HUMAN	zinc finger protein 262	359					multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TCAGAGGAAAGGGTCTACTCA	0.483																0.021505	-40.77506	6.833107	4	182	KEEP	---	---	---	---	2	2	96	121	0.5	capture	Missense_Mutation	SNP	35836122	35836122	ZMYM4	1	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	17582	158
EPS15	2060	broad.mit.edu	37	1	51869155	51869155	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:51869155T>C	uc001csq.1	-	17	1819	c.1727A>G	c.(1726-1728)GAG>GGG	p.E576G	EPS15_uc009vyz.1_Missense_Mutation_p.E442G|EPS15_uc001csp.3_Missense_Mutation_p.E262G	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway	576					cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						TGTAGTCACCTCATTTTCATC	0.303					562	T	MLL	ALL								0.020833	-28.906361	8.099611	3	141	KEEP	---	---	---	---	3	0	83	93	-1	capture	Missense_Mutation	SNP	51869155	51869155	EPS15	1	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	5147	158
ECHDC2	55268	broad.mit.edu	37	1	53370462	53370462	+	Silent	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53370462C>T	uc001cup.3	-	7	804	c.558G>A	c.(556-558)GCG>GCA	p.A186A	ECHDC2_uc001cun.2_Silent_p.A109A|ECHDC2_uc001cuo.3_Silent_p.A155A|ECHDC2_uc010onk.1_Silent_p.A140A	NM_018281	NP_060751	Q86YB7	ECHD2_HUMAN	enoyl Coenzyme A hydratase domain containing 2	186					fatty acid metabolic process	mitochondrion	lyase activity			central_nervous_system(1)	1						TGAGCTCCTTCGCCAGGGCCA	0.642																0.337349	77.062671	79.010442	28	55	KEEP	---	---	---	---	11	19	30	29	-1	capture	Silent	SNP	53370462	53370462	ECHDC2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	4849	158
TXNIP	10628	broad.mit.edu	37	1	145439050	145439050	+	Missense_Mutation	SNP	C	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145439050C>A	uc001enn.3	+	1	589	c.248C>A	c.(247-249)ACA>AAA	p.T83K	NBPF10_uc001emp.3_Intron|TXNIP_uc001enm.1_Intron|TXNIP_uc010oys.1_5'Flank	NM_006472	NP_006463	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	83					cell cycle|keratinocyte differentiation|transcription, DNA-dependent		ubiquitin protein ligase binding			ovary(2)	2	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GACCAGCCAACAGGTAAGCGG	0.463																0.036585	-12.150479	6.945391	3	79	KEEP	---	---	---	---	4	1	41	57	0.2	capture	Missense_Mutation	SNP	145439050	145439050	TXNIP	1	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	16685	158
OR6K2	81448	broad.mit.edu	37	1	158669789	158669789	+	Silent	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158669789G>A	uc001fsu.1	-	1	654	c.654C>T	c.(652-654)TCC>TCT	p.S218S		NM_001005279	NP_001005279	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K,	218	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					TACCATCGTAGGACATGAAGA	0.478																0.331034	146.945666	150.616634	48	97	KEEP	---	---	---	---	33	25	61	51	-1	capture	Silent	SNP	158669789	158669789	OR6K2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	11106	158
CNTN2	6900	broad.mit.edu	37	1	205042816	205042816	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:205042816C>T	uc001hbr.2	+	23	3315	c.3046C>T	c.(3046-3048)CGC>TGC	p.R1016C	CNTN2_uc001hbs.2_Missense_Mutation_p.R804C	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	1016					axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CATGGCAGTCCGCCCAGCACC	0.607	Melanoma(183;2548 2817 37099 41192)															0.198582	66.119025	78.042347	28	113	KEEP	---	---	---	---	18	15	63	67	-1	capture	Missense_Mutation	SNP	205042816	205042816	CNTN2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3606	158
ZMIZ1	57178	broad.mit.edu	37	10	81065892	81065892	+	Missense_Mutation	SNP	G	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:81065892G>T	uc001kaf.2	+	22	3031	c.2459G>T	c.(2458-2460)TGC>TTC	p.C820F	ZMIZ1_uc001kag.2_Missense_Mutation_p.C696F|ZMIZ1_uc010qlq.1_5'UTR	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17	820					transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			GATCCCACGTGCAGCTGGCGG	0.607																0.068182	-1.408408	7.077323	3	41	KEEP	---	---	---	---	1	2	25	22	0.333333333333	capture	Missense_Mutation	SNP	81065892	81065892	ZMIZ1	10	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	17576	158
PNLIP	5406	broad.mit.edu	37	10	118307871	118307871	+	Splice_Site	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:118307871G>A	uc001lcm.2	+	4	245	c.202_splice	c.e4-1	p.E68_splice		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	TGTCTAAACAGGAAGTTGCCG	0.388																0.4	228.515973	230.046516	70	105	KEEP	---	---	---	---	34	41	37	72	-1	capture	Splice_Site	SNP	118307871	118307871	PNLIP	10	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	12052	158
KIAA1598	57698	broad.mit.edu	37	10	118728202	118728202	+	Silent	SNP	G	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:118728202G>T	uc009xyw.2	-	3	631	c.133C>A	c.(133-135)CGA>AGA	p.R45R	KIAA1598_uc001lcz.3_Silent_p.R45R|KIAA1598_uc010qso.1_5'UTR|KIAA1598_uc010qsp.1_Silent_p.R45R|KIAA1598_uc010qsq.1_5'UTR|KIAA1598_uc001lcy.3_Silent_p.R15R	NM_001127211	NP_001120683	A0MZ66	SHOT1_HUMAN	shootin1 isoform a	45	Potential.				axon guidance	axon					0				all cancers(201;0.00494)		GCTTCATCTCGTTCTTGCCTA	0.318																0.454545	16.473902	16.493698	5	6	KEEP	---	---	---	---	2	4	4	4	0.333333333333	capture	Silent	SNP	118728202	118728202	KIAA1598	10	G	T	T	T	1	0	0	0	0	0	0	0	1	519	40	4	4	8168	158
STIM1	6786	broad.mit.edu	37	11	4045179	4045179	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4045179G>A	uc001lyv.2	+	3	915	c.347G>A	c.(346-348)AGC>AAC	p.S116N	STIM1_uc009yef.2_Missense_Mutation_p.S116N	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor	116	Extracellular (Potential).				activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		AAGCTCATCAGCGTGGAGGAC	0.488																0.287356	67.537009	71.066743	25	62	KEEP	---	---	---	---	10	20	39	42	-1	capture	Missense_Mutation	SNP	4045179	4045179	STIM1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	15173	158
OR8I2	120586	broad.mit.edu	37	11	55861310	55861310	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55861310T>C	uc010rix.1	+	1	527	c.527T>C	c.(526-528)TTT>TCT	p.F176S		NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I,	176	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1	Esophageal squamous(21;0.00693)					ATCAATCATTTTTTTTGTGAC	0.443																0.043689	-24.101111	21.860555	9	197	KEEP	---	---	---	---	2	8	109	123	-1	capture	Missense_Mutation	SNP	55861310	55861310	OR8I2	11	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	11144	158
SLC22A9	114571	broad.mit.edu	37	11	63137793	63137793	+	Missense_Mutation	SNP	C	T	T	rs143461929	by1000genomes	TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63137793C>T	uc001nww.2	+	1	533	c.265C>T	c.(265-267)CGT>TGT	p.R89C	SLC22A9_uc001nwx.2_RNA	NM_080866	NP_543142	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion/cation	89	Extracellular (Potential).				transmembrane transport	integral to membrane				breast(2)|large_intestine(1)	3						AGAGAAGTGTCGTCGCTTTGT	0.537																0.377193	123.895931	125.405198	43	71	KEEP	---	---	---	---	26	24	38	58	-1	capture	Missense_Mutation	SNP	63137793	63137793	SLC22A9	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14353	158
TSGA10IP	254187	broad.mit.edu	37	11	65714723	65714723	+	Nonsense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65714723C>T	uc001ogk.1	+	5	459	c.427C>T	c.(427-429)CAG>TAG	p.Q143*	TSGA10IP_uc009yqw.1_RNA|TSGA10IP_uc009yqx.1_Intron	NM_152762	NP_689975	Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein	143											0						CTCGTTCTCCCAGCGTCAGTC	0.657																0.076923	1.628003	6.392396	2	24	KEEP	---	---	---	---	2	0	12	16	-1	capture	Nonsense_Mutation	SNP	65714723	65714723	TSGA10IP	11	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	16501	158
MOGAT2	80168	broad.mit.edu	37	11	75439862	75439862	+	Silent	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:75439862C>T	uc010rru.1	+	5	678	c.678C>T	c.(676-678)TTC>TTT	p.F226F	MOGAT2_uc001oww.1_3'UTR|MOGAT2_uc010rrv.1_Silent_p.F144F	NM_025098	NP_079374	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	226					glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			ovary(2)	2	Ovarian(111;0.103)					TCTTCTCCTTCGGGGAGAATG	0.537																0.283871	115.10254	121.628408	44	111	KEEP	---	---	---	---	20	34	60	77	-1	capture	Silent	SNP	75439862	75439862	MOGAT2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	9607	158
GDPD4	220032	broad.mit.edu	37	11	76990356	76990356	+	Silent	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:76990356G>A	uc001oyf.2	-	3	393	c.142C>T	c.(142-144)CTG>TTG	p.L48L		NM_182833	NP_878253	Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain	48	Helical; (Potential).				glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding			skin(1)	1						CTCACCAACAGCAATGAAGAG	0.433																0.333333	41.835085	42.868769	14	28	KEEP	---	---	---	---	3	16	19	10	-1	capture	Silent	SNP	76990356	76990356	GDPD4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	6266	158
AMOTL1	154810	broad.mit.edu	37	11	94532995	94532995	+	Silent	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94532995G>A	uc001pfb.2	+	3	809	c.639G>A	c.(637-639)GCG>GCA	p.A213A	AMOTL1_uc001pfc.2_Silent_p.A163A	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN	angiomotin like 1	213						cytoplasm|tight junction	identical protein binding			ovary(1)|breast(1)	2		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				agcagGGGGCGGTGGGCCATG	0.532																0.105263	3.550573	6.47972	2	17	KEEP	---	---	---	---	0	2	11	8	-1	capture	Silent	SNP	94532995	94532995	AMOTL1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	583	158
CLDN25	644672	broad.mit.edu	37	11	113650759	113650759	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113650759G>A	uc009yyw.1	+	1	242	c.242G>A	c.(241-243)CGC>CAC	p.R81H		NM_001101389	NP_001094859	C9JDP6	CLD25_HUMAN	claudin 25	81	Extracellular (Potential).					integral to membrane|tight junction	structural molecule activity				0						CAGGTAGCCCGCATCCTCATG	0.557																0.016234	-74.282304	7.312978	5	303	KEEP	---	---	---	---	3	3	154	186	-1	capture	Missense_Mutation	SNP	113650759	113650759	CLDN25	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3450	158
AQP5	362	broad.mit.edu	37	12	50355944	50355944	+	Silent	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:50355944G>A	uc001rvo.2	+	1	666	c.144G>A	c.(142-144)GCG>GCA	p.A48A		NM_001651	NP_001642	P55064	AQP5_HUMAN	aquaporin 5	48	Helical; (Potential).				carbon dioxide transport|excretion|odontogenesis|pancreatic juice secretion	apical plasma membrane|integral to plasma membrane	protein binding|water channel activity				0						TCGCGCTGGCGTTTGGCCTGG	0.667																0.24	11.527849	13.080995	6	19	KEEP	---	---	---	---	3	5	15	10	-1	capture	Silent	SNP	50355944	50355944	AQP5	12	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	822	158
HSD17B6	8630	broad.mit.edu	37	12	57167873	57167873	+	Silent	SNP	G	A	A	rs147344470	byFrequency	TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57167873G>A	uc001smg.1	+	2	347	c.237G>A	c.(235-237)ACG>ACA	p.T79T		NM_003725	NP_003716	O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	79					androgen biosynthetic process|androgen catabolic process	early endosome membrane|endoplasmic reticulum|microsome	binding|electron carrier activity|estradiol 17-beta-dehydrogenase activity|retinol dehydrogenase activity|testosterone 17-beta-dehydrogenase (NAD+) activity			upper_aerodigestive_tract(1)|pancreas(1)	2					Succinic acid(DB00139)	GGCTGGAGACGGTGACCCTGG	0.567																0.333333	78.061778	80.133381	28	56	KEEP	---	---	---	---	14	18	36	36	-1	capture	Silent	SNP	57167873	57167873	HSD17B6	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7312	158
NOS1	4842	broad.mit.edu	37	12	117669899	117669899	+	Silent	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117669899C>T	uc001twm.1	-	22	3959	c.3273G>A	c.(3271-3273)CCG>CCA	p.P1091P		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	1091	FAD-binding FR-type.				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	TGGTGCAGGGCGGGAGGCGGA	0.602	Esophageal Squamous(162;1748 2599 51982 52956)															0.254717	65.368198	71.16107	27	79	KEEP	---	---	---	---	18	15	46	57	-1	capture	Silent	SNP	117669899	117669899	NOS1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	10448	158
TSC22D1	8848	broad.mit.edu	37	13	45148388	45148388	+	Missense_Mutation	SNP	G	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:45148388G>T	uc001uzn.3	-	1	2314	c.1823C>A	c.(1822-1824)TCT>TAT	p.S608Y	TSC22D1_uc001uzo.1_Intron	NM_183422	NP_904358	Q15714	T22D1_HUMAN	TSC22 domain family, member 1 isoform 1	608	Gln-rich.				transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		AGCCGCCTGAGAATATGGTAG	0.522																0.209877	36.425648	42.73969	17	64	KEEP	---	---	---	---	8	12	30	41	0.4	capture	Missense_Mutation	SNP	45148388	45148388	TSC22D1	13	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	16490	158
TUBGCP3	10426	broad.mit.edu	37	13	113176787	113176787	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113176787T>C	uc001vse.1	-	14	1779	c.1592A>G	c.(1591-1593)CAG>CGG	p.Q531R	TUBGCP3_uc010tjq.1_Missense_Mutation_p.Q521R|TUBGCP3_uc001vsf.2_Missense_Mutation_p.Q531R	NM_006322	NP_006313	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	531					G2/M transition of mitotic cell cycle|microtubule nucleation|single fertilization	centriole|cytosol|polar microtubule	gamma-tubulin binding|structural constituent of cytoskeleton			central_nervous_system(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					AATCTTCCCCTGAAATGCATT	0.423																0.01676	-40.840014	6.416118	3	176	KEEP	---	---	---	---	0	5	114	96	-1	capture	Missense_Mutation	SNP	113176787	113176787	TUBGCP3	13	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	16649	158
ZNF828	283489	broad.mit.edu	37	13	115090500	115090500	+	Missense_Mutation	SNP	C	G	G			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:115090500C>G	uc010ahb.2	+	3	1512	c.1183C>G	c.(1183-1185)CCA>GCA	p.P395A	ZNF828_uc001vuv.2_Missense_Mutation_p.P395A|ZNF828_uc010tko.1_Missense_Mutation_p.P395A	NM_001164144	NP_001157616	Q96JM3	ZN828_HUMAN	zinc finger protein 828	395	Mediates interaction with MAD2L2.|Pro-rich.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|protein localization to kinetochore|protein localization to microtubule|sister chromatid biorientation	condensed chromosome kinetochore|cytoplasm|nucleus|spindle	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_epithelial(44;0.122)|all_lung(25;0.123)	BRCA - Breast invasive adenocarcinoma(86;0.104)	OV - Ovarian serous cystadenocarcinoma(48;0.193)|Epithelial(10;0.197)		GTCTGGCCCACCAGAACTCCG	0.557																0.313364	235.032245	241.753421	68	149	KEEP	---	---	---	---	44	34	61	99	-1	capture	Missense_Mutation	SNP	115090500	115090500	ZNF828	13	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	18057	158
AK7	122481	broad.mit.edu	37	14	96875256	96875256	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96875256C>T	uc001yfn.2	+	4	520	c.476C>T	c.(475-477)GCG>GTG	p.A159V		NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	159	Potential.				cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		ATGACTTGGGCGCGCTCCAAA	0.473																0.240964	49.663842	54.743317	20	63	KEEP	---	---	---	---	9	13	31	46	-1	capture	Missense_Mutation	SNP	96875256	96875256	AK7	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	444	158
AHNAK2	113146	broad.mit.edu	37	14	105407228	105407228	+	Missense_Mutation	SNP	G	C	C			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105407228G>C	uc010axc.1	-	7	14680	c.14560C>G	c.(14560-14562)CCT>GCT	p.P4854A	AHNAK2_uc001ypx.2_Missense_Mutation_p.P4754A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4854						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGAGAAACAGGAATCATGGAA	0.483																0.243243	27.355302	29.579558	9	28	KEEP	---	---	---	---	2	8	13	19	-1	capture	Missense_Mutation	SNP	105407228	105407228	AHNAK2	14	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	415	158
NDN	4692	broad.mit.edu	37	15	23932352	23932352	+	Missense_Mutation	SNP	T	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:23932352T>A	uc001ywk.2	-	1	99	c.13A>T	c.(13-15)AGT>TGT	p.S5C		NM_002487	NP_002478	Q99608	NECD_HUMAN	necdin	5					negative regulation of cell proliferation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perikaryon	DNA binding				0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		AGATCCTTACTTTGTTCTGAC	0.642												Prader-Willi_syndrome				0.351852	49.160721	50.226896	19	35	KEEP	---	---	---	---	8	12	13	27	-1	capture	Missense_Mutation	SNP	23932352	23932352	NDN	15	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	10154	158
CHRFAM7A	89832	broad.mit.edu	37	15	30659651	30659651	+	Silent	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:30659651G>A	uc001zdt.1	-	9	1256	c.690C>T	c.(688-690)CAC>CAT	p.H230H	DKFZP434L187_uc001zds.2_Intron|CHRFAM7A_uc001zdu.1_Silent_p.H139H|CHRFAM7A_uc010azn.2_Silent_p.H139H	NM_139320	NP_647536	Q494W8	CRFM7_HUMAN	CHRNA7-FAM7A fusion isoform 1	230						integral to membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity			skin(1)	1		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		CGTCGGGGTCGTGGTGGTGGT	0.602																0.141176	19.244899	29.802242	12	73	KEEP	---	---	---	---	5	7	41	53	-1	capture	Silent	SNP	30659651	30659651	CHRFAM7A	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3340	158
ARID3B	10620	broad.mit.edu	37	15	74884098	74884098	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74884098C>T	uc002aye.2	+	7	1564	c.1363C>T	c.(1363-1365)CGC>TGC	p.R455C	ARID3B_uc002ayd.2_Missense_Mutation_p.R455C|ARID3B_uc010bjs.1_Missense_Mutation_p.R160C	NM_006465	NP_006456	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B	455	REKLES.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						GGCCTTCCAGCGCAACTTTTT	0.647																0.267442	51.979613	56.185672	23	63	KEEP	---	---	---	---	11	21	33	47	-1	capture	Missense_Mutation	SNP	74884098	74884098	ARID3B	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	910	158
SRRM2	23524	broad.mit.edu	37	16	2812074	2812074	+	Silent	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2812074G>A	uc002crk.2	+	11	2094	c.1545G>A	c.(1543-1545)AGG>AGA	p.R515R	SRRM2_uc002crj.1_Silent_p.R419R|SRRM2_uc002crl.1_Silent_p.R515R|SRRM2_uc010bsu.1_Silent_p.R419R	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	515	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						AGTGGCGTAGGTCCAGGTCTG	0.617																0.26875	108.540065	116.276013	43	117	KEEP	---	---	---	---	22	29	75	72	-1	capture	Silent	SNP	2812074	2812074	SRRM2	16	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	15061	158
ACSM2A	123876	broad.mit.edu	37	16	20476938	20476938	+	Missense_Mutation	SNP	G	A	A	rs141326932		TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20476938G>A	uc010bwe.2	+	4	516	c.277G>A	c.(277-279)GCA>ACA	p.A93T	ACSM2A_uc010bwd.1_RNA|ACSM2A_uc010vax.1_Missense_Mutation_p.A14T|ACSM2A_uc002dhf.3_Missense_Mutation_p.A93T|ACSM2A_uc002dhg.3_Missense_Mutation_p.A93T|ACSM2A_uc010vay.1_Missense_Mutation_p.A14T	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	93					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						CAGCCAGCAGGCAGCCAACGT	0.612																0.063158	-4.812474	14.050035	6	89	KEEP	---	---	---	---	2	6	57	50	-1	capture	Missense_Mutation	SNP	20476938	20476938	ACSM2A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	183	158
ACSM2B	348158	broad.mit.edu	37	16	20570670	20570670	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20570670C>T	uc002dhj.3	-	4	487	c.277G>A	c.(277-279)GCA>ACA	p.A93T	ACSM2B_uc002dhk.3_Missense_Mutation_p.A93T|ACSM2B_uc010bwf.1_Missense_Mutation_p.A93T	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	93					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						ATGTTGGCTGCCTGCTGGCTG	0.602																0.3125	11.765943	12.268627	5	11	KEEP	---	---	---	---	6	2	18	12	-1	capture	Missense_Mutation	SNP	20570670	20570670	ACSM2B	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	184	158
ALOX12B	242	broad.mit.edu	37	17	7989533	7989533	+	Silent	SNP	G	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7989533G>T	uc002gjy.1	-	2	414	c.153C>A	c.(151-153)GGC>GGA	p.G51G	hsa-mir-4314|MI0015846_5'Flank	NM_001139	NP_001130	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	51	PLAT.				epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity				0						CGGTGTACTGGCCCACCTAGG	0.647													Multiple Myeloma(8;0.094)			0.142857	6.122101	11.324911	6	36	KEEP	---	---	---	---	3	4	20	21	0.428571428571	capture	Silent	SNP	7989533	7989533	ALOX12B	17	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	537	158
SMCR7	125170	broad.mit.edu	37	17	18167942	18167942	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:18167942G>A	uc002gst.2	+	4	1440	c.1229G>A	c.(1228-1230)GGC>GAC	p.G410D	SMCR7_uc002gsu.2_3'UTR|SMCR7_uc010vxq.1_Missense_Mutation_p.G421D	NM_139162	NP_631901	Q96C03	SMCR7_HUMAN	Smith-Magenis syndrome chromosome region,	410						integral to membrane	protein binding				0	all_neural(463;0.228)					CTGCTCATCGGCAGCCTGGAG	0.627																0.055556	-4.920634	6.30288	3	51	KEEP	---	---	---	---	2	1	44	49	-1	capture	Missense_Mutation	SNP	18167942	18167942	SMCR7	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	14682	158
GPR179	440435	broad.mit.edu	37	17	36499092	36499092	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:36499092G>A	uc002hpz.2	-	1	602	c.581C>T	c.(580-582)ACC>ATC	p.T194I		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	194	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CAGGGCAGGGGTGTCCAGGTC	0.642																0.304598	133.936426	139.850933	53	121	KEEP	---	---	---	---	17	37	62	70	-1	capture	Missense_Mutation	SNP	36499092	36499092	GPR179	17	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	6608	158
KRTAP4-7	100132476	broad.mit.edu	37	17	39240819	39240819	+	Missense_Mutation	SNP	C	G	G			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39240819C>G	uc010wfn.1	+	1	361	c.361C>G	c.(361-363)CTG>GTG	p.L121V		NM_033061	NP_149050			keratin associated protein 4-7												0						ctgctgctgcCTGCGTCCAGT	0.313																0.333333	8.121591	8.343201	3	6	KEEP	---	---	---	---	2	4	6	4	-1	capture	Missense_Mutation	SNP	39240819	39240819	KRTAP4-7	17	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	8475	158
KRTAP4-7	100132476	broad.mit.edu	37	17	39240900	39240900	+	Missense_Mutation	SNP	T	G	G	rs61746948		TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39240900T>G	uc010wfn.1	+	1	442	c.442T>G	c.(442-444)TTG>GTG	p.L148V		NM_033061	NP_149050			keratin associated protein 4-7												0						TCCCCGCCCCTTGTGCTGTGC	0.552																0.375	9.725434	9.834229	3	5	KEEP	---	---	---	---	1	3	2	10	-1	capture	Missense_Mutation	SNP	39240900	39240900	KRTAP4-7	17	T	G	G	G	1	0	0	0	0	1	0	0	0	725	56	4	4	8475	158
PPM1D	8493	broad.mit.edu	37	17	58740521	58740521	+	Nonsense_Mutation	SNP	G	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:58740521G>T	uc002iyt.1	+	6	1648	c.1426G>T	c.(1426-1428)GAA>TAA	p.E476*	PPM1D_uc010ddm.1_RNA	NM_003620	NP_003611	O15297	PPM1D_HUMAN	protein phosphatase 1D	476					negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			ACCACTTGAAGAAAATTGCGC	0.403														OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	0.255411	139.0992	151.647508	59	172	KEEP	---	---	---	---	31	33	95	104	0.484375	capture	Nonsense_Mutation	SNP	58740521	58740521	PPM1D	17	G	T	T	T	1	0	0	0	0	0	1	0	0	429	33	5	4	12238	158
C17orf77	146723	broad.mit.edu	37	17	72588368	72588368	+	Silent	SNP	T	G	G			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72588368T>G	uc002jla.1	+	3	545	c.183T>G	c.(181-183)GGT>GGG	p.G61G	CD300LD_uc002jkz.2_5'UTR	NM_152460	NP_689673	Q96MU5	CQ077_HUMAN	hypothetical protein LOC146723	61						extracellular region					0						CTCTCCTTGGTGATCACAGGT	0.537																0.397436	104.07577	104.802339	31	47	KEEP	---	---	---	---	16	15	22	28	-1	capture	Silent	SNP	72588368	72588368	C17orf77	17	T	G	G	G	1	0	0	0	0	0	0	0	1	756	59	4	4	1867	158
EMILIN2	84034	broad.mit.edu	37	18	2892201	2892201	+	Silent	SNP	G	A	A	rs3810066	by1000genomes	TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:2892201G>A	uc002kln.2	+	4	2235	c.2076G>A	c.(2074-2076)ACG>ACA	p.T692T		NM_032048	NP_114437	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2 precursor	692					cell adhesion	collagen	extracellular matrix constituent conferring elasticity|protein binding			skin(2)|ovary(1)	3				READ - Rectum adenocarcinoma(2;0.1)		AGGAATGCACGCAGGGGGTCC	0.572																0.034031	-67.542398	22.805637	13	369	KEEP	---	---	---	---	6	9	229	225	-1	capture	Silent	SNP	2892201	2892201	EMILIN2	18	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5049	158
DCC	1630	broad.mit.edu	37	18	50592528	50592528	+	Missense_Mutation	SNP	C	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:50592528C>A	uc002lfe.1	+	7	1840	c.1253C>A	c.(1252-1254)CCT>CAT	p.P418H	DCC_uc010xdr.1_Missense_Mutation_p.P266H|DCC_uc010dpf.1_Missense_Mutation_p.P73H	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	418	Extracellular (Potential).				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CTCATTGTCCCTAAGCCTGGT	0.438																0.028777	-26.633332	7.351906	4	135	KEEP	---	---	---	---	3	2	63	77	0.4	capture	Missense_Mutation	SNP	50592528	50592528	DCC	18	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	4241	158
ZNF532	55205	broad.mit.edu	37	18	56587377	56587377	+	Nonsense_Mutation	SNP	G	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:56587377G>T	uc002lho.2	+	4	2405	c.1858G>T	c.(1858-1860)GAG>TAG	p.E620*	ZNF532_uc002lhp.2_Nonsense_Mutation_p.E618*|ZNF532_uc010xeg.1_Nonsense_Mutation_p.E618*|ZNF532_uc002lhr.2_Nonsense_Mutation_p.E618*|ZNF532_uc002lhs.2_Nonsense_Mutation_p.E618*	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	620	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						CAAGTGCTTGGAGTGTGGGGA	0.537																0.337209	75.150238	77.165167	29	57	KEEP	---	---	---	---	14	19	33	37	0.424242424242	capture	Nonsense_Mutation	SNP	56587377	56587377	ZNF532	18	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	17851	158
MC4R	4160	broad.mit.edu	37	18	58039346	58039346	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:58039346C>T	uc002lie.1	-	1	656	c.237G>A	c.(235-237)ATG>ATA	p.M79I		NM_005912	NP_005903	P32245	MC4R_HUMAN	melanocortin 4 receptor	79	Cytoplasmic (Potential).				feeding behavior|G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of bone resorption|positive regulation of cAMP biosynthetic process	integral to membrane|plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|ubiquitin protein ligase binding			lung(1)	1		Colorectal(73;0.0946)				TGAAAAAGTACATGGGTGAAT	0.438																0.266667	84.129378	90.776099	36	99	KEEP	---	---	---	---	26	23	60	72	-1	capture	Missense_Mutation	SNP	58039346	58039346	MC4R	18	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	9279	158
ARID3A	1820	broad.mit.edu	37	19	964263	964263	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:964263G>A	uc002lql.2	+	5	1072	c.782G>A	c.(781-783)CGC>CAC	p.R261H		NM_005224	NP_005215	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT- like)	261	ARID.					cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGTGAACCGCATCCCCATC	0.418	Pancreas(29;54 1022 32760 50921)															0.032258	-15.157528	7.079464	3	90	KEEP	---	---	---	---	4	0	55	53	-1	capture	Missense_Mutation	SNP	964263	964263	ARID3A	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	909	158
FUT6	2528	broad.mit.edu	37	19	5832254	5832254	+	Missense_Mutation	SNP	G	C	C			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5832254G>C	uc002mdf.1	-	4	851	c.325C>G	c.(325-327)CAC>GAC	p.H109D	FUT6_uc002mdg.1_Missense_Mutation_p.H109D|FUT6_uc002mdh.1_Missense_Mutation_p.H109D|FUT6_uc010dul.1_Missense_Mutation_p.H109D	NM_001040701	NP_001035791	P51993	FUT6_HUMAN	fucosyltransferase 6	109	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						ACCTCTCGGTGGTGCACGATG	0.642																0.182432	61.433531	75.452606	27	121	KEEP	---	---	---	---	16	22	76	94	-1	capture	Missense_Mutation	SNP	5832254	5832254	FUT6	19	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	6050	158
OR1M1	125963	broad.mit.edu	37	19	9204125	9204125	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9204125G>A	uc010xkj.1	+	1	205	c.205G>A	c.(205-207)GTT>ATT	p.V69I		NM_001004456	NP_001004456	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3						CCTGTCCCTGGTTGATTTCTG	0.557																0.022989	-37.74484	6.353405	4	170	KEEP	---	---	---	---	3	5	96	109	-1	capture	Missense_Mutation	SNP	9204125	9204125	OR1M1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	10872	158
CYP2B6	1555	broad.mit.edu	37	19	41515999	41515999	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41515999G>A	uc002opr.1	+	6	930	c.923G>A	c.(922-924)CGC>CAC	p.R308H	CYP2A7_uc002opo.2_Intron|CYP2B6_uc010xvu.1_Intron	NM_000767	NP_000758	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B,	308					cellular ketone metabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(20;0.00322)		Bupropion(DB01156)|Butalbital(DB00241)|Carbamazepine(DB00564)|Clopidogrel(DB00758)|Cyclophosphamide(DB00531)|Efavirenz(DB00625)|Ifosfamide(DB01181)|Memantine(DB01043)|Meperidine(DB00454)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicotine(DB00184)|Orphenadrine(DB01173)|Phenytoin(DB00252)|Propofol(DB00818)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Ticlopidine(DB00208)|Troleandomycin(DB01361)	ACCACTCTCCGCTACGGCTTC	0.552					56											0.369748	126.967242	128.742132	44	75	KEEP	---	---	---	---	16	31	38	49	-1	capture	Missense_Mutation	SNP	41515999	41515999	CYP2B6	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4124	158
FOXA3	3171	broad.mit.edu	37	19	46375889	46375889	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46375889G>A	uc002pdr.2	+	2	823	c.626G>A	c.(625-627)CGC>CAC	p.R209H		NM_004497	NP_004488	P55318	FOXA3_HUMAN	forkhead box A3	209					brain development|cellular glucose homeostasis|cellular response to starvation|chromatin modification|embryo development|endocrine pancreas development|negative regulation of cell proliferation|neural plate anterior/posterior regionalization|neuron fate specification|positive regulation of hepatocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|spermatogenesis	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(1)	1		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00453)|GBM - Glioblastoma multiforme(486;0.0518)|Epithelial(262;0.236)		TACCTGCGCCGCCAGAAACGC	0.627																0.380952	22.600042	22.859082	8	13	KEEP	---	---	---	---	3	5	9	7	-1	capture	Missense_Mutation	SNP	46375889	46375889	FOXA3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5935	158
EHD3	30845	broad.mit.edu	37	2	31483729	31483729	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31483729C>T	uc002rnu.2	+	4	1464	c.856C>T	c.(856-858)CCC>TCC	p.P286S	EHD3_uc010ymt.1_Intron	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	286					blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding	p.P286P(1)		skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					CCAGAGTCTGCCCCGAAATGC	0.622																0.02139	-40.556852	7.326455	4	183	KEEP	---	---	---	---	3	2	112	112	-1	capture	Missense_Mutation	SNP	31483729	31483729	EHD3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4934	158
BIRC6	57448	broad.mit.edu	37	2	32727897	32727897	+	Missense_Mutation	SNP	A	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:32727897A>T	uc010ezu.2	+	48	9377	c.9243A>T	c.(9241-9243)TTA>TTT	p.L3081F		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3081					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					CTGAGCCATTATTGTGGTTCA	0.313	Pancreas(94;175 1509 16028 18060 45422)				1555											0.27381	65.993285	69.862029	23	61	KEEP	---	---	---	---	10	19	36	42	-1	capture	Missense_Mutation	SNP	32727897	32727897	BIRC6	2	A	T	T	T	1	0	0	0	0	1	0	0	0	206	16	4	4	1426	158
SLC4A5	57835	broad.mit.edu	37	2	74477637	74477637	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74477637C>T	uc002sko.1	-	12	1488	c.1486G>A	c.(1486-1488)GGT>AGT	p.G496S	SLC4A5_uc002skl.2_RNA|SLC4A5_uc002skn.2_Missense_Mutation_p.G496S|SLC4A5_uc010ffc.1_Missense_Mutation_p.G496S|SLC4A5_uc002skp.1_Missense_Mutation_p.G432S|SLC4A5_uc002sks.1_Missense_Mutation_p.G496S	NM_021196	NP_067019	Q9BY07	S4A5_HUMAN	sodium bicarbonate transporter 4 isoform a	496	Cytoplasmic (Potential).|Gly-rich.					apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						CACAGGCCACCGAAGAACCTG	0.527														OREG0014716	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.235521	151.767567	168.319158	61	198	KEEP	---	---	---	---	36	33	99	125	-1	capture	Missense_Mutation	SNP	74477637	74477637	SLC4A5	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14549	158
IL18RAP	8807	broad.mit.edu	37	2	103040791	103040791	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103040791C>T	uc002tbx.2	+	5	980	c.496C>T	c.(496-498)CTT>TTT	p.L166F	IL18RAP_uc010fiz.2_Missense_Mutation_p.L24F	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	166	Ig-like C2-type 1.|Extracellular (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						gcaagacctacttcttgggag	0.343																0.335664	133.545557	136.967495	48	95	KEEP	---	---	---	---	25	23	50	49	-1	capture	Missense_Mutation	SNP	103040791	103040791	IL18RAP	2	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	7571	158
TMEM87B	84910	broad.mit.edu	37	2	112865416	112865416	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:112865416G>A	uc002thm.2	+	17	1945	c.1576G>A	c.(1576-1578)GTA>ATA	p.V526I		NM_032824	NP_116213	Q96K49	TM87B_HUMAN	transmembrane protein 87B precursor	526						integral to membrane					0						ATTCACAGATGTGTAAGTTAT	0.343																0.261905	27.903927	30.059617	11	31	KEEP	---	---	---	---	7	5	23	13	-1	capture	Missense_Mutation	SNP	112865416	112865416	TMEM87B	2	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	16094	158
GCG	2641	broad.mit.edu	37	2	163005628	163005628	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:163005628G>A	uc002ucc.2	-	2	160	c.61C>T	c.(61-63)CGT>TGT	p.R21C		NM_002054	NP_002045	P01275	GLUC_HUMAN	glucagon preproprotein	21					cell proliferation|cellular response to glucagon stimulus|energy reserve metabolic process|feeding behavior|regulation of insulin secretion	plasma membrane|soluble fraction	hormone activity				0					Exenatide(DB01276)|Phentolamine(DB00692)	TGAAGGGAACGTTGCCAGCTG	0.413																0.297297	176.267392	184.420946	66	156	KEEP	---	---	---	---	33	40	81	93	-1	capture	Missense_Mutation	SNP	163005628	163005628	GCG	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6230	158
MYO3B	140469	broad.mit.edu	37	2	171243715	171243715	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:171243715T>C	uc002ufy.2	+	14	1617	c.1474T>C	c.(1474-1476)TTT>CTT	p.F492L	MYO3B_uc002ufv.2_Missense_Mutation_p.F479L|MYO3B_uc010fqb.1_Missense_Mutation_p.F479L|MYO3B_uc002ufz.2_Missense_Mutation_p.F492L|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002ugb.2_RNA	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2	492	Myosin head-like.				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						CTCGAGCCGTTTTGGAAAATA	0.433					1118											0.061644	-4.820694	24.422861	9	137	KEEP	---	---	---	---	3	7	99	98	-1	capture	Missense_Mutation	SNP	171243715	171243715	MYO3B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	9987	158
ITGA4	3676	broad.mit.edu	37	2	182358131	182358131	+	Silent	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:182358131G>A	uc002unu.2	+	11	1996	c.1233G>A	c.(1231-1233)TCG>TCA	p.S411S		NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	411	FG-GAP 6.|Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	ATGGGATCTCGTCAACCTTCT	0.368																0.264045	117.737951	126.702345	47	131	KEEP	---	---	---	---	25	28	77	76	-1	capture	Silent	SNP	182358131	182358131	ITGA4	2	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	7801	158
MYO1B	4430	broad.mit.edu	37	2	192141643	192141643	+	Missense_Mutation	SNP	A	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192141643A>T	uc010fsg.2	+	2	277	c.22A>T	c.(22-24)ACC>TCC	p.T8S	MYO1B_uc002usq.2_Missense_Mutation_p.T8S|MYO1B_uc002usr.2_Missense_Mutation_p.T8S|MYO1B_uc002uss.1_Missense_Mutation_p.T8S	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1	8						myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			GGAGGTGAAAACCTCACTTCT	0.433																0.303797	187.80527	195.950435	72	165	KEEP	---	---	---	---	43	46	102	103	-1	capture	Missense_Mutation	SNP	192141643	192141643	MYO1B	2	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	9979	158
SLC19A3	80704	broad.mit.edu	37	2	228560683	228560683	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:228560683T>C	uc002vpi.2	-	4	1183	c.1094A>G	c.(1093-1095)TAC>TGC	p.Y365C	SLC19A3_uc002vpj.2_RNA|SLC19A3_uc010zlv.1_Missense_Mutation_p.Y361C	NM_025243	NP_079519	Q9BZV2	S19A3_HUMAN	solute carrier family 19, member 3	365	Extracellular (Potential).				thiamine-containing compound metabolic process	integral to membrane|plasma membrane	folic acid binding|reduced folate carrier activity|thiamine uptake transmembrane transporter activity			ovary(2)	2		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	ATTGGCTGTGTAATGCATGAG	0.443																0.291262	89.9155	93.933124	30	73	KEEP	---	---	---	---	21	16	39	47	-1	capture	Missense_Mutation	SNP	228560683	228560683	SLC19A3	2	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	14323	158
CHRND	1144	broad.mit.edu	37	2	233394760	233394760	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233394760G>A	uc002vsw.2	+	7	735	c.731G>A	c.(730-732)CGC>CAC	p.R244H	CHRND_uc010zmg.1_Missense_Mutation_p.R229H|CHRND_uc010fyc.2_Missense_Mutation_p.R117H|CHRND_uc010zmh.1_Intron	NM_000751	NP_000742	Q07001	ACHD_HUMAN	nicotinic acetylcholine receptor delta	244	Extracellular (Potential).				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)|breast(1)|skin(1)	3		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)		ATCATCCGCCGCAAGCCCCTC	0.607																0.029412	-26.600653	6.503947	4	132	KEEP	---	---	---	---	2	2	85	75	-1	capture	Missense_Mutation	SNP	233394760	233394760	CHRND	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3359	158
SNED1	25992	broad.mit.edu	37	2	242004746	242004746	+	Silent	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242004746G>A	uc002wah.1	+	21	2745	c.2745G>A	c.(2743-2745)GAG>GAA	p.E915E	SNED1_uc002wai.1_Silent_p.E150E|SNED1_uc002waj.1_Silent_p.E2E|SNED1_uc002wak.2_Silent_p.E2E	NM_001080437	NP_001073906	Q8TER0	SNED1_HUMAN	6720455I24Rik homolog precursor	915	Fibronectin type-III 1.				cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		TCAAGATGGAGAGAGTGGAGG	0.607																0.380952	49.390066	49.912166	16	26	KEEP	---	---	---	---	7	10	15	14	-1	capture	Silent	SNP	242004746	242004746	SNED1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	14737	158
ANGPT4	51378	broad.mit.edu	37	20	869018	869018	+	Missense_Mutation	SNP	A	G	G			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:869018A>G	uc002wei.2	-	3	633	c.530T>C	c.(529-531)CTG>CCG	p.L177P	ANGPT4_uc010zpn.1_Missense_Mutation_p.L171P	NM_015985	NP_057069	Q9Y264	ANGP4_HUMAN	angiopoietin 4 precursor	177	Potential.				anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			ovary(2)	2						CTGGTTCTCCAGCTTGTTGGT	0.522	Pancreas(181;481 2077 3259 31286 49856)															0.283333	96.110625	101.16449	34	86	KEEP	---	---	---	---	25	24	54	49	-1	capture	Missense_Mutation	SNP	869018	869018	ANGPT4	20	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	609	158
DHX35	60625	broad.mit.edu	37	20	37632428	37632428	+	Missense_Mutation	SNP	C	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:37632428C>A	uc002xjh.2	+	11	900	c.889C>A	c.(889-891)CAG>AAG	p.Q297K	DHX35_uc010zwa.1_Missense_Mutation_p.Q142K|DHX35_uc010zwb.1_Missense_Mutation_p.Q142K|DHX35_uc010zwc.1_Missense_Mutation_p.Q266K	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	297	Helicase C-terminal.					catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				GCTCATCGAGCAGGCTCGAGC	0.453																0.018382	-62.076868	8.97373	5	267	KEEP	---	---	---	---	4	3	167	169	0.428571428571	capture	Missense_Mutation	SNP	37632428	37632428	DHX35	20	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	4466	158
BACH1	571	broad.mit.edu	37	21	30693606	30693606	+	Missense_Mutation	SNP	C	G	G			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:30693606C>G	uc002ynj.2	+	2	120	c.5C>G	c.(4-6)TCT>TGT	p.S2C	BACH1_uc002ynk.2_Missense_Mutation_p.S2C|BACH1_uc002ynl.2_RNA	NM_001186	NP_001177	O14867	BACH1_HUMAN	BTB and CNC homology 1 transcription factor	2						nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|liver(1)	2						TGCAGAATGTCTCTGAGTGAG	0.403																0.294118	121.27526	125.790932	35	84	KEEP	---	---	---	---	18	19	42	44	-1	capture	Missense_Mutation	SNP	30693606	30693606	BACH1	21	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	1272	158
KRTAP12-3	386683	broad.mit.edu	37	21	46078019	46078019	+	Silent	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46078019G>A	uc002zft.2	+	1	171	c.123G>A	c.(121-123)ACG>ACA	p.T41T	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198697	NP_941970	P60328	KR123_HUMAN	keratin associated protein 12-3	41	14 X 5 AA approximate repeats.					intermediate filament				central_nervous_system(1)	1						TGAGCTGCACGCGCATTGTGT	0.637																0.282051	132.835315	141.167964	55	140	KEEP	---	---	---	---	36	35	80	95	-1	capture	Silent	SNP	46078019	46078019	KRTAP12-3	21	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8440	158
PARVG	64098	broad.mit.edu	37	22	44581720	44581720	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:44581720C>T	uc011aqe.1	+	4	536	c.112C>T	c.(112-114)CGG>TGG	p.R38W	PARVG_uc010gzo.2_Missense_Mutation_p.R105W|PARVG_uc010gzp.2_RNA|PARVG_uc003bep.2_Missense_Mutation_p.R38W|PARVG_uc010gzq.1_RNA|PARVG_uc010gzr.1_RNA|PARVG_uc011aqf.1_Missense_Mutation_p.R38W|PARVG_uc003beq.2_RNA|PARVG_uc003ber.2_RNA	NM_001137605	NP_001131077	Q9HBI0	PARVG_HUMAN	parvin, gamma	38					cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)				ACCCACTTCCCGGAAGGACCC	0.607																0.30303	28.936825	30.080085	10	23	KEEP	---	---	---	---	3	11	12	14	-1	capture	Missense_Mutation	SNP	44581720	44581720	PARVG	22	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	11373	158
SLC4A7	9497	broad.mit.edu	37	3	27478926	27478926	+	Missense_Mutation	SNP	T	G	G			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:27478926T>G	uc003cdv.2	-	4	425	c.354A>C	c.(352-354)GAA>GAC	p.E118D	SLC4A7_uc011awu.1_RNA|SLC4A7_uc011awv.1_RNA|SLC4A7_uc003cdu.3_Missense_Mutation_p.E123D|SLC4A7_uc011aww.1_Missense_Mutation_p.E127D|SLC4A7_uc011awx.1_Missense_Mutation_p.E127D|SLC4A7_uc011awy.1_Missense_Mutation_p.E123D|SLC4A7_uc011awz.1_RNA|SLC4A7_uc011axa.1_Missense_Mutation_p.E123D|SLC4A7_uc011axb.1_Missense_Mutation_p.E127D|SLC4A7_uc010hfm.2_Missense_Mutation_p.E123D|SLC4A7_uc003cdw.2_Missense_Mutation_p.E118D	NM_003615	NP_003606	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate	118	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5						TGTAACACAGTTCATCCATTT	0.333																0.293478	87.992111	91.502115	27	65	KEEP	---	---	---	---	14	16	35	37	-1	capture	Missense_Mutation	SNP	27478926	27478926	SLC4A7	3	T	G	G	G	1	0	0	0	0	1	0	0	0	777	60	4	4	14550	158
PIK3CA	5290	broad.mit.edu	37	3	178917478	178917478	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178917478G>A	uc003fjk.2	+	3	510	c.353G>A	c.(352-354)GGT>GAT	p.G118D		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	118					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.G118D(6)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TTTATTAAAGGTTTTGCTATC	0.338	Colon(199;1504 1750 3362 26421 31210 32040)		57	p.G118D(NCIH1975-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.551948	271.383254	271.743885	85	69	KEEP	---	---	---	---	52	49	41	40	-1	capture	Missense_Mutation	SNP	178917478	178917478	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	11816	158
GABRA4	2557	broad.mit.edu	37	4	46930475	46930475	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:46930475C>T	uc003gxg.2	-	9	1571	c.1432G>A	c.(1432-1434)GTG>ATG	p.V478M		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	478	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	GATCCAAACACGTGACGAGTA	0.488	Ovarian(6;283 369 8234 12290 33402)															0.366279	178.678176	181.382851	63	109	KEEP	---	---	---	---	34	31	66	55	-1	capture	Missense_Mutation	SNP	46930475	46930475	GABRA4	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6105	158
C4orf35	85438	broad.mit.edu	37	4	71201240	71201240	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71201240G>A	uc003hff.2	+	1	570	c.484G>A	c.(484-486)GTC>ATC	p.V162I		NM_033122	NP_149113	Q96KC9	CABS1_HUMAN	testis development protein NYD-SP26	162						flagellum	calcium ion binding				0		all_hematologic(202;0.196)				AACCTCTGAAGTCTCTGGCAC	0.413																0.059406	-7.539	12.984677	6	95	KEEP	---	---	---	---	3	4	50	49	-1	capture	Missense_Mutation	SNP	71201240	71201240	C4orf35	4	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	2243	158
SEC24B	10427	broad.mit.edu	37	4	110384778	110384778	+	Silent	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110384778G>A	uc003hzk.2	+	2	910	c.855G>A	c.(853-855)GCG>GCA	p.A285A	SEC24B_uc003hzl.2_Silent_p.A285A|SEC24B_uc011cfp.1_Silent_p.A316A|SEC24B_uc011cfq.1_Silent_p.A285A|SEC24B_uc011cfr.1_Silent_p.A285A	NM_006323	NP_006314	O95487	SC24B_HUMAN	SEC24 (S. cerevisiae) homolog B isoform a	285					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|transporter activity|zinc ion binding			ovary(2)|large_intestine(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TGGCTGTAGCGAACAACAACC	0.413																0.061224	-10.442185	19.099684	9	138	KEEP	---	---	---	---	6	6	73	96	-1	capture	Silent	SNP	110384778	110384778	SEC24B	4	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	13888	158
NAF1	92345	broad.mit.edu	37	4	164050096	164050096	+	Missense_Mutation	SNP	G	C	C			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:164050096G>C	uc003iqj.2	-	8	1632	c.1438C>G	c.(1438-1440)CCA>GCA	p.P480A	NAF1_uc010iqw.1_Intron	NM_138386	NP_612395	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 homolog isoform a	480	Pro-rich.				rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding			ovary(2)	2	all_hematologic(180;0.166)	Prostate(90;0.109)				GAAgagggtggaggaggcagt	0.289																0.068966	1.324915	6.893739	2	27	KEEP	---	---	---	---	2	0	14	15	-1	capture	Missense_Mutation	SNP	164050096	164050096	NAF1	4	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	10050	158
PALLD	23022	broad.mit.edu	37	4	169433085	169433085	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:169433085G>A	uc011cjx.1	+	2	641	c.430G>A	c.(430-432)GGT>AGT	p.G144S	PALLD_uc003iru.2_Missense_Mutation_p.G144S	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2	144					cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		TGAAAAGCGTGGTGCAAAAAC	0.512	Esophageal Squamous(109;1482 1532 18347 40239 51172)											Pancreatic_Cancer_Familial_Clustering_of				0.023622	-25.195173	6.869021	3	124	KEEP	---	---	---	---	1	2	53	85	-1	capture	Missense_Mutation	SNP	169433085	169433085	PALLD	4	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	11311	158
LRP2BP	55805	broad.mit.edu	37	4	186299262	186299262	+	Missense_Mutation	SNP	A	C	C			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:186299262A>C	uc003ixj.1	-	1	891	c.79T>G	c.(79-81)TTT>GTT	p.F27V	LRP2BP_uc003ixk.1_5'UTR|LRP2BP_uc011ckr.1_Missense_Mutation_p.F27V	NM_018409	NP_060879	Q9P2M1	LR2BP_HUMAN	LRP2 binding protein	27						cytoplasm	protein binding				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;2.14e-25)|Epithelial(43;1.55e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-11)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000766)|Colorectal(24;0.00116)|LUSC - Lung squamous cell carcinoma(40;0.00904)|COAD - Colon adenocarcinoma(29;0.0101)|READ - Rectum adenocarcinoma(43;0.161)		CACTGGAAAAATTTTTGGTTT	0.378																0.299559	221.933408	230.069667	68	159	KEEP	---	---	---	---	37	45	96	92	-1	capture	Missense_Mutation	SNP	186299262	186299262	LRP2BP	4	A	C	C	C	1	0	0	0	0	1	0	0	0	52	4	4	4	8873	158
MARVELD2	153562	broad.mit.edu	37	5	68737366	68737366	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:68737366C>T	uc003jwq.2	+	7	1621	c.1562C>T	c.(1561-1563)ACA>ATA	p.T521I	MARVELD2_uc010ixf.2_Missense_Mutation_p.T509I|MARVELD2_uc003jwr.1_Intron|MARVELD2_uc003jws.1_RNA	NM_001038603	NP_001033692	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2 isoform 1	521	Cytoplasmic (Potential).				sensory perception of sound	integral to membrane|tight junction					0		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		CAGGATCCTACATTTCTGGAA	0.318																0.276923	43.316529	46.231582	18	47	KEEP	---	---	---	---	10	14	14	38	-1	capture	Missense_Mutation	SNP	68737366	68737366	MARVELD2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	9231	158
FBN2	2201	broad.mit.edu	37	5	127728993	127728993	+	Missense_Mutation	SNP	G	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127728993G>T	uc003kuu.2	-	10	1739	c.1300C>A	c.(1300-1302)CCT>ACT	p.P434T	FBN2_uc003kuv.2_Missense_Mutation_p.P401T	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	434					bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GTGCCTCCAGGTCTGGAACCA	0.532					1552											0.275862	109.732332	116.293863	40	105	KEEP	---	---	---	---	19	29	50	72	0.395833333333	capture	Missense_Mutation	SNP	127728993	127728993	FBN2	5	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	5649	158
PDLIM4	8572	broad.mit.edu	37	5	131607724	131607724	+	Silent	SNP	C	G	G			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131607724C>G	uc003kwn.2	+	7	872	c.795C>G	c.(793-795)ACC>ACG	p.T265T	uc003kwm.3_Intron|PDLIM4_uc003kwp.2_Missense_Mutation_p.P226R|PDLIM4_uc003kwo.2_Silent_p.T373T	NM_003687	NP_003678	P50479	PDLI4_HUMAN	PDZ and LIM domain 4 isoform 1	265	LIM zinc-binding.						protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCAGGGGCACCATCGTCAAGG	0.617																0.035714	-13.044746	6.615583	3	81	KEEP	---	---	---	---	3	0	45	49	-1	capture	Silent	SNP	131607724	131607724	PDLIM4	5	C	G	G	G	1	0	0	0	0	0	0	0	1	273	21	4	4	11585	158
PCDHGA8	9708	broad.mit.edu	37	5	140774290	140774290	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140774290C>T	uc003lkd.1	+	1	2808	c.1910C>T	c.(1909-1911)GCG>GTG	p.A637V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.A637V	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	637	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACAGAGATGCGCTCAAGCAG	0.682																0.204545	18.169756	21.72016	9	35	KEEP	---	---	---	---	4	8	22	21	-1	capture	Missense_Mutation	SNP	140774290	140774290	PCDHGA8	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11463	158
DSP	1832	broad.mit.edu	37	6	7580369	7580369	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7580369G>A	uc003mxp.1	+	23	4225	c.3946G>A	c.(3946-3948)GCT>ACT	p.A1316T	DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1316	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CCTGGAGGAGGCTGCCAAGAC	0.512																0.349776	211.167586	215.614434	78	145	KEEP	---	---	---	---	36	54	70	91	-1	capture	Missense_Mutation	SNP	7580369	7580369	DSP	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4736	158
COL11A2	1302	broad.mit.edu	37	6	33137189	33137189	+	Missense_Mutation	SNP	T	C	C			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33137189T>C	uc003ocx.1	-	51	3997	c.3769A>G	c.(3769-3771)ACA>GCA	p.T1257A	COL11A2_uc010jul.1_Intron|COL11A2_uc003ocy.1_Missense_Mutation_p.T1171A|COL11A2_uc003ocz.1_Missense_Mutation_p.T1150A	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	1257	Triple-helical region.			T -> Q (in Ref. 1; AAC50213/AAC50214/ AAC50215 and 6; AAA52034).	cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						TCATCGCCTGTGGGGCCTTTA	0.627	Melanoma(1;90 116 3946 5341 17093)															0.037037	-12.238988	6.562362	3	78	KEEP	---	---	---	---	3	0	43	47	-1	capture	Missense_Mutation	SNP	33137189	33137189	COL11A2	6	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	3633	158
KCNK17	89822	broad.mit.edu	37	6	39272395	39272395	+	Missense_Mutation	SNP	C	T	T	rs142227833		TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:39272395C>T	uc003ooo.2	-	3	529	c.389G>A	c.(388-390)CGC>CAC	p.R130H	KCNK17_uc003oop.2_Missense_Mutation_p.R130H	NM_031460	NP_113648	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	130	Helical; (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2						GCAGAAGAGGCGGGCAGCCAT	0.612																0.193772	113.092449	138.343194	56	233	KEEP	---	---	---	---	32	41	181	150	-1	capture	Missense_Mutation	SNP	39272395	39272395	KCNK17	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7986	158
PTK7	5754	broad.mit.edu	37	6	43109453	43109453	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43109453C>T	uc003oub.1	+	11	1864	c.1666C>T	c.(1666-1668)CAT>TAT	p.H556Y	PTK7_uc003ouc.1_Missense_Mutation_p.H556Y|PTK7_uc003oud.1_Missense_Mutation_p.H516Y|PTK7_uc003oue.1_Missense_Mutation_p.H426Y|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_RNA|PTK7_uc011dve.1_Missense_Mutation_p.H564Y|PTK7_uc010jyj.1_Intron	NM_002821	NP_002812	Q13308	PTK7_HUMAN	PTK7 protein tyrosine kinase 7 isoform a	556	Ig-like C2-type 6.|Extracellular (Potential).				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			TGGGACCCTGCATTTTGCCCG	0.582					398											0.385382	308.298254	311.774255	116	185	KEEP	---	---	---	---	69	68	100	107	-1	capture	Missense_Mutation	SNP	43109453	43109453	PTK7	6	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	12660	158
TINAG	27283	broad.mit.edu	37	6	54191661	54191661	+	Missense_Mutation	SNP	C	T	T	rs115438249	byFrequency	TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:54191661C>T	uc003pcj.2	+	4	717	c.571C>T	c.(571-573)CGC>TGC	p.R191C	TINAG_uc010jzt.2_RNA	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	191					cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			TTTTAAATTTCGCCTTGGCAC	0.373																0.276243	135.970486	144.129086	50	131	KEEP	---	---	---	---	28	33	84	70	-1	capture	Missense_Mutation	SNP	54191661	54191661	TINAG	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15806	158
TINAG	27283	broad.mit.edu	37	6	54254704	54254704	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:54254704C>T	uc003pcj.2	+	11	1558	c.1412C>T	c.(1411-1413)ACG>ATG	p.T471M	TINAG_uc010jzt.2_RNA	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	471					cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			GGCCAACTGACGAGTTCTGAT	0.403																0.326087	211.144005	217.266233	75	155	KEEP	---	---	---	---	33	47	76	97	-1	capture	Missense_Mutation	SNP	54254704	54254704	TINAG	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15806	158
RIMS1	22999	broad.mit.edu	37	6	72993805	72993805	+	Missense_Mutation	SNP	G	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:72993805G>T	uc003pga.2	+	24	3615	c.3538G>T	c.(3538-3540)GCC>TCC	p.A1180S	RIMS1_uc011dyb.1_Intron|RIMS1_uc003pgc.2_Intron|RIMS1_uc010kaq.2_Missense_Mutation_p.A561S|RIMS1_uc011dyc.1_Intron|RIMS1_uc010kar.2_Missense_Mutation_p.A481S|RIMS1_uc011dyd.1_Missense_Mutation_p.A547S|RIMS1_uc003pgf.2_Intron|RIMS1_uc003pgg.2_Intron|RIMS1_uc003pgi.2_Intron|RIMS1_uc003pgh.2_Intron|RIMS1_uc003pgd.2_Intron|RIMS1_uc003pge.2_Intron|RIMS1_uc011dye.1_Missense_Mutation_p.A37S|RIMS1_uc011dyf.1_Missense_Mutation_p.A37S	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1180					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GAAAGGCACTGCCTCTGATGC	0.398																0.040541	-9.743652	7.082444	3	71	KEEP	---	---	---	---	1	2	36	53	0.333333333333	capture	Missense_Mutation	SNP	72993805	72993805	RIMS1	6	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	13259	158
MAP3K7	6885	broad.mit.edu	37	6	91226312	91226312	+	Nonsense_Mutation	SNP	C	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:91226312C>A	uc003pnz.1	-	17	1891	c.1729G>T	c.(1729-1731)GAA>TAA	p.E577*	MAP3K7_uc003pny.1_Nonsense_Mutation_p.E114*|MAP3K7_uc003poa.1_3'UTR|MAP3K7_uc003pob.1_Nonsense_Mutation_p.E550*|MAP3K7_uc003poc.1_3'UTR	NM_145331	NP_663304	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	577					activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|histone H3 acetylation|I-kappaB phosphorylation|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transforming growth factor beta receptor signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytosol|endosome membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)	6		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		CTTTTGTTTTCATCTAAAAGC	0.408					329											0.079137	-1.895616	23.261426	11	128	KEEP	---	---	---	---	5	7	66	74	0.583333333333	capture	Nonsense_Mutation	SNP	91226312	91226312	MAP3K7	6	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	9169	158
LAMA4	3910	broad.mit.edu	37	6	112496666	112496666	+	Missense_Mutation	SNP	C	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:112496666C>A	uc003pvu.2	-	11	1515	c.1206G>T	c.(1204-1206)ATG>ATT	p.M402I	LAMA4_uc003pvv.2_Missense_Mutation_p.M395I|LAMA4_uc003pvt.2_Missense_Mutation_p.M395I	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	402	Potential.|Domain II and I.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CATAATAGAGCATCTTGTTGT	0.483																0.035573	-42.557209	16.734023	9	244	KEEP	---	---	---	---	4	5	114	157	0.555555555556	capture	Missense_Mutation	SNP	112496666	112496666	LAMA4	6	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	8528	158
DSE	29940	broad.mit.edu	37	6	116757126	116757126	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:116757126G>A	uc003pws.2	+	6	1689	c.1495G>A	c.(1495-1497)GTG>ATG	p.V499M	DSE_uc011ebg.1_Missense_Mutation_p.V518M|DSE_uc003pwt.2_Missense_Mutation_p.V499M|DSE_uc003pwu.2_Missense_Mutation_p.V166M	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor	499					dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TTCTCCCTGGGTGGGTCAGGT	0.483																0.404959	140.639466	141.597791	49	72	KEEP	---	---	---	---	28	27	44	39	-1	capture	Missense_Mutation	SNP	116757126	116757126	DSE	6	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	4729	158
COL28A1	340267	broad.mit.edu	37	7	7412801	7412801	+	Silent	SNP	T	C	C			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:7412801T>C	uc003src.1	-	32	2853	c.2736A>G	c.(2734-2736)AAA>AAG	p.K912K	COL28A1_uc011jxe.1_Silent_p.K595K	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor	912	VWFA 2.				cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		TCAGTTTCTCTTTATCACGAG	0.443																0.131387	38.370783	56.447701	18	119	KEEP	---	---	---	---	12	7	57	68	-1	capture	Silent	SNP	7412801	7412801	COL28A1	7	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	3651	158
C7orf57	136288	broad.mit.edu	37	7	48081010	48081010	+	Missense_Mutation	SNP	C	G	G			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48081010C>G	uc003toh.3	+	3	347	c.135C>G	c.(133-135)AGC>AGG	p.S45R	C7orf57_uc003toi.3_5'UTR	NM_001100159	NP_001093629	Q8NEG2	CG057_HUMAN	hypothetical protein LOC136288	45										ovary(1)	1						CAGGTCTCAGCAATTTGGGAG	0.537																0.019108	-33.313509	7.487577	3	154	KEEP	---	---	---	---	1	2	79	88	-1	capture	Missense_Mutation	SNP	48081010	48081010	C7orf57	7	C	G	G	G	1	0	0	0	0	1	0	0	0	324	25	4	4	2381	158
EGFR	1956	broad.mit.edu	37	7	55221716	55221716	+	Missense_Mutation	SNP	T	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221716T>A	uc003tqk.2	+	7	1006	c.760T>A	c.(760-762)TTC>ATC	p.F254I	EGFR_uc003tqh.2_Missense_Mutation_p.F254I|EGFR_uc003tqi.2_Missense_Mutation_p.F254I|EGFR_uc003tqj.2_Missense_Mutation_p.F254I|EGFR_uc010kzg.1_Missense_Mutation_p.F209I|EGFR_uc011kco.1_Missense_Mutation_p.F201I|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	254	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.F254F(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CTGCCGCAAATTCCGAGACGA	0.587			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.949766	2784.031975	2865.597836	813	43	KEEP	---	---	---	---	404	537	28	31	-1	capture	Missense_Mutation	SNP	55221716	55221716	EGFR	7	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	4922	158
WBSCR17	64409	broad.mit.edu	37	7	71135089	71135089	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71135089G>A	uc003tvy.2	+	8	1399	c.1399G>A	c.(1399-1401)GGG>AGG	p.G467R	WBSCR17_uc003tvz.2_Missense_Mutation_p.G166R	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	467	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CGTTGCTTACGGGGAGGTAAT	0.413																0.227872	314.900484	350.97717	121	410	KEEP	---	---	---	---	68	82	251	265	-1	capture	Missense_Mutation	SNP	71135089	71135089	WBSCR17	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17145	158
SAMD9	54809	broad.mit.edu	37	7	92733048	92733048	+	Missense_Mutation	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92733048C>T	uc003umf.2	-	3	2619	c.2363G>A	c.(2362-2364)CGT>CAT	p.R788H	SAMD9_uc003umg.2_Missense_Mutation_p.R788H	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	788						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GTATTCCTGACGGTTCATTGC	0.378																0.208791	166.296921	194.882429	76	288	KEEP	---	---	---	---	34	46	153	171	-1	capture	Missense_Mutation	SNP	92733048	92733048	SAMD9	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13718	158
TRIM56	81844	broad.mit.edu	37	7	100730794	100730794	+	Silent	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100730794C>T	uc003uxq.2	+	3	432	c.201C>T	c.(199-201)CCC>CCT	p.P67P	TRIM56_uc003uxr.2_Silent_p.P67P	NM_030961	NP_112223	Q9BRZ2	TRI56_HUMAN	tripartite motif-containing 56	67					defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			kidney(1)|central_nervous_system(1)|skin(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)					CTGTGCCGCCCGAGGGTGTGG	0.677	Ovarian(89;1092 1379 22756 38989 39611)															0.234848	78.757525	87.250157	31	101	KEEP	---	---	---	---	15	23	76	64	-1	capture	Silent	SNP	100730794	100730794	TRIM56	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16413	158
RELN	5649	broad.mit.edu	37	7	103159906	103159906	+	Missense_Mutation	SNP	G	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103159906G>T	uc003vca.2	-	49	7886	c.7726C>A	c.(7726-7728)CAA>AAA	p.Q2576K	RELN_uc010liz.2_Missense_Mutation_p.Q2576K	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2576					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AAGTAAAATTGGATGAACTCA	0.378	NSCLC(146;835 1944 15585 22231 52158)															0.193277	52.05316	62.504782	23	96	KEEP	---	---	---	---	11	17	57	56	0.392857142857	capture	Missense_Mutation	SNP	103159906	103159906	RELN	7	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	13115	158
TAS2R41	259287	broad.mit.edu	37	7	143175728	143175728	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143175728G>A	uc003wdc.1	+	1	763	c.763G>A	c.(763-765)GCA>ACA	p.A255T	uc003wda.2_Intron	NM_176883	NP_795364	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	255	Helical; Name=6; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			pancreas(1)|skin(1)	2	Melanoma(164;0.15)					CATTGATGCCGCAAAATTTAT	0.493																0.16	72.83608	100.362102	40	210	KEEP	---	---	---	---	22	26	107	136	-1	capture	Missense_Mutation	SNP	143175728	143175728	TAS2R41	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15467	158
DLGAP2	9228	broad.mit.edu	37	8	1649565	1649565	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:1649565G>A	uc003wpl.2	+	12	3018	c.2921G>A	c.(2920-2922)CGG>CAG	p.R974Q	DLGAP2_uc003wpm.2_Missense_Mutation_p.R960Q	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	1053					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GCCCAGACCCGGCTCTGAGGG	0.706																0.307692	11.507305	11.929149	4	9	KEEP	---	---	---	---	1	3	3	8	-1	capture	Missense_Mutation	SNP	1649565	1649565	DLGAP2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4518	158
ADAM28	10863	broad.mit.edu	37	8	24199150	24199150	+	Silent	SNP	G	A	A	rs145453785	byFrequency;by1000genomes	TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24199150G>A	uc003xdy.2	+	16	1793	c.1710G>A	c.(1708-1710)TCG>TCA	p.S570S	ADAM28_uc011laa.1_RNA|ADAM28_uc010lua.2_Silent_p.S257S	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	570	Extracellular (Potential).|Cys-rich.				proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		AAGGTGGGTCGGATAATTTGC	0.413	NSCLC(193;488 2149 22258 34798 40734)			p.S570S(COLO783-Tumor)	410											0.281609	276.724981	291.628285	98	250	KEEP	---	---	---	---	55	63	152	149	-1	capture	Silent	SNP	24199150	24199150	ADAM28	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	246	158
ARHGAP39	80728	broad.mit.edu	37	8	145771184	145771184	+	Missense_Mutation	SNP	A	G	G			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145771184A>G	uc003zdt.1	-	7	2525	c.1970T>C	c.(1969-1971)CTC>CCC	p.L657P	ARHGAP39_uc011llk.1_Missense_Mutation_p.L657P|ARHGAP39_uc003zds.1_Missense_Mutation_p.L657P	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	657					axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0						ACAGGCAGCGAGGTCCTCAGA	0.672																0.068966	1.22672	6.793926	2	27	KEEP	---	---	---	---	0	2	10	18	-1	capture	Missense_Mutation	SNP	145771184	145771184	ARHGAP39	8	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	877	158
FREM1	158326	broad.mit.edu	37	9	14784500	14784500	+	Missense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:14784500G>A	uc003zlm.2	-	24	4900	c.4310C>T	c.(4309-4311)CCG>CTG	p.P1437L	FREM1_uc010mic.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1437	CSPG 10.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		GCCATATCGCGGAGGGGAGGT	0.488																0.056604	-4.620125	6.327963	3	50	KEEP	---	---	---	---	4	0	26	35	-1	capture	Missense_Mutation	SNP	14784500	14784500	FREM1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5987	158
PHF8	23133	broad.mit.edu	37	X	53970579	53970579	+	Silent	SNP	C	T	T			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53970579C>T	uc004dsu.2	-	20	2818	c.2745G>A	c.(2743-2745)AAG>AAA	p.K915K	PHF8_uc004dst.2_Silent_p.K879K|PHF8_uc004dsv.2_Silent_p.K745K|PHF8_uc004dsw.2_Silent_p.K778K|PHF8_uc004dsx.2_Silent_p.K643K|PHF8_uc004dsy.2_Silent_p.K862K	NM_015107	NP_055922	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	915					brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(3)	3						GCTGGGCCAGCTTTGCAGCTG	0.592																0.344828	26.138427	26.756376	10	19	KEEP	---	---	---	---	6	8	6	15	-1	capture	Silent	SNP	53970579	53970579	PHF8	23	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	11743	158
ITIH5L	347365	broad.mit.edu	37	X	54784130	54784130	+	Nonsense_Mutation	SNP	G	A	A			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54784130G>A	uc004dtj.2	-	8	2407	c.2377C>T	c.(2377-2379)CAA>TAA	p.Q793*		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	793	Pro-rich.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						GCCCCAAGTTGGGGGTGCGAT	0.552					249											0.586207	167.230234	167.793006	51	36	KEEP	---	---	---	---	28	28	18	23	-1	capture	Nonsense_Mutation	SNP	54784130	54784130	ITIH5L	23	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	7831	158
PCDH11Y	83259	broad.mit.edu	37	Y	4966471	4966471	+	Silent	SNP	A	G	G			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:4966471A>G	uc004fqo.2	+	2	1586	c.852A>G	c.(850-852)ACA>ACG	p.T284T	PCDH11Y_uc010nwg.1_Silent_p.T273T|PCDH11Y_uc004fql.1_Silent_p.T273T|PCDH11Y_uc004fqm.1_Silent_p.T273T|PCDH11Y_uc004fqn.1_Silent_p.T284T|PCDH11Y_uc004fqp.1_Silent_p.T55T	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	284	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						TTAAGGAGACAGAGATTGAAG	0.428																0.028846	-18.071046	7.332309	3	101	KEEP	---	---	---	---	1	2	74	84	-1	capture	Silent	SNP	4966471	4966471	PCDH11Y	24	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	11412	158
AMY2B	280	broad.mit.edu	37	1	104115707	104115710	+	Frame_Shift_Del	DEL	TAAT	-	-			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:104115707_104115710delTAAT	uc001duq.2	+	5	954_957	c.338_341delTAAT	c.(337-342)GTAATTfs	p.V113fs	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Frame_Shift_Del_p.V113fs|AMY2B_uc001dus.1_5'Flank	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	113_114					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		GTGGATGCTGTAATTAATCATATG	0.387																0.15			153	844		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	104115707	104115710	AMY2B	1	TAAT	-	-	-	1	0	1	0	1	0	0	0	0	741	57	5	5	592	158
MNS1	55329	broad.mit.edu	37	15	56735891	56735893	+	In_Frame_Del	DEL	TCT	-	-			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:56735891_56735893delTCT	uc002adr.2	-	6	1011_1013	c.846_848delAGA	c.(844-849)GAAGAT>GAT	p.E282del	MNS1_uc010bfo.2_In_Frame_Del_p.E150del|TEX9_uc002adp.2_Intron|TEX9_uc010ugl.1_Intron	NM_018365	NP_060835	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	282	Potential.|Glu-rich.				meiosis					ovary(1)	1				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		TGCCATCCGATCTTCTTCTCTTT	0.369																0.13			40	261		---	---	---	---						capture_indel	In_Frame_Del	DEL	56735891	56735893	MNS1	15	TCT	-	-	-	1	0	1	0	1	0	0	0	0	650	50	5	5	9589	158
FOXD4L5	653427	broad.mit.edu	37	9	70177746	70177747	+	In_Frame_Ins	INS	-	GCC	GCC			TCGA-16-1048-01	TCGA-16-1048-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:70177746_70177747insGCC	uc010moc.2	-	1	1069_1070	c.237_238insGGC	c.(235-240)insGGC	p.79_80insG		NM_001126334	NP_001119806	Q5VV16	FX4L5_HUMAN	forkhead box D4-like 5	79_80					axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0						GGGTCACTCGGGCCGCCGCCGC	0.688																0.05			18	325		---	---	---	---						capture_indel	In_Frame_Ins	INS	70177746	70177747	FOXD4L5	9	-	GCC	GCC	GCC	1	0	1	1	0	0	0	0	0	559	43	5	5	5946	158
