Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GABRD	2563	broad.mit.edu	37	1	1957086	1957086	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1957086G>A	uc001aip.2	+	4	474	c.379G>A	c.(379-381)GTG>ATG	p.V127M		NM_000815	NP_000806	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	127	Extracellular (Probable).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		CACCTTCATCGTGAACGCCAA	0.637																0.299401	129.485553	135.490732	50	117	KEEP	---	---	---	---	28	32	55	75	-1	capture	Missense_Mutation	SNP	1957086	1957086	GABRD	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6111	225
RERE	473	broad.mit.edu	37	1	8419978	8419978	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:8419978G>A	uc001ape.2	-	20	4274	c.3464C>T	c.(3463-3465)GCC>GTC	p.A1155V	RERE_uc001apf.2_Missense_Mutation_p.A1155V|RERE_uc001apd.2_Missense_Mutation_p.A601V	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	1155					multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CTTGGACCCGGCCAGAGGCAT	0.562																0.028571	-27.120181	7.130869	4	136	KEEP	---	---	---	---	2	3	85	80	-1	capture	Missense_Mutation	SNP	8419978	8419978	RERE	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	13126	225
RERE	473	broad.mit.edu	37	1	8684379	8684379	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:8684379T>G	uc001ape.2	-	4	1196	c.386A>C	c.(385-387)GAC>GCC	p.D129A	RERE_uc001apf.2_Missense_Mutation_p.D129A|RERE_uc001aph.1_Missense_Mutation_p.D129A	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	129	BAH.				multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CAGTTTGAAGTCTTGAATGCT	0.383																0.368421	294.550944	298.016774	84	144	KEEP	---	---	---	---	49	56	87	95	-1	capture	Missense_Mutation	SNP	8684379	8684379	RERE	1	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	13126	225
KPNA6	23633	broad.mit.edu	37	1	32622514	32622514	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32622514C>A	uc001bug.2	+	3	287	c.199C>A	c.(199-201)CTC>ATC	p.L67I	KPNA6_uc001buh.2_5'UTR|KPNA6_uc010ogx.1_Missense_Mutation_p.L64I|KPNA6_uc010ogy.1_Missense_Mutation_p.L72I|KPNA6_uc009vtz.2_Missense_Mutation_p.L6I	NM_012316	NP_036448	O60684	IMA7_HUMAN	karyopherin alpha 6	67					NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CGATAGTCTTCTCATGGACTC	0.468																0.02649	-31.144803	6.303833	4	147	KEEP	---	---	---	---	3	1	100	74	0.25	capture	Missense_Mutation	SNP	32622514	32622514	KPNA6	1	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	8354	225
HPCA	3208	broad.mit.edu	37	1	33354728	33354728	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:33354728G>A	uc001bwh.2	+	2	269	c.229G>A	c.(229-231)GAT>AAT	p.D77N		NM_002143	NP_002134	P84074	HPCA_HUMAN	hippocalcin	77	EF-hand 2.|1 (Potential).						actin binding|calcium ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				CACCAACAGCGATGGCACCAT	0.547																0.030534	-49.127404	14.195394	8	254	KEEP	---	---	---	---	2	6	145	147	-1	capture	Missense_Mutation	SNP	33354728	33354728	HPCA	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7254	225
NAV1	89796	broad.mit.edu	37	1	201782286	201782286	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201782286C>T	uc001gwu.2	+	27	5578	c.5231C>T	c.(5230-5232)TCG>TTG	p.S1744L	NAV1_uc001gwx.2_Missense_Mutation_p.S1353L	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1747					cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						TTCTTTCTGTCGTGTCCCATT	0.507																0.393333	172.187271	173.682957	59	91	KEEP	---	---	---	---	34	36	51	52	-1	capture	Missense_Mutation	SNP	201782286	201782286	NAV1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10090	225
RYR2	6262	broad.mit.edu	37	1	237936883	237936883	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237936883C>T	uc001hyl.1	+	87	11830	c.11710C>T	c.(11710-11712)CGG>TGG	p.R3904W	RYR2_uc010pya.1_Missense_Mutation_p.R319W	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3904					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACAAGGACAACGGAATTTCTC	0.338																0.293478	72.987581	76.500577	27	65	KEEP	---	---	---	---	9	19	32	36	-1	capture	Missense_Mutation	SNP	237936883	237936883	RYR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	13661	225
C10orf2	56652	broad.mit.edu	37	10	102748161	102748161	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:102748161G>A	uc001ksf.2	+	1	869	c.194G>A	c.(193-195)CGG>CAG	p.R65Q	MRPL43_uc001kry.1_5'Flank|MRPL43_uc010qpu.1_5'Flank|MRPL43_uc001krz.1_5'Flank|MRPL43_uc001ksa.1_5'Flank|MRPL43_uc001ksb.1_5'Flank|MRPL43_uc001ksd.1_5'Flank|MRPL43_uc001ksc.2_5'Flank|MRPL43_uc001kse.2_5'Flank|C10orf2_uc001ksg.2_Missense_Mutation_p.R65Q|C10orf2_uc001ksi.2_Intron|C10orf2_uc010qpv.1_Intron|C10orf2_uc001ksh.2_Intron	NM_021830	NP_068602	Q96RR1	PEO1_HUMAN	twinkle isoform A	65					cell death|mitochondrial DNA replication|protein hexamerization|protein homooligomerization|transcription from mitochondrial promoter	mitochondrial nucleoid	5'-3' DNA helicase activity|ATP binding|protease binding|single-stranded DNA binding			ovary(1)	1		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CAGTATTTGCGGGGGCATGGG	0.572																0.594737	378.946702	380.453676	113	77	KEEP	---	---	---	---	63	61	40	44	-1	capture	Missense_Mutation	SNP	102748161	102748161	C10orf2	10	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1585	225
OR5L2	26338	broad.mit.edu	37	11	55594981	55594981	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55594981G>T	uc001nhy.1	+	1	287	c.287G>T	c.(286-288)GGG>GTG	p.G96V		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	96	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				TCCTTCCTAGGGTGCATGGTG	0.473													HNSCC(27;0.073)			0.390052	422.766604	426.818516	149	233	KEEP	---	---	---	---	69	84	127	133	0.450980392157	capture	Missense_Mutation	SNP	55594981	55594981	OR5L2	11	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	11075	225
MED17	9440	broad.mit.edu	37	11	93543034	93543034	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:93543034C>A	uc001pem.3	+	11	2011	c.1736C>A	c.(1735-1737)GCT>GAT	p.A579D		NM_004268	NP_004259	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	579					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GGTGACTATGCTATTTCAGGT	0.408																0.054167	-25.226649	25.077888	13	227	KEEP	---	---	---	---	7	6	143	123	0.461538461538	capture	Missense_Mutation	SNP	93543034	93543034	MED17	11	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	9348	225
KRT18	3875	broad.mit.edu	37	12	53345364	53345364	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53345364C>T	uc001sbe.2	+	5	826	c.757C>T	c.(757-759)CGG>TGG	p.R253W	KRT18_uc009zmn.1_Missense_Mutation_p.R253W|KRT18_uc001sbf.1_Missense_Mutation_p.R80W|KRT18_uc001sbg.2_Missense_Mutation_p.R253W|KRT18_uc009zmo.2_Missense_Mutation_p.R253W|KRT8_uc009zml.1_5'Flank|KRT8_uc009zmm.1_5'Flank	NM_199187	NP_954657	P05783	K1C18_HUMAN	keratin 18	253	Interaction with DNAJB6.|Coil 2.|Rod.|Necessary for interaction with PNN.				anatomical structure morphogenesis|cell cycle|Golgi to plasma membrane CFTR protein transport|interspecies interaction between organisms|negative regulation of apoptosis	centriolar satellite|keratin filament|perinuclear region of cytoplasm	protein binding|structural molecule activity			skin(1)	1						GGCAGACATCCGGGCCCAATA	0.582																0.325581	77.573936	79.893404	28	58	KEEP	---	---	---	---	18	11	27	33	-1	capture	Missense_Mutation	SNP	53345364	53345364	KRT18	12	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	8375	225
C12orf12	196477	broad.mit.edu	37	12	91347528	91347528	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:91347528C>G	uc001tbj.2	-	1	1426	c.992G>C	c.(991-993)GGA>GCA	p.G331A		NM_152638	NP_689851	Q8TC90	CL012_HUMAN	hypothetical protein LOC196477	331	Potential.|Glu-rich.									central_nervous_system(1)|pancreas(1)	2						ctcctcctctccctcctccac	0.184																0.42268	146.662557	147.167859	41	56	KEEP	---	---	---	---	19	24	30	30	-1	capture	Missense_Mutation	SNP	91347528	91347528	C12orf12	12	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	1662	225
FOXN4	121643	broad.mit.edu	37	12	109719317	109719317	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109719317G>T	uc001toe.3	-	9	1294	c.1189C>A	c.(1189-1191)CAC>AAC	p.H397N	FOXN4_uc009zvg.2_Missense_Mutation_p.H194N|FOXN4_uc001tof.3_Missense_Mutation_p.H217N	NM_213596	NP_998761	Q96NZ1	FOXN4_HUMAN	forkhead box N4	397					axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)	2						ATGGCGGGGTGGGGGAGCGGG	0.647																0.32	65.871197	68.031463	24	51	KEEP	---	---	---	---	14	12	25	27	0.538461538462	capture	Missense_Mutation	SNP	109719317	109719317	FOXN4	12	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	5966	225
HVCN1	84329	broad.mit.edu	37	12	111099035	111099035	+	Silent	SNP	G	A	A	rs138491014		TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111099035G>A	uc001trs.1	-	4	405	c.240C>T	c.(238-240)CCC>CCT	p.P80P	HVCN1_uc001trq.1_Silent_p.P80P|HVCN1_uc001trt.1_Silent_p.P80P|HVCN1_uc010syd.1_Silent_p.P60P	NM_032369	NP_115745	Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	80	Cytoplasmic (Potential).				response to pH|response to zinc ion	integral to membrane	voltage-gated proton channel activity			skin(1)	1						CCCTGGGTGCGGGGCCAGGGG	0.567																0.365217	122.824426	124.659627	42	73	KEEP	---	---	---	---	28	27	52	40	-1	capture	Silent	SNP	111099035	111099035	HVCN1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7387	225
KNTC1	9735	broad.mit.edu	37	12	123097664	123097664	+	Silent	SNP	A	G	G			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123097664A>G	uc001ucv.2	+	54	5791	c.5628A>G	c.(5626-5628)TTA>TTG	p.L1876L	KNTC1_uc010taf.1_Silent_p.L801L	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	1876					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TTCAGACATTAGGTATGCATC	0.373																0.015	-46.252921	7.168771	3	197	KEEP	---	---	---	---	0	4	117	98	-1	capture	Silent	SNP	123097664	123097664	KNTC1	12	A	G	G	G	1	0	0	0	0	0	0	0	1	193	15	3	3	8348	225
C13orf27	93081	broad.mit.edu	37	13	103418858	103418858	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:103418858A>G	uc001vpo.2	-	6	755	c.577T>C	c.(577-579)TCC>CCC	p.S193P	C13orf27_uc001vpn.2_Missense_Mutation_p.S152P|C13orf27_uc001vpp.2_Missense_Mutation_p.S152P	NM_138779	NP_620134	Q5JUR7	CM027_HUMAN	hypothetical protein LOC93081	193											0	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					ACTGCCATGGAATGATTTGCC	0.368																0.62766	225.550448	226.896643	59	35	KEEP	---	---	---	---	33	33	21	15	-1	capture	Missense_Mutation	SNP	103418858	103418858	C13orf27	13	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	1709	225
GTF3C1	2975	broad.mit.edu	37	16	27499713	27499713	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27499713C>G	uc002dov.1	-	23	3575	c.3535G>C	c.(3535-3537)GGG>CGG	p.G1179R	GTF3C1_uc002dou.2_Missense_Mutation_p.G1179R	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	1179						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						CTTGCTTCCCCCCAAATATTC	0.552																0.290657	259.977646	271.32791	84	205	KEEP	---	---	---	---	50	45	104	131	-1	capture	Missense_Mutation	SNP	27499713	27499713	GTF3C1	16	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	6801	225
RPAIN	84268	broad.mit.edu	37	17	5329307	5329307	+	Missense_Mutation	SNP	C	A	A	rs142664022	byFrequency	TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5329307C>A	uc002gbq.2	+	4	900	c.330C>A	c.(328-330)AGC>AGA	p.S110R	RPAIN_uc010vsz.1_Missense_Mutation_p.S110R|RPAIN_uc002gbp.1_Intron|RPAIN_uc010vta.1_Intron|RPAIN_uc010vtb.1_Missense_Mutation_p.S110R|RPAIN_uc002gbs.2_Intron|RPAIN_uc002gbt.2_Missense_Mutation_p.S110R|RPAIN_uc002gbu.2_Intron|RPAIN_uc002gbv.2_Intron|RPAIN_uc002gbr.2_RNA|RPAIN_uc002gbw.2_Intron|RPAIN_uc002gbx.1_5'Flank	NM_001033002	NP_001028174	Q86UA6	RIP_HUMAN	RPA interacting protein isoform b	110					DNA recombination|DNA repair|DNA-dependent DNA replication|protein import into nucleus|response to UV	cytoplasm|cytoplasm|nucleolus|PML body|PML body	metal ion binding|protein complex binding				0						CCATCATCAGCGAGTATGAGA	0.478																0.09375	1.498653	6.809384	3	29	KEEP	---	---	---	---	3	1	17	14	0.25	capture	Missense_Mutation	SNP	5329307	5329307	RPAIN	17	C	A	A	A	1	0	0	0	0	1	0	0	0	350	27	4	4	13432	225
TP53	7157	broad.mit.edu	37	17	7579699	7579699	+	Splice_Site	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7579699C>T	uc002gim.2	-	3	290	c.96_splice	c.e3+1	p.L32_splice	TP53_uc002gig.1_Splice_Site_p.L32_splice|TP53_uc002gih.2_Splice_Site_p.L32_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Splice_Site_p.L32_splice|TP53_uc010cni.1_Splice_Site_p.L32_splice|TP53_uc002gij.2_Splice_Site_p.L32_splice|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Splice_Site_p.L32_splice|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Splice_Site|TP53_uc010cnk.1_Splice_Site_p.L47_splice	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.?(2)|p.S33fs*10(1)|p.P13fs*18(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CTTGTCCTTACCAGAACGTTG	0.383	Pancreas(47;798 1329 9957 10801)		111		690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.681319	203.477421	206.135204	62	29	KEEP	---	---	---	---	34	33	17	14	-1	capture	Splice_Site	SNP	7579699	7579699	TP53	17	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	16264	225
MBD3	53615	broad.mit.edu	37	19	1578435	1578435	+	Silent	SNP	C	T	T	rs150880184		TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1578435C>T	uc002ltl.1	-	6	802	c.780G>A	c.(778-780)GCG>GCA	p.A260A	uc002lti.1_5'Flank|MBD3_uc002ltj.2_Silent_p.A260A|MBD3_uc002ltk.2_Silent_p.A228A	NM_003926	NP_003917	O95983	MBD3_HUMAN	methyl-CpG binding domain protein 3	260					transcription, DNA-dependent	NuRD complex	DNA binding|protein binding			ovary(1)|pancreas(1)|skin(1)	3		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.179)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTCCAGCGGCGCCTCCCCGT	0.557																0.383838	100.618379	101.79208	38	61	KEEP	---	---	---	---	15	25	26	36	-1	capture	Silent	SNP	1578435	1578435	MBD3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9257	225
NOTCH3	4854	broad.mit.edu	37	19	15280951	15280951	+	Silent	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15280951C>T	uc002nan.2	-	28	5221	c.5145G>A	c.(5143-5145)GGG>GGA	p.G1715G		NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor	1715	Cytoplasmic (Potential).				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			TGGCCACCTCCCCCATCAGGC	0.627					417											0.291667	19.51527	20.448275	7	17	KEEP	---	---	---	---	5	5	11	11	-1	capture	Silent	SNP	15280951	15280951	NOTCH3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	10457	225
FKBP8	23770	broad.mit.edu	37	19	18648452	18648452	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18648452G>A	uc002njk.1	-	6	1014	c.901C>T	c.(901-903)CAC>TAC	p.H301Y	FKBP8_uc002nji.1_Missense_Mutation_p.H139Y|FKBP8_uc010xqi.1_Missense_Mutation_p.H330Y|FKBP8_uc002njj.1_Missense_Mutation_p.H302Y|FKBP8_uc002njl.1_Missense_Mutation_p.H302Y|FKBP8_uc002njm.1_Missense_Mutation_p.H301Y|FKBP8_uc010ebr.1_Missense_Mutation_p.H140Y|FKBP8_uc002njn.2_RNA	NM_012181	NP_036313	Q14318	FKBP8_HUMAN	FK506-binding protein 8	301	TPR 2.				apoptosis|interspecies interaction between organisms|intracellular signal transduction|protein folding	integral to endoplasmic reticulum membrane|mitochondrial membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity|protein binding			ovary(1)	1						TCTGGCTGGTGCTCCAGCACA	0.642																0.421687	92.036428	92.472824	35	48	KEEP	---	---	---	---	21	18	27	26	-1	capture	Missense_Mutation	SNP	18648452	18648452	FKBP8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	5859	225
NFKBIB	4793	broad.mit.edu	37	19	39398200	39398200	+	Silent	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39398200C>T	uc002ojw.2	+	5	928	c.870C>T	c.(868-870)GCC>GCT	p.A290A	NFKBIB_uc002ojx.2_Silent_p.A258A|NFKBIB_uc002ojy.2_Silent_p.A290A	NM_002503	NP_002494	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene	290	ANK 6.				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleus	protein binding|signal transducer activity|transcription coactivator activity			lung(1)|kidney(1)	2	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CCATCCTCGCCCGCCTCCTCC	0.706	Pancreas(165;1492 2005 6979 7739 34483)															0.311688	64.554835	66.996363	24	53	KEEP	---	---	---	---	11	17	28	30	-1	capture	Silent	SNP	39398200	39398200	NFKBIB	19	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	10285	225
AXL	558	broad.mit.edu	37	19	41744401	41744401	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41744401A>G	uc010ehj.2	+	8	1211	c.1021A>G	c.(1021-1023)AGT>GGT	p.S341G	CYP2F1_uc010xvw.1_Intron|AXL_uc010ehi.1_Missense_Mutation_p.S341G|AXL_uc010ehk.2_Missense_Mutation_p.S341G	NM_021913	NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase isoform 1	341	Extracellular (Potential).|Fibronectin type-III 2.					integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						TGAGAACATTAGTGCTACGCG	0.657					318											0.029126	-17.366566	7.741919	3	100	KEEP	---	---	---	---	3	1	54	65	-1	capture	Missense_Mutation	SNP	41744401	41744401	AXL	19	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	1228	225
RRM2	6241	broad.mit.edu	37	2	10264898	10264898	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:10264898T>C	uc002rah.2	+	5	681	c.490T>C	c.(490-492)TTC>CTC	p.F164L		NM_001034	NP_001025	P31350	RIR2_HUMAN	ribonucleotide reductase M2 polypeptide isoform	164					deoxyribonucleoside diphosphate metabolic process|deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol	ribonucleoside-diphosphate reductase activity|transition metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)		TTTCTATGGCTTCCAAATTGC	0.383					178											0.017964	-36.832658	6.905897	3	164	KEEP	---	---	---	---	0	3	89	89	-1	capture	Missense_Mutation	SNP	10264898	10264898	RRM2	2	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	13574	225
POLR1A	25885	broad.mit.edu	37	2	86272410	86272410	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:86272410T>C	uc002sqs.2	-	21	3339	c.2960A>G	c.(2959-2961)TAT>TGT	p.Y987C	POLR1A_uc010ytb.1_Missense_Mutation_p.Y353C|POLR1A_uc002sqt.1_5'Flank	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	987					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						CCTTTGGAGATAGCCTGAGCG	0.522																0.066667	-1.36951	13.213595	5	70	KEEP	---	---	---	---	8	2	57	58	-1	capture	Missense_Mutation	SNP	86272410	86272410	POLR1A	2	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	12112	225
TTN	7273	broad.mit.edu	37	2	179438951	179438951	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179438951G>A	uc010zfg.1	-	275	64428	c.64204C>T	c.(64204-64206)CGG>TGG	p.R21402W	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R15097W|TTN_uc010zfi.1_Missense_Mutation_p.R15030W|TTN_uc010zfj.1_Missense_Mutation_p.R14905W	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22329							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.R21402C(1)		ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCAGCCACCGTCCATTAGGA	0.413					8722											0.215686	48.492657	56.103312	22	80	KEEP	---	---	---	---	16	16	50	41	-1	capture	Missense_Mutation	SNP	179438951	179438951	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	16617	225
TTN	7273	broad.mit.edu	37	2	179466465	179466465	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179466465C>A	uc010zfg.1	-	235	47872	c.47648G>T	c.(47647-47649)CGA>CTA	p.R15883L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R9578L|TTN_uc010zfi.1_Missense_Mutation_p.R9511L|TTN_uc010zfj.1_Missense_Mutation_p.R9386L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16810							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTATGAGATCGTTTACACTC	0.363					8722											0.319149	171.837651	177.299837	60	128	KEEP	---	---	---	---	31	32	62	76	0.507936507937	capture	Missense_Mutation	SNP	179466465	179466465	TTN	2	C	A	A	A	1	0	0	0	0	1	0	0	0	403	31	4	4	16617	225
DNAH7	56171	broad.mit.edu	37	2	196825609	196825609	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:196825609G>A	uc002utj.3	-	18	2367	c.2266C>T	c.(2266-2268)CGT>TGT	p.R756C		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	756	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						ATTTTTTTACGTTGAGGATAT	0.368																0.334842	201.984078	207.317447	74	147	KEEP	---	---	---	---	45	34	76	79	-1	capture	Missense_Mutation	SNP	196825609	196825609	DNAH7	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4562	225
C20orf85	128602	broad.mit.edu	37	20	56728664	56728664	+	Missense_Mutation	SNP	A	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:56728664A>T	uc002xyv.2	+	2	171	c.133A>T	c.(133-135)ACA>TCA	p.T45S		NM_178456	NP_848551	Q9H1P6	CT085_HUMAN	hypothetical protein LOC128602	45										ovary(1)	1	all_epithelial(3;5.99e-14)|Lung NSC(12;0.000152)|all_lung(29;0.000518)|Melanoma(10;0.118)		BRCA - Breast invasive adenocarcinoma(13;5.53e-12)|Epithelial(14;7.42e-08)|all cancers(14;7.19e-07)			GGGGTTTTTAACAACCCCTTT	0.433																0.336879	275.144235	281.778434	95	187	KEEP	---	---	---	---	50	50	97	104	-1	capture	Missense_Mutation	SNP	56728664	56728664	C20orf85	20	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	2101	225
TMPRSS15	5651	broad.mit.edu	37	21	19713765	19713765	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:19713765G>C	uc002ykw.2	-	13	1560	c.1529C>G	c.(1528-1530)CCA>CGA	p.P510R		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	510	Extracellular (Potential).				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						CACCAAAGTTGGTTCTGGATA	0.328																0.66242	382.956078	386.623892	104	53	KEEP	---	---	---	---	41	72	32	27	-1	capture	Missense_Mutation	SNP	19713765	19713765	TMPRSS15	21	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	16129	225
RIPK4	54101	broad.mit.edu	37	21	43161460	43161460	+	Silent	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43161460G>A	uc002yzn.1	-	8	1941	c.1893C>T	c.(1891-1893)AAC>AAT	p.N631N		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	631						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						GGCTGCAGACGTTGACGTCGG	0.697					268											0.723881	302.699696	308.737355	97	37	KEEP	---	---	---	---	49	60	18	30	-1	capture	Silent	SNP	43161460	43161460	RIPK4	21	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13275	225
PRAME	23532	broad.mit.edu	37	22	22892481	22892481	+	Missense_Mutation	SNP	C	T	T	rs116965324	by1000genomes	TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22892481C>T	uc002zwf.2	-	4	776	c.620G>A	c.(619-621)CGC>CAC	p.R207H	LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Missense_Mutation_p.R191H|PRAME_uc010gtr.2_Missense_Mutation_p.R207H|PRAME_uc002zwg.2_Missense_Mutation_p.R207H|PRAME_uc002zwh.2_Missense_Mutation_p.R207H|PRAME_uc002zwi.2_Missense_Mutation_p.R207H|PRAME_uc002zwj.2_Missense_Mutation_p.R207H|PRAME_uc002zwk.2_Missense_Mutation_p.R207H	NM_206956	NP_996839	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	207					apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding			central_nervous_system(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		ACAGCACAGGCGTAGTACATT	0.443	Melanoma(73;1707 1838 15168 27201)				1184											0.347222	197.544772	202.001785	75	141	KEEP	---	---	---	---	40	43	76	77	-1	capture	Missense_Mutation	SNP	22892481	22892481	PRAME	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12325	225
DEPDC5	9681	broad.mit.edu	37	22	32239092	32239092	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32239092C>T	uc003als.2	+	28	2642	c.2500C>T	c.(2500-2502)CGA>TGA	p.R834*	DEPDC5_uc011als.1_Nonsense_Mutation_p.R765*|DEPDC5_uc011alu.1_Nonsense_Mutation_p.R843*|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Nonsense_Mutation_p.R834*|DEPDC5_uc003alu.2_Nonsense_Mutation_p.R283*|DEPDC5_uc003alv.2_RNA|DEPDC5_uc011alw.1_Nonsense_Mutation_p.R164*|DEPDC5_uc003alw.2_Nonsense_Mutation_p.R132*|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_5'Flank	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	834					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						CCTTGTGTCCCGAAACCGCCC	0.433																0.074074	0.370938	10.418617	4	50	KEEP	---	---	---	---	2	2	32	21	-1	capture	Nonsense_Mutation	SNP	32239092	32239092	DEPDC5	22	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	4400	225
SUSD5	26032	broad.mit.edu	37	3	33194586	33194586	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:33194586G>A	uc003cfo.1	-	5	1956	c.1538C>T	c.(1537-1539)ACG>ATG	p.T513M		NM_015551	NP_056366	O60279	SUSD5_HUMAN	sushi domain containing 5 precursor	513	Extracellular (Potential).				cell adhesion	integral to membrane	hyaluronic acid binding			ovary(1)|central_nervous_system(1)	2						TGCCATGATCGTTGAGGGGAT	0.522																0.508197	92.326322	92.33	31	30	KEEP	---	---	---	---	20	13	23	11	-1	capture	Missense_Mutation	SNP	33194586	33194586	SUSD5	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15299	225
STAB1	23166	broad.mit.edu	37	3	52551109	52551109	+	Silent	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52551109C>T	uc003dej.2	+	42	4547	c.4473C>T	c.(4471-4473)GAC>GAT	p.D1491D	STAB1_uc003dek.1_5'Flank	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	1491	Extracellular (Potential).|EGF-like 11.				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		ACATGGGCGACGGGGAGCTGT	0.622																0.451923	138.511431	138.720719	47	57	KEEP	---	---	---	---	27	25	41	24	-1	capture	Silent	SNP	52551109	52551109	STAB1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15127	225
TMEM14E	645843	broad.mit.edu	37	3	152058532	152058532	+	Silent	SNP	A	G	G			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:152058532A>G	uc010hvo.2	-	1	248	c.162T>C	c.(160-162)TCT>TCC	p.S54S	MBNL1_uc003ezh.2_Intron|MBNL1_uc003ezi.2_Intron|MBNL1_uc003ezj.2_Intron|MBNL1_uc003ezm.2_Intron|MBNL1_uc003ezl.2_Intron|MBNL1_uc003ezp.2_Intron|MBNL1_uc003ezn.2_Intron|MBNL1_uc003ezo.2_Intron	NM_001123228	NP_001116700	Q6UXP3	TM14E_HUMAN	transmembrane protein 14E	54						integral to membrane					0						GTGATGGCTGAGAAGCATCCA	0.453																0.267857	93.202333	98.649684	30	82	KEEP	---	---	---	---	17	14	47	41	-1	capture	Silent	SNP	152058532	152058532	TMEM14E	3	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	15950	225
PDE6B	5158	broad.mit.edu	37	4	619881	619881	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:619881G>A	uc003gap.2	+	1	519	c.466G>A	c.(466-468)GAG>AAG	p.E156K	PDE6B_uc003gao.3_Missense_Mutation_p.E156K	NM_000283	NP_000274	P35913	PDE6B_HUMAN	phosphodiesterase 6B isoform 1	156	GAF 1.				cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding				0						GGACGTGGCCGAGGTGGGTCT	0.642	GBM(71;463 1194 9848 25922 46834)															0.444444	12.398741	12.422968	4	5	KEEP	---	---	---	---	2	2	4	1	-1	capture	Missense_Mutation	SNP	619881	619881	PDE6B	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11549	225
HS3ST1	9957	broad.mit.edu	37	4	11401266	11401266	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:11401266C>T	uc003gmq.2	-	2	687	c.364G>A	c.(364-366)GCG>ACG	p.A122T		NM_005114	NP_005105	O14792	HS3S1_HUMAN	heparan sulfate D-glucosaminyl	122						Golgi lumen|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			skin(1)	1						GTGAAATACGCGGGGGTCTTC	0.612																0.188811	52.384104	65.312279	27	116	KEEP	---	---	---	---	17	11	67	58	-1	capture	Missense_Mutation	SNP	11401266	11401266	HS3ST1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7288	225
UGT2A1	10941	broad.mit.edu	37	4	70455276	70455276	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70455276C>T	uc003hem.3	-	6	1461	c.1398G>A	c.(1396-1398)ATG>ATA	p.M466I	UGT2A1_uc011caq.1_Missense_Mutation_p.M632I|UGT2A1_uc010ihu.2_Missense_Mutation_p.M466I|UGT2A1_uc010iht.2_Missense_Mutation_p.M422I|UGT2A1_uc010ihs.2_Missense_Mutation_p.M467I	NM_006798	NP_006789	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family,	466	Extracellular (Potential).				detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1						CTTTGTGGCGCATGACAAACT	0.478																0.25	151.874237	167.118583	67	201	KEEP	---	---	---	---	31	42	120	98	-1	capture	Missense_Mutation	SNP	70455276	70455276	UGT2A1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	16835	225
ODAM	54959	broad.mit.edu	37	4	71062419	71062419	+	Missense_Mutation	SNP	A	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71062419A>T	uc003hfc.2	+	2	79	c.62A>T	c.(61-63)CAG>CTG	p.Q21L		NM_017855	NP_060325	A1E959	ODAM_HUMAN	odontogenic ameloblast-associated protein	21					biomineral tissue development|odontogenesis of dentine-containing tooth	fibril				ovary(3)|large_intestine(1)	4						CTTATCCCACAGCGTCTCATG	0.333																0.302326	76.917122	79.917206	26	60	KEEP	---	---	---	---	15	18	32	34	-1	capture	Missense_Mutation	SNP	71062419	71062419	ODAM	4	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	10729	225
MAST4	375449	broad.mit.edu	37	5	66084566	66084566	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:66084566G>A	uc003jur.3	+	3	894	c.586G>A	c.(586-588)GTG>ATG	p.V196M	MAST4_uc010iwz.2_Missense_Mutation_p.V196M	NM_198828	NP_942123	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	196						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		GTCCAACCTCGTGCGCATGCG	0.657					805											0.244898	27.676124	30.581021	12	37	KEEP	---	---	---	---	6	7	22	18	-1	capture	Missense_Mutation	SNP	66084566	66084566	MAST4	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9240	225
PCDHA1	56147	broad.mit.edu	37	5	140167892	140167892	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140167892G>A	uc003lhb.2	+	1	2017	c.2017G>A	c.(2017-2019)GGC>AGC	p.G673S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Missense_Mutation_p.G673S	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	673	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGGAGAGCGGCCAGGCGCC	0.657																0.436975	157.384829	157.796171	52	67	KEEP	---	---	---	---	28	37	43	45	-1	capture	Missense_Mutation	SNP	140167892	140167892	PCDHA1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11422	225
SLC44A4	80736	broad.mit.edu	37	6	31838592	31838592	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31838592C>T	uc010jti.2	-	10	1000	c.934G>A	c.(934-936)GCC>ACC	p.A312T	SLC44A4_uc011dol.1_Missense_Mutation_p.A236T|SLC44A4_uc011dom.1_Missense_Mutation_p.A270T	NM_025257	NP_079533	Q53GD3	CTL4_HUMAN	choline transporter-like protein 4	312	Helical; (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4					Choline(DB00122)	CACTCACGGGCGGCCAGCCAG	0.692																0.315217	65.726546	68.530176	29	63	KEEP	---	---	---	---	15	17	38	35	-1	capture	Missense_Mutation	SNP	31838592	31838592	SLC44A4	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14530	225
COL19A1	1310	broad.mit.edu	37	6	70637867	70637867	+	Silent	SNP	C	T	T	rs143252227	byFrequency	TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:70637867C>T	uc003pfc.1	+	5	450	c.333C>T	c.(331-333)AAC>AAT	p.N111N	COL19A1_uc010kam.1_Silent_p.N7N	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	111	TSP N-terminal.			FRVRRNAKKERWFL -> ETTVPFWRFFVLET (in Ref. 6; AAA36358).	cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						TACGAAGAAACGCCAAAAAGG	0.428																0.313084	178.642589	185.300259	67	147	KEEP	---	---	---	---	40	42	81	112	-1	capture	Silent	SNP	70637867	70637867	COL19A1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3641	225
AHR	196	broad.mit.edu	37	7	17378648	17378648	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:17378648C>T	uc011jxz.1	+	10	1812	c.1199C>T	c.(1198-1200)ACG>ATG	p.T400M	AHR_uc003stt.3_RNA	NM_001621	NP_001612	P35869	AHR_HUMAN	aryl hydrocarbon receptor precursor	400					apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			urinary_tract(1)|kidney(1)|pancreas(1)	3	Lung NSC(10;0.0392)|all_lung(11;0.0754)					AAACGAAATACGAAGTTGCCT	0.333																0.211268	165.315747	192.697678	75	280	KEEP	---	---	---	---	46	37	150	180	-1	capture	Missense_Mutation	SNP	17378648	17378648	AHR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	416	225
RABGEF1	27342	broad.mit.edu	37	7	66240279	66240279	+	Missense_Mutation	SNP	C	T	T	rs149995446	by1000genomes	TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:66240279C>T	uc011kee.1	+	3	451	c.287C>T	c.(286-288)ACA>ATA	p.T96I	RABGEF1_uc003tvf.2_5'UTR|RABGEF1_uc003tvg.2_5'UTR|RABGEF1_uc010lag.2_Missense_Mutation_p.T82I|RABGEF1_uc003tvh.2_Missense_Mutation_p.T82I|RABGEF1_uc003tvi.2_5'UTR	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	260					endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						CAATCCCTCACATTCTCCAAG	0.483																0.025	-41.911472	8.154829	5	195	KEEP	---	---	---	---	1	5	104	107	-1	capture	Missense_Mutation	SNP	66240279	66240279	RABGEF1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	12861	225
PCLO	27445	broad.mit.edu	37	7	82784650	82784650	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82784650G>A	uc003uhx.2	-	2	1596	c.1307C>T	c.(1306-1308)CCT>CTT	p.P436L	PCLO_uc003uhv.2_Missense_Mutation_p.P436L	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	388	Gln-rich.|Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						AGTCTTTGTAGGCCCAGGTGC	0.587																0.132898	102.142617	162.209353	61	398	KEEP	---	---	---	---	19	45	230	201	-1	capture	Missense_Mutation	SNP	82784650	82784650	PCLO	7	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	11486	225
SEMA3D	223117	broad.mit.edu	37	7	84671590	84671590	+	Silent	SNP	T	C	C			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:84671590T>C	uc003uic.2	-	8	913	c.873A>G	c.(871-873)GGA>GGG	p.G291G	SEMA3D_uc010led.2_Silent_p.G291G|SEMA3D_uc003uib.2_5'Flank	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor	291	Sema.				cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5						TGCGTTGTCCTCCTACATCAT	0.378	Ovarian(63;442 1191 17318 29975 31528)															0.202096	389.703886	444.732018	135	533	KEEP	---	---	---	---	82	94	279	400	-1	capture	Silent	SNP	84671590	84671590	SEMA3D	7	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	13920	225
AP4M1	9179	broad.mit.edu	37	7	99702962	99702962	+	Missense_Mutation	SNP	A	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99702962A>T	uc003utb.3	+	10	1035	c.827A>T	c.(826-828)CAG>CTG	p.Q276L	AP4M1_uc011kjg.1_Missense_Mutation_p.Q230L|AP4M1_uc010lgl.1_Missense_Mutation_p.Q276L|AP4M1_uc003utc.3_Missense_Mutation_p.Q283L|AP4M1_uc010lgm.2_Missense_Mutation_p.Q148L|AP4M1_uc003utd.2_Missense_Mutation_p.Q276L|AP4M1_uc011kjh.1_Missense_Mutation_p.Q228L|AP4M1_uc003ute.3_Missense_Mutation_p.Q51L|AP4M1_uc003utf.3_Missense_Mutation_p.Q148L	NM_004722	NP_004713	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	276	MHD.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|coated pit|Golgi trans cisterna	transporter activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAACCACCTCAGGGCGAGGTC	0.552	Pancreas(174;1182 2812 29595 49511)															0.042904	-42.2916	25.626212	13	290	KEEP	---	---	---	---	6	8	144	169	-1	capture	Missense_Mutation	SNP	99702962	99702962	AP4M1	7	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	746	225
RELN	5649	broad.mit.edu	37	7	103293088	103293088	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103293088A>G	uc003vca.2	-	14	1833	c.1673T>C	c.(1672-1674)TTC>TCC	p.F558S	RELN_uc010liz.2_Missense_Mutation_p.F558S	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	558					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CAAGACATGGAAAAAGTCTAC	0.448	NSCLC(146;835 1944 15585 22231 52158)															0.018868	-91.778279	18.588026	8	416	KEEP	---	---	---	---	3	5	218	238	-1	capture	Missense_Mutation	SNP	103293088	103293088	RELN	7	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	13115	225
REPIN1	29803	broad.mit.edu	37	7	150068992	150068992	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150068992C>T	uc010lpq.1	+	4	1151	c.662C>T	c.(661-663)GCG>GTG	p.A221V	REPIN1_uc003whd.2_Missense_Mutation_p.A210V|REPIN1_uc010lpr.1_Missense_Mutation_p.A278V|REPIN1_uc003whc.2_Missense_Mutation_p.A221V|REPIN1_uc003whe.2_Missense_Mutation_p.A221V	NM_013400	NP_037532	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 1	221					DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			ggccgccccgcggtgaccgcc	0.488																0.111111	3.916235	11.98957	6	48	KEEP	---	---	---	---	5	2	30	25	-1	capture	Missense_Mutation	SNP	150068992	150068992	REPIN1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13122	225
MLL3	58508	broad.mit.edu	37	7	151904459	151904459	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151904459G>C	uc003wla.2	-	24	3986	c.3767C>G	c.(3766-3768)GCT>GGT	p.A1256G	MLL3_uc003wkz.2_Missense_Mutation_p.A317G	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	1256					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ATCATCCACAGCTTCCCGCTC	0.393	Colon(68;14 1149 1884 27689 34759)				1780	N		medulloblastoma								0.168766	161.16983	202.413913	67	330	KEEP	---	---	---	---	41	39	190	175	-1	capture	Missense_Mutation	SNP	151904459	151904459	MLL3	7	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	9534	225
UBE3C	9690	broad.mit.edu	37	7	157000142	157000142	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:157000142T>C	uc010lqs.2	+	12	1781	c.1469T>C	c.(1468-1470)TTT>TCT	p.F490S	UBE3C_uc003wng.2_Missense_Mutation_p.F490S	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	490					protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		CCTATGTCTTTTGAAGATTCT	0.358																0.024096	-98.653019	26.677353	12	486	KEEP	---	---	---	---	7	5	297	276	-1	capture	Missense_Mutation	SNP	157000142	157000142	UBE3C	7	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	16763	225
SGK223	157285	broad.mit.edu	37	8	8234543	8234543	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:8234543C>T	uc003wsh.3	-	2	1376	c.1376G>A	c.(1375-1377)CGG>CAG	p.R459Q		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	459							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						TGGGCTGTCCCGGCCCCAGCC	0.622	GBM(34;731 755 10259 33573 33867)			p.R459L(YD10B-Tumor)	135											0.05303	-12.156446	15.66154	7	125	KEEP	---	---	---	---	5	2	64	67	-1	capture	Missense_Mutation	SNP	8234543	8234543	SGK223	8	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14103	225
CNTNAP3	79937	broad.mit.edu	37	9	39140559	39140559	+	Silent	SNP	T	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:39140559T>A	uc004abi.2	-	12	2072	c.1833A>T	c.(1831-1833)GGA>GGT	p.G611G	CNTNAP3_uc004abj.2_Silent_p.G611G|CNTNAP3_uc011lqr.1_RNA|CNTNAP3_uc004abk.1_Silent_p.G611G|CNTNAP3_uc011lqs.1_Silent_p.G518G|CNTNAP3_uc004abl.1_Silent_p.G430G	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor	611	Fibrinogen C-terminal.|Extracellular (Potential).				cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GGGGGCCACTTCCATCTGCAT	0.453																0.331288	139.590662	143.70383	54	109	KEEP	---	---	---	---	31	25	75	60	-1	capture	Silent	SNP	39140559	39140559	CNTNAP3	9	T	A	A	A	1	0	0	0	0	0	0	0	1	795	62	4	4	3613	225
ZNF618	114991	broad.mit.edu	37	9	116810979	116810979	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116810979G>A	uc004bid.2	+	15	1496	c.1397G>A	c.(1396-1398)CGG>CAG	p.R466Q	ZNF618_uc004bic.2_Missense_Mutation_p.R373Q|ZNF618_uc011lxi.1_Missense_Mutation_p.R433Q|ZNF618_uc011lxj.1_Missense_Mutation_p.R434Q|ZNF618_uc010mvb.2_Missense_Mutation_p.R56Q	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	466					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAAAAGGAGCGGCAGAACATC	0.552																0.336066	126.035646	128.937134	41	81	KEEP	---	---	---	---	32	24	58	49	-1	capture	Missense_Mutation	SNP	116810979	116810979	ZNF618	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17920	225
PNPLA7	375775	broad.mit.edu	37	9	140389550	140389550	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140389550G>A	uc004cnf.2	-	18	2324	c.1987C>T	c.(1987-1989)CGG>TGG	p.R663W	C9orf167_uc011mew.1_Intron|PNPLA7_uc011mfa.1_Intron|PNPLA7_uc010ncj.1_Missense_Mutation_p.R688W	NM_152286	NP_689499	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	663	cNMP 3.				lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity			skin(1)	1	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		TCTGAGTCCCGAACGGCATGC	0.687																0.357724	118.26773	120.459418	44	79	KEEP	---	---	---	---	29	24	52	48	-1	capture	Missense_Mutation	SNP	140389550	140389550	PNPLA7	9	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	12073	225
ZCCHC13	389874	broad.mit.edu	37	X	73524398	73524398	+	Missense_Mutation	SNP	T	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:73524398T>A	uc004ebs.3	+	1	374	c.297T>A	c.(295-297)CAT>CAA	p.H99Q		NM_203303	NP_976048	Q8WW36	ZCH13_HUMAN	zinc finger, CCHC domain containing 13	99	CCHC-type 4.						nucleic acid binding|zinc ion binding				0						GACTAGGACATCTGGCTCGTG	0.512																0.153846	28.542572	40.449879	16	88	KEEP	---	---	---	---	9	9	39	56	-1	capture	Missense_Mutation	SNP	73524398	73524398	ZCCHC13	23	T	A	A	A	1	0	0	0	0	1	0	0	0	647	50	4	4	17462	225
MAGEA12	4111	broad.mit.edu	37	X	151900252	151900252	+	Silent	SNP	G	A	A			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151900252G>A	uc010ntp.2	-	3	903	c.549C>T	c.(547-549)GGC>GGT	p.G183G	MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Silent_p.G183G|CSAG1_uc004fge.2_5'Flank|CSAG1_uc004fgf.2_5'Flank|CSAG1_uc004fgd.2_5'Flank	NM_005367	NP_005358	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	183	MAGE.									skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					CGTAGGAGAGGCCCAGGCAGG	0.577																0.060241	-27.494968	39.558272	20	312	KEEP	---	---	---	---	8	12	167	169	-1	capture	Silent	SNP	151900252	151900252	MAGEA12	23	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	9080	225
JAK1	3716	broad.mit.edu	37	1	65301859	65301860	+	Frame_Shift_Ins	INS	-	AT	AT			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:65301859_65301860insAT	uc001dbu.1	-	23	3428_3429	c.3179_3180insAT	c.(3178-3180)ATTfs	p.I1060fs	JAK1_uc009wam.1_Frame_Shift_Ins_p.I1048fs|JAK1_uc009wal.1_Frame_Shift_Ins_p.I237fs	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1	1060	Protein kinase 2.				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		CGTCAGAGGCAATATAAAATTT	0.421					1025	Mis		ALL								0.38			35	56		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	65301859	65301860	JAK1	1	-	AT	AT	AT	1	0	1	1	0	0	0	0	0	60	5	5	5	7860	225
CDC73	79577	broad.mit.edu	37	1	193099308	193099309	+	Frame_Shift_Ins	INS	-	AAATATT	AAATATT			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:193099308_193099309insAAATATT	uc001gtb.2	+	3	485_486	c.242_243insAAATATT	c.(241-243)GAAfs	p.E81fs		NM_024529	NP_078805	Q6P1J9	CDC73_HUMAN	parafibromin	81					cell cycle|histone H2B ubiquitination|histone monoubiquitination|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding			parathyroid(46)|ovary(1)|breast(1)|pancreas(1)	49						TTTTAGACTGAAAATATTCCTG	0.287				p.E81D(NCIH727-Tumor)	312							Hyperparathyroidism_Familial_Isolated|Hyperparathyroidism-Jaw_Tumor_Syndrome				0.16			18	97		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	193099308	193099309	CDC73	1	-	AAATATT	AAATATT	AAATATT	1	0	1	1	0	0	0	0	0	117	9	5	5	3056	225
ITPRIPL1	150771	broad.mit.edu	37	2	96992793	96992795	+	In_Frame_Del	DEL	GAG	-	-			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:96992793_96992795delGAG	uc002svx.2	+	3	759_761	c.424_426delGAG	c.(424-426)GAGdel	p.E147del	ITPRIPL1_uc010yuk.1_In_Frame_Del_p.E139del|ITPRIPL1_uc002svy.2_In_Frame_Del_p.E155del|ITPRIPL1_uc010yul.1_In_Frame_Del_p.E139del	NM_001008949	NP_001008949	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-triphosphate receptor interacting	147	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(2)|ovary(1)	3						TTCCAGCAGTGAGGAGGAGGAGG	0.532																0.05			8	167		---	---	---	---						capture_indel	In_Frame_Del	DEL	96992793	96992795	ITPRIPL1	2	GAG	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	7847	225
GLI2	2736	broad.mit.edu	37	2	121744096	121744096	+	Frame_Shift_Del	DEL	G	-	-			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:121744096delG	uc010flp.2	+	12	2229	c.2199delG	c.(2197-2199)AAGfs	p.K733fs	GLI2_uc002tmq.1_Frame_Shift_Del_p.K405fs|GLI2_uc002tmr.1_Frame_Shift_Del_p.K388fs|GLI2_uc002tmt.3_Frame_Shift_Del_p.K405fs|GLI2_uc002tmu.3_Frame_Shift_Del_p.K388fs|GLI2_uc002tmw.1_Frame_Shift_Del_p.K716fs	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	733					axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				AGCAGCTCAAGAAGGAGAAGC	0.647					376											0.33			39	80		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	121744096	121744096	GLI2	2	G	-	-	-	1	0	1	0	1	0	0	0	0	425	33	5	5	6374	225
AKAP9	10142	broad.mit.edu	37	7	91708676	91708676	+	Frame_Shift_Del	DEL	C	-	-			TCGA-28-5219-01	TCGA-28-5219-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:91708676delC	uc003ulg.2	+	31	7454	c.7229delC	c.(7228-7230)ACCfs	p.T2410fs	AKAP9_uc003ulf.2_Frame_Shift_Del_p.T2402fs|AKAP9_uc003uli.2_Frame_Shift_Del_p.T2033fs|AKAP9_uc003ulj.2_Frame_Shift_Del_p.T180fs	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	2422	Potential.|Glu-rich.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GAAGAAATGACCTTCATGAAA	0.353					807	T	BRAF	papillary thyroid								0.18			25	111		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	91708676	91708676	AKAP9	7	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	459	225
