Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TAS1R1	80835	broad.mit.edu	37	1	6634905	6634905	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6634905G>A	uc001ant.2	+	3	713	c.713G>A	c.(712-714)TGC>TAC	p.C238Y	TAS1R1_uc001anu.2_Intron|TAS1R1_uc001anv.2_Intron|TAS1R1_uc001anw.2_Missense_Mutation_p.C238Y	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN	sweet taste receptor T1r isoform b	238	Extracellular (Potential).				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		CAGGGGATCTGCATTGCTTTC	0.622																0.257895	115.775254	125.876499	49	141	KEEP	---	---	---	---	26	28	71	83	-1	capture	Missense_Mutation	SNP	6634905	6634905	TAS1R1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	15450	220
KLHDC7A	127707	broad.mit.edu	37	1	18808936	18808936	+	Silent	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:18808936G>A	uc001bax.2	+	1	1513	c.1461G>A	c.(1459-1461)CGG>CGA	p.R487R	KLHDC7A_uc009vpg.2_Silent_p.R269R	NM_152375	NP_689588	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	487						integral to membrane				ovary(2)|upper_aerodigestive_tract(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TGCAGCGCCGGCTCCGGGGCC	0.662																0.308411	85.430325	88.934201	33	74	KEEP	---	---	---	---	22	19	42	65	-1	capture	Silent	SNP	18808936	18808936	KLHDC7A	1	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	8280	220
RSPO1	284654	broad.mit.edu	37	1	38079485	38079485	+	Silent	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38079485G>A	uc001cbl.1	-	7	1304	c.516C>T	c.(514-516)TCC>TCT	p.S172S	RSPO1_uc001cbm.1_Silent_p.S172S|RSPO1_uc009vvf.1_Silent_p.S145S|RSPO1_uc009vvg.1_Intron	NM_001038633	NP_001033722	Q2MKA7	RSPO1_HUMAN	R-spondin1 precursor	172	TSP type-1.				positive regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization		heparin binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TCCGCTCCTCGGAGCCCCTCC	0.632	GBM(122;680 2230 27822 42821)															0.318182	195.985489	202.442983	70	150	KEEP	---	---	---	---	42	35	87	92	-1	capture	Silent	SNP	38079485	38079485	RSPO1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	13601	220
MACF1	23499	broad.mit.edu	37	1	39799225	39799225	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39799225C>T	uc010oiu.1	+	1	2416	c.2285C>T	c.(2284-2286)GCC>GTC	p.A762V	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2327	Plectin 6.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGTCACACTGCCGTGAAGCTT	0.423																0.022727	-38.066227	6.633019	4	172	KEEP	---	---	---	---	3	1	89	101	-1	capture	Missense_Mutation	SNP	39799225	39799225	MACF1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9059	220
MOBKL2C	148932	broad.mit.edu	37	1	47078629	47078629	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47078629A>G	uc001cqf.3	-	2	596	c.365T>C	c.(364-366)ATG>ACG	p.M122T	MKNK1_uc010omf.1_Intron|MOBKL2C_uc001cqe.3_Missense_Mutation_p.M174T	NM_201403	NP_958805	Q70IA8	MOL2C_HUMAN	MOB1, Mps One Binder kinase activator-like 2C	122							metal ion binding			pancreas(1)	1	Acute lymphoblastic leukemia(166;0.155)					GATCCAGTCCATGAGCAATGC	0.637																0.169811	37.5908	48.521446	18	88	KEEP	---	---	---	---	6	13	45	48	-1	capture	Missense_Mutation	SNP	47078629	47078629	MOBKL2C	1	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	9598	220
C1orf177	163747	broad.mit.edu	37	1	55273665	55273665	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55273665G>A	uc001cyb.3	+	4	515	c.461G>A	c.(460-462)CGC>CAC	p.R154H	C1orf177_uc001cya.3_Missense_Mutation_p.R154H	NM_001110533	NP_001104003	Q3ZCV2	CA177_HUMAN	hypothetical protein LOC163747 isoform 2	154											0						GGGGAGGTTCGCTTCCGAGGA	0.413																0.248826	126.558963	138.793738	53	160	KEEP	---	---	---	---	24	33	88	94	-1	capture	Missense_Mutation	SNP	55273665	55273665	C1orf177	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1999	220
INADL	10207	broad.mit.edu	37	1	62253476	62253476	+	Silent	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:62253476C>T	uc001dab.2	+	8	1014	c.900C>T	c.(898-900)AAC>AAT	p.N300N	INADL_uc009waf.1_Silent_p.N300N|INADL_uc001daa.2_Silent_p.N300N|INADL_uc001dad.3_Translation_Start_Site	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	300	PDZ 2.				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						GTGGCACAAACGTGCAGGGAA	0.438																0.223077	66.603898	75.774155	29	101	KEEP	---	---	---	---	13	20	53	62	-1	capture	Silent	SNP	62253476	62253476	INADL	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7654	220
TRIM45	80263	broad.mit.edu	37	1	117663350	117663350	+	Silent	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117663350G>A	uc001egz.2	-	1	1062	c.474C>T	c.(472-474)TGC>TGT	p.C158C	TRIM45_uc009whe.2_Silent_p.C158C|TRIM45_uc001eha.2_Silent_p.C54C	NM_025188	NP_079464	Q9H8W5	TRI45_HUMAN	tripartite motif-containing 45 isoform 1	158	B box-type 1.					cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)	1	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		GAGCCTGGCAGCAGAAGTGGC	0.527																0.025806	-31.334978	7.251288	4	151	KEEP	---	---	---	---	0	6	94	84	-1	capture	Silent	SNP	117663350	117663350	TRIM45	1	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	16403	220
TCHH	7062	broad.mit.edu	37	1	152083970	152083970	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152083970G>A	uc001ezp.2	-	2	1723	c.1723C>T	c.(1723-1725)CGC>TGC	p.R575C	TCHH_uc009wne.1_Missense_Mutation_p.R575C	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	575	9 X 28 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCTGATCGCGCCTCTCCTCC	0.677																0.263514	86.846045	94.347904	39	109	KEEP	---	---	---	---	21	26	74	68	-1	capture	Missense_Mutation	SNP	152083970	152083970	TCHH	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15585	220
SPTA1	6708	broad.mit.edu	37	1	158606471	158606471	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158606471C>T	uc001fst.1	-	37	5469	c.5270G>A	c.(5269-5271)CGC>CAC	p.R1757H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1757	Spectrin 17.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CCCCTCTAGGCGTTTGTGCTT	0.383																0.220183	156.760244	180.317932	72	255	KEEP	---	---	---	---	44	35	138	160	-1	capture	Missense_Mutation	SNP	158606471	158606471	SPTA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15008	220
PYHIN1	149628	broad.mit.edu	37	1	158906881	158906881	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158906881G>A	uc001ftb.2	+	2	426	c.181G>A	c.(181-183)GGT>AGT	p.G61S	PYHIN1_uc001fta.3_Missense_Mutation_p.G61S|PYHIN1_uc001ftc.2_Missense_Mutation_p.G61S|PYHIN1_uc001ftd.2_Missense_Mutation_p.G61S|PYHIN1_uc001fte.2_Missense_Mutation_p.G61S	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	61	DAPIN.				cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					AGGTGATGCCGGTTTGGGCAA	0.368																0.146552	33.39841	47.323182	17	99	KEEP	---	---	---	---	8	10	46	65	-1	capture	Missense_Mutation	SNP	158906881	158906881	PYHIN1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12760	220
OR2T33	391195	broad.mit.edu	37	1	248436203	248436203	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248436203G>A	uc010pzi.1	-	1	914	c.914C>T	c.(913-915)ACG>ATG	p.T305M		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	305	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GTTTACACACGTCCCCAGCCA	0.423																0.194444	159.990733	194.465814	77	319	KEEP	---	---	---	---	40	41	177	165	-1	capture	Missense_Mutation	SNP	248436203	248436203	OR2T33	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10928	220
NEBL	10529	broad.mit.edu	37	10	21120216	21120216	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:21120216A>G	uc001iqi.2	-	16	1977	c.1580T>C	c.(1579-1581)TTA>TCA	p.L527S	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_RNA	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	527	Nebulin 14.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						TTCATTTTCTAAGTCCTTCTT	0.353																0.028571	-18.103011	7.518744	3	102	KEEP	---	---	---	---	1	3	55	54	-1	capture	Missense_Mutation	SNP	21120216	21120216	NEBL	10	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	10210	220
ADAM12	8038	broad.mit.edu	37	10	127755335	127755335	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:127755335A>G	uc001ljk.2	-	13	1786	c.1373T>C	c.(1372-1374)CTG>CCG	p.L458P	ADAM12_uc010qul.1_Missense_Mutation_p.L409P|ADAM12_uc001ljm.2_Missense_Mutation_p.L458P|ADAM12_uc001ljn.2_Missense_Mutation_p.L455P|ADAM12_uc001ljl.3_Missense_Mutation_p.L455P	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	458	Extracellular (Potential).|Disintegrin.				cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GTCCGGCTTCAGGGTACAGGT	0.547					1070											0.030928	-15.657888	7.721399	3	94	KEEP	---	---	---	---	2	1	53	49	-1	capture	Missense_Mutation	SNP	127755335	127755335	ADAM12	10	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	236	220
MICAL2	9645	broad.mit.edu	37	11	12278418	12278418	+	Silent	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:12278418G>A	uc001mjz.2	+	24	3330	c.3042G>A	c.(3040-3042)CGG>CGA	p.R1014R	MICAL2_uc010rch.1_Silent_p.R824R|MICAL2_uc001mka.2_Silent_p.R1014R|MICAL2_uc010rci.1_Silent_p.R993R|MICAL2_uc001mkb.2_Silent_p.R788R|MICAL2_uc001mkc.2_Silent_p.R767R|MICAL2_uc001mkd.2_Silent_p.R596R|MICAL2_uc010rcj.1_Silent_p.R226R|MICAL2_uc001mkf.2_RNA	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin	1014	LIM zinc-binding.					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)		TGATGGAACGGCTGAGCGCCG	0.572																0.037879	-21.341122	9.160448	5	127	KEEP	---	---	---	---	4	1	67	72	-1	capture	Silent	SNP	12278418	12278418	MICAL2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	9482	220
AHNAK	79026	broad.mit.edu	37	11	62288237	62288237	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62288237G>A	uc001ntl.2	-	5	13952	c.13652C>T	c.(13651-13653)CCC>CTC	p.P4551L	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4551					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				ATCCACTTTGGGACCTTTCAG	0.423																0.234742	131.336889	145.051256	50	163	KEEP	---	---	---	---	24	29	80	90	-1	capture	Missense_Mutation	SNP	62288237	62288237	AHNAK	11	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	414	220
GANAB	23193	broad.mit.edu	37	11	62396739	62396739	+	Silent	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62396739G>A	uc001nub.2	-	16	1896	c.1863C>T	c.(1861-1863)GCC>GCT	p.A621A	GANAB_uc001ntz.2_5'Flank|GANAB_uc001nua.2_Silent_p.A643A|GANAB_uc001nuc.2_Silent_p.A524A|GANAB_uc010rma.1_Silent_p.A529A|GANAB_uc010rmb.1_Silent_p.A507A	NM_198334	NP_938148	Q14697	GANAB_HUMAN	neutral alpha-glucosidase AB isoform 2	621					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5						GGTCCCACTCGGCAGTGTTGT	0.527	Melanoma(23;1005 1074 15747 18937)															0.194286	83.169931	98.410497	34	141	KEEP	---	---	---	---	18	21	61	101	-1	capture	Silent	SNP	62396739	62396739	GANAB	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6173	220
MUS81	80198	broad.mit.edu	37	11	65628471	65628471	+	Silent	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65628471C>T	uc001ofv.3	+	2	516	c.163C>T	c.(163-165)CTG>TTG	p.L55L	CFL1_uc001ofs.2_5'Flank|CFL1_uc001oft.2_5'Flank|CFL1_uc001ofu.2_5'Flank|MUS81_uc001ofw.3_RNA|MUS81_uc001ofx.3_5'Flank	NM_025128	NP_079404	Q96NY9	MUS81_HUMAN	MUS81 endonuclease homolog	55					DNA recombination|DNA repair	nucleolus	3'-flap endonuclease activity|DNA binding|metal ion binding|protein binding				0				READ - Rectum adenocarcinoma(159;0.166)		ACGGTACCCACTGCCGCTGCG	0.682											Homologous_recombination					0.202247	37.395245	44.730199	18	71	KEEP	---	---	---	---	6	14	45	41	-1	capture	Silent	SNP	65628471	65628471	MUS81	11	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	9898	220
OR2AT4	341152	broad.mit.edu	37	11	74800717	74800717	+	Silent	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:74800717G>A	uc010rro.1	-	1	42	c.42C>T	c.(40-42)CCC>CCT	p.P14P		NM_001005285	NP_001005285	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GATAGAAGACGGGTGAGCCAT	0.478																0.252101	76.796199	83.436753	30	89	KEEP	---	---	---	---	17	14	39	59	-1	capture	Silent	SNP	74800717	74800717	OR2AT4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10891	220
MLL	4297	broad.mit.edu	37	11	118375649	118375649	+	Silent	SNP	A	C	C			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118375649A>C	uc001pta.2	+	27	9056	c.9033A>C	c.(9031-9033)TCA>TCC	p.S3011S	MLL_uc001ptb.2_Silent_p.S3014S	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	3011					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		CTTGTGGTTCAGTAGAGCAAG	0.502					723	T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								0.221053	113.649328	127.255535	42	148	KEEP	---	---	---	---	21	24	74	86	-1	capture	Silent	SNP	118375649	118375649	MLL	11	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	9532	220
C12orf35	55196	broad.mit.edu	37	12	32137685	32137685	+	Missense_Mutation	SNP	A	C	C			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:32137685A>C	uc001rks.2	+	4	4210	c.3796A>C	c.(3796-3798)AGC>CGC	p.S1266R	C12orf35_uc001rkt.2_5'Flank	NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	1266										ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			AAAACATAAAAGCTTACCAAG	0.348																0.211111	47.173626	54.121093	19	71	KEEP	---	---	---	---	9	12	28	44	-1	capture	Missense_Mutation	SNP	32137685	32137685	C12orf35	12	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	1668	220
LRP1	4035	broad.mit.edu	37	12	57562923	57562923	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57562923A>G	uc001snd.2	+	20	3462	c.2996A>G	c.(2995-2997)GAC>GGC	p.D999G	LRP1_uc009zpi.1_RNA	NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	999	Extracellular (Potential).|LDL-receptor class A 6.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCACCGCCAGACAATGACTGT	0.627					1456											0.22619	104.763512	116.328618	38	130	KEEP	---	---	---	---	27	15	83	71	-1	capture	Missense_Mutation	SNP	57562923	57562923	LRP1	12	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	8867	220
UBE3B	89910	broad.mit.edu	37	12	109921388	109921388	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109921388G>A	uc001top.2	+	3	635	c.32G>A	c.(31-33)TGG>TAG	p.W11*	UBE3B_uc001toq.2_Nonsense_Mutation_p.W11*|UBE3B_uc001tol.1_Nonsense_Mutation_p.W11*|UBE3B_uc001tom.2_Nonsense_Mutation_p.W11*|UBE3B_uc001ton.2_Nonsense_Mutation_p.W11*|UBE3B_uc001too.1_RNA|UBE3B_uc009zvj.1_Nonsense_Mutation_p.W11*|UBE3B_uc001tor.2_Nonsense_Mutation_p.W11*	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	11					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						TCGAGAGCATGGTTCATCGAT	0.512					668											0.228464	140.318122	158.392793	61	206	KEEP	---	---	---	---	37	27	108	115	-1	capture	Nonsense_Mutation	SNP	109921388	109921388	UBE3B	12	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	16762	220
KDM2B	84678	broad.mit.edu	37	12	121880495	121880495	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121880495C>T	uc001uat.2	-	19	2853	c.2749G>A	c.(2749-2751)GCG>ACG	p.A917T	KDM2B_uc001uaq.2_Missense_Mutation_p.A357T|KDM2B_uc010szy.1_Missense_Mutation_p.A357T|KDM2B_uc001uar.2_Missense_Mutation_p.A508T|KDM2B_uc001uas.2_Missense_Mutation_p.A848T|KDM2B_uc001uau.2_Intron|KDM2B_uc001uao.2_Missense_Mutation_p.A165T|KDM2B_uc010szx.1_Missense_Mutation_p.A165T|KDM2B_uc001uap.2_RNA	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	917					embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						CTGGGTCCCGCGGTGGGGGAG	0.627																0.28125	22.761489	24.137693	9	23	KEEP	---	---	---	---	6	4	13	12	-1	capture	Missense_Mutation	SNP	121880495	121880495	KDM2B	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8047	220
SACS	26278	broad.mit.edu	37	13	23942617	23942617	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:23942617C>A	uc001uon.2	-	5	858	c.269G>T	c.(268-270)GGT>GTT	p.G90V	SACS_uc001uoo.2_5'UTR|SACS_uc001uoq.1_5'UTR	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	90					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CGTTGTCTGACCAAATCGACC	0.393					738											0.18	18.75438	23.562022	9	41	KEEP	---	---	---	---	4	5	17	32	0.555555555556	capture	Missense_Mutation	SNP	23942617	23942617	SACS	13	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	13696	220
ATL1	51062	broad.mit.edu	37	14	51027003	51027003	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:51027003A>G	uc001wyf.3	+	1	261	c.20A>G	c.(19-21)GAC>GGC	p.D7G	ATL1_uc001wyd.3_Missense_Mutation_p.D7G|ATL1_uc001wye.3_Missense_Mutation_p.D7G	NM_015915	NP_056999	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1 isoform a	7	Cytoplasmic.				axonogenesis|cell death|endoplasmic reticulum organization|protein homooligomerization	axon|endoplasmic reticulum membrane|Golgi cis cisterna|Golgi membrane|integral to membrane|microsome	GTP binding|GTPase activity|identical protein binding			skin(3)|central_nervous_system(1)	4						AACCGCAGGGACAGAAACAGT	0.632																0.076923	0.795611	7.939497	3	36	KEEP	---	---	---	---	2	2	15	29	-1	capture	Missense_Mutation	SNP	51027003	51027003	ATL1	14	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	1097	220
CLMN	79789	broad.mit.edu	37	14	95677204	95677204	+	Silent	SNP	C	T	T	rs139868659		TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95677204C>T	uc001yef.2	-	7	737	c.621G>A	c.(619-621)GCG>GCA	p.A207A		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	207	Actin-binding.|CH 2.					integral to membrane	actin binding				0				Epithelial(152;0.193)		AGTCCTGCACCGCCACGCCAT	0.582																0.038251	-29.720427	12.45504	7	176	KEEP	---	---	---	---	7	0	125	151	-1	capture	Silent	SNP	95677204	95677204	CLMN	14	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3507	220
ATP10A	57194	broad.mit.edu	37	15	25953147	25953147	+	Silent	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:25953147G>A	uc010ayu.2	-	12	2657	c.2551C>T	c.(2551-2553)CTG>TTG	p.L851L		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	851	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TTGGTCTCCAGGCGAATGGCA	0.537					877											0.28169	56.56811	59.610667	20	51	KEEP	---	---	---	---	13	8	21	38	-1	capture	Silent	SNP	25953147	25953147	ATP10A	15	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	1107	220
SERINC4	619189	broad.mit.edu	37	15	44090144	44090144	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:44090144A>G	uc010bds.1	-	3	554	c.86T>C	c.(85-87)CTT>CCT	p.L29P	ELL3_uc001zsx.1_5'UTR|C15orf63_uc001ztb.2_Intron|SERINC4_uc001ztc.1_RNA|SERINC4_uc001ztd.1_5'UTR|SERINC4_uc001zte.1_Missense_Mutation_p.L29P|C15orf63_uc001ztf.2_5'Flank|C15orf63_uc001ztg.1_5'Flank	NM_001033517	NP_001028689	A6NH21	SERC4_HUMAN	serine incorporator 4	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					phospholipid biosynthetic process	integral to membrane					0		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		GBM - Glioblastoma multiforme(94;7.81e-07)		AATGGGCAAAAGCTGTAATAA	0.463														OREG0003944	type=REGULATORY REGION|Gene=AK094716|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.051724	-3.82539	8.504603	3	55	KEEP	---	---	---	---	3	0	35	30	-1	capture	Missense_Mutation	SNP	44090144	44090144	SERINC4	15	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	13975	220
GRIN2A	2903	broad.mit.edu	37	16	9857047	9857047	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:9857047G>A	uc002czo.3	-	13	4902	c.4354C>T	c.(4354-4356)CGC>TGC	p.R1452C	GRIN2A_uc010uym.1_Missense_Mutation_p.R1452C|GRIN2A_uc010uyn.1_3'UTR|GRIN2A_uc002czr.3_3'UTR	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1452	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TTGTACACGCGTCTATTGCTG	0.363					324											0.242857	82.16972	90.619818	34	106	KEEP	---	---	---	---	21	15	52	62	-1	capture	Missense_Mutation	SNP	9857047	9857047	GRIN2A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6712	220
GRIN2A	2903	broad.mit.edu	37	16	9934645	9934645	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:9934645G>A	uc002czo.3	-	7	2058	c.1510C>T	c.(1510-1512)CGG>TGG	p.R504W	GRIN2A_uc010uym.1_Missense_Mutation_p.R504W|GRIN2A_uc010uyn.1_Missense_Mutation_p.R347W|GRIN2A_uc002czr.3_Missense_Mutation_p.R504W	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	504	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	ATGACTGCCCGTTGATAGACC	0.453					324											0.25	41.940424	45.805198	17	51	KEEP	---	---	---	---	12	11	29	42	-1	capture	Missense_Mutation	SNP	9934645	9934645	GRIN2A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	6712	220
CDH15	1013	broad.mit.edu	37	16	89261354	89261354	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89261354G>A	uc002fmt.2	+	14	2313	c.2236G>A	c.(2236-2238)GCG>ACG	p.A746T		NM_004933	NP_004924	P55291	CAD15_HUMAN	cadherin 15 preproprotein	746	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CGGCTCGGTGGCGGGGACGCT	0.637																0.28125	19.761121	21.138272	9	23	KEEP	---	---	---	---	5	5	16	14	-1	capture	Missense_Mutation	SNP	89261354	89261354	CDH15	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3071	220
PFAS	5198	broad.mit.edu	37	17	8158344	8158344	+	Splice_Site	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8158344G>A	uc002gkr.2	+	4	420	c.279_splice	c.e4-1	p.R93_splice	PFAS_uc010vuv.1_Splice_Site	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase						'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	CCATTGTTCAGGCTGAACTTC	0.632																0.144654	42.511341	61.837224	23	136	KEEP	---	---	---	---	12	13	84	65	-1	capture	Splice_Site	SNP	8158344	8158344	PFAS	17	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	11657	220
NTN1	9423	broad.mit.edu	37	17	9066204	9066204	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:9066204G>A	uc002glw.3	+	3	1200	c.1093G>A	c.(1093-1095)GGA>AGA	p.G365R		NM_004822	NP_004813	O95631	NET1_HUMAN	netrin 1 precursor	365	Laminin EGF-like 2.				apoptosis|axon guidance		protein binding				0						GCGCAAGAGCGGAGGTGTCTG	0.627																0.367089	85.053242	86.280485	29	50	KEEP	---	---	---	---	19	13	30	29	-1	capture	Missense_Mutation	SNP	9066204	9066204	NTN1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10607	220
DGKE	8526	broad.mit.edu	37	17	54925329	54925329	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:54925329G>T	uc002iur.2	+	5	971	c.791G>T	c.(790-792)TGT>TTT	p.C264F	DGKE_uc002ius.1_Missense_Mutation_p.C264F	NM_003647	NP_003638	P52429	DGKE_HUMAN	diacylglycerol kinase epsilon	264	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding			breast(2)	2	Breast(9;3.59e-07)					CTACAACTCTGTACTCTTCTC	0.388																0.198113	101.520145	119.512143	42	170	KEEP	---	---	---	---	20	29	107	98	0.408163265306	capture	Missense_Mutation	SNP	54925329	54925329	DGKE	17	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	4426	220
MIDN	90007	broad.mit.edu	37	19	1257138	1257138	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1257138G>A	uc002lrp.2	+	8	1789	c.1274G>A	c.(1273-1275)GGC>GAC	p.G425D		NM_177401	NP_796375	Q504T8	MIDN_HUMAN	midnolin	425						nucleolus					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCAAGGCCGGCCGCAGCGAC	0.697																0.285714	35.992253	37.97516	14	35	KEEP	---	---	---	---	7	16	28	39	-1	capture	Missense_Mutation	SNP	1257138	1257138	MIDN	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	9491	220
FUT3	2525	broad.mit.edu	37	19	5844200	5844200	+	Silent	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5844200G>A	uc002mdk.2	-	2	748	c.651C>T	c.(649-651)CTC>CTT	p.L217L	FUT3_uc002mdm.2_Silent_p.L217L|FUT3_uc002mdj.2_Silent_p.L217L|FUT3_uc002mdl.2_Silent_p.L217L	NM_001097641	NP_001091110	P21217	FUT3_HUMAN	fucosyltransferase 3	217	Lumenal (Potential).				protein glycosylation	Golgi cisterna membrane|integral to membrane|membrane fraction	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity				0						CGTCCACCTTGAGATGAGCCT	0.622	Esophageal Squamous(82;745 1728 24593 44831)															0.236559	102.60441	114.406257	44	142	KEEP	---	---	---	---	28	29	130	99	-1	capture	Silent	SNP	5844200	5844200	FUT3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	6047	220
RAB11B	9230	broad.mit.edu	37	19	8464851	8464851	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8464851G>T	uc002mju.3	+	2	241	c.145G>T	c.(145-147)GCC>TCC	p.A49S	RAB11B_uc010xkd.1_Missense_Mutation_p.A49S	NM_004218	NP_004209	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family	49					cell cycle|protein transport|small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity				0						CGTGGAGTTCGCCACCCGCAG	0.652																0.035714	-12.492047	7.018828	3	81	KEEP	---	---	---	---	0	3	42	59	-1	capture	Missense_Mutation	SNP	8464851	8464851	RAB11B	19	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	12787	220
MUC16	94025	broad.mit.edu	37	19	9069909	9069909	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9069909C>A	uc002mkp.2	-	3	17741	c.17537G>T	c.(17536-17538)AGG>ATG	p.R5846M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5848	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGTGGAGAGCCTGGTGATGGT	0.488																0.272401	196.369899	209.403116	76	203	KEEP	---	---	---	---	40	41	118	111	0.506172839506	capture	Missense_Mutation	SNP	9069909	9069909	MUC16	19	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	9883	220
CCDC85A	114800	broad.mit.edu	37	2	56603032	56603032	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:56603032C>T	uc002rzn.2	+	5	2036	c.1534C>T	c.(1534-1536)CCT>TCT	p.P512S		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	512										breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ACATGCCACACCTTCCCAGCA	0.473																0.211864	57.404754	66.46654	25	93	KEEP	---	---	---	---	19	9	65	48	-1	capture	Missense_Mutation	SNP	56603032	56603032	CCDC85A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	2833	220
POLR1B	84172	broad.mit.edu	37	2	113315616	113315616	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113315616T>C	uc002thw.2	+	8	1868	c.1288T>C	c.(1288-1290)TTT>CTT	p.F430L	POLR1B_uc010fkn.2_Missense_Mutation_p.F374L|POLR1B_uc002thx.2_Missense_Mutation_p.F291L|POLR1B_uc010fko.2_Intron|POLR1B_uc010fkp.2_Intron|POLR1B_uc010yxn.1_Missense_Mutation_p.F468L|POLR1B_uc002thy.2_Missense_Mutation_p.F291L|POLR1B_uc010yxo.1_Missense_Mutation_p.F207L	NM_019014	NP_061887	Q9H9Y6	RPA2_HUMAN	RNA polymerase I polypeptide B isoform 1	430					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(1)	1						TACAAAACCATTTGAATACCT	0.328	Ovarian(16;256 576 9537 23969 41147)															0.234234	79.794427	86.965829	26	85	KEEP	---	---	---	---	13	14	42	58	-1	capture	Missense_Mutation	SNP	113315616	113315616	POLR1B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	12113	220
TTN	7273	broad.mit.edu	37	2	179410767	179410767	+	Silent	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179410767C>T	uc010zfg.1	-	292	87716	c.87492G>A	c.(87490-87492)CCG>CCA	p.P29164P	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.P22859P|TTN_uc010zfi.1_Silent_p.P22792P|TTN_uc010zfj.1_Silent_p.P22667P	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30091							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGTCTTCCTGCGGAAGGCTCC	0.527					8722											0.222222	64.933226	73.877565	28	98	KEEP	---	---	---	---	9	20	46	53	-1	capture	Silent	SNP	179410767	179410767	TTN	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	16617	220
CRYGC	1420	broad.mit.edu	37	2	208993026	208993026	+	Silent	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:208993026C>T	uc002vco.3	-	3	464	c.426G>A	c.(424-426)CGG>CGA	p.R142R		NM_020989	NP_066269	P07315	CRGC_HUMAN	crystallin, gamma C	142	Beta/gamma crystallin 'Greek key' 4.				visual perception	cytoplasm|nucleus	protein binding|structural constituent of eye lens				0				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		GCAGGTATTGCCGCCCCCGGT	0.622																0.022472	-38.525734	6.711316	4	174	KEEP	---	---	---	---	2	3	100	101	-1	capture	Silent	SNP	208993026	208993026	CRYGC	2	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	3881	220
PNKD	25953	broad.mit.edu	37	2	219206751	219206751	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219206751G>A	uc002vhn.2	+	7	809	c.665G>A	c.(664-666)CGG>CAG	p.R222Q	PNKD_uc002vhq.2_Missense_Mutation_p.R198Q	NM_015488	NP_056303	Q8N490	PNKD_HUMAN	myofibrillogenesis regulator 1 isoform 1	222						membrane|mitochondrion|nucleus	hydroxyacylglutathione hydrolase activity|zinc ion binding				0		Renal(207;0.0474)		Epithelial(149;7.33e-07)|all cancers(144;0.000133)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTCAGATCCGGGCCCTGGCT	0.597																0.216783	78.521853	89.046538	31	112	KEEP	---	---	---	---	15	17	70	63	-1	capture	Missense_Mutation	SNP	219206751	219206751	PNKD	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12049	220
MATN4	8785	broad.mit.edu	37	20	43933304	43933304	+	Silent	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43933304G>A	uc002xnn.2	-	3	394	c.207C>T	c.(205-207)AAC>AAT	p.N69N	MATN4_uc002xno.2_Silent_p.N69N|MATN4_uc002xnp.2_Silent_p.N69N|MATN4_uc010zwr.1_Silent_p.N17N|MATN4_uc002xnr.1_Silent_p.N69N|RBPJL_uc002xns.2_5'Flank|RBPJL_uc002xnt.2_5'Flank	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	69	VWFA 1.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)				CGCGCGTGGCGTTGGGACCCA	0.642																0.181818	36.621218	47.108714	20	90	KEEP	---	---	---	---	10	10	56	49	-1	capture	Silent	SNP	43933304	43933304	MATN4	20	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9249	220
LAMA5	3911	broad.mit.edu	37	20	60897158	60897158	+	Missense_Mutation	SNP	C	T	T	rs143066016	byFrequency	TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60897158C>T	uc002ycq.2	-	48	6480	c.6413G>A	c.(6412-6414)AGC>AAC	p.S2138N		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	2138	Laminin EGF-like 22.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCGCTCCCCGCTGAGCCCCGG	0.701																0.203125	29.13543	34.375923	13	51	KEEP	---	---	---	---	6	8	26	27	-1	capture	Missense_Mutation	SNP	60897158	60897158	LAMA5	20	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	8529	220
SGOL1	151648	broad.mit.edu	37	3	20225255	20225255	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:20225255T>C	uc003cbs.2	-	3	371	c.184A>G	c.(184-186)AAA>GAA	p.K62E	SGOL1_uc003cbr.2_Missense_Mutation_p.K62E|SGOL1_uc010hfa.2_Missense_Mutation_p.K62E|SGOL1_uc003cbt.2_Missense_Mutation_p.K62E|SGOL1_uc003cbu.2_Missense_Mutation_p.K62E|SGOL1_uc003cbv.2_Missense_Mutation_p.K62E|SGOL1_uc003cbw.2_Missense_Mutation_p.K62E|SGOL1_uc003cbx.2_Missense_Mutation_p.K62E|SGOL1_uc003cby.2_Missense_Mutation_p.K62E|SGOL1_uc003cbz.2_Missense_Mutation_p.K62E|SGOL1_uc003cca.2_Missense_Mutation_p.K62E|SGOL1_uc003ccb.2_Missense_Mutation_p.K62E|SGOL1_uc003ccc.2_Missense_Mutation_p.K62E	NM_001012410	NP_001012410	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 isoform A2	62	Potential.|Necessary for interaction with PPP2CA and PPP2R1A.				attachment of spindle microtubules to kinetochore|cell division|centriole-centriole cohesion|meiotic chromosome segregation|mitotic prometaphase	centrosome|condensed chromosome kinetochore|cytosol|mitotic cohesin complex|spindle pole	protein binding				0						ACTAACATTTTGTTGTTGTCT	0.294																0.215827	75.273933	85.631161	30	109	KEEP	---	---	---	---	15	16	50	66	-1	capture	Missense_Mutation	SNP	20225255	20225255	SGOL1	3	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	14109	220
MAPKAPK3	7867	broad.mit.edu	37	3	50655078	50655078	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50655078C>T	uc003day.1	+	4	678	c.82C>T	c.(82-84)CCG>TCG	p.P28S	MAPKAPK3_uc003daz.1_Missense_Mutation_p.P28S|MAPKAPK3_uc003dba.1_Missense_Mutation_p.P28S|MAPKAPK3_uc010hlr.1_Missense_Mutation_p.P28S	NM_004635	NP_004626	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated	28			P -> S (in a glioblastoma multiforme sample; somatic mutation).		activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity	p.P28S(1)		ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		GGGCGGTGCTCCGGGGGGGCG	0.697					122											0.190476	48.739906	60.016584	24	102	KEEP	---	---	---	---	20	21	71	81	-1	capture	Missense_Mutation	SNP	50655078	50655078	MAPKAPK3	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	9203	220
CASR	846	broad.mit.edu	37	3	122003457	122003457	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122003457C>T	uc003eev.3	+	7	3028	c.2656C>T	c.(2656-2658)CGG>TGG	p.R886W	CASR_uc003eew.3_Missense_Mutation_p.R896W	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	886	Cytoplasmic (Potential).|Interaction with RNF19A.		R -> W (could be associated with FHH).		anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GGTGGCTGCCCGGGCCACGCT	0.612																0.289474	57.49263	60.471002	22	54	KEEP	---	---	---	---	14	8	28	34	-1	capture	Missense_Mutation	SNP	122003457	122003457	CASR	3	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	2658	220
GHSR	2693	broad.mit.edu	37	3	172165482	172165482	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:172165482C>T	uc003fib.1	-	1	722	c.722G>A	c.(721-723)CGG>CAG	p.R241Q	GHSR_uc011bpv.1_Missense_Mutation_p.R241Q	NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	241	Cytoplasmic (Potential).				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			GCGCCTCCTCCGCCACAGCTT	0.602	Esophageal Squamous(93;641 1401 20883 29581 34638)															0.223881	37.592789	42.285874	15	52	KEEP	---	---	---	---	11	7	43	34	-1	capture	Missense_Mutation	SNP	172165482	172165482	GHSR	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6314	220
WDFY3	23001	broad.mit.edu	37	4	85634313	85634313	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:85634313C>T	uc003hpd.2	-	51	8449	c.8041G>A	c.(8041-8043)GGA>AGA	p.G2681R	WDFY3_uc003hpe.1_Missense_Mutation_p.G292R	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	2681						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		ACCACCTACCCCTGCTCCACA	0.398																0.199525	204.72393	240.034988	84	337	KEEP	---	---	---	---	52	49	197	188	-1	capture	Missense_Mutation	SNP	85634313	85634313	WDFY3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	17151	220
SLCO6A1	133482	broad.mit.edu	37	5	101834365	101834365	+	Missense_Mutation	SNP	C	T	T	rs144293843		TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101834365C>T	uc003knn.2	-	1	356	c.184G>A	c.(184-186)GGC>AGC	p.G62S	SLCO6A1_uc003kno.2_Missense_Mutation_p.G62S|SLCO6A1_uc003knp.2_Missense_Mutation_p.G62S|SLCO6A1_uc003knq.2_Missense_Mutation_p.G62S	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	62	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CGGAAACCGCCGAACCTTATC	0.537																0.191126	270.757656	322.997751	112	474	KEEP	---	---	---	---	62	63	286	251	-1	capture	Missense_Mutation	SNP	101834365	101834365	SLCO6A1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14624	220
TFAP2B	7021	broad.mit.edu	37	6	50791291	50791291	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:50791291C>T	uc003pag.2	+	2	419	c.253C>T	c.(253-255)CCC>TCC	p.P85S		NM_003221	NP_003212	Q92481	AP2B_HUMAN	transcription factor AP-2 beta	85	Gln/Pro-rich (transactivation domain).				nervous system development|positive regulation of transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0	Lung NSC(77;0.156)					GAGCCAGGACCCCTACTCCCA	0.682	Pancreas(116;1373 2332 5475 10752)															0.126437	16.792628	28.616782	11	76	KEEP	---	---	---	---	3	10	37	58	-1	capture	Missense_Mutation	SNP	50791291	50791291	TFAP2B	6	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	15673	220
GJA10	84694	broad.mit.edu	37	6	90605129	90605129	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:90605129C>A	uc011eaa.1	+	1	942	c.942C>A	c.(940-942)GAC>GAA	p.D314E		NM_032602	NP_115991	Q969M2	CXA10_HUMAN	gap junction protein, alpha 10	314	Cytoplasmic (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		TTGAAGTAGACCCTTCCAATG	0.498																0.04	-9.843147	7.262762	3	72	KEEP	---	---	---	---	3	0	44	30	-1	capture	Missense_Mutation	SNP	90605129	90605129	GJA10	6	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	6338	220
C7orf11	136647	broad.mit.edu	37	7	40172717	40172717	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:40172717T>C	uc003thl.3	-	2	573	c.481A>G	c.(481-483)AGC>GGC	p.S161G	C7orf10_uc003thm.1_5'Flank|C7orf10_uc003thn.1_5'Flank|C7orf10_uc003tho.1_5'Flank	NM_138701	NP_619646	Q8TAP9	TTDN1_HUMAN	chromosome 7 open reading frame 11	161					cell division|mitosis	microtubule organizing center|nucleus				breast(1)	1						TATTGTTGGCTTATATCCACT	0.363											Direct_reversal_of_damage|Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents					0.171756	116.308667	142.986295	45	217	KEEP	---	---	---	---	27	20	129	106	-1	capture	Missense_Mutation	SNP	40172717	40172717	C7orf11	7	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	2354	220
ADCY1	107	broad.mit.edu	37	7	45717835	45717835	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45717835G>A	uc003tne.3	+	10	1889	c.1871G>A	c.(1870-1872)GGC>GAC	p.G624D		NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	624	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GCCTTATTTGGCCTTGTCTAC	0.493																0.168168	102.080185	136.826188	56	277	KEEP	---	---	---	---	35	31	166	163	-1	capture	Missense_Mutation	SNP	45717835	45717835	ADCY1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	292	220
SUN3	256979	broad.mit.edu	37	7	48056901	48056901	+	Silent	SNP	A	G	G			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48056901A>G	uc003tof.2	-	4	343	c.246T>C	c.(244-246)TAT>TAC	p.Y82Y	SUN3_uc003tog.2_Silent_p.Y82Y|SUN3_uc011kcf.1_Silent_p.Y70Y	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 1	82						integral to membrane				central_nervous_system(1)	1						CAATTATGGCATATAATTGTC	0.299																0.188679	45.541484	55.152077	20	86	KEEP	---	---	---	---	11	12	52	53	-1	capture	Silent	SNP	48056901	48056901	SUN3	7	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	15281	220
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.182171	85.86666	110.357422	47	211	KEEP	---	---	---	---	23	30	114	119	0.433962264151	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	220
TRPM3	80036	broad.mit.edu	37	9	73213424	73213424	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:73213424C>T	uc004aid.2	-	20	3167	c.2923G>A	c.(2923-2925)GTG>ATG	p.V975M	TRPM3_uc004ahu.2_Missense_Mutation_p.V805M|TRPM3_uc004ahv.2_Missense_Mutation_p.V777M|TRPM3_uc004ahw.2_Missense_Mutation_p.V847M|TRPM3_uc004ahx.2_Missense_Mutation_p.V834M|TRPM3_uc004ahy.2_Missense_Mutation_p.V837M|TRPM3_uc004ahz.2_Missense_Mutation_p.V824M|TRPM3_uc004aia.2_Missense_Mutation_p.V822M|TRPM3_uc004aib.2_Missense_Mutation_p.V812M|TRPM3_uc004aic.2_Missense_Mutation_p.V975M	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	1000	Helical; (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						ATGATGTTCACGCAGTAGATG	0.483																0.227106	143.258429	161.88662	62	211	KEEP	---	---	---	---	41	25	115	105	-1	capture	Missense_Mutation	SNP	73213424	73213424	TRPM3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16470	220
ERP44	23071	broad.mit.edu	37	9	102784454	102784454	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:102784454C>T	uc004bam.2	-	5	549	c.341G>A	c.(340-342)CGT>CAT	p.R114H	ERP44_uc010msy.2_RNA|ERP44_uc010msz.2_Missense_Mutation_p.R114H	NM_015051	NP_055866	Q9BS26	ERP44_HUMAN	thioredoxin domain containing 4 (endoplasmic	114	Thioredoxin.				cell redox homeostasis|glycoprotein metabolic process|protein folding|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|ER-Golgi intermediate compartment	protein binding|protein disulfide isomerase activity				0						CATCCCATTACGAAACAATTT	0.393																0.198347	107.663066	128.160399	48	194	KEEP	---	---	---	---	20	31	125	90	-1	capture	Missense_Mutation	SNP	102784454	102784454	ERP44	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5198	220
ASMT	438	broad.mit.edu	37	X	1746630	1746630	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1746630G>A	uc004cqd.2	+	5	554	c.409G>A	c.(409-411)GTT>ATT	p.V137I	ASMT_uc010ncy.2_Missense_Mutation_p.V137I|ASMT_uc004cqe.2_Missense_Mutation_p.V137I	NM_004043	NP_004034	P46597	HIOM_HUMAN	acetylserotonin O-methyltransferase	137					melatonin biosynthetic process|translation	cytosol	acetylserotonin O-methyltransferase activity|S-methyltransferase activity			skin(1)	1		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GACGTTTGGCGTTCCCGCTGA	0.338																0.209821	220.832287	255.719411	94	354	KEEP	---	---	---	---	57	57	198	233	-1	capture	Missense_Mutation	SNP	1746630	1746630	ASMT	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1036	220
NR0B1	190	broad.mit.edu	37	X	30327199	30327199	+	Silent	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30327199C>T	uc004dcf.3	-	1	297	c.282G>A	c.(280-282)CCG>CCA	p.P94P		NM_000475	NP_000466	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	94	4 X 67 AA tandem repeats.|2.				adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)	CGGGCGCCTTCGGTGCCGCGT	0.687																0.333333	47.060269	48.313776	17	34	KEEP	---	---	---	---	14	8	24	15	-1	capture	Silent	SNP	30327199	30327199	NR0B1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	10520	220
KIAA2022	340533	broad.mit.edu	37	X	73962950	73962950	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:73962950C>T	uc004eby.2	-	3	2059	c.1442G>A	c.(1441-1443)CGA>CAA	p.R481Q		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	481					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						TCTCTTGGCTCGCAGCCCATA	0.453					126											0.3	32.083467	33.513541	12	28	KEEP	---	---	---	---	4	10	13	15	-1	capture	Missense_Mutation	SNP	73962950	73962950	KIAA2022	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8191	220
DNAJC11	55735	broad.mit.edu	37	1	6727803	6727804	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6727803_6727804delTC	uc001aof.2	-	4	449_450	c.343_344delGA	c.(343-345)GAAfs	p.E115fs	DNAJC11_uc010nzt.1_Frame_Shift_Del_p.E77fs|DNAJC11_uc001aog.2_Frame_Shift_Del_p.E115fs|DNAJC11_uc010nzu.1_Frame_Shift_Del_p.E25fs	NM_018198	NP_060668	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	115					protein folding		heat shock protein binding|unfolded protein binding			ovary(1)|skin(1)	2	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		TCTCCTCTCTTCTCTCTCTCTC	0.505																0.06			8	131		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	6727803	6727804	DNAJC11	1	TC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	4586	220
FBXL12	54850	broad.mit.edu	37	19	9929295	9929296	+	Splice_Site	INS	-	G	G			TCGA-28-5213-01	TCGA-28-5213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9929295_9929296insG	uc002mme.2	-	2	329	c.87_splice	c.e2-1	p.R29_splice	FBXL12_uc002mmd.2_5'UTR|FBXL12_uc002mmf.2_Splice_Site|FBXL12_uc002mmg.2_Splice_Site|FBXL12_uc002mmh.2_Splice_Site	NM_017703	NP_060173	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12								protein binding			lung(1)|kidney(1)	2						TGACAGACCCTGGGGGAGGGGA	0.723																0.40			4	6		---	---	---	---						capture_indel	Splice_Site	INS	9929295	9929296	FBXL12	19	-	G	G	G	1	0	1	1	0	0	0	1	0	715	55	5	5	5654	220
