Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TAS1R1	80835	broad.mit.edu	37	1	6631015	6631015	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6631015C>T	uc001ant.2	+	2	238	c.238C>T	c.(238-240)CGG>TGG	p.R80W	TAS1R1_uc001anu.2_Missense_Mutation_p.R80W|TAS1R1_uc001anv.2_Missense_Mutation_p.R80W|TAS1R1_uc001anw.2_Missense_Mutation_p.R80W	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN	sweet taste receptor T1r isoform b	80	Extracellular (Potential).				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		CCAGGCTATGCGGCTTGGGGT	0.532																0.020202	-44.568515	6.537289	4	194	KEEP	---	---	---	---	3	1	115	106	-1	capture	Missense_Mutation	SNP	6631015	6631015	TAS1R1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	15450	163
RERE	473	broad.mit.edu	37	1	8419927	8419927	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:8419927C>T	uc001ape.2	-	20	4325	c.3515G>A	c.(3514-3516)CGC>CAC	p.R1172H	RERE_uc001apf.2_Missense_Mutation_p.R1172H|RERE_uc001apd.2_Missense_Mutation_p.R618H	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	1172	Potential.				multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CTCAGCCTCGCGCTTGGCCTT	0.498																0.149425	21.833524	32.076528	13	74	KEEP	---	---	---	---	9	5	49	37	-1	capture	Missense_Mutation	SNP	8419927	8419927	RERE	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13126	163
HTR6	3362	broad.mit.edu	37	1	19992747	19992747	+	Silent	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19992747C>T	uc001bcl.2	+	1	968	c.501C>T	c.(499-501)CAC>CAT	p.H167H		NM_000871	NP_000862	P50406	5HT6R_HUMAN	5-hydroxytryptamine (serotonin) receptor 6	167	Extracellular (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	histamine receptor activity|protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Granisetron(DB00889)|Ondansetron(DB00904)|Sertindole(DB06144)	TGGGCTGGCACGAGCTGGGCC	0.711	Esophageal Squamous(168;1879 2619 6848 21062)															0.3125	52.37266	54.377999	20	44	KEEP	---	---	---	---	9	14	28	22	-1	capture	Silent	SNP	19992747	19992747	HTR6	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7376	163
RNF19B	127544	broad.mit.edu	37	1	33402782	33402782	+	Silent	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:33402782C>T	uc010oho.1	-	9	1824	c.1824G>A	c.(1822-1824)ACG>ACA	p.T608T	RNF19B_uc001bwm.3_3'UTR|RNF19B_uc010ohp.1_Silent_p.T607T	NM_153341	NP_699172	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B isoform a	608						integral to membrane	ligase activity|protein binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GCGAGTCCTCCGTGCTGCTTC	0.502																0.022727	-47.195069	8.641062	5	215	KEEP	---	---	---	---	2	4	142	135	-1	capture	Silent	SNP	33402782	33402782	RNF19B	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13363	163
COL9A2	1298	broad.mit.edu	37	1	40770007	40770007	+	Silent	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40770007G>A	uc001cfh.1	-	24	1342	c.1272C>T	c.(1270-1272)GGC>GGT	p.G424G	COL9A2_uc001cfi.1_Silent_p.G243G	NM_001852	NP_001843	Q14055	CO9A2_HUMAN	alpha 2 type IX collagen precursor	424	Triple-helical region 3 (COL3).				axon guidance|skeletal system development	collagen type IX				ovary(2)	2	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			CTCCTTTGACGCCTGGCAAGC	0.607																0.583333	23.2271	23.299916	7	5	KEEP	---	---	---	---	4	3	0	6	-1	capture	Silent	SNP	40770007	40770007	COL9A2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3673	163
LRRC7	57554	broad.mit.edu	37	1	70504762	70504762	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:70504762G>C	uc001dep.2	+	19	3171	c.3141G>C	c.(3139-3141)AGG>AGC	p.R1047S	LRRC7_uc009wbg.2_Missense_Mutation_p.R331S|LRRC7_uc001deq.2_Missense_Mutation_p.R288S	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1047						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						CCGAAAAGAGGATACCACCCC	0.448					783											0.452055	115.668468	115.81432	33	40	KEEP	---	---	---	---	16	19	20	25	-1	capture	Missense_Mutation	SNP	70504762	70504762	LRRC7	1	G	C	C	C	1	0	0	0	0	1	0	0	0	529	41	4	4	8935	163
PTGFR	5737	broad.mit.edu	37	1	78958623	78958623	+	Silent	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:78958623G>A	uc001din.2	+	2	461	c.195G>A	c.(193-195)TCG>TCA	p.S65S	PTGFR_uc001dim.2_Silent_p.S65S	NM_000959	NP_000950	P43088	PF2R_HUMAN	prostaglandin F receptor isoform a precursor	65	Cytoplasmic (Potential).				parturition	extracellular region|integral to plasma membrane	prostaglandin F receptor activity			ovary(3)|breast(2)|skin(1)	6				Colorectal(170;0.248)	Bimatoprost(DB00905)|Latanoprost(DB00654)|Travoprost(DB00287)	CCAAGGCATCGTTTCTGCTTT	0.423																0.022523	-47.71868	8.716745	5	217	KEEP	---	---	---	---	4	2	118	108	-1	capture	Silent	SNP	78958623	78958623	PTGFR	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	12644	163
GBP4	115361	broad.mit.edu	37	1	89650937	89650937	+	Nonstop_Mutation	SNP	T	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89650937T>A	uc001dnb.2	-	11	2039	c.1923A>T	c.(1921-1923)TAA>TAT	p.*641Y		NM_052941	NP_443173	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	641						cytoplasm	GTP binding|GTPase activity				0				all cancers(265;0.00723)|Epithelial(280;0.0291)		ATTCAGGCTCTTAAATACGTG	0.343																0.07483	-3.204156	24.096326	11	136	KEEP	---	---	---	---	8	4	69	78	-1	capture	Nonstop_Mutation	SNP	89650937	89650937	GBP4	1	T	A	A	A	1	0	0	0	0	0	0	0	0	725	56	5	4	6216	163
C1orf161	126868	broad.mit.edu	37	1	116670945	116670945	+	Silent	SNP	G	A	A	rs148441950		TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:116670945G>A	uc001egc.1	+	6	1105	c.840G>A	c.(838-840)ACG>ACA	p.T280T		NM_152367	NP_689580	Q8N8X9	MB213_HUMAN	hypothetical protein LOC126868	280											0	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CGGTTATCACGTCCCACCATC	0.582																0.414634	46.962838	47.224609	17	24	KEEP	---	---	---	---	10	7	16	10	-1	capture	Silent	SNP	116670945	116670945	C1orf161	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	1991	163
NBPF9	400818	broad.mit.edu	37	1	144823890	144823890	+	Nonsense_Mutation	SNP	C	G	G			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144823890C>G	uc009wig.1	+	17	2007	c.1931C>G	c.(1930-1932)TCA>TGA	p.S644*	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Nonsense_Mutation_p.S445*|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Nonsense_Mutation_p.S304*	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	644	NBPF 4.					cytoplasm					0						TCAACTCCTTCAGGTTGTCTT	0.483					20											0.32948	200.617549	205.075871	57	116	KEEP	---	---	---	---	29	37	97	87	-1	capture	Nonsense_Mutation	SNP	144823890	144823890	NBPF9	1	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	10106	163
FLG	2312	broad.mit.edu	37	1	152283564	152283564	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152283564C>A	uc001ezu.1	-	3	3834	c.3798G>T	c.(3796-3798)CAG>CAT	p.Q1266H	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1266	Ser-rich.|Filaggrin 7.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CACTGGATCCCTGGTGCCTGC	0.488												Ichthyosis				0.021531	-91.318963	15.652294	9	409	KEEP	---	---	---	---	8	2	225	228	0.2	capture	Missense_Mutation	SNP	152283564	152283564	FLG	1	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	5867	163
OR6N2	81442	broad.mit.edu	37	1	158746549	158746549	+	Missense_Mutation	SNP	G	A	A	rs144962739		TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158746549G>A	uc010pir.1	-	1	877	c.877C>T	c.(877-879)CGT>TGT	p.R293C		NM_001005278	NP_001005278	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N,	293	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_hematologic(112;0.0378)					TCCTTGTTACGAAGACTGTAG	0.418																0.299559	196.61183	204.760492	68	159	KEEP	---	---	---	---	35	38	94	84	-1	capture	Missense_Mutation	SNP	158746549	158746549	OR6N2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11111	163
IGSF8	93185	broad.mit.edu	37	1	160064843	160064843	+	Silent	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160064843G>A	uc001fva.2	-	2	303	c.258C>T	c.(256-258)TTC>TTT	p.F86F	IGSF8_uc001fuz.2_Silent_p.F86F|IGSF8_uc009wtf.2_Silent_p.F86F	NM_052868	NP_443100	Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	86	Ig-like C2-type 1.|Extracellular (Potential).				cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding				0	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CAGCATAGGAGAACTGGGTAT	0.602																0.037383	-17.299472	7.502536	4	103	KEEP	---	---	---	---	2	2	67	54	-1	capture	Silent	SNP	160064843	160064843	IGSF8	1	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	7528	163
SEC16B	89866	broad.mit.edu	37	1	177927423	177927423	+	Silent	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:177927423G>A	uc001gli.1	-	10	1299	c.1209C>T	c.(1207-1209)CCC>CCT	p.P403P	SEC16B_uc001glk.1_Silent_p.P80P|SEC16B_uc001glh.1_Silent_p.P62P|SEC16B_uc009wwz.1_Silent_p.P62P|SEC16B_uc001glj.1_Silent_p.P404P|SEC16B_uc001gll.3_Silent_p.P404P	NM_033127	NP_149118	Q96JE7	SC16B_HUMAN	leucine zipper transcription regulator 2	403					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane				ovary(3)|central_nervous_system(1)	4						TGGCCACAGGGGGCTGCCGCT	0.587																0.326531	41.957219	43.279094	16	33	KEEP	---	---	---	---	11	11	16	30	-1	capture	Silent	SNP	177927423	177927423	SEC16B	1	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	13880	163
GPATCH2	55105	broad.mit.edu	37	1	217688167	217688167	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:217688167T>C	uc001hlf.1	-	6	1259	c.1163A>G	c.(1162-1164)CAT>CGT	p.H388R		NM_018040	NP_060510	Q9NW75	GPTC2_HUMAN	G patch domain containing 2	388						intracellular	nucleic acid binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		TACTCACTCATGGTGATGAGA	0.353																0.390244	53.291093	53.723653	16	25	KEEP	---	---	---	---	6	14	15	13	-1	capture	Missense_Mutation	SNP	217688167	217688167	GPATCH2	1	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	6525	163
NVL	4931	broad.mit.edu	37	1	224514105	224514105	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:224514105T>C	uc001hok.2	-	2	162	c.119A>G	c.(118-120)CAA>CGA	p.Q40R	NVL_uc001hol.2_Intron|NVL_uc010pvd.1_Missense_Mutation_p.Q40R|NVL_uc010pve.1_Intron|NVL_uc010pvf.1_Intron|NVL_uc010pvg.1_Missense_Mutation_p.Q40R	NM_002533	NP_002524	O15381	NVL_HUMAN	nuclear VCP-like isoform 1	40						aggresome|cytoplasm|nucleolus	ATP binding|nucleoside-triphosphatase activity			skin(2)	2				GBM - Glioblastoma multiforme(131;0.00501)		GTACACTCTTTGTAAATCAGA	0.318																0.369427	195.914902	198.265293	58	99	KEEP	---	---	---	---	40	39	58	61	-1	capture	Missense_Mutation	SNP	224514105	224514105	NVL	1	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	10687	163
OR4P4	81300	broad.mit.edu	37	11	55406513	55406513	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55406513C>T	uc010rij.1	+	1	680	c.680C>T	c.(679-681)TCT>TTT	p.S227F		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	227	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						AGAGCATACTCTGCAGAGAGA	0.393																0.608696	281.922875	283.348623	84	54	KEEP	---	---	---	---	42	45	34	20	-1	capture	Missense_Mutation	SNP	55406513	55406513	OR4P4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	10984	163
OR5D16	390144	broad.mit.edu	37	11	55606713	55606713	+	Silent	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55606713G>A	uc010rio.1	+	1	486	c.486G>A	c.(484-486)GCG>GCA	p.A162A		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	162	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				TGACACTCGCGTGCTCTGCTT	0.453																0.495327	164.058077	164.060263	53	54	KEEP	---	---	---	---	31	22	27	28	-1	capture	Silent	SNP	55606713	55606713	OR5D16	11	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11060	163
PVRL1	5818	broad.mit.edu	37	11	119535607	119535607	+	Nonsense_Mutation	SNP	G	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119535607G>C	uc001pwv.2	-	6	1576	c.1404C>G	c.(1402-1404)TAC>TAG	p.Y468*	PVRL1_uc001pwu.1_Intron	NM_002855	NP_002846	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 isoform 1	468	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		CCACGGTGAAGTAGGGCCGCT	0.582																0.346939	59.861834	60.874523	17	32	KEEP	---	---	---	---	11	8	22	17	-1	capture	Nonsense_Mutation	SNP	119535607	119535607	PVRL1	11	G	C	C	C	1	0	0	0	0	0	1	0	0	464	36	5	4	12734	163
LEPREL2	10536	broad.mit.edu	37	12	6939135	6939135	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6939135G>A	uc001qra.1	+	4	645	c.611G>A	c.(610-612)CGG>CAG	p.R204Q	LEPREL2_uc001qqz.1_Missense_Mutation_p.R11Q|LEPREL2_uc001qrb.1_Missense_Mutation_p.R11Q|GPR162_uc001qqy.1_Missense_Mutation_p.R139Q	NM_014262	NP_055077	Q8IVL6	P3H3_HUMAN	leprecan-like 2 precursor	204					negative regulation of cell proliferation	endoplasmic reticulum	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity				0					L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TCGGGAGTTCGGCCCCAGAGC	0.602																0.05	-9.653278	7.523717	4	76	KEEP	---	---	---	---	0	4	41	50	-1	capture	Missense_Mutation	SNP	6939135	6939135	LEPREL2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8651	163
C12orf39	80763	broad.mit.edu	37	12	21681996	21681996	+	Silent	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21681996G>A	uc001rfa.1	+	5	421	c.270G>A	c.(268-270)GCG>GCA	p.A90A	C12orf39_uc009ziv.1_RNA|C12orf39_uc009ziw.1_RNA	NM_030572	NP_085049	Q9BT56	SPXN_HUMAN	spexin precursor	90						extracellular region|nucleus|transport vesicle					0						TCTTACTGGCGTCCCTTCAGA	0.438																0.654639	412.464364	416.555915	127	67	KEEP	---	---	---	---	73	65	36	43	-1	capture	Silent	SNP	21681996	21681996	C12orf39	12	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	1670	163
ITPR2	3709	broad.mit.edu	37	12	26628304	26628304	+	Silent	SNP	A	G	G			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:26628304A>G	uc001rhg.2	-	45	6684	c.6267T>C	c.(6265-6267)CAT>CAC	p.H2089H	ITPR2_uc009zjg.1_Silent_p.H240H	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	2089	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CATCATCCCCATGGTCACATT	0.368					1600											0.043478	-8.734254	6.675249	3	66	KEEP	---	---	---	---	0	3	30	39	-1	capture	Silent	SNP	26628304	26628304	ITPR2	12	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	7844	163
SFRS2IP	9169	broad.mit.edu	37	12	46321868	46321868	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:46321868G>C	uc001rox.2	-	11	1903	c.1616C>G	c.(1615-1617)ACA>AGA	p.T539R	SFRS2IP_uc001row.2_Missense_Mutation_p.T224R|SFRS2IP_uc001roy.1_Missense_Mutation_p.T613R	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	539					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		ACATACATCTGTCTTTACCTC	0.363																0.619835	292.654485	294.178199	75	46	KEEP	---	---	---	---	47	33	23	27	-1	capture	Missense_Mutation	SNP	46321868	46321868	SFRS2IP	12	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	14070	163
SPATS2	65244	broad.mit.edu	37	12	49919998	49919998	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49919998G>A	uc001rud.2	+	14	2587	c.1598G>A	c.(1597-1599)CGC>CAC	p.R533H	SPATS2_uc001rue.2_RNA|SPATS2_uc009zli.1_Missense_Mutation_p.R533H|SPATS2_uc001ruf.2_Missense_Mutation_p.R533H|SPATS2_uc001rug.2_Missense_Mutation_p.R533H	NM_023071	NP_075559	Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	533						cytoplasm		p.R533H(1)		breast(1)	1						CTCCCCCAGCGCAAACCCAGG	0.522																0.616667	114.183645	114.899676	37	23	KEEP	---	---	---	---	21	18	11	15	-1	capture	Missense_Mutation	SNP	49919998	49919998	SPATS2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14911	163
FLT3	2322	broad.mit.edu	37	13	28592630	28592630	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28592630C>G	uc001urw.2	-	20	2597	c.2515G>C	c.(2515-2517)GAT>CAT	p.D839H	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Intron	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	839	Protein kinase.|Cytoplasmic (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity	p.D839?(2)		haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	TAGTTGGAATCACTCATGATA	0.453					630	Mis|O		AML|ALL								0.355556	107.412319	109.093327	32	58	KEEP	---	---	---	---	18	17	24	42	-1	capture	Missense_Mutation	SNP	28592630	28592630	FLT3	13	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	5886	163
PSMA3	5684	broad.mit.edu	37	14	58737688	58737688	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:58737688T>C	uc001xdj.1	+	10	741	c.695T>C	c.(694-696)ATA>ACA	p.I232T	C14orf37_uc010tro.1_Intron|PSMA3_uc001xdk.1_Missense_Mutation_p.I225T|uc001xdl.2_Intron	NM_002788	NP_002779	P25788	PSA3_HUMAN	proteasome alpha 3 subunit isoform 1	232					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	protein binding|threonine-type endopeptidase activity				0						CCAAAAGATATAAGAGAAGAA	0.289																0.583333	135.338001	135.702271	35	25	KEEP	---	---	---	---	19	26	17	14	-1	capture	Missense_Mutation	SNP	58737688	58737688	PSMA3	14	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	12563	163
CDCA4	55038	broad.mit.edu	37	14	105477700	105477700	+	Silent	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105477700G>A	uc001yqa.2	-	2	663	c.567C>T	c.(565-567)TAC>TAT	p.Y189Y	CDCA4_uc001yqb.2_Silent_p.Y189Y	NM_145701	NP_663747	Q9BXL8	CDCA4_HUMAN	cell division cycle associated 4	189						nucleus				ovary(1)	1		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.142)		TGTCCAGGTCGTAGTAGGGGC	0.587																0.630435	94.886978	95.575742	29	17	KEEP	---	---	---	---	11	19	8	9	-1	capture	Silent	SNP	105477700	105477700	CDCA4	14	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3059	163
MKRN3	7681	broad.mit.edu	37	15	23812072	23812072	+	Silent	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:23812072G>A	uc001ywh.3	+	1	1619	c.1143G>A	c.(1141-1143)GAG>GAA	p.E381E	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Silent_p.E381E	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	381						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		TGGAGGAGGAGGAAGAGAAGC	0.507					79											0.030864	-28.177228	10.900938	5	157	KEEP	---	---	---	---	3	2	69	104	-1	capture	Silent	SNP	23812072	23812072	MKRN3	15	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	9520	163
FMN1	342184	broad.mit.edu	37	15	33358855	33358855	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33358855G>A	uc001zhf.3	-	1	1231	c.1231C>T	c.(1231-1233)CGG>TGG	p.R411W	FMN1_uc001zhg.2_Missense_Mutation_p.R411W	NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CTGGGGGGCCGGATGAATAGG	0.567																0.284211	75.877942	79.855712	27	68	KEEP	---	---	---	---	15	14	44	35	-1	capture	Missense_Mutation	SNP	33358855	33358855	FMN1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	5893	163
GPR176	11245	broad.mit.edu	37	15	40093624	40093624	+	Silent	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40093624C>T	uc001zkj.1	-	3	2123	c.1257G>A	c.(1255-1257)GCG>GCA	p.A419A	GPR176_uc010uck.1_Silent_p.A359A	NM_007223	NP_009154	Q14439	GP176_HUMAN	G protein-coupled receptor 176	419	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		GGGCAGAGGGCGCAAACTGTG	0.572																0.363057	318.530013	323.682874	114	200	KEEP	---	---	---	---	69	51	102	105	-1	capture	Silent	SNP	40093624	40093624	GPR176	15	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6607	163
PLA2G4D	283748	broad.mit.edu	37	15	42364007	42364007	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42364007C>A	uc001zox.2	-	15	1633	c.1538G>T	c.(1537-1539)AGG>ATG	p.R513M		NM_178034	NP_828848	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD	513	PLA2c.				phospholipid catabolic process	cytoplasmic vesicle membrane|cytosol	metal ion binding|phospholipase A2 activity			large_intestine(1)|skin(1)	2		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		CGGGATCCTCCTCATCAGCCG	0.617																0.341667	115.631611	118.293232	41	79	KEEP	---	---	---	---	15	30	47	43	0.666666666667	capture	Missense_Mutation	SNP	42364007	42364007	PLA2G4D	15	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	11907	163
C15orf48	84419	broad.mit.edu	37	15	45724277	45724277	+	Nonsense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45724277C>T	uc001zvg.2	+	4	248	c.130C>T	c.(130-132)CGA>TGA	p.R44*	C15orf48_uc001zvh.2_Nonsense_Mutation_p.R44*|MIR147B_hsa-mir-147b|MI0005544_5'Flank	NM_197955	NP_922946	Q9C002	NMES1_HUMAN	normal mucosa of esophagus specific 1	44						nucleus				ovary(1)	1		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.67e-16)|GBM - Glioblastoma multiforme(94;1.71e-06)		TAGCCTTGATCGAAAAAAAAA	0.313																0.322034	56.403875	58.0635	19	40	KEEP	---	---	---	---	12	9	31	24	-1	capture	Nonsense_Mutation	SNP	45724277	45724277	C15orf48	15	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	1785	163
UACA	55075	broad.mit.edu	37	15	70970467	70970467	+	Missense_Mutation	SNP	C	T	T	rs145715387		TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:70970467C>T	uc002asr.2	-	11	1074	c.970G>A	c.(970-972)GTC>ATC	p.V324I	UACA_uc010uke.1_Missense_Mutation_p.V215I|UACA_uc002asq.2_Missense_Mutation_p.V311I|UACA_uc010bin.1_Missense_Mutation_p.V310I	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	324	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						AAACCATTGACTTTATCCAAA	0.284																0.196721	55.123383	65.582778	24	98	KEEP	---	---	---	---	11	15	62	45	-1	capture	Missense_Mutation	SNP	70970467	70970467	UACA	15	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	16706	163
MYH11	4629	broad.mit.edu	37	16	15857677	15857677	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:15857677G>A	uc002ddy.2	-	10	1212	c.1105C>T	c.(1105-1107)CAG>TAG	p.Q369*	MYH11_uc002ddv.2_Nonsense_Mutation_p.Q376*|MYH11_uc002ddw.2_Nonsense_Mutation_p.Q369*|MYH11_uc002ddx.2_Nonsense_Mutation_p.Q376*|MYH11_uc010bvg.2_Nonsense_Mutation_p.Q201*|MYH11_uc002dea.1_Nonsense_Mutation_p.Q75*	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	369	Myosin head-like.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						ATGGACGCCTGGTCTGTGTTT	0.507					1257	T	CBFB	AML								0.315972	251.945173	260.664565	91	197	KEEP	---	---	---	---	54	61	112	132	-1	capture	Nonsense_Mutation	SNP	15857677	15857677	MYH11	16	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	9941	163
DNAH3	55567	broad.mit.edu	37	16	21145656	21145656	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21145656C>T	uc010vbe.1	-	7	1006	c.1006G>A	c.(1006-1008)GCC>ACC	p.A336T	DNAH3_uc002die.2_Missense_Mutation_p.A307T	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	336	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		CACTTCTTGGCGCTCCTGTAG	0.527																0.324	219.90807	226.771673	81	169	KEEP	---	---	---	---	47	43	100	84	-1	capture	Missense_Mutation	SNP	21145656	21145656	DNAH3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4560	163
ITGAD	3681	broad.mit.edu	37	16	31426282	31426282	+	Silent	SNP	C	T	T	rs144306080	byFrequency	TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31426282C>T	uc002ebv.1	+	18	2302	c.2253C>T	c.(2251-2253)GCC>GCT	p.A751A	ITGAD_uc010cap.1_Silent_p.A752A	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	751	Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						CTGTGCTGGCCGTGGGCTCAC	0.537																0.358491	179.33361	182.136395	57	102	KEEP	---	---	---	---	31	29	51	57	-1	capture	Silent	SNP	31426282	31426282	ITGAD	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7807	163
CYLD	1540	broad.mit.edu	37	16	50815179	50815179	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50815179C>T	uc002egp.1	+	10	1956	c.1541C>T	c.(1540-1542)ACG>ATG	p.T514M	CYLD_uc002ego.2_Missense_Mutation_p.T511M|CYLD_uc010cbs.1_Missense_Mutation_p.T511M|CYLD_uc002egq.1_Missense_Mutation_p.T511M|CYLD_uc002egr.1_Missense_Mutation_p.T511M|CYLD_uc002egs.1_Missense_Mutation_p.T511M	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN	ubiquitin carboxyl-terminal hydrolase CYLD	514	CAP-Gly 3.|Interaction with TRIP.|Interaction with IKBKG/NEMO.				cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	p.T514fs*29(1)		skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)				GCAGGCTGTACGGATGGAACC	0.453					247	Mis|N|F|S		cylindroma	cylindroma			Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial				0.321839	162.240218	167.14435	56	118	KEEP	---	---	---	---	27	34	70	70	-1	capture	Missense_Mutation	SNP	50815179	50815179	CYLD	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4103	163
LRRC50	123872	broad.mit.edu	37	16	84203580	84203580	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84203580C>A	uc002fhl.3	+	8	1327	c.1146C>A	c.(1144-1146)AGC>AGA	p.S382R	LRRC50_uc010vnw.1_Missense_Mutation_p.S146R	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50	382					axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						TTAAGGAAAGCTTTGAGGCCA	0.577												Kartagener_syndrome				0.181818	32.347689	40.719462	16	72	KEEP	---	---	---	---	9	8	36	38	0.470588235294	capture	Missense_Mutation	SNP	84203580	84203580	LRRC50	16	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	8924	163
NLRP1	22861	broad.mit.edu	37	17	5463322	5463322	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5463322G>A	uc002gci.2	-	4	1249	c.694C>T	c.(694-696)CCC>TCC	p.P232S	NLRP1_uc002gcg.1_Missense_Mutation_p.P232S|NLRP1_uc002gck.2_Missense_Mutation_p.P232S|NLRP1_uc002gcj.2_Missense_Mutation_p.P232S|NLRP1_uc002gcl.2_Missense_Mutation_p.P232S|NLRP1_uc002gch.3_Missense_Mutation_p.P232S|NLRP1_uc010clh.2_Missense_Mutation_p.P232S	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	232					defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				GCCCATGGGGGCCTGCCTTTC	0.507					431											0.571429	69.597448	69.783251	24	18	KEEP	---	---	---	---	21	13	14	12	-1	capture	Missense_Mutation	SNP	5463322	5463322	NLRP1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10378	163
TP53	7157	broad.mit.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	T	T	rs28934575		TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577548C>T	uc002gim.2	-	7	927	c.733G>A	c.(733-735)GGC>AGC	p.G245S	TP53_uc002gig.1_Missense_Mutation_p.G245S|TP53_uc002gih.2_Missense_Mutation_p.G245S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G113S|TP53_uc010cng.1_Missense_Mutation_p.G113S|TP53_uc002gii.1_Missense_Mutation_p.G113S|TP53_uc010cnh.1_Missense_Mutation_p.G245S|TP53_uc010cni.1_Missense_Mutation_p.G245S|TP53_uc002gij.2_Missense_Mutation_p.G245S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.G152S|TP53_uc002gio.2_Missense_Mutation_p.G113S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	245	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> A (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> E (in a sporadic cancer; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G245S(274)|p.G245D(93)|p.G245V(50)|p.G245C(47)|p.G245R(10)|p.G245A(8)|p.0?(7)|p.G245G(3)|p.G245fs*2(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.G245fs*22(1)|p.M243fs*18(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CGGTTCATGCCGCCCATGCAG	0.577	Pancreas(47;798 1329 9957 10801)	G245S(SKLMS1_SOFT_TISSUE)|G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKMEL2_SKIN)	111	p.G245C(NCIH684-Tumor)|p.G245C(PANC04.03-Tumor)|p.G245R(NCIH1930-Tumor)|p.G245C(SNUC4-Tumor)|p.G245C(LS1034-Tumor)|p.G245S(NCIH596-Tumor)|p.G245S(TE4-Tumor)|p.G245S(SNU46-Tumor)|p.G245S(COLO668-Tumor)|p.G245C(SU.86.86-Tumor)|p.G245S(DMS273-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.589286	109.779881	110.169596	33	23	KEEP	---	---	---	---	22	16	12	17	-1	capture	Missense_Mutation	SNP	7577548	7577548	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16264	163
MYH8	4626	broad.mit.edu	37	17	10297588	10297588	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10297588C>T	uc002gmm.2	-	35	5239	c.5144G>A	c.(5143-5145)CGT>CAT	p.R1715H	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1715	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						GAGCTGGACACGCTCACTGGC	0.512												Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				0.651376	233.454802	235.659086	71	38	KEEP	---	---	---	---	41	42	29	16	-1	capture	Missense_Mutation	SNP	10297588	10297588	MYH8	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9951	163
CCL13	6357	broad.mit.edu	37	17	32685057	32685057	+	Missense_Mutation	SNP	A	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:32685057A>C	uc002hic.2	+	3	279	c.204A>C	c.(202-204)AAA>AAC	p.K68N		NM_005408	NP_005399	Q99616	CCL13_HUMAN	small inducible cytokine A13 precursor	68					cell-cell signaling|cellular calcium ion homeostasis|chemotaxis|immune response|inflammatory response	extracellular space	chemokine activity|signal transducer activity				0		Ovarian(249;0.0443)|Breast(31;0.151)				TCAGAACCAAACTGGGCAAGG	0.512																0.213115	36.839959	41.47976	13	48	KEEP	---	---	---	---	8	8	26	26	-1	capture	Missense_Mutation	SNP	32685057	32685057	CCL13	17	A	C	C	C	1	0	0	0	0	1	0	0	0	24	2	4	4	2857	163
KRT25	147183	broad.mit.edu	37	17	38911514	38911514	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38911514G>A	uc002hve.2	-	1	71	c.10C>T	c.(10-12)CGA>TGA	p.R4*		NM_181534	NP_853512	Q7Z3Z0	K1C25_HUMAN	keratin 25	4	Head.					cytoplasm|intermediate filament	structural molecule activity			ovary(2)	2		Breast(137;0.00526)				CTGGAAAGTCGAAGAGACATG	0.488																0.065217	-2.513291	6.517819	3	43	KEEP	---	---	---	---	4	1	18	28	-1	capture	Nonsense_Mutation	SNP	38911514	38911514	KRT25	17	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	8382	163
DHX8	1659	broad.mit.edu	37	17	41601142	41601142	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41601142G>A	uc002idu.1	+	23	3663	c.3590G>A	c.(3589-3591)CGT>CAT	p.R1197H	DHX8_uc010wig.1_Intron	NM_004941	NP_004932	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	1197						catalytic step 2 spliceosome	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|pancreas(1)	4		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		AAGCAACAGCGTCTTGAACCC	0.517	NSCLC(56;1548 1661 49258 49987)															0.671053	168.591773	170.604712	51	25	KEEP	---	---	---	---	26	33	7	22	-1	capture	Missense_Mutation	SNP	41601142	41601142	DHX8	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4473	163
TBX21	30009	broad.mit.edu	37	17	45822386	45822386	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45822386G>A	uc002ilv.1	+	6	1473	c.1262G>A	c.(1261-1263)CGA>CAA	p.R421Q		NM_013351	NP_037483	Q9UL17	TBX21_HUMAN	T-box 21	421					lymphocyte migration|multicellular organismal development|positive regulation of transcription, DNA-dependent|response to virus	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0						TCCTACTACCGAGGCCAGGAG	0.662																0.631579	119.713073	120.579883	36	21	KEEP	---	---	---	---	16	24	11	14	-1	capture	Missense_Mutation	SNP	45822386	45822386	TBX21	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	15544	163
MC2R	4158	broad.mit.edu	37	18	13885081	13885081	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:13885081C>T	uc002ksp.1	-	2	614	c.437G>A	c.(436-438)CGC>CAC	p.R146H		NM_000529	NP_000520	Q01718	ACTHR_HUMAN	melanocortin 2 receptor	146	Cytoplasmic (By similarity).		R -> H (in GCCD1).		G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	corticotropin receptor activity|protein binding			ovary(4)|skin(1)	5					Corticotropin(DB01285)|Cosyntropin(DB01284)	CACCACAGTGCGGCGCATGGT	0.577	Colon(141;1584 1782 35999 48227 48692)															0.037383	-16.791039	8.001186	4	103	KEEP	---	---	---	---	2	2	46	61	-1	capture	Missense_Mutation	SNP	13885081	13885081	MC2R	18	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9277	163
ATP5A1	498	broad.mit.edu	37	18	43668121	43668121	+	Silent	SNP	T	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:43668121T>C	uc002lbr.1	-	6	843	c.753A>G	c.(751-753)CAA>CAG	p.Q251Q	ATP5A1_uc010dnl.1_Silent_p.Q201Q|ATP5A1_uc002lbs.1_Silent_p.Q201Q|ATP5A1_uc002lbt.1_Silent_p.Q251Q	NM_004046	NP_004037	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1	251					ATP hydrolysis coupled proton transport|embryo development|lipid metabolic process|negative regulation of endothelial cell proliferation|respiratory electron transport chain	mitochondrial matrix|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism				0						TGGATCTCTTTTGACCAATAG	0.368																0.412698	377.663482	379.33893	104	148	KEEP	---	---	---	---	76	38	77	79	-1	capture	Silent	SNP	43668121	43668121	ATP5A1	18	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	1138	163
INSR	3643	broad.mit.edu	37	19	7117197	7117197	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7117197G>A	uc002mgd.1	-	22	4128	c.4019C>T	c.(4018-4020)GCG>GTG	p.A1340V	INSR_uc002mge.1_Missense_Mutation_p.A1328V	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	1340	Cytoplasmic (Potential).				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CCGGCCCCCCGCCTCCTCCCT	0.592					649											0.230769	67.394985	76.024217	30	100	KEEP	---	---	---	---	13	17	65	44	-1	capture	Missense_Mutation	SNP	7117197	7117197	INSR	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7696	163
FBN3	84467	broad.mit.edu	37	19	8160957	8160957	+	Silent	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8160957G>A	uc002mjf.2	-	44	5568	c.5547C>T	c.(5545-5547)GAC>GAT	p.D1849D		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1849	EGF-like 29; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GGTCACACTCGTCAATGTCTG	0.582																0.301887	88.144781	91.869166	32	74	KEEP	---	---	---	---	16	21	50	34	-1	capture	Silent	SNP	8160957	8160957	FBN3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5650	163
UPF1	5976	broad.mit.edu	37	19	18976409	18976409	+	Missense_Mutation	SNP	G	A	A	rs139317612		TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18976409G>A	uc002nkg.2	+	22	3367	c.3092G>A	c.(3091-3093)CGC>CAC	p.R1031H	UPF1_uc002nkf.2_Missense_Mutation_p.R1020H|UPF1_uc002nkh.2_Missense_Mutation_p.R275H	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1	1031					cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CGTGGGGGACGCCAGAAGAAC	0.642																0.352601	178.851951	182.153539	61	112	KEEP	---	---	---	---	32	29	54	61	-1	capture	Missense_Mutation	SNP	18976409	18976409	UPF1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16885	163
PLEKHG2	64857	broad.mit.edu	37	19	39908257	39908257	+	Silent	SNP	T	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39908257T>C	uc010xuz.1	+	8	1132	c.807T>C	c.(805-807)GCT>GCC	p.A269A	PLEKHG2_uc010xuy.1_Silent_p.A210A|PLEKHG2_uc002olj.2_Silent_p.A269A|PLEKHG2_uc010xva.1_Silent_p.A76A	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	269	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TGGAGGAAGCTATTGTGTCCA	0.602																0.044118	-7.132913	7.992824	3	65	KEEP	---	---	---	---	2	2	47	27	-1	capture	Silent	SNP	39908257	39908257	PLEKHG2	19	T	C	C	C	1	0	0	0	0	0	0	0	1	678	53	3	3	11972	163
XRCC1	7515	broad.mit.edu	37	19	44057610	44057610	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44057610C>T	uc002owt.2	-	6	664	c.544G>A	c.(544-546)GCC>ACC	p.A182T	XRCC1_uc010xwp.1_Missense_Mutation_p.A151T	NM_006297	NP_006288	P18887	XRCC1_HUMAN	X-ray repair cross complementing protein 1	182					base-excision repair|single strand break repair	nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(2)|large_intestine(1)|prostate(1)|breast(1)	7		Prostate(69;0.0153)				AGAGAGTTGGCGCTCTCATCC	0.502											Other_BER_factors					0.028369	-27.523101	7.022316	4	137	KEEP	---	---	---	---	2	2	88	70	-1	capture	Missense_Mutation	SNP	44057610	44057610	XRCC1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17333	163
NLRP2	55655	broad.mit.edu	37	19	55501996	55501996	+	Silent	SNP	G	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55501996G>C	uc002qij.2	+	10	2750	c.2664G>C	c.(2662-2664)CTG>CTC	p.L888L	NLRP2_uc010yfp.1_Silent_p.L865L|NLRP2_uc010esn.2_Silent_p.L864L|NLRP2_uc010eso.2_Silent_p.L885L|NLRP2_uc010esp.2_Silent_p.L866L	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	888	LRR 3.				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGAAGTTTCTGTGTGAGGGCT	0.567																0.333333	118.876933	121.466594	35	70	KEEP	---	---	---	---	25	15	46	34	-1	capture	Silent	SNP	55501996	55501996	NLRP2	19	G	C	C	C	1	0	0	0	0	0	0	0	1	613	48	4	4	10384	163
NLRP5	126206	broad.mit.edu	37	19	56539073	56539073	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56539073G>A	uc002qmj.2	+	7	1474	c.1474G>A	c.(1474-1476)GCC>ACC	p.A492T	NLRP5_uc002qmi.2_Missense_Mutation_p.A473T	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	492	NACHT.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GGAGAGCGTCGCCCCCTTCAA	0.637																0.466667	62.276135	62.318951	21	24	KEEP	---	---	---	---	13	10	16	11	-1	capture	Missense_Mutation	SNP	56539073	56539073	NLRP5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10387	163
DYSF	8291	broad.mit.edu	37	2	71909724	71909724	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71909724C>T	uc002sie.2	+	54	6497	c.6121C>T	c.(6121-6123)CGG>TGG	p.R2041W	DYSF_uc010feg.2_Missense_Mutation_p.R2072W|DYSF_uc010feh.2_Missense_Mutation_p.R2048W|DYSF_uc002sig.3_Missense_Mutation_p.R2027W|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.R2062W|DYSF_uc010fef.2_Missense_Mutation_p.R2079W|DYSF_uc010fei.2_Missense_Mutation_p.R2058W|DYSF_uc010fek.2_Missense_Mutation_p.R2059W|DYSF_uc010fej.2_Missense_Mutation_p.R2049W|DYSF_uc010fel.2_Missense_Mutation_p.R2028W|DYSF_uc010feo.2_Missense_Mutation_p.R2073W|DYSF_uc010fem.2_Missense_Mutation_p.R2063W|DYSF_uc010fen.2_Missense_Mutation_p.R2080W|DYSF_uc002sif.2_Missense_Mutation_p.R2042W|DYSF_uc010yqy.1_Missense_Mutation_p.R922W|DYSF_uc010yqz.1_Missense_Mutation_p.R802W	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	2041	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						CATCCTGTGGCGGCGTTTCCG	0.522																0.343284	133.413006	136.318373	46	88	KEEP	---	---	---	---	23	28	46	53	-1	capture	Missense_Mutation	SNP	71909724	71909724	DYSF	2	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	4814	163
ASTL	431705	broad.mit.edu	37	2	96798441	96798441	+	Missense_Mutation	SNP	G	A	A	rs145986421		TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:96798441G>A	uc010yui.1	-	6	475	c.475C>T	c.(475-477)CGC>TGC	p.R159C		NM_001002036	NP_001002036	Q6HA08	ASTL_HUMAN	astacin-like metalloendopeptidase precursor	159					proteolysis		metalloendopeptidase activity|zinc ion binding				0						CCTCCACTGCGCCCCACACTC	0.627																0.422018	123.51686	124.097364	46	63	KEEP	---	---	---	---	21	33	29	45	-1	capture	Missense_Mutation	SNP	96798441	96798441	ASTL	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1054	163
NEB	4703	broad.mit.edu	37	2	152470900	152470900	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:152470900G>A	uc010fnx.2	-	73	10953	c.10762C>T	c.(10762-10764)CAG>TAG	p.Q3588*		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3588	Nebulin 98.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		ACAAGGATCTGACACTTCTTG	0.527																0.127841	52.910986	100.462298	45	307	KEEP	---	---	---	---	15	32	176	154	-1	capture	Nonsense_Mutation	SNP	152470900	152470900	NEB	2	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	10209	163
ZNF804A	91752	broad.mit.edu	37	2	185801478	185801478	+	Nonsense_Mutation	SNP	C	G	G			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:185801478C>G	uc002uph.2	+	4	1949	c.1355C>G	c.(1354-1356)TCA>TGA	p.S452*		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	452						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						ACGAAACCATCAATTTCCTAT	0.333																0.369478	327.737884	331.465527	92	157	KEEP	---	---	---	---	41	51	96	67	-1	capture	Nonsense_Mutation	SNP	185801478	185801478	ZNF804A	2	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	18046	163
COL3A1	1281	broad.mit.edu	37	2	189851838	189851838	+	Silent	SNP	A	G	G			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:189851838A>G	uc002uqj.1	+	5	618	c.501A>G	c.(499-501)GGA>GGG	p.G167G		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	167	Nonhelical region (N-terminal).				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	TAGCAGTAGGAGGACTCGCAG	0.403					1079											0.026786	-21.274634	6.434311	3	109	KEEP	---	---	---	---	3	1	62	63	-1	capture	Silent	SNP	189851838	189851838	COL3A1	2	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	3653	163
COL3A1	1281	broad.mit.edu	37	2	189864035	189864035	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:189864035C>A	uc002uqj.1	+	30	2164	c.2047C>A	c.(2047-2049)CGT>AGT	p.R683S		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	683	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	CCCTGGTGAACGTGGACCTCC	0.493					1079											0.15	6.112188	8.460382	3	17	KEEP	---	---	---	---	2	1	12	14	0.333333333333	capture	Missense_Mutation	SNP	189864035	189864035	COL3A1	2	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	3653	163
ANKAR	150709	broad.mit.edu	37	2	190571779	190571779	+	Missense_Mutation	SNP	A	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:190571779A>C	uc002uqw.1	+	8	1813	c.1813A>C	c.(1813-1815)ATC>CTC	p.I605L	ANKAR_uc002uqu.2_RNA	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	676	ANK 5.					integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			AAATAATATAATCCATTTATC	0.343																0.396396	161.483504	162.524229	44	67	KEEP	---	---	---	---	23	23	36	38	-1	capture	Missense_Mutation	SNP	190571779	190571779	ANKAR	2	A	C	C	C	1	0	0	0	0	1	0	0	0	52	4	4	4	620	163
ZNF142	7701	broad.mit.edu	37	2	219507508	219507508	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219507508C>T	uc002vin.2	-	8	4167	c.3731G>A	c.(3730-3732)CGC>CAC	p.R1244H	ZNF142_uc002vil.2_Missense_Mutation_p.R1205H|ZNF142_uc010fvt.2_Missense_Mutation_p.R1081H|ZNF142_uc002vim.2_Missense_Mutation_p.R1081H	NM_001105537	NP_001099007	P52746	ZN142_HUMAN	zinc finger protein 142	1244	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CCGGTGCAAGCGCAGTTTCGA	0.542	Colon(170;867 1942 8995 15834 18053)															0.356863	263.249859	267.853546	91	164	KEEP	---	---	---	---	55	46	95	92	-1	capture	Missense_Mutation	SNP	219507508	219507508	ZNF142	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17611	163
KIAA1486	57624	broad.mit.edu	37	2	226447451	226447451	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:226447451G>A	uc002voe.2	+	4	1493	c.1318G>A	c.(1318-1320)GTC>ATC	p.V440I	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Missense_Mutation_p.V210I	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	440	Pro-rich.									ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		TCCCTCCCCCGTCAGCATGGG	0.642																0.285714	35.83123	37.849911	14	35	KEEP	---	---	---	---	9	5	16	22	-1	capture	Missense_Mutation	SNP	226447451	226447451	KIAA1486	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8159	163
TRPM8	79054	broad.mit.edu	37	2	234891861	234891861	+	Silent	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234891861C>T	uc002vvh.2	+	20	2794	c.2754C>T	c.(2752-2754)GAC>GAT	p.D918D	TRPM8_uc010fyj.2_Silent_p.D496D|TRPM8_uc010fyk.2_RNA	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,	918	Extracellular (Potential).					integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	TGCCCAGTGACGTGGATGGTA	0.592					505											0.25	63.259028	68.709585	24	72	KEEP	---	---	---	---	15	10	34	52	-1	capture	Silent	SNP	234891861	234891861	TRPM8	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16475	163
VPS16	64601	broad.mit.edu	37	20	2843940	2843940	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2843940G>A	uc002whe.2	+	15	1420	c.1372G>A	c.(1372-1374)GTG>ATG	p.V458M	VPS16_uc002whh.2_RNA|PTPRA_uc002whj.2_5'Flank|VPS16_uc002whf.2_Missense_Mutation_p.V314M|VPS16_uc002whd.2_RNA|VPS16_uc002whg.2_Missense_Mutation_p.V144M|VPS16_uc002whi.2_5'Flank	NM_022575	NP_072097	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 isoform 1	458					intracellular protein transport	early endosome|HOPS complex|late endosome membrane|lysosomal membrane|recycling endosome				ovary(2)|pancreas(1)|skin(1)	4						TACCAGGCTCGTGTTGCGGAG	0.592																0.072727	-2.082683	18.571593	8	102	KEEP	---	---	---	---	5	4	58	50	-1	capture	Missense_Mutation	SNP	2843940	2843940	VPS16	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17075	163
SMOX	54498	broad.mit.edu	37	20	4162543	4162543	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:4162543C>T	uc002wkm.1	+	4	730	c.529C>T	c.(529-531)CGT>TGT	p.R177C	SMOX_uc002wkk.1_Missense_Mutation_p.R177C|SMOX_uc002wkl.1_Missense_Mutation_p.R177C|SMOX_uc002wkn.1_Intron|SMOX_uc002wkp.2_Missense_Mutation_p.R177C|SMOX_uc010zqo.1_Missense_Mutation_p.R154C|SMOX_uc002wko.1_Missense_Mutation_p.R177C	NM_175839	NP_787033	Q9NWM0	SMOX_HUMAN	spermine oxidase isoform 1	177					polyamine biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	polyamine oxidase activity			breast(1)	1					Spermine(DB00127)	AGAGGAGGTGCGTAACCGCAT	0.537																0.363636	134.162418	136.322058	48	84	KEEP	---	---	---	---	17	34	46	42	-1	capture	Missense_Mutation	SNP	4162543	4162543	SMOX	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14695	163
ZNF831	128611	broad.mit.edu	37	20	57767832	57767832	+	Silent	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:57767832C>T	uc002yan.2	+	1	1758	c.1758C>T	c.(1756-1758)GAC>GAT	p.D586D		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	586						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					AGGACACAGACGCAAAGAGAA	0.672																0.25	21.255705	23.303043	9	27	KEEP	---	---	---	---	5	4	15	16	-1	capture	Silent	SNP	57767832	57767832	ZNF831	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	18061	163
SAMSN1	64092	broad.mit.edu	37	21	15889263	15889263	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:15889263T>C	uc002yju.1	-	3	311	c.229A>G	c.(229-231)ATG>GTG	p.M77V	SAMSN1_uc010gky.1_Intron|SAMSN1_uc002yjv.1_Missense_Mutation_p.M145V	NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization	77					negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding			ovary(3)|pancreas(1)	4				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		TTTTTCTTCATTGTCCATGAA	0.338																0.103093	12.5807	27.795595	10	87	KEEP	---	---	---	---	5	5	49	45	-1	capture	Missense_Mutation	SNP	15889263	15889263	SAMSN1	21	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	13722	163
CAND2	23066	broad.mit.edu	37	3	12858462	12858462	+	Silent	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:12858462C>T	uc003bxk.2	+	10	2080	c.2031C>T	c.(2029-2031)GAC>GAT	p.D677D	CAND2_uc003bxj.2_Silent_p.D584D	NM_001162499	NP_001155971	O75155	CAND2_HUMAN	TBP-interacting protein isoform 1	677	HEAT 14.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			skin(3)|pancreas(1)	4						CAGCCCTGGACGCCCTGGCCC	0.662	GBM(43;676 868 1633 6395 37496)															0.456522	64.387882	64.460714	21	25	KEEP	---	---	---	---	7	15	15	13	-1	capture	Silent	SNP	12858462	12858462	CAND2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2592	163
SCN10A	6336	broad.mit.edu	37	3	38748876	38748876	+	Splice_Site	SNP	T	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38748876T>C	uc003ciq.2	-	25	4282	c.4282_splice	c.e25-1	p.L1428_splice		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha						sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	GCCCCCTAAGTGCAGAGAGGG	0.512																0.394495	128.301197	129.362979	43	66	KEEP	---	---	---	---	24	20	38	33	-1	capture	Splice_Site	SNP	38748876	38748876	SCN10A	3	T	C	C	C	1	0	0	0	0	0	0	1	0	767	59	5	3	13805	163
PCOLCE2	26577	broad.mit.edu	37	3	142557612	142557612	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142557612G>A	uc003evd.2	-	5	906	c.710C>T	c.(709-711)GCG>GTG	p.A237V		NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	237	CUB 2.					extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)|skin(1)	3						TGCTACTTACGCAGGTGGACT	0.378																0.388571	205.958262	207.861817	68	107	KEEP	---	---	---	---	38	34	62	50	-1	capture	Missense_Mutation	SNP	142557612	142557612	PCOLCE2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11498	163
GPR78	27201	broad.mit.edu	37	4	8582980	8582980	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:8582980T>C	uc003glk.2	+	1	690	c.271T>C	c.(271-273)TCC>CCC	p.S91P	CPZ_uc003gll.2_RNA	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	91	Helical; Name=3; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						CTTCCTGGCGTCCAACGCGGC	0.706																0.111111	3.637693	6.327702	2	16	KEEP	---	---	---	---	2	0	9	11	-1	capture	Missense_Mutation	SNP	8582980	8582980	GPR78	4	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	6643	163
NCAPG	64151	broad.mit.edu	37	4	17816578	17816578	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:17816578G>A	uc003gpp.2	+	4	823	c.647G>A	c.(646-648)CGC>CAC	p.R216H	NCAPG_uc011bxj.1_5'UTR	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G	216					cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)		ATTGTAGGGCGCACCAAGGAT	0.398																0.028369	-27.728246	6.820802	4	137	KEEP	---	---	---	---	5	1	91	66	-1	capture	Missense_Mutation	SNP	17816578	17816578	NCAPG	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10114	163
LGI2	55203	broad.mit.edu	37	4	25014103	25014103	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:25014103G>T	uc003grf.2	-	7	773	c.674C>A	c.(673-675)ACT>AAT	p.T225N		NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	225	EAR 1.					extracellular region					0		Breast(46;0.173)				GTAGGGTAAAGTCTGATGAAC	0.473																0.319149	133.023567	137.122632	45	96	KEEP	---	---	---	---	24	28	55	49	0.461538461538	capture	Missense_Mutation	SNP	25014103	25014103	LGI2	4	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	8672	163
GABRG1	2565	broad.mit.edu	37	4	46043100	46043100	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:46043100G>A	uc003gxb.2	-	9	1455	c.1303C>T	c.(1303-1305)CGC>TGC	p.R435C		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	435	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		TTGGCAATGCGTATGTGTATC	0.403																0.433824	185.108239	185.626812	59	77	KEEP	---	---	---	---	33	31	43	39	-1	capture	Missense_Mutation	SNP	46043100	46043100	GABRG1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6113	163
UGT2B4	7363	broad.mit.edu	37	4	70361563	70361563	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70361563G>A	uc003hek.3	-	1	64	c.17C>T	c.(16-18)ACT>ATT	p.T6I	UGT2B4_uc011cap.1_Intron|UGT2B4_uc003hel.3_Missense_Mutation_p.T6I	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	6					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						AAGAGCTGAAGTCCATTTCAT	0.443																0.313846	295.226693	305.252022	102	223	KEEP	---	---	---	---	57	54	111	130	-1	capture	Missense_Mutation	SNP	70361563	70361563	UGT2B4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	16843	163
PF4	5196	broad.mit.edu	37	4	74847163	74847163	+	Silent	SNP	G	A	A	rs144253863		TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74847163G>A	uc003hhi.2	-	2	234	c.189C>T	c.(187-189)GCC>GCT	p.A63A		NM_002619	NP_002610	P02776	PLF4_HUMAN	platelet factor 4 (chemokine (C-X-C motif)	63					cytokine-mediated signaling pathway|immune response|leukocyte chemotaxis|negative regulation of angiogenesis|negative regulation of apoptosis|negative regulation of cytolysis|negative regulation of megakaryocyte differentiation|negative regulation of MHC class II biosynthetic process|platelet activation|platelet degranulation|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|positive regulation of macrophage differentiation|positive regulation of tumor necrosis factor production	extracellular space|platelet alpha granule lumen	chemokine activity|heparin binding				0	Breast(15;0.00136)		all cancers(17;0.0034)|Lung(101;0.196)		Drotrecogin alfa(DB00055)	AGTGGGGTCCGGCCTTGATCA	0.612																0.265823	56.232435	60.153361	21	58	KEEP	---	---	---	---	15	6	45	28	-1	capture	Silent	SNP	74847163	74847163	PF4	4	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11655	163
MEPE	56955	broad.mit.edu	37	4	88766796	88766796	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88766796G>A	uc003hqy.2	+	4	815	c.776G>A	c.(775-777)GGC>GAC	p.G259D	MEPE_uc010ikn.2_Missense_Mutation_p.G146D	NM_020203	NP_064588	Q9NQ76	MEPE_HUMAN	matrix, extracellular phosphoglycoprotein with	259					skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			ovary(1)|lung(1)|skin(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		AGTGGGGACGGCCAACCTTTT	0.453																0.03125	-23.918037	6.889497	4	124	KEEP	---	---	---	---	3	1	68	68	-1	capture	Missense_Mutation	SNP	88766796	88766796	MEPE	4	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	9391	163
FAM13A	10144	broad.mit.edu	37	4	89668975	89668975	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:89668975T>C	uc003hse.1	-	18	2397	c.2189A>G	c.(2188-2190)GAC>GGC	p.D730G	FAM13A_uc003hsa.1_Missense_Mutation_p.D201G|FAM13A_uc003hsb.1_Missense_Mutation_p.D404G|FAM13A_uc003hsd.1_Missense_Mutation_p.D404G|FAM13A_uc003hsc.1_Missense_Mutation_p.D390G|FAM13A_uc011cdq.1_Missense_Mutation_p.D376G|FAM13A_uc003hsf.1_Missense_Mutation_p.D316G|FAM13A_uc003hsg.1_Missense_Mutation_p.D201G	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1	730	Potential.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						GGGAGTTAGGTCCTCTTCAGA	0.348																0.203187	142.877668	163.41647	51	200	KEEP	---	---	---	---	31	25	129	95	-1	capture	Missense_Mutation	SNP	89668975	89668975	FAM13A	4	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	5406	163
CDH18	1016	broad.mit.edu	37	5	19747074	19747074	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:19747074G>A	uc003jgc.2	-	3	877	c.500C>T	c.(499-501)ACT>ATT	p.T167I	CDH18_uc003jgd.2_Missense_Mutation_p.T167I|CDH18_uc011cnm.1_Missense_Mutation_p.T167I	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	167	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TTCAGGCACAGTAACAATGTA	0.338																0.283019	132.905115	139.630164	45	114	KEEP	---	---	---	---	25	25	83	56	-1	capture	Missense_Mutation	SNP	19747074	19747074	CDH18	5	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	3074	163
HEATR7B2	133558	broad.mit.edu	37	5	41012778	41012778	+	Silent	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41012778G>A	uc003jmj.3	-	30	3532	c.3042C>T	c.(3040-3042)GAC>GAT	p.D1014D	HEATR7B2_uc003jmi.3_Silent_p.D569D	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1014							binding			ovary(6)|central_nervous_system(2)	8						TCTCCAGACCGTCCAGCATTT	0.478																0.428571	193.398766	194.053095	63	84	KEEP	---	---	---	---	41	32	54	41	-1	capture	Silent	SNP	41012778	41012778	HEATR7B2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6961	163
TTC37	9652	broad.mit.edu	37	5	94834176	94834176	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:94834176T>A	uc003klb.2	-	33	3731	c.3461A>T	c.(3460-3462)CAC>CTC	p.H1154L		NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	1154							binding			ovary(3)|pancreas(1)	4						ACTGTCTTTGTGTTTGATGTG	0.448																0.2	115.74861	134.578257	45	180	KEEP	---	---	---	---	20	29	101	100	-1	capture	Missense_Mutation	SNP	94834176	94834176	TTC37	5	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	16587	163
SPOCK1	6695	broad.mit.edu	37	5	136476318	136476318	+	Nonsense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:136476318G>A	uc003lbo.2	-	3	489	c.298C>T	c.(298-300)CAG>TAG	p.Q100*	SPOCK1_uc003lbp.2_Nonsense_Mutation_p.Q100*	NM_004598	NP_004589	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains	100					cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGGTAGTCCTGGGTCACACAC	0.617																0.301587	49.395358	51.61365	19	44	KEEP	---	---	---	---	14	6	30	21	-1	capture	Nonsense_Mutation	SNP	136476318	136476318	SPOCK1	5	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	14971	163
GTF2H4	2968	broad.mit.edu	37	6	30876944	30876944	+	Missense_Mutation	SNP	T	G	G			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30876944T>G	uc003nsa.1	+	2	338	c.131T>G	c.(130-132)GTC>GGC	p.V44G	GTF2H4_uc010jsf.2_Missense_Mutation_p.V44G|GTF2H4_uc011dmv.1_Intron|GTF2H4_uc003nsb.1_5'UTR|GTF2H4_uc011dmw.1_Missense_Mutation_p.V50G	NM_001517	NP_001508	Q92759	TF2H4_HUMAN	general transcription factor IIH, polypeptide 4,	44					mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3						TGTCTGGCTGTCTTCAGGTGA	0.527											NER					0.405405	49.211719	49.502555	15	22	KEEP	---	---	---	---	9	6	12	13	-1	capture	Missense_Mutation	SNP	30876944	30876944	GTF2H4	6	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	6794	163
AARS2	57505	broad.mit.edu	37	6	44268962	44268962	+	Silent	SNP	G	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44268962G>C	uc010jza.1	-	21	2727	c.2724C>G	c.(2722-2724)CCC>CCG	p.P908P	SPATS1_uc003oxg.2_Intron|TMEM151B_uc003oxf.2_Intron	NM_020745	NP_065796	Q5JTZ9	SYAM_HUMAN	alanyl-tRNA synthetase 2, mitochondrial	908					alanyl-tRNA aminoacylation	mitochondrion	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			ovary(1)	1	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		L-Alanine(DB00160)	CAGACGTGCTGGGGGCCTGCT	0.647																0.289157	70.563154	73.87252	24	59	KEEP	---	---	---	---	13	16	32	33	-1	capture	Silent	SNP	44268962	44268962	AARS2	6	G	C	C	C	1	0	0	0	0	0	0	0	1	600	47	4	4	20	163
LGSN	51557	broad.mit.edu	37	6	63991036	63991036	+	Silent	SNP	G	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:63991036G>T	uc003peh.2	-	4	454	c.420C>A	c.(418-420)GCC>GCA	p.A140A	LGSN_uc003pei.2_Silent_p.A140A	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	140					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	TAAAACATGTGGCTCTTATGT	0.408																0.026455	-37.787908	9.068003	5	184	KEEP	---	---	---	---	1	4	98	101	0.2	capture	Silent	SNP	63991036	63991036	LGSN	6	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	8679	163
SLC22A2	6582	broad.mit.edu	37	6	160679391	160679391	+	Silent	SNP	C	T	T	rs112210325	byFrequency	TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160679391C>T	uc003qtf.2	-	1	569	c.399G>A	c.(397-399)TCG>TCA	p.S133S	SLC22A2_uc003qte.1_Silent_p.S133S|SLC22A2_uc003qth.1_Silent_p.S133S	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2	133	Extracellular (Potential).				body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		TGACGATGGACGAGCCAGGCG	0.627																0.517647	272.245558	272.294829	88	82	KEEP	---	---	---	---	53	54	58	60	-1	capture	Silent	SNP	160679391	160679391	SLC22A2	6	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	14343	163
MAD1L1	8379	broad.mit.edu	37	7	2269722	2269722	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2269722G>A	uc003slh.1	-	3	313	c.47C>T	c.(46-48)TCT>TTT	p.S16F	MAD1L1_uc003slf.1_Missense_Mutation_p.S16F|MAD1L1_uc003slg.1_Missense_Mutation_p.S16F|MAD1L1_uc010ksh.1_Missense_Mutation_p.S16F|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Missense_Mutation_p.S16F|MAD1L1_uc010ksj.2_Missense_Mutation_p.S16F	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	16					cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GTTGTTCAAAGATCTCAGGGT	0.537																0.238095	25.427201	28.059898	10	32	KEEP	---	---	---	---	1	9	19	13	-1	capture	Missense_Mutation	SNP	2269722	2269722	MAD1L1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	9062	163
SDK1	221935	broad.mit.edu	37	7	4009042	4009042	+	Missense_Mutation	SNP	C	T	T	rs145189416		TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4009042C>T	uc003smx.2	+	11	1839	c.1700C>T	c.(1699-1701)ACG>ATG	p.T567M		NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	567	Ig-like C2-type 5.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GCATCGGCCACGCTCACTGTG	0.587																0.231405	143.547851	159.491275	56	186	KEEP	---	---	---	---	33	25	110	87	-1	capture	Missense_Mutation	SNP	4009042	4009042	SDK1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13861	163
POM121L12	285877	broad.mit.edu	37	7	53103741	53103741	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53103741G>A	uc003tpz.2	+	1	393	c.377G>A	c.(376-378)CGT>CAT	p.R126H		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	126											0						GGGCTGTGTCGTGCCTGGAAC	0.672																0.202899	31.014893	36.668465	14	55	KEEP	---	---	---	---	13	5	35	28	-1	capture	Missense_Mutation	SNP	53103741	53103741	POM121L12	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12143	163
DGKI	9162	broad.mit.edu	37	7	137363356	137363356	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:137363356C>T	uc003vtt.2	-	3	554	c.553G>A	c.(553-555)GTC>ATC	p.V185I	DGKI_uc003vtu.2_5'UTR	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	185	Phorbol-ester/DAG-type 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						TCTCCCGAGACGTTGGTCTCC	0.507																0.252918	147.565548	161.81476	65	192	KEEP	---	---	---	---	39	43	112	137	-1	capture	Missense_Mutation	SNP	137363356	137363356	DGKI	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4429	163
HTR5A	3361	broad.mit.edu	37	7	154863096	154863096	+	Missense_Mutation	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:154863096G>A	uc003wlu.1	+	1	551	c.487G>A	c.(487-489)GCG>ACG	p.A163T	uc011kvt.1_5'UTR|uc003wlt.2_5'UTR	NM_024012	NP_076917	P47898	5HT5A_HUMAN	5-hydroxytryptamine receptor 5A	163	Helical; Name=4; (By similarity).					integral to plasma membrane	serotonin receptor activity			ovary(2)|large_intestine(1)	3	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		CGTCATGATCGCGCTCACCTG	0.627																0.082192	1.229549	14.163283	6	67	KEEP	---	---	---	---	7	2	34	44	-1	capture	Missense_Mutation	SNP	154863096	154863096	HTR5A	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7375	163
EN2	2020	broad.mit.edu	37	7	155251752	155251752	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:155251752C>T	uc003wmb.2	+	1	929	c.680C>T	c.(679-681)TCT>TTT	p.S227F		NM_001427	NP_001418	P19622	HME2_HUMAN	engrailed homeobox 2	227						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GACCGGCCTTCTTCAGGTGAG	0.726																0.25	11.492164	12.401135	4	12	KEEP	---	---	---	---	4	1	6	12	-1	capture	Missense_Mutation	SNP	155251752	155251752	EN2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	5065	163
LMBR1	64327	broad.mit.edu	37	7	156521400	156521400	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:156521400C>G	uc003wmw.3	-	11	1068	c.853G>C	c.(853-855)GCT>CCT	p.A285P	LMBR1_uc003wmv.3_Missense_Mutation_p.A133P|LMBR1_uc003wmx.3_Missense_Mutation_p.A133P|LMBR1_uc010lqn.2_Missense_Mutation_p.A326P|LMBR1_uc011kvx.1_Missense_Mutation_p.A264P	NM_022458	NP_071903	Q8WVP7	LMBR1_HUMAN	limb region 1 protein	285	Potential.|Cytoplasmic (Potential).					integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		CATGCTGAAGCCTTTTTTCGC	0.299																0.049724	-16.079552	22.85781	9	172	KEEP	---	---	---	---	3	6	95	92	-1	capture	Missense_Mutation	SNP	156521400	156521400	LMBR1	7	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	8760	163
TUSC3	7991	broad.mit.edu	37	8	15508246	15508246	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:15508246C>T	uc003wwt.2	+	3	559	c.349C>T	c.(349-351)CGC>TGC	p.R117C	TUSC3_uc003wwr.2_Missense_Mutation_p.R117C|TUSC3_uc003wws.2_Missense_Mutation_p.R117C|TUSC3_uc003wwu.2_Missense_Mutation_p.R117C|TUSC3_uc003wwv.2_Missense_Mutation_p.R117C|TUSC3_uc003www.2_Missense_Mutation_p.R117C|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Missense_Mutation_p.R117C	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	117					cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)		GAACTCCTGGCGCTATTCATC	0.398																0.390805	401.108072	404.746142	136	212	KEEP	---	---	---	---	81	67	123	112	-1	capture	Missense_Mutation	SNP	15508246	15508246	TUSC3	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16660	163
MSR1	4481	broad.mit.edu	37	8	16021625	16021625	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:16021625G>C	uc003wwz.2	-	5	964	c.766C>G	c.(766-768)CTG>GTG	p.L256V	MSR1_uc010lsu.2_Missense_Mutation_p.L274V|MSR1_uc003wxa.2_Missense_Mutation_p.L256V|MSR1_uc003wxb.2_Missense_Mutation_p.L256V|MSR1_uc011kxz.1_Missense_Mutation_p.L30V	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	256	Extracellular (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CAATCTTTCAGTCTGAGATCA	0.308																0.333333	54.48425	55.664955	16	32	KEEP	---	---	---	---	6	10	18	18	-1	capture	Missense_Mutation	SNP	16021625	16021625	MSR1	8	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	9796	163
EFCAB1	79645	broad.mit.edu	37	8	49643175	49643175	+	Silent	SNP	A	G	G			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:49643175A>G	uc003xqo.2	-	3	403	c.243T>C	c.(241-243)GAT>GAC	p.D81D	EFCAB1_uc003xqn.3_Intron|EFCAB1_uc011ldj.1_Silent_p.D29D|EFCAB1_uc010lxx.2_RNA|EFCAB1_uc011ldk.1_RNA	NM_024593	NP_078869	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1 isoform a	81	EF-hand 1.|1 (Potential).						calcium ion binding				0		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				TTACACAGCCATCATTATCTT	0.368																0.442623	91.718754	91.893485	27	34	KEEP	---	---	---	---	15	14	17	21	-1	capture	Silent	SNP	49643175	49643175	EFCAB1	8	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	4888	163
COLEC10	10584	broad.mit.edu	37	8	120118082	120118082	+	Silent	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120118082C>T	uc003yoo.2	+	6	583	c.486C>T	c.(484-486)ATC>ATT	p.I162I		NM_006438	NP_006429	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 precursor	162	C-type lectin.					collagen|cytoplasm	mannose binding			ovary(2)|skin(1)	3	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			TCTACTACATCGTGCAGGAAG	0.458																0.321429	51.629759	53.216062	18	38	KEEP	---	---	---	---	11	7	16	25	-1	capture	Silent	SNP	120118082	120118082	COLEC10	8	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	3675	163
CYP11B1	1584	broad.mit.edu	37	8	143956451	143956451	+	Silent	SNP	G	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143956451G>A	uc003yxi.2	-	8	1327	c.1320C>T	c.(1318-1320)CAC>CAT	p.H440H	CYP11B1_uc010mex.2_Silent_p.H139H|CYP11B1_uc003yxh.2_Intron|CYP11B1_uc003yxj.2_Intron|CYP11B1_uc010mey.2_Silent_p.H511H	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	440					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	CAAAGGGCACGTGGTAGAAGT	0.652												Familial_Hyperaldosteronism_type_I				0.364238	152.26166	154.717966	55	96	KEEP	---	---	---	---	30	35	57	54	-1	capture	Silent	SNP	143956451	143956451	CYP11B1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4105	163
TAF1L	138474	broad.mit.edu	37	9	32633905	32633905	+	Missense_Mutation	SNP	C	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32633905C>A	uc003zrg.1	-	1	1763	c.1673G>T	c.(1672-1674)CGA>CTA	p.R558L	uc003zrh.1_RNA	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	558					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CAAGAGAATTCGACTCTTCTT	0.458					234											0.287212	400.394641	419.756765	137	340	KEEP	---	---	---	---	93	53	200	178	0.36301369863	capture	Missense_Mutation	SNP	32633905	32633905	TAF1L	9	C	A	A	A	1	0	0	0	0	1	0	0	0	403	31	4	4	15411	163
NOL6	65083	broad.mit.edu	37	9	33465223	33465223	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33465223T>C	uc003zsz.2	-	20	2764	c.2663A>G	c.(2662-2664)GAG>GGG	p.E888G	SUGT1P1_uc010mjq.1_Intron|NOL6_uc003zsy.2_5'Flank|NOL6_uc003zta.2_Intron|NOL6_uc010mjv.2_Missense_Mutation_p.E885G|NOL6_uc011lob.1_Missense_Mutation_p.E836G|NOL6_uc003ztb.1_Missense_Mutation_p.E888G	NM_022917	NP_075068	Q9H6R4	NOL6_HUMAN	nucleolar protein family 6 alpha isoform	888					rRNA processing	condensed nuclear chromosome|nucleolus	RNA binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		GGTGAAGGGCTCAGGGTGCAG	0.602																0.4	7.249303	7.29295	2	3	KEEP	---	---	---	---	2	0	2	2	-1	capture	Missense_Mutation	SNP	33465223	33465223	NOL6	9	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	10432	163
TRPM3	80036	broad.mit.edu	37	9	73167906	73167906	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:73167906C>T	uc004aid.2	-	23	3636	c.3392G>A	c.(3391-3393)AGG>AAG	p.R1131K	TRPM3_uc004ahu.2_Missense_Mutation_p.R973K|TRPM3_uc004ahv.2_Missense_Mutation_p.R933K|TRPM3_uc004ahw.2_Missense_Mutation_p.R1003K|TRPM3_uc004ahx.2_Missense_Mutation_p.R990K|TRPM3_uc004ahy.2_Missense_Mutation_p.R993K|TRPM3_uc004ahz.2_Missense_Mutation_p.R980K|TRPM3_uc004aia.2_Missense_Mutation_p.R978K|TRPM3_uc004aib.2_Missense_Mutation_p.R968K|TRPM3_uc004aic.2_Missense_Mutation_p.R1131K	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	1156	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						GAGCTGATACCTCTGAAACTT	0.423																0.14527	86.016279	121.849698	43	253	KEEP	---	---	---	---	19	31	139	134	-1	capture	Missense_Mutation	SNP	73167906	73167906	TRPM3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	16470	163
IKBKAP	8518	broad.mit.edu	37	9	111658909	111658909	+	Missense_Mutation	SNP	T	A	A			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:111658909T>A	uc004bdm.3	-	25	3123	c.2603A>T	c.(2602-2604)GAT>GTT	p.D868V	IKBKAP_uc004bdl.2_Missense_Mutation_p.D519V|IKBKAP_uc011lwc.1_Missense_Mutation_p.D754V|IKBKAP_uc010mtq.2_Missense_Mutation_p.D519V	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	868					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						AGCATCAGGATCAGAGGGAGC	0.368																0.166667	40.452745	52.462076	19	95	KEEP	---	---	---	---	9	13	50	64	-1	capture	Missense_Mutation	SNP	111658909	111658909	IKBKAP	9	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	7534	163
SPTAN1	6709	broad.mit.edu	37	9	131371470	131371470	+	Missense_Mutation	SNP	G	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:131371470G>C	uc004bvl.3	+	36	4778	c.4665G>C	c.(4663-4665)CAG>CAC	p.Q1555H	SPTAN1_uc004bvm.3_Missense_Mutation_p.Q1555H|SPTAN1_uc004bvn.3_Missense_Mutation_p.Q1535H	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	1555	Spectrin 17.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						CCCTCCAACAGTTCAGCCGGG	0.473	NSCLC(120;833 1744 2558 35612 37579)				1105											0.386139	137.200701	138.348867	39	62	KEEP	---	---	---	---	19	23	37	30	-1	capture	Missense_Mutation	SNP	131371470	131371470	SPTAN1	9	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	15009	163
LHX3	8022	broad.mit.edu	37	9	139092592	139092592	+	Silent	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139092592C>T	uc004cha.2	-	2	184	c.87G>A	c.(85-87)CCG>CCA	p.P29P	LHX3_uc004cgz.2_Silent_p.P34P	NM_178138	NP_835258	Q9UBR4	LHX3_HUMAN	LIM homeobox protein 3 isoform a	29					inner ear development|organ morphogenesis|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		CAGCGCACAGCGGGATCTCTG	0.632																0.036585	-12.742217	6.346156	3	79	KEEP	---	---	---	---	2	1	38	48	-1	capture	Silent	SNP	139092592	139092592	LHX3	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8692	163
PCYT1B	9468	broad.mit.edu	37	X	24580418	24580418	+	Missense_Mutation	SNP	C	G	G			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:24580418C>G	uc004dbi.2	-	8	1335	c.1102G>C	c.(1102-1104)GAA>CAA	p.E368Q	PCYT1B_uc004dbk.3_Intron|PCYT1B_uc004dbj.2_Missense_Mutation_p.E350Q	NM_004845	NP_004836	Q9Y5K3	PCY1B_HUMAN	choline phosphate cytidylyltransferase 1 beta	368						endoplasmic reticulum	choline-phosphate cytidylyltransferase activity				0					Choline(DB00122)	CTCTACTTTTCATCCTCATCC	0.577																0.5	18.275314	18.275314	5	5	KEEP	---	---	---	---	5	2	2	3	-1	capture	Missense_Mutation	SNP	24580418	24580418	PCYT1B	23	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	11514	163
DMD	1756	broad.mit.edu	37	X	32563337	32563337	+	Missense_Mutation	SNP	G	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:32563337G>T	uc004dda.1	-	17	2351	c.2107C>A	c.(2107-2109)CTT>ATT	p.L703I	DMD_uc004dcz.2_Missense_Mutation_p.L580I|DMD_uc004dcy.1_Missense_Mutation_p.L699I|DMD_uc004ddb.1_Missense_Mutation_p.L695I|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Missense_Mutation_p.L695I	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	703					muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GGTGGTGGAAGTTCCTCTTGA	0.448																0.7	190.067377	192.90558	56	24	KEEP	---	---	---	---	38	20	18	7	0.655172413793	capture	Missense_Mutation	SNP	32563337	32563337	DMD	23	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	4538	163
CXorf22	170063	broad.mit.edu	37	X	35989828	35989828	+	Missense_Mutation	SNP	C	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:35989828C>T	uc004ddj.2	+	12	2155	c.2096C>T	c.(2095-2097)GCG>GTG	p.A699V	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	699										large_intestine(1)|lung(1)|ovary(1)	3						TCAATTAGAGCGAATCGATTG	0.448																0.78125	81.189036	83.519613	25	7	KEEP	---	---	---	---	11	16	4	4	-1	capture	Missense_Mutation	SNP	35989828	35989828	CXorf22	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4062	163
THOC2	57187	broad.mit.edu	37	X	122799597	122799597	+	Missense_Mutation	SNP	T	C	C			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:122799597T>C	uc004etu.2	-	12	1314	c.1282A>G	c.(1282-1284)AGG>GGG	p.R428G	THOC2_uc011muh.1_Missense_Mutation_p.R349G|THOC2_uc011mui.1_Missense_Mutation_p.R313G	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	428					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						ACGTCTCTCCTCAAATCTTCA	0.403																0.022059	-28.297573	6.379763	3	133	KEEP	---	---	---	---	1	2	74	73	-1	capture	Missense_Mutation	SNP	122799597	122799597	THOC2	23	T	C	C	C	1	0	0	0	0	1	0	0	0	700	54	3	3	15750	163
MGAT4C	25834	broad.mit.edu	37	12	86373320	86373324	+	Frame_Shift_Del	DEL	TTTAC	-	-			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:86373320_86373324delTTTAC	uc001tai.3	-	8	2430_2434	c.1180_1184delGTAAA	c.(1180-1185)GTAAATfs	p.V394fs	MGAT4C_uc001tal.3_Frame_Shift_Del_p.V394fs|MGAT4C_uc001taj.3_Frame_Shift_Del_p.V394fs|MGAT4C_uc001tak.3_Frame_Shift_Del_p.V394fs|MGAT4C_uc010sum.1_Frame_Shift_Del_p.V418fs|MGAT4C_uc001tah.3_Frame_Shift_Del_p.V394fs	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	394_395	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						TGTTCCAGTATTTACtttaattttt	0.346																0.46			33	38		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	86373320	86373324	MGAT4C	12	TTTAC	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	9459	163
RFX4	5992	broad.mit.edu	37	12	107033171	107033172	+	Splice_Site	INS	-	T	T			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:107033171_107033172insT	uc001tlr.2	+	3	257	c.191_splice	c.e3+1	p.W64_splice	RFX4_uc010swv.1_Splice_Site|RFX4_uc001tls.2_Splice_Site_p.W73_splice|RFX4_uc001tlt.2_Splice_Site_p.W73_splice	NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c						transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1						CTCTGCAATGGTAAGTTTCCAT	0.371																0.20			16	64		---	---	---	---						capture_indel	Splice_Site	INS	107033171	107033172	RFX4	12	-	T	T	T	1	0	1	1	0	0	0	1	0	572	44	5	5	13160	163
RB1	5925	broad.mit.edu	37	13	48955560	48955563	+	Frame_Shift_Del	DEL	AATC	-	-			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48955560_48955563delAATC	uc001vcb.2	+	17	1842_1845	c.1676_1679delAATC	c.(1675-1680)GAATCCfs	p.E559fs		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	559_560	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CGAATCATGGAATCCCTTGCATGG	0.328			6		568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.57			17	13		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	48955560	48955563	RB1	13	AATC	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	12993	163
OR7C1	26664	broad.mit.edu	37	19	14910414	14910414	+	Frame_Shift_Del	DEL	A	-	-			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14910414delA	uc010xnz.1	-	1	535	c.535delT	c.(535-537)TGTfs	p.C179fs		NM_198944	NP_945182	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C,	179	Extracellular (Potential).				sensory perception of smell|spermatogenesis	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2						AGTAGATCACAAAAAAAGTGT	0.478																0.29			65	163		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	14910414	14910414	OR7C1	19	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	11121	163
MLLT4	4301	broad.mit.edu	37	6	168317900	168317900	+	Frame_Shift_Del	DEL	T	-	-			TCGA-19-2623-01	TCGA-19-2623-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:168317900delT	uc003qwd.2	+	19	2815	c.2673delT	c.(2671-2673)CCTfs	p.P891fs	MLLT4_uc003qwb.1_Frame_Shift_Del_p.P876fs|MLLT4_uc003qwc.1_Frame_Shift_Del_p.P892fs|MLLT4_uc003qwg.1_Frame_Shift_Del_p.P201fs	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	892	Dilute.				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		CTGATGAGCCTTTTATCCCAA	0.398					1250	T	MLL	AL								0.02			7	339		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	168317900	168317900	MLLT4	6	T	-	-	-	1	0	1	0	1	0	0	0	0	717	56	5	5	9541	163
