Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CTSS	1520	broad.mit.edu	37	1	150727568	150727568	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150727568C>T	uc001evn.2	-	4	441	c.308G>A	c.(307-309)AGA>AAA	p.R103K	CTSS_uc010pcj.1_Intron|CTSS_uc001evo.1_Missense_Mutation_p.R103K	NM_004079	NP_004070	P25774	CATS_HUMAN	cathepsin S preproprotein	103					immune response|proteolysis	extracellular region|lysosome	cysteine-type endopeptidase activity				0	all_cancers(9;6.17e-52)|all_epithelial(9;9.7e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.00146)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|Epithelial(6;5.02e-21)|all cancers(9;1.28e-20)|OV - Ovarian serous cystadenocarcinoma(6;1.09e-14)|BRCA - Breast invasive adenocarcinoma(12;0.00501)|LUSC - Lung squamous cell carcinoma(543;0.171)			TGTGATATTTCTCTGCCACTG	0.353					120											0.447592	509.202066	510.047638	158	195	KEEP	---	---	---	---	93	102	122	109	-1	capture	Missense_Mutation	SNP	150727568	150727568	CTSS	1	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	4002	208
ROBLD3	28956	broad.mit.edu	37	1	156025122	156025122	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156025122C>T	uc001fnb.3	+	2	301	c.137C>T	c.(136-138)GCT>GTT	p.A46V	UBQLN4_uc001fna.2_5'Flank|UBQLN4_uc010pgx.1_5'Flank|ROBLD3_uc010pgy.1_Missense_Mutation_p.A46V	NM_014017	NP_054736	Q9Y2Q5	LTOR2_HUMAN	roadblock domain-containing protein 3 isoform 1	46					cell growth|cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade	lysosomal membrane|Ragulator complex					0						CGGGTCACCGCTGCCATAGCC	0.572																0.063158	-5.630725	13.249164	6	89	KEEP	---	---	---	---	3	5	79	56	-1	capture	Missense_Mutation	SNP	156025122	156025122	ROBLD3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	13404	208
PHRF1	57661	broad.mit.edu	37	11	607393	607393	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:607393C>T	uc001lqe.2	+	14	2068	c.1937C>T	c.(1936-1938)GCG>GTG	p.A646V	PHRF1_uc010qwc.1_Missense_Mutation_p.A645V|PHRF1_uc010qwd.1_Missense_Mutation_p.A644V|PHRF1_uc010qwe.1_Missense_Mutation_p.A642V|PHRF1_uc009ybz.1_Missense_Mutation_p.A436V|PHRF1_uc009yca.1_RNA	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	646							RNA polymerase binding|zinc ion binding				0						GCCTCTGCCGCGTCTAAGATC	0.587																0.262069	91.987914	99.413547	38	107	KEEP	---	---	---	---	26	14	51	67	-1	capture	Missense_Mutation	SNP	607393	607393	PHRF1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11764	208
FAT3	120114	broad.mit.edu	37	11	92531786	92531786	+	Silent	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92531786C>T	uc001pdj.3	+	9	5624	c.5607C>T	c.(5605-5607)GTC>GTT	p.V1869V		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1869	Cadherin 16.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCGTTGAAGTCAACATTGAGG	0.463													TCGA Ovarian(4;0.039)			0.313725	40.179994	41.755791	16	35	KEEP	---	---	---	---	7	9	18	20	-1	capture	Silent	SNP	92531786	92531786	FAT3	11	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	5637	208
TRPC6	7225	broad.mit.edu	37	11	101323804	101323804	+	Missense_Mutation	SNP	C	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:101323804C>A	uc001pgk.3	-	13	3103	c.2678G>T	c.(2677-2679)AGT>ATT	p.S893I	TRPC6_uc009ywy.2_Missense_Mutation_p.S777I	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,	893	Cytoplasmic (Potential).				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		ATAGCGGAGACTTGAGATGTC	0.388	Colon(166;1315 1927 11094 12848 34731)															0.577114	380.72807	381.771518	116	85	KEEP	---	---	---	---	55	72	30	59	0.566929133858	capture	Missense_Mutation	SNP	101323804	101323804	TRPC6	11	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	16466	208
ANO2	57101	broad.mit.edu	37	12	5908717	5908717	+	Silent	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5908717C>T	uc001qnm.2	-	10	1071	c.999G>A	c.(997-999)GCG>GCA	p.A333A		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	338	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						CTCCATAGCGCGCCCATTCTT	0.418																0.283019	41.604015	43.844368	15	38	KEEP	---	---	---	---	8	10	14	28	-1	capture	Silent	SNP	5908717	5908717	ANO2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	691	208
LECT1	11061	broad.mit.edu	37	13	53307443	53307443	+	Missense_Mutation	SNP	A	G	G			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:53307443A>G	uc001vhf.2	-	3	376	c.265T>C	c.(265-267)TCA>CCA	p.S89P	LECT1_uc001vhg.2_Missense_Mutation_p.S89P|LECT1_uc001vhh.2_Missense_Mutation_p.S116P	NM_007015	NP_008946	O75829	LECT1_HUMAN	leukocyte cell derived chemotaxin 1 isoform 1	89					cartilage development|proteoglycan metabolic process	endomembrane system|extracellular region|integral to membrane				ovary(2)	2		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)		ATTTCCATTGACCCATCTTGT	0.363																0.793548	468.108795	480.491819	123	32	KEEP	---	---	---	---	72	64	19	16	-1	capture	Missense_Mutation	SNP	53307443	53307443	LECT1	13	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	8632	208
TFDP1	7027	broad.mit.edu	37	13	114286001	114286001	+	Missense_Mutation	SNP	C	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:114286001C>A	uc001vtw.2	+	5	462	c.250C>A	c.(250-252)CCC>ACC	p.P84T	TFDP1_uc010tkd.1_Intron|TFDP1_uc010tke.1_Intron|TFDP1_uc001vty.3_Missense_Mutation_p.P84T|TFDP1_uc001vtx.2_5'Flank|TFDP1_uc010agx.2_Missense_Mutation_p.P84T	NM_007111	NP_009042	Q14186	TFDP1_HUMAN	transcription factor Dp-1	84					cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|regulation of transcription from RNA polymerase II promoter	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			lung(4)|ovary(2)|skin(1)	7	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			CCCACACACCCCCAGCACTCA	0.557					482								TSP Lung(29;0.18)			0.725	89.430732	91.317471	29	11	KEEP	---	---	---	---	15	18	9	6	0.545454545455	capture	Missense_Mutation	SNP	114286001	114286001	TFDP1	13	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	15682	208
WDR72	256764	broad.mit.edu	37	15	53908374	53908374	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:53908374C>T	uc002acj.2	-	15	2071	c.2029G>A	c.(2029-2031)GTT>ATT	p.V677I	WDR72_uc010bfi.1_Missense_Mutation_p.V677I	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	677										lung(1)|skin(1)	2				all cancers(107;0.0511)		TGAAAGCCAACGTTACTCCAT	0.378																0.446154	88.568516	88.732368	29	36	KEEP	---	---	---	---	19	12	9	29	-1	capture	Missense_Mutation	SNP	53908374	53908374	WDR72	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17203	208
TLN2	83660	broad.mit.edu	37	15	63063321	63063321	+	Silent	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:63063321C>T	uc002alb.3	+	39	5355	c.5355C>T	c.(5353-5355)GGC>GGT	p.G1785G	TLN2_uc002alc.3_Silent_p.G178G|TLN2_uc002ald.2_Silent_p.G178G	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1785					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						AAGAAGGTGGCGGAAACCCCA	0.507																0.436364	141.982107	142.370275	48	62	KEEP	---	---	---	---	24	29	35	30	-1	capture	Silent	SNP	63063321	63063321	TLN2	15	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15833	208
AXIN1	8312	broad.mit.edu	37	16	339566	339566	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:339566G>A	uc002cgp.1	-	10	2513	c.2336C>T	c.(2335-2337)CCG>CTG	p.P779L	AXIN1_uc002cgq.1_Missense_Mutation_p.P743L	NM_003502	NP_003493	O15169	AXIN1_HUMAN	axin 1 isoform a	779	Interaction with PPP2CA.				activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			breast(1)|liver(1)	2		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GCTGTCACACGGCTGGGCACT	0.637					659											0.433333	121.829185	122.173904	39	51	KEEP	---	---	---	---	25	16	24	34	-1	capture	Missense_Mutation	SNP	339566	339566	AXIN1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1226	208
TEKT5	146279	broad.mit.edu	37	16	10788283	10788283	+	Missense_Mutation	SNP	A	G	G			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10788283A>G	uc002czz.1	-	1	520	c.448T>C	c.(448-450)TTC>CTC	p.F150L		NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5	150	Potential.				microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						GACTTCCAGAAGCCAATGTCC	0.597																0.441989	281.783289	282.313027	80	101	KEEP	---	---	---	---	54	50	83	74	-1	capture	Missense_Mutation	SNP	10788283	10788283	TEKT5	16	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	15641	208
PKD1L2	114780	broad.mit.edu	37	16	81219137	81219137	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81219137G>A	uc002fgh.1	-	11	1957	c.1957C>T	c.(1957-1959)CTC>TTC	p.L653F	PKD1L2_uc002fgj.2_Missense_Mutation_p.L653F	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	653	REJ.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GACACGTAGAGGCACTGCTCT	0.567																0.282051	30.511544	32.174537	11	28	KEEP	---	---	---	---	5	6	18	14	-1	capture	Missense_Mutation	SNP	81219137	81219137	PKD1L2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	11868	208
SLC13A2	9058	broad.mit.edu	37	17	26822743	26822743	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26822743C>T	uc002hbh.2	+	10	1446	c.1379C>T	c.(1378-1380)GCC>GTC	p.A460V	SLC13A2_uc010wam.1_Missense_Mutation_p.A416V|SLC13A2_uc010wan.1_Missense_Mutation_p.A509V|SLC13A2_uc010wao.1_Missense_Mutation_p.A417V|SLC13A2_uc002hbi.2_Missense_Mutation_p.A389V	NM_003984	NP_003975	Q13183	S13A2_HUMAN	solute carrier family 13, member 2 isoform b	460	Helical; (Potential).					integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity				0	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	CCAGCCATTGCCATCATCCTC	0.607																0.438596	144.23159	144.606318	50	64	KEEP	---	---	---	---	36	26	31	45	-1	capture	Missense_Mutation	SNP	26822743	26822743	SLC13A2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14285	208
GPS1	2873	broad.mit.edu	37	17	80011213	80011213	+	Missense_Mutation	SNP	G	A	A	rs146475501		TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80011213G>A	uc002kdl.1	+	2	142	c.97G>A	c.(97-99)GTC>ATC	p.V33I	RFNG_uc002kdh.2_5'Flank|RFNG_uc002kdj.2_5'Flank|GPS1_uc002kdk.1_Missense_Mutation_p.V73I|GPS1_uc010dij.1_Missense_Mutation_p.V73I|GPS1_uc002kdm.1_Missense_Mutation_p.V17I|GPS1_uc002kdn.1_Missense_Mutation_p.V33I|GPS1_uc002kdo.1_Missense_Mutation_p.V33I|GPS1_uc010wvh.1_Missense_Mutation_p.V25I	NM_004127	NP_004118	Q13098	CSN1_HUMAN	G protein pathway suppressor 1 isoform 2	33					cell cycle|cullin deneddylation|inactivation of MAPK activity|JNK cascade	cytoplasm|signalosome	GTPase inhibitor activity|protein binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			TGCACCTGACGTCAACTACGT	0.667																0.393939	38.783619	39.103148	13	20	KEEP	---	---	---	---	3	15	7	18	-1	capture	Missense_Mutation	SNP	80011213	80011213	GPS1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6665	208
TSPAN16	26526	broad.mit.edu	37	19	11408879	11408879	+	Missense_Mutation	SNP	C	T	T	rs138340787		TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11408879C>T	uc002mqv.1	+	2	281	c.131C>T	c.(130-132)ACG>ATG	p.T44M	TSPAN16_uc002mqu.1_RNA	NM_012466	NP_036598	Q9UKR8	TSN16_HUMAN	transmembrane 4 superfamily member 16	44	Helical; (Potential).					integral to membrane				skin(1)	1						GCCTCTCTGACGAATGTCCTC	0.532																0.041379	-21.645881	11.126293	6	139	KEEP	---	---	---	---	3	3	73	81	-1	capture	Missense_Mutation	SNP	11408879	11408879	TSPAN16	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16523	208
CALR	811	broad.mit.edu	37	19	13050871	13050871	+	Silent	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13050871C>T	uc002mvu.2	+	4	482	c.402C>T	c.(400-402)CCC>CCT	p.P134P		NM_004343	NP_004334	P27797	CALR_HUMAN	calreticulin precursor	134	N-domain.				cell cycle arrest|cellular senescence|glucocorticoid receptor signaling pathway|negative regulation of neuron differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of steroid hormone receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of translation|peptide antigen assembly with MHC class I protein complex|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of phagocytosis|post-translational protein modification|protein export from nucleus|protein maturation by protein folding|protein N-linked glycosylation via asparagine|protein stabilization|regulation of apoptosis|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|extracellular space|MHC class I peptide loading complex|nucleus|perinuclear region of cytoplasm|polysome|proteinaceous extracellular matrix	androgen receptor binding|calcium ion binding|chaperone binding|complement component C1q binding|DNA binding|integrin binding|mRNA binding|protein binding involved in protein folding|sugar binding|ubiquitin protein ligase binding|unfolded protein binding|zinc ion binding			ovary(1)	1					Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	ACCTAGGTCCCGACATCTGTG	0.502																0.45	176.928593	177.190753	54	66	KEEP	---	---	---	---	26	32	41	35	-1	capture	Silent	SNP	13050871	13050871	CALR	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	2568	208
PGLYRP2	114770	broad.mit.edu	37	19	15586693	15586693	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15586693G>A	uc002nbf.3	-	2	921	c.788C>T	c.(787-789)CCC>CTC	p.P263L	PGLYRP2_uc002nbg.3_Missense_Mutation_p.P263L	NM_052890	NP_443122	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2 precursor	263					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptide amidation|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)	3						AGATGCCTTGGGGTCCAAAAG	0.617																0.034091	-14.451854	6.352431	3	85	KEEP	---	---	---	---	1	2	36	56	-1	capture	Missense_Mutation	SNP	15586693	15586693	PGLYRP2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11697	208
SPP2	6694	broad.mit.edu	37	2	234967547	234967547	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234967547G>A	uc002vvk.1	+	3	363	c.278G>A	c.(277-279)AGG>AAG	p.R93K	SPP2_uc010fyl.1_Missense_Mutation_p.R13K	NM_006944	NP_008875	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa precursor	93					bone remodeling|skeletal system development	extracellular region	endopeptidase inhibitor activity				0		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		ACTACATGCAGGAAGGATTCT	0.453																0.420455	239.601739	240.57741	74	102	KEEP	---	---	---	---	28	53	46	61	-1	capture	Missense_Mutation	SNP	234967547	234967547	SPP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	14979	208
PABPC1L	80336	broad.mit.edu	37	20	43559261	43559261	+	Nonsense_Mutation	SNP	T	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43559261T>A	uc010ggv.1	+	8	1215	c.1133T>A	c.(1132-1134)TTG>TAG	p.L378*	PABPC1L_uc010zwq.1_RNA|PABPC1L_uc002xmv.2_RNA|PABPC1L_uc002xmw.2_5'Flank|PABPC1L_uc002xmx.2_5'Flank	NM_001124756	NP_001118228	Q4VXU2	PAP1L_HUMAN	poly(A)-binding protein, cytoplasmic 1-like	378							nucleotide binding|RNA binding			ovary(1)	1						AAGGCCATCTTGACCAACCAG	0.627																0.460317	500.069198	500.586085	174	204	KEEP	---	---	---	---	105	94	108	113	-1	capture	Nonsense_Mutation	SNP	43559261	43559261	PABPC1L	20	T	A	A	A	1	0	0	0	0	0	1	0	0	819	63	5	4	11268	208
NFXL1	152518	broad.mit.edu	37	4	47886362	47886362	+	Splice_Site	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:47886362C>T	uc010igh.2	-	15	2093	c.1916_splice	c.e15+1	p.M639_splice	NFXL1_uc003gxp.2_Splice_Site_p.M639_splice|NFXL1_uc003gxq.3_Splice_Site|NFXL1_uc010igi.2_Splice_Site_p.M639_splice	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like							integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						CTAATACTTACATAGGAATAG	0.368																0.065421	-6.560795	14.419863	7	100	KEEP	---	---	---	---	6	2	52	58	-1	capture	Splice_Site	SNP	47886362	47886362	NFXL1	4	C	T	T	T	1	0	0	0	0	0	0	1	0	221	17	5	2	10295	208
FRAS1	80144	broad.mit.edu	37	4	79402982	79402982	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79402982G>A	uc003hlb.2	+	57	8908	c.8468G>A	c.(8467-8469)CGC>CAC	p.R2823H		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2818	Calx-beta 3.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						CCAGTTATCCGCCATGGTACT	0.468																0.422311	624.067965	626.696996	212	290	KEEP	---	---	---	---	122	130	189	150	-1	capture	Missense_Mutation	SNP	79402982	79402982	FRAS1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5986	208
CDH9	1007	broad.mit.edu	37	5	26902807	26902807	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:26902807G>T	uc003jgs.1	-	7	1200	c.1031C>A	c.(1030-1032)ACT>AAT	p.T344N		NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	344	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						CACTCTTAAAGTATAGAGCAT	0.328	Melanoma(8;187 585 15745 40864 52829)															0.460317	97.870029	97.956372	29	34	KEEP	---	---	---	---	22	10	17	18	0.6875	capture	Missense_Mutation	SNP	26902807	26902807	CDH9	5	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	3088	208
PTCD2	79810	broad.mit.edu	37	5	71618025	71618025	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:71618025G>A	uc003kcb.2	+	2	164	c.154G>A	c.(154-156)GTG>ATG	p.V52M	MRPS27_uc003kca.3_5'Flank|MRPS27_uc003kbz.3_5'Flank|MRPS27_uc011cse.1_5'Flank|MRPS27_uc010iza.2_5'Flank|PTCD2_uc011csf.1_Translation_Start_Site|PTCD2_uc003kcc.2_Translation_Start_Site|PTCD2_uc011csg.1_Translation_Start_Site|PTCD2_uc011csh.1_Missense_Mutation_p.V52M|PTCD2_uc003kcd.2_RNA	NM_024754	NP_079030	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	52											0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		TACAGATAATGTGGTGAAATT	0.284																0.348837	165.045812	168.515165	60	112	KEEP	---	---	---	---	34	46	84	54	-1	capture	Missense_Mutation	SNP	71618025	71618025	PTCD2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	12623	208
VDAC1	7416	broad.mit.edu	37	5	133326760	133326760	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:133326760C>T	uc003kyp.1	-	4	302	c.203G>A	c.(202-204)GGC>GAC	p.G68D	VDAC1_uc003kyq.1_Missense_Mutation_p.G68D|VDAC1_uc003kyr.1_Missense_Mutation_p.G68D	NM_003374	NP_003365	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1	68					apoptosis|interspecies interaction between organisms	mitochondrial nucleoid|mitochondrial outer membrane|plasma membrane|pore complex	porin activity|protein binding|voltage-gated anion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	AAACGTCAGGCCGTACTCAGT	0.463	NSCLC(127;1776 1806 35523 41489 48154)				247											0.01875	-74.205553	9.053591	6	314	KEEP	---	---	---	---	3	3	174	156	-1	capture	Missense_Mutation	SNP	133326760	133326760	VDAC1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	17028	208
TAP2	6891	broad.mit.edu	37	6	32782892	32782892	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32782892C>T	uc011dqf.1	-	13	2233	c.2111G>A	c.(2110-2112)AGC>AAC	p.S704N	HLA-DOB_uc003oca.2_Missense_Mutation_p.S97N|HLA-DOB_uc011dqg.1_Missense_Mutation_p.S97N	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	Error:Variant_position_missing_in_Q03519_after_alignment					antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0						GGCCTGTCTGCTCCTCTCCAA	0.592																0.5	120.292409	120.292409	40	40	KEEP	---	---	---	---	22	21	18	26	-1	capture	Missense_Mutation	SNP	32782892	32782892	TAP2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	15439	208
FAM83B	222584	broad.mit.edu	37	6	54806575	54806575	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:54806575C>T	uc003pck.2	+	5	2922	c.2806C>T	c.(2806-2808)CGT>TGT	p.R936C		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	936										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					TGTTTACAGTCGTTTTGAGCC	0.438																0.391753	223.286049	225.26587	76	118	KEEP	---	---	---	---	35	43	54	78	-1	capture	Missense_Mutation	SNP	54806575	54806575	FAM83B	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5580	208
DDX56	54606	broad.mit.edu	37	7	44611974	44611974	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44611974G>A	uc003tlg.2	-	5	1260	c.617C>T	c.(616-618)GCA>GTA	p.A206V	DDX56_uc003tle.2_RNA|DDX56_uc003tlf.2_Missense_Mutation_p.A142V|DDX56_uc003tlh.2_RNA|DDX56_uc010kyg.2_Missense_Mutation_p.A206V|DDX56_uc010kyh.1_RNA	NM_019082	NP_061955	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 56	206	Helicase ATP-binding.				rRNA processing	nucleolus	ATP binding|ATP-dependent RNA helicase activity|identical protein binding|RNA binding			upper_aerodigestive_tract(1)	1						CTCCTTGAGTGCTTGTACGTC	0.473																0.231884	71.12139	80.214554	32	106	KEEP	---	---	---	---	18	20	56	62	-1	capture	Missense_Mutation	SNP	44611974	44611974	DDX56	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4332	208
MAGI2	9863	broad.mit.edu	37	7	77756518	77756518	+	Missense_Mutation	SNP	G	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:77756518G>T	uc003ugx.2	-	19	3673	c.3419C>A	c.(3418-3420)CCC>CAC	p.P1140H	MAGI2_uc003ugy.2_Missense_Mutation_p.P1126H|MAGI2_uc010ldx.1_Missense_Mutation_p.P733H	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	1140						cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				AGGTACCTGGGGTTGTCTGTA	0.597																0.126623	41.287879	83.133102	39	269	KEEP	---	---	---	---	20	22	160	153	0.47619047619	capture	Missense_Mutation	SNP	77756518	77756518	MAGI2	7	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	9105	208
LAMB4	22798	broad.mit.edu	37	7	107746315	107746315	+	Missense_Mutation	SNP	C	T	T			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107746315C>T	uc010ljo.1	-	8	901	c.817G>A	c.(817-819)GAA>AAA	p.E273K	LAMB4_uc003vey.2_Missense_Mutation_p.E273K	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	273	Laminin EGF-like 1.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						GGGCGACATTCGCTAGCATGG	0.468																0.28479	240.993322	253.826731	88	221	KEEP	---	---	---	---	48	44	138	128	-1	capture	Missense_Mutation	SNP	107746315	107746315	LAMB4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8533	208
LGI3	203190	broad.mit.edu	37	8	22005999	22005999	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22005999G>A	uc003xav.2	-	8	1610	c.1321C>T	c.(1321-1323)CGC>TGC	p.R441C	LGI3_uc010ltu.2_Missense_Mutation_p.R417C	NM_139278	NP_644807	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3	441	EAR 5.				exocytosis	cell junction|extracellular region|synaptic vesicle|synaptosome				ovary(1)	1				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)		CCAATGTAGCGGCTGAGGCAC	0.657																0.380952	50.18972	50.711934	16	26	KEEP	---	---	---	---	9	10	15	20	-1	capture	Missense_Mutation	SNP	22005999	22005999	LGI3	8	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8673	208
NRG1	3084	broad.mit.edu	37	8	32599524	32599524	+	Splice_Site	SNP	A	G	G			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:32599524A>G	uc003xiv.2	+	7	1150	c.633_splice	c.e7-2	p.K211_splice	NRG1_uc003xip.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Splice_Site_p.K211_splice|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Splice_Site_p.K101_splice|NRG1_uc003xiy.2_Intron|NRG1_uc010lvt.2_Intron|NRG1_uc011lbg.1_Splice_Site_p.K57_splice|NRG1_uc011lbh.1_Intron|NRG1_uc003xiz.1_Splice_Site|NRG1_uc003xja.2_Splice_Site_p.K14_splice	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TTTGCCCTCTAGGTGCCAACC	0.378																0.055556	-6.773256	19.401637	7	119	KEEP	---	---	---	---	4	3	71	69	-1	capture	Splice_Site	SNP	32599524	32599524	NRG1	8	A	G	G	G	1	0	0	0	0	0	0	1	0	195	15	5	3	10554	208
GML	2765	broad.mit.edu	37	8	143928002	143928002	+	Missense_Mutation	SNP	G	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143928002G>A	uc003yxg.2	+	4	463	c.373G>A	c.(373-375)GAT>AAT	p.D125N		NM_002066	NP_002057	Q99445	GML_HUMAN	glycosylphosphatidylinositol anchored molecule	125	UPAR/Ly6.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|negative regulation of cell proliferation	anchored to membrane|extrinsic to membrane|plasma membrane				central_nervous_system(2)	2	all_cancers(97;4.26e-11)|all_epithelial(106;1.85e-08)|Lung NSC(106;0.000274)|all_lung(105;0.000755)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CATGTTACCCGATGAAGTAAC	0.418																0.459627	227.041818	227.26905	74	87	KEEP	---	---	---	---	46	35	39	61	-1	capture	Missense_Mutation	SNP	143928002	143928002	GML	8	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6428	208
OR2K2	26248	broad.mit.edu	37	9	114090554	114090554	+	Missense_Mutation	SNP	G	A	A	rs117283259	byFrequency;by1000genomes	TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114090554G>A	uc011lwp.1	-	1	160	c.160C>T	c.(160-162)CGC>TGC	p.R54C		NM_205859	NP_995581	Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K,	83	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GTTTTAAGGCGTGAATCTAGG	0.433																0.779221	200.639444	206.16656	60	17	KEEP	---	---	---	---	26	36	7	10	-1	capture	Missense_Mutation	SNP	114090554	114090554	OR2K2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10909	208
ZNF337	26152	broad.mit.edu	37	20	25655873	25655873	+	Frame_Shift_Del	DEL	G	-	-			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:25655873delG	uc002wva.2	-	4	2573	c.2051delC	c.(2050-2052)CCTfs	p.P684fs	uc002wuz.2_RNA|ZNF337_uc010ztg.1_Frame_Shift_Del_p.P652fs|ZNF337_uc002wvb.2_Frame_Shift_Del_p.P684fs|ZNF337_uc002wvc.2_Frame_Shift_Del_p.P684fs	NM_015655	NP_056470	Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	684					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCAAACAAAAGGCTTCTCCTT	0.502																0.42			133	187		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	25655873	25655873	ZNF337	20	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	17733	208
RLN2	6019	broad.mit.edu	37	9	5304560	5304561	+	Frame_Shift_Ins	INS	-	A	A			TCGA-28-2499-01	TCGA-28-2499-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:5304560_5304561insA	uc003zja.1	-	1	20_21	c.20_21insT	c.(19-21)TTCfs	p.F7fs	RLN2_uc003ziz.1_Frame_Shift_Ins_p.F7fs	NM_134441	NP_604390	P04090	REL2_HUMAN	relaxin 2 isoform 1 preproprotein	7					female pregnancy	extracellular region	hormone activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.0987)		CTAGCAGGTGGAAAAAAAACAG	0.535																0.04			7	186		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	5304560	5304561	RLN2	9	-	A	A	A	1	0	1	1	0	0	0	0	0	529	41	5	5	13284	208
