Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ACTRT2	140625	broad.mit.edu	37	1	2938845	2938845	+	Missense_Mutation	SNP	G	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:2938845G>T	uc001ajz.2	+	1	800	c.595G>T	c.(595-597)GCC>TCC	p.A199S		NM_080431	NP_536356	Q8TDY3	ACTT2_HUMAN	actin-related protein M2	199						cytoplasm|cytoskeleton					0	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		GCTGCTCCTGGCCAGCGGCCA	0.617																0.1	1.775941	8.166064	4	36	KEEP	---	---	---	---	3	3	25	27	0.5	capture	Missense_Mutation	SNP	2938845	2938845	ACTRT2	1	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	219	257
TPRG1L	127262	broad.mit.edu	37	1	3545150	3545150	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3545150G>A	uc001akm.2	+	5	883	c.802G>A	c.(802-804)GGC>AGC	p.G268S	TPRG1L_uc009vlj.2_Missense_Mutation_p.G209S	NM_182752	NP_877429	Q5T0D9	TPRGL_HUMAN	tumor protein p63 regulated 1-like	268						cell junction|synaptic vesicle					0	all_cancers(77;0.0119)|all_epithelial(69;0.00481)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.41e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.83e-22)|GBM - Glioblastoma multiforme(42;4.77e-14)|Colorectal(212;1.12e-05)|COAD - Colon adenocarcinoma(227;5.61e-05)|Kidney(185;0.000351)|BRCA - Breast invasive adenocarcinoma(365;0.000688)|KIRC - Kidney renal clear cell carcinoma(229;0.00553)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.201)		CATGACCAGGGGCAAAATAGG	0.612																0.083333	1.232333	7.551901	3	33	KEEP	---	---	---	---	2	1	12	24	-1	capture	Missense_Mutation	SNP	3545150	3545150	TPRG1L	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	16302	257
PCSK9	255738	broad.mit.edu	37	1	55523733	55523733	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55523733C>T	uc001cyf.1	+	8	1496	c.1205C>T	c.(1204-1206)GCC>GTC	p.A402V	PCSK9_uc010oom.1_RNA	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	402	Peptidase S8.				cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						ATGCTGTCTGCCGAGCCGGAG	0.602	Pancreas(137;1454 1827 5886 22361 42375)															0.041237	-12.487234	9.473994	4	93	KEEP	---	---	---	---	2	2	65	62	-1	capture	Missense_Mutation	SNP	55523733	55523733	PCSK9	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11509	257
ADAM30	11085	broad.mit.edu	37	1	120436835	120436835	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120436835G>A	uc001eij.2	-	1	2279	c.2125C>T	c.(2125-2127)CGG>TGG	p.R709W		NM_021794	NP_068566	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30 preproprotein	709	Cytoplasmic (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		ATCACTTGCCGGAAAAACACA	0.393																0.028169	-26.828719	8.001202	4	138	KEEP	---	---	---	---	2	2	60	81	-1	capture	Missense_Mutation	SNP	120436835	120436835	ADAM30	1	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	248	257
PDC	5132	broad.mit.edu	37	1	186413476	186413476	+	Missense_Mutation	SNP	T	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186413476T>G	uc001gsa.2	-	4	449	c.376A>C	c.(376-378)ACA>CCA	p.T126P	PDC_uc001grz.2_Missense_Mutation_p.T74P	NM_002597	NP_002588	P20941	PHOS_HUMAN	phosducin isoform a	126					G-protein coupled receptor protein signaling pathway|phototransduction|visual perception	actin cytoskeleton|cytosol|nucleus|photoreceptor inner segment|photoreceptor outer segment	phospholipase inhibitor activity			skin(1)	1		Breast(1374;1.53e-05)		KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.0129)		TTTTCAATTGTTTCTAGGAAT	0.398																0.212329	178.782581	201.133038	62	230	KEEP	---	---	---	---	36	36	132	133	-1	capture	Missense_Mutation	SNP	186413476	186413476	PDC	1	T	G	G	G	1	0	0	0	0	1	0	0	0	780	60	4	4	11517	257
RYR2	6262	broad.mit.edu	37	1	237550598	237550598	+	Silent	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237550598C>T	uc001hyl.1	+	9	714	c.594C>T	c.(592-594)AAC>AAT	p.N198N		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	198	Cytoplasmic (By similarity).|MIR 2.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTATGGCAACGGCAGCTTAC	0.498																0.166667	34.451194	46.46395	19	95	KEEP	---	---	---	---	11	13	55	94	-1	capture	Silent	SNP	237550598	237550598	RYR2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13661	257
ZMIZ1	57178	broad.mit.edu	37	10	81066012	81066012	+	Missense_Mutation	SNP	A	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:81066012A>C	uc001kaf.2	+	22	3151	c.2579A>C	c.(2578-2580)GAG>GCG	p.E860A	ZMIZ1_uc001kag.2_Missense_Mutation_p.E736A|ZMIZ1_uc010qlq.1_Missense_Mutation_p.E13A	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17	860					transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			AATGTCATGGAGATGATCGCA	0.612																0.473684	60.748149	60.770977	18	20	KEEP	---	---	---	---	4	15	13	8	-1	capture	Missense_Mutation	SNP	81066012	81066012	ZMIZ1	10	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	17576	257
PTEN	5728	broad.mit.edu	37	10	89690814	89690814	+	Missense_Mutation	SNP	G	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89690814G>C	uc001kfb.2	+	5	1252	c.221G>C	c.(220-222)AGA>ACA	p.R74T		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	74	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.L70fs*7(4)|p.R55fs*1(4)|p.?(2)|p.C71fs*6(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.R74I(1)|p.E73fs*25(1)|p.R74fs*25(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGTGCTGAAAGACATTATGAC	0.274			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.358974	50.139728	50.82256	14	25	KEEP	---	---	---	---	11	7	18	12	-1	capture	Missense_Mutation	SNP	89690814	89690814	PTEN	10	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	12633	257
PRLHR	2834	broad.mit.edu	37	10	120354176	120354176	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:120354176G>A	uc001ldp.1	-	2	720	c.581C>T	c.(580-582)GCC>GTC	p.A194V		NM_004248	NP_004239	P49683	PRLHR_HUMAN	G protein-coupled receptor 10	194	Helical; Name=4; (Potential).			A -> P (in Ref. 1; AAC50504).	female pregnancy	integral to plasma membrane	neuropeptide Y receptor activity				0		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		GTGCACGGCGGCGGGCAGCGC	0.716																0.285714	6.446898	6.735448	2	5	KEEP	---	---	---	---	2	0	1	4	-1	capture	Missense_Mutation	SNP	120354176	120354176	PRLHR	10	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12426	257
INPP5A	3632	broad.mit.edu	37	10	134523875	134523875	+	Missense_Mutation	SNP	G	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:134523875G>C	uc001llp.2	+	8	810	c.562G>C	c.(562-564)GAT>CAT	p.D188H	INPP5A_uc001llo.1_Missense_Mutation_p.D188H|INPP5A_uc001llq.2_Missense_Mutation_p.D140H	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A	188					cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		TCTTTTCCATGATGCTTCCAA	0.488	Pancreas(63;823 1267 11107 20380 51626)															0.1	3.933965	7.130743	2	18	KEEP	---	---	---	---	2	0	15	5	-1	capture	Missense_Mutation	SNP	134523875	134523875	INPP5A	10	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	7677	257
BBOX1	8424	broad.mit.edu	37	11	27114719	27114719	+	Silent	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:27114719C>T	uc001mre.1	+	5	707	c.339C>T	c.(337-339)TGC>TGT	p.C113C	BBOX1_uc009yih.1_Silent_p.C113C|BBOX1_uc001mrg.1_Silent_p.C113C	NM_003986	NP_003977	O75936	BODG_HUMAN	gamma-butyrobetaine dioxygenase	113					carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1					Succinic acid(DB00139)|Vitamin C(DB00126)	TCACAGAATGCCAATACTGGG	0.393																0.045455	-12.280674	7.151375	4	84	KEEP	---	---	---	---	1	4	49	45	-1	capture	Silent	SNP	27114719	27114719	BBOX1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	1323	257
SYT13	57586	broad.mit.edu	37	11	45274269	45274269	+	Silent	SNP	C	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45274269C>A	uc001myq.2	-	4	675	c.549G>T	c.(547-549)GTG>GTT	p.V183V	SYT13_uc009yku.1_Silent_p.V39V	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	183	Cytoplasmic (Potential).|C2 1.					transport vesicle				ovary(1)	1						GGTTGCTGGTCACAGCTGCAG	0.587														OREG0020928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.044118	-8.537367	6.595053	3	65	KEEP	---	---	---	---	2	1	42	36	0.333333333333	capture	Silent	SNP	45274269	45274269	SYT13	11	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	15357	257
KCTD14	65987	broad.mit.edu	37	11	77728030	77728030	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77728030G>A	uc001oyw.3	-	2	402	c.377C>T	c.(376-378)CCA>CTA	p.P126L		NM_023930	NP_076419	Q9BQ13	KCD14_HUMAN	potassium channel tetramerisation domain	126	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			AAAGATCTGTGGCATGTCCTC	0.567	NSCLC(86;414 1416 18100 32729 49271)|Esophageal Squamous(156;1132 1858 11406 36132 46748)				54											0.040541	-10.331088	6.482756	3	71	KEEP	---	---	---	---	3	0	36	49	-1	capture	Missense_Mutation	SNP	77728030	77728030	KCTD14	11	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	8023	257
KDM4D	55693	broad.mit.edu	37	11	94731105	94731105	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94731105C>T	uc001pfe.2	+	3	1401	c.569C>T	c.(568-570)GCT>GTT	p.A190V		NM_018039	NP_060509	Q6B0I6	KDM4D_HUMAN	jumonji domain containing 2D	190	JmjC.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						ACCACGTTTGCTTGGCATACA	0.512																0.113821	17.95362	36.053872	14	109	KEEP	---	---	---	---	5	10	58	67	-1	capture	Missense_Mutation	SNP	94731105	94731105	KDM4D	11	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	8053	257
MLL	4297	broad.mit.edu	37	11	118359396	118359396	+	Missense_Mutation	SNP	T	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118359396T>C	uc001pta.2	+	11	4423	c.4400T>C	c.(4399-4401)CTG>CCG	p.L1467P	MLL_uc001ptb.2_Missense_Mutation_p.L1467P|MLL_uc001pte.1_RNA	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1467	PHD-type 1.				apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		GAGCGCCCTCTGGAGGACCAG	0.433					723	T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								0.024793	-22.681036	7.629485	3	118	KEEP	---	---	---	---	2	1	63	78	-1	capture	Missense_Mutation	SNP	118359396	118359396	MLL	11	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	9532	257
OR4D5	219875	broad.mit.edu	37	11	123810626	123810626	+	Silent	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123810626C>T	uc001pzk.1	+	1	303	c.303C>T	c.(301-303)CTC>CTT	p.L101L		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	101	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TGACTCAACTCTTCTTCTTCC	0.507																0.025424	-22.885133	6.565135	3	115	KEEP	---	---	---	---	2	1	69	59	-1	capture	Silent	SNP	123810626	123810626	OR4D5	11	C	T	T	T	1	0	0	0	0	0	0	0	1	405	32	2	2	10961	257
OR10S1	219873	broad.mit.edu	37	11	123847863	123847863	+	Missense_Mutation	SNP	C	T	T	rs141270826		TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123847863C>T	uc001pzm.1	-	1	536	c.536G>A	c.(535-537)CGC>CAC	p.R179H		NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S,	179	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GTAGAGCAGGCGGAAGGTGAG	0.552																0.2	29.903782	36.169366	15	60	KEEP	---	---	---	---	5	11	20	47	-1	capture	Missense_Mutation	SNP	123847863	123847863	OR10S1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10822	257
PATE2	399967	broad.mit.edu	37	11	125648646	125648646	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:125648646C>T	uc001qcu.2	-	1	69	c.23G>A	c.(22-24)GGC>GAC	p.G8D	PATE2_uc010sbj.1_Missense_Mutation_p.G8D	NM_212555	NP_997720	Q6UY27	PATE2_HUMAN	prostate and testis expressed 2 precursor	8						extracellular space					0						AAAGACTGTGCCCAGGAGAAA	0.522																0.033708	-14.558831	6.539347	3	86	KEEP	---	---	---	---	0	3	43	57	-1	capture	Missense_Mutation	SNP	125648646	125648646	PATE2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11377	257
ANO2	57101	broad.mit.edu	37	12	5687643	5687643	+	Missense_Mutation	SNP	G	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5687643G>C	uc001qnm.2	-	22	2347	c.2275C>G	c.(2275-2277)CCC>GCC	p.P759A		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	764	Helical; (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						GGTGCCAGGGGAAAGGAGGCC	0.537																0.12766	12.21691	18.568079	6	41	KEEP	---	---	---	---	4	2	28	22	-1	capture	Missense_Mutation	SNP	5687643	5687643	ANO2	12	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	691	257
MLL2	8085	broad.mit.edu	37	12	49432573	49432573	+	Missense_Mutation	SNP	C	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49432573C>G	uc001rta.3	-	34	8566	c.8566G>C	c.(8566-8568)GGA>CGA	p.G2856R		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	2856					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GTGGAAATTCCCGCCAACGGG	0.557						N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			0.153846	5.941096	7.430459	2	11	KEEP	---	---	---	---	2	0	5	10	-1	capture	Missense_Mutation	SNP	49432573	49432573	MLL2	12	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	9533	257
CALCOCO1	57658	broad.mit.edu	37	12	54105903	54105903	+	Missense_Mutation	SNP	C	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54105903C>G	uc001sef.2	-	15	2045	c.1901G>C	c.(1900-1902)GGC>GCC	p.G634A	CALCOCO1_uc001see.2_Missense_Mutation_p.G159A|CALCOCO1_uc010som.1_Missense_Mutation_p.G549A|CALCOCO1_uc010son.1_Missense_Mutation_p.G511A|CALCOCO1_uc001seh.2_3'UTR|CALCOCO1_uc009znd.2_Missense_Mutation_p.G633A|CALCOCO1_uc001seg.2_Missense_Mutation_p.G459A	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform	634	C-terminal AD (CTNNB1 binding site) (By similarity).				steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						CACTGTAAAGCCACTAAGAGA	0.577																0.25	7.346041	7.800519	2	6	KEEP	---	---	---	---	2	0	4	7	-1	capture	Missense_Mutation	SNP	54105903	54105903	CALCOCO1	12	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	2553	257
SUOX	6821	broad.mit.edu	37	12	56398139	56398139	+	Missense_Mutation	SNP	C	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56398139C>G	uc001six.2	+	6	1292	c.966C>G	c.(964-966)GAC>GAG	p.D322E	SUOX_uc001siy.2_Missense_Mutation_p.D322E|SUOX_uc001siz.2_Missense_Mutation_p.D322E|SUOX_uc001sja.2_Missense_Mutation_p.D322E	NM_000456	NP_000447	P51687	SUOX_HUMAN	sulfite oxidase precursor	322	Molybdenum-pterin domain (By similarity).|Molybdenum-pterin-binding (By similarity).					mitochondrial intermembrane space	electron carrier activity|molybdenum ion binding|sulfite oxidase activity				0			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			AGGGACTGGACTCAGACCCTA	0.607																0.051282	-1.983509	6.32869	2	37	KEEP	---	---	---	---	2	0	17	23	-1	capture	Missense_Mutation	SNP	56398139	56398139	SUOX	12	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	15283	257
LRRIQ1	84125	broad.mit.edu	37	12	85450952	85450952	+	Missense_Mutation	SNP	C	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85450952C>G	uc001tac.2	+	8	2492	c.2381C>G	c.(2380-2382)ACT>AGT	p.T794S	LRRIQ1_uc001tab.1_Missense_Mutation_p.T794S|LRRIQ1_uc001taa.1_Missense_Mutation_p.T769S	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	794										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		CCTTGGGATACTTTACAGCAG	0.313																0.192982	87.574992	102.619987	33	138	KEEP	---	---	---	---	11	23	72	79	-1	capture	Missense_Mutation	SNP	85450952	85450952	LRRIQ1	12	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	8944	257
ISCU	23479	broad.mit.edu	37	12	108962628	108962628	+	Missense_Mutation	SNP	A	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:108962628A>G	uc010sxc.1	+	5	545	c.440A>G	c.(439-441)AAG>AGG	p.K147R	ISCU_uc010sxb.1_3'UTR|ISCU_uc001tnc.3_Missense_Mutation_p.K122R|ISCU_uc009zuy.2_3'UTR|ISCU_uc010sxd.1_3'UTR	NM_213595	NP_998760	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme isoform	147					iron-sulfur cluster assembly|nitrogen fixation	cytosol|mitochondrion|nucleus	iron ion binding|iron-sulfur cluster binding|protein complex scaffold				0						GATGCAATCAAGGCCGCCCTG	0.478																0.105263	3.73602	6.677953	2	17	KEEP	---	---	---	---	0	2	11	9	-1	capture	Missense_Mutation	SNP	108962628	108962628	ISCU	12	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	7775	257
HNF1A	6927	broad.mit.edu	37	12	121426701	121426701	+	Missense_Mutation	SNP	G	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121426701G>T	uc001tzg.2	+	2	415	c.392G>T	c.(391-393)CGG>CTG	p.R131L	HNF1A_uc001tze.1_Missense_Mutation_p.R131L|HNF1A_uc001tzf.2_Missense_Mutation_p.R131L|HNF1A_uc010szn.1_Missense_Mutation_p.R131L	NM_000545	NP_000536	P20823	HNF1A_HUMAN	hepatic nuclear factor-1-alpha	131	Interaction with DNA.		R -> Q (in MODY3; expected to interfere with DNA binding).|R -> W (in MODY3; expected to interfere with DNA binding).		glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	p.R131W(1)		liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ATCCCACAGCGGGAGGTGGTC	0.622					239							Hepatic_Adenoma_Familial_Clustering_of				0.048387	-5.498091	7.917829	3	59	KEEP	---	---	---	---	1	2	32	41	0.333333333333	capture	Missense_Mutation	SNP	121426701	121426701	HNF1A	12	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	7176	257
GOLGA3	2802	broad.mit.edu	37	12	133383767	133383767	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133383767C>T	uc001ukz.1	-	6	1845	c.1286G>A	c.(1285-1287)AGT>AAT	p.S429N	GOLGA3_uc001ula.1_Missense_Mutation_p.S429N|GOLGA3_uc001ulb.2_Missense_Mutation_p.S429N	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	429	Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CGTTACCTGACTCGCCTCCAG	0.547																0.153846	4.840957	6.330649	2	11	KEEP	---	---	---	---	0	2	7	4	-1	capture	Missense_Mutation	SNP	133383767	133383767	GOLGA3	12	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	6490	257
GSX1	219409	broad.mit.edu	37	13	28367747	28367747	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28367747G>A	uc001urr.1	+	2	505	c.457G>A	c.(457-459)GCT>ACT	p.A153T		NM_145657	NP_663632	Q9H4S2	GSX1_HUMAN	GS homeobox 1	153	Homeobox.				positive regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		GATGCGCACGGCTTTCACCAG	0.577																0.040541	-9.639052	7.182623	3	71	KEEP	---	---	---	---	2	1	36	49	-1	capture	Missense_Mutation	SNP	28367747	28367747	GSX1	13	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	6779	257
NBEA	26960	broad.mit.edu	37	13	35883701	35883701	+	Missense_Mutation	SNP	G	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:35883701G>C	uc001uvb.2	+	36	6081	c.5875G>C	c.(5875-5877)GCA>CCA	p.A1959P	NBEA_uc010abi.2_Missense_Mutation_p.A615P	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	1959						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TGCAGGACTTGCATTTATTGA	0.343																0.153846	5.640956	7.130429	2	11	KEEP	---	---	---	---	2	0	4	11	-1	capture	Missense_Mutation	SNP	35883701	35883701	NBEA	13	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	10094	257
RNF31	55072	broad.mit.edu	37	14	24620756	24620756	+	Missense_Mutation	SNP	G	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24620756G>C	uc001wmn.1	+	10	2049	c.1800G>C	c.(1798-1800)CAG>CAC	p.Q600H	RNF31_uc001wml.1_Missense_Mutation_p.Q449H|RNF31_uc001wmm.1_Intron|RNF31_uc010alg.1_Missense_Mutation_p.Q359H|RNF31_uc001wmo.1_Missense_Mutation_p.Q67H|RNF31_uc001wmp.2_RNA	NM_017999	NP_060469	Q96EP0	RNF31_HUMAN	ring finger protein 31	600	Interaction with RBCK1.|UBA.				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(265;0.00861)		CATTGTTCCAGCACGGAGGTG	0.627																0.042254	-8.735131	7.235878	3	68	KEEP	---	---	---	---	3	0	34	38	-1	capture	Missense_Mutation	SNP	24620756	24620756	RNF31	14	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	13379	257
GPR65	8477	broad.mit.edu	37	14	88477519	88477519	+	Missense_Mutation	SNP	G	A	A	rs142375010	byFrequency	TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:88477519G>A	uc001xvv.2	+	2	858	c.328G>A	c.(328-330)GTT>ATT	p.V110I		NM_003608	NP_003599	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	110	Helical; Name=3; (Potential).				actin cytoskeleton reorganization|activation of Rho GTPase activity|apoptosis|immune response|multicellular organismal development|positive regulation of cAMP biosynthetic process|positive regulation of stress fiber assembly|response to acidity	integral to plasma membrane	G-protein coupled receptor activity				0						CTGCATTGCCGTTGATCGGTA	0.433																0.016908	-97.857966	11.366363	7	407	KEEP	---	---	---	---	1	6	209	241	-1	capture	Missense_Mutation	SNP	88477519	88477519	GPR65	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6639	257
AHNAK2	113146	broad.mit.edu	37	14	105405535	105405535	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105405535G>A	uc010axc.1	-	7	16373	c.16253C>T	c.(16252-16254)GCC>GTC	p.A5418V	AHNAK2_uc001ypx.2_Missense_Mutation_p.A5318V	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5418						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ATCAATATTGGCCTCTGGACA	0.557																0.071429	-1.611438	6.34091	3	39	KEEP	---	---	---	---	0	3	17	22	-1	capture	Missense_Mutation	SNP	105405535	105405535	AHNAK2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	415	257
SECISBP2L	9728	broad.mit.edu	37	15	49284790	49284790	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:49284790C>T	uc001zxe.1	-	18	3091	c.2957G>A	c.(2956-2958)GGC>GAC	p.G986D	SECISBP2L_uc001zxd.1_Missense_Mutation_p.G941D	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	986										breast(1)|skin(1)	2						ttcAAGCATGCCAGGTACAAG	0.383																0.03125	-16.051124	7.037865	3	93	KEEP	---	---	---	---	1	2	58	39	-1	capture	Missense_Mutation	SNP	49284790	49284790	SECISBP2L	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13900	257
SLC27A2	11001	broad.mit.edu	37	15	50497504	50497504	+	Missense_Mutation	SNP	G	A	A	rs141444028		TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50497504G>A	uc001zxw.2	+	4	1148	c.916G>A	c.(916-918)GTC>ATC	p.V306I	SLC27A2_uc010bes.2_Missense_Mutation_p.V253I|SLC27A2_uc001zxx.2_Missense_Mutation_p.V71I	NM_003645	NP_003636	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid	306	Cytoplasmic (Potential).				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)|skin(1)	2		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		AAAATACAACGTCACTGTCAT	0.428																0.282927	153.459988	162.139052	58	147	KEEP	---	---	---	---	25	37	69	94	-1	capture	Missense_Mutation	SNP	50497504	50497504	SLC27A2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14418	257
C15orf39	56905	broad.mit.edu	37	15	75501019	75501019	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75501019C>T	uc002azp.3	+	2	2950	c.2630C>T	c.(2629-2631)ACG>ATG	p.T877M	C15orf39_uc002azq.3_Missense_Mutation_p.T877M|C15orf39_uc002azr.3_Missense_Mutation_p.T275M	NM_015492	NP_056307	Q6ZRI6	CO039_HUMAN	hypothetical protein LOC56905	877											0						CGGCCCACCACGCTGTCGGAG	0.667																0.153846	4.841898	6.330821	2	11	KEEP	---	---	---	---	0	2	9	4	-1	capture	Missense_Mutation	SNP	75501019	75501019	C15orf39	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1779	257
C15orf27	123591	broad.mit.edu	37	15	76484332	76484332	+	Silent	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:76484332G>A	uc002bbq.2	+	9	947	c.792G>A	c.(790-792)GCG>GCA	p.A264A	C15orf27_uc010bkp.2_Silent_p.A80A|C15orf27_uc002bbr.2_Silent_p.A80A|C15orf27_uc002bbs.2_5'UTR	NM_152335	NP_689548	Q2M3C6	CO027_HUMAN	hypothetical protein LOC123591	264	Potential.					integral to membrane					0						AGCTGCGCGCGCACCTGGCGC	0.716																0.090909	2.299064	7.867072	3	30	KEEP	---	---	---	---	2	2	19	23	-1	capture	Silent	SNP	76484332	76484332	C15orf27	15	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1774	257
ZNF668	79759	broad.mit.edu	37	16	31072650	31072650	+	Silent	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31072650C>T	uc010caf.2	-	3	1956	c.1599G>A	c.(1597-1599)CGG>CGA	p.R533R	ZNF668_uc002eao.2_Silent_p.R533R	NM_024706	NP_078982	Q96K58	ZN668_HUMAN	zinc finger protein 668	533	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(4)	4						AGCGCTCGTGCCGACGCAGCA	0.672	Colon(181;1111 1980 5060 10512 25785)				49											0.032967	-15.358539	6.313233	3	88	KEEP	---	---	---	---	1	2	51	43	-1	capture	Silent	SNP	31072650	31072650	ZNF668	16	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	17953	257
CPNE7	27132	broad.mit.edu	37	16	89655119	89655119	+	Missense_Mutation	SNP	C	T	T	rs145109453		TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89655119C>T	uc002fnp.2	+	12	1319	c.1189C>T	c.(1189-1191)CGG>TGG	p.R397W	CPNE7_uc002fnq.2_Missense_Mutation_p.R322W	NM_014427	NP_055242	Q9UBL6	CPNE7_HUMAN	copine 7 isoform b	397	VWFA.				lipid metabolic process		transporter activity				0		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		TGGAGACCCGCGGAACAGCTG	0.647																0.212766	22.527163	26.108809	10	37	KEEP	---	---	---	---	6	8	26	28	-1	capture	Missense_Mutation	SNP	89655119	89655119	CPNE7	16	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	3782	257
NF1	4763	broad.mit.edu	37	17	29508778	29508778	+	Nonsense_Mutation	SNP	C	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29508778C>G	uc002hgg.2	+	7	1038	c.705C>G	c.(703-705)TAC>TAG	p.Y235*	NF1_uc002hge.1_Nonsense_Mutation_p.Y235*|NF1_uc002hgf.1_Nonsense_Mutation_p.Y235*|NF1_uc002hgh.2_Nonsense_Mutation_p.Y235*|NF1_uc010csn.1_Nonsense_Mutation_p.Y95*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	235					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CAAAACTGTACCAGATCCCAC	0.313					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.426966	138.738814	139.152506	38	51	KEEP	---	---	---	---	20	24	38	27	-1	capture	Nonsense_Mutation	SNP	29508778	29508778	NF1	17	C	G	G	G	1	0	0	0	0	0	1	0	0	233	18	5	4	10263	257
SLC4A1	6521	broad.mit.edu	37	17	42330723	42330723	+	Missense_Mutation	SNP	G	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42330723G>C	uc002igf.3	-	17	2223	c.2074C>G	c.(2074-2076)CCT>GCT	p.P692A		NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	692	Membrane (anion exchange).				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		TTGCGCTCAGGTTTGCTGACA	0.612																0.123457	17.491485	28.725607	10	71	KEEP	---	---	---	---	7	7	42	43	-1	capture	Missense_Mutation	SNP	42330723	42330723	SLC4A1	17	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	14542	257
CNDP2	55748	broad.mit.edu	37	18	72167228	72167228	+	Missense_Mutation	SNP	T	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:72167228T>C	uc002llm.1	+	2	182	c.20T>C	c.(19-21)CTG>CCG	p.L7P	CNDP2_uc002lln.1_Missense_Mutation_p.L7P|CNDP2_uc002llo.2_Missense_Mutation_p.L7P	NM_018235	NP_060705	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2	7						cytoplasm	carboxypeptidase activity|metal ion binding|metallopeptidase activity|protein binding|tripeptidase activity			ovary(2)|skin(1)	3		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		CTCACTACCCTGTTTAAGTAC	0.458																0.284091	76.840995	80.522302	25	63	KEEP	---	---	---	---	15	16	40	49	-1	capture	Missense_Mutation	SNP	72167228	72167228	CNDP2	18	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	3559	257
ITPKC	80271	broad.mit.edu	37	19	41245286	41245286	+	Missense_Mutation	SNP	G	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41245286G>C	uc002oot.2	+	7	1906	c.1873G>C	c.(1873-1875)GTG>CTG	p.V625L		NM_025194	NP_079470	Q96DU7	IP3KC_HUMAN	inositol 1,4,5-trisphosphate 3-kinase C	625						cytoplasm|nucleus	ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity				0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CCTCCTCTTCGTGCACGACCA	0.617																0.055556	-1.179152	6.300158	2	34	KEEP	---	---	---	---	0	3	14	26	-1	capture	Missense_Mutation	SNP	41245286	41245286	ITPKC	19	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	7842	257
SIGLEC5	8778	broad.mit.edu	37	19	52132644	52132644	+	Missense_Mutation	SNP	T	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52132644T>A	uc002pxe.2	-	3	806	c.667A>T	c.(667-669)ACC>TCC	p.T223S		NM_003830	NP_003821	O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5 precursor	223	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion	integral to membrane	sugar binding			skin(2)|breast(1)|central_nervous_system(1)	4		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		CTCTCCGTGGTCACCTGAGCT	0.582																0.207792	34.453646	40.550146	16	61	KEEP	---	---	---	---	14	6	34	37	-1	capture	Missense_Mutation	SNP	52132644	52132644	SIGLEC5	19	T	A	A	A	1	0	0	0	0	1	0	0	0	754	58	4	4	14204	257
LILRA6	79168	broad.mit.edu	37	19	54744985	54744985	+	Missense_Mutation	SNP	G	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54744985G>T	uc002qeu.1	-	5	801	c.677C>A	c.(676-678)TCC>TAC	p.S226Y	LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Missense_Mutation_p.S226Y|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Missense_Mutation_p.S226Y|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.S226Y|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Missense_Mutation_p.S226Y|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Missense_Mutation_p.S226Y|LILRA6_uc010yeq.1_Missense_Mutation_p.S226Y|LILRA6_uc002qet.3_RNA|LILRA6_uc002qev.1_Missense_Mutation_p.S87Y	NM_024318	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor,	226	Extracellular (Potential).|Ig-like C2-type 1.					integral to membrane	receptor activity			skin(2)	2	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGTCAGGAGGGAGGGCTTCCT	0.632																0.065789	-6.492525	8.391641	5	71	KEEP	---	---	---	---	2	4	56	63	0.333333333333	capture	Missense_Mutation	SNP	54744985	54744985	LILRA6	19	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	8709	257
ZNF460	10794	broad.mit.edu	37	19	57802944	57802944	+	Missense_Mutation	SNP	C	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57802944C>G	uc002qog.2	+	3	1357	c.1035C>G	c.(1033-1035)TTC>TTG	p.F345L	ZNF460_uc010ygv.1_Missense_Mutation_p.F304L	NM_006635	NP_006626	Q14592	ZN460_HUMAN	zinc finger protein 460	345	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GGAAGGCCTTCAACTGCAGGT	0.488																0.273684	79.305966	83.691415	26	69	KEEP	---	---	---	---	10	16	36	35	-1	capture	Missense_Mutation	SNP	57802944	57802944	ZNF460	19	C	G	G	G	1	0	0	0	0	1	0	0	0	376	29	4	4	17803	257
APOB	338	broad.mit.edu	37	2	21227177	21227177	+	Silent	SNP	G	A	A	rs12713501	byFrequency	TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21227177G>A	uc002red.2	-	28	12179	c.12051C>T	c.(12049-12051)GAC>GAT	p.D4017D		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	4017					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TAGAAAAGTCGTCATCTTCAT	0.512																0.277778	81.407484	86.203965	30	78	KEEP	---	---	---	---	12	23	53	43	-1	capture	Silent	SNP	21227177	21227177	APOB	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	778	257
LCT	3938	broad.mit.edu	37	2	136566637	136566637	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:136566637C>T	uc002tuu.1	-	8	3291	c.3280G>A	c.(3280-3282)GCC>ACC	p.A1094T		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1094	3.|Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		ACGGCGTGGGCTATCCTATAT	0.542																0.053571	-5.003331	6.75448	3	53	KEEP	---	---	---	---	2	2	36	27	-1	capture	Missense_Mutation	SNP	136566637	136566637	LCT	2	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	8613	257
TTN	7273	broad.mit.edu	37	2	179392028	179392028	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179392028G>A	uc010zfg.1	-	312	100207	c.99983C>T	c.(99982-99984)CCG>CTG	p.P33328L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P27023L|TTN_uc010zfi.1_Missense_Mutation_p.P26956L|TTN_uc010zfj.1_Missense_Mutation_p.P26831L|TTN_uc002umq.2_Missense_Mutation_p.P244L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	34255							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATTTTAGGCGGAATTCCTTT	0.378				p.P27023L(HEC6-Tumor)	8722											0.083333	1.498925	7.848678	3	33	KEEP	---	---	---	---	2	1	12	25	-1	capture	Missense_Mutation	SNP	179392028	179392028	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16617	257
ALPP	250	broad.mit.edu	37	2	233245025	233245025	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233245025C>T	uc002vsq.2	+	6	952	c.787C>T	c.(787-789)CGC>TGC	p.R263C	ALPP_uc002vsr.2_5'Flank	NM_001632	NP_001623	P05187	PPB1_HUMAN	placental alkaline phosphatase preproprotein	263						anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		GCTGGCGAAGCGCCAGGTGAT	0.667																0.118644	28.837084	54.168692	21	156	KEEP	---	---	---	---	4	20	67	100	-1	capture	Missense_Mutation	SNP	233245025	233245025	ALPP	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	548	257
ALPPL2	251	broad.mit.edu	37	2	233273106	233273106	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233273106C>T	uc002vss.3	+	6	831	c.778C>T	c.(778-780)CAC>TAC	p.H260Y		NM_031313	NP_112603	P10696	PPBN_HUMAN	placental-like alkaline phosphatase	260				H -> R (in Ref. 8; AAH14139).	phosphorylation	anchored to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			skin(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)|Levamisole(DB00848)	GCTGGCGAAGCACCAGGTGAT	0.662																0.060241	-7.19846	9.590701	5	78	KEEP	---	---	---	---	8	2	40	44	-1	capture	Missense_Mutation	SNP	233273106	233273106	ALPPL2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	549	257
SCAND1	51282	broad.mit.edu	37	20	34542061	34542061	+	Missense_Mutation	SNP	T	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:34542061T>C	uc002xen.1	-	2	260	c.146A>G	c.(145-147)GAG>GGG	p.E49G	SCAND1_uc002xeo.2_Missense_Mutation_p.E49G|SCAND1_uc002xep.2_Missense_Mutation_p.E49G	NM_033630	NP_361012	P57086	SCND1_HUMAN	SCAN domain containing protein 1	49					viral reproduction	nucleus	identical protein binding|sequence-specific DNA binding transcription factor activity				0	Breast(12;0.00631)|all_lung(11;0.0233)					ACTGGAAGGCTCAGGGGCAGG	0.711																0.4	7.949328	7.992967	2	3	KEEP	---	---	---	---	0	2	4	2	-1	capture	Missense_Mutation	SNP	34542061	34542061	SCAND1	20	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	13767	257
DLGAP4	22839	broad.mit.edu	37	20	35060225	35060225	+	Silent	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35060225G>A	uc002xff.2	+	3	540	c.105G>A	c.(103-105)TCG>TCA	p.S35S	DLGAP4_uc010zvp.1_Silent_p.S35S	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a	35					cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				ACCTGCTGTCGCCCACGGAGG	0.701																0.192771	35.272758	42.57135	16	67	KEEP	---	---	---	---	6	15	44	49	-1	capture	Silent	SNP	35060225	35060225	DLGAP4	20	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4520	257
SHANK3	85358	broad.mit.edu	37	22	51160153	51160153	+	Missense_Mutation	SNP	A	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:51160153A>G	uc003bne.1	+	22	3940	c.3940A>G	c.(3940-3942)AGG>GGG	p.R1314G	SHANK3_uc003bnf.1_Missense_Mutation_p.R761G|SHANK3_uc010hbg.1_Missense_Mutation_p.R496G	NM_001080420	NP_001073889	F2Z3L0	F2Z3L0_HUMAN	SH3 and multiple ankyrin repeat domains 3	1314										central_nervous_system(1)	1		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		TGAGGAGACCAGGGAGGAGCT	0.677																0.153846	4.94147	6.430564	2	11	KEEP	---	---	---	---	2	0	12	5	-1	capture	Missense_Mutation	SNP	51160153	51160153	SHANK3	22	A	G	G	G	1	0	0	0	0	1	0	0	0	88	7	3	3	14159	257
DHX30	22907	broad.mit.edu	37	3	47882649	47882649	+	Missense_Mutation	SNP	G	A	A	rs138418233	by1000genomes	TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47882649G>A	uc003cru.2	+	7	1075	c.649G>A	c.(649-651)GCT>ACT	p.A217T	DHX30_uc003crs.2_Missense_Mutation_p.A178T|DHX30_uc003crt.2_Missense_Mutation_p.A178T|DHX30_uc010hjr.1_Missense_Mutation_p.A245T	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 30	217						mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GGATTCCCACGCTCCACTCAG	0.552																0.340426	45.883446	46.942346	16	31	KEEP	---	---	---	---	8	12	19	17	-1	capture	Missense_Mutation	SNP	47882649	47882649	DHX30	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4462	257
LAMP3	27074	broad.mit.edu	37	3	182872086	182872086	+	Missense_Mutation	SNP	A	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:182872086A>G	uc003flh.3	-	2	367	c.143T>C	c.(142-144)ATA>ACA	p.I48T		NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	48	Lumenal (Potential).				cell proliferation	integral to membrane|lysosomal membrane		p.I48T(1)		ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			AGGTTTTTTTATGTCCTGTAC	0.428																0.297872	316.810002	328.836303	98	231	KEEP	---	---	---	---	38	68	116	138	-1	capture	Missense_Mutation	SNP	182872086	182872086	LAMP3	3	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	8539	257
UTP3	57050	broad.mit.edu	37	4	71555475	71555475	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71555475G>A	uc003hfo.2	+	1	1280	c.1081G>A	c.(1081-1083)GTT>ATT	p.V361I		NM_020368	NP_065101	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit processome component	361					brain development|chromatin modification|gene silencing	nucleolus					0			Lung(101;0.235)			TGCCTGTGCTGTTACAGATCT	0.363																0.038095	-17.097917	7.142054	4	101	KEEP	---	---	---	---	2	2	47	60	-1	capture	Missense_Mutation	SNP	71555475	71555475	UTP3	4	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	16983	257
TRIML1	339976	broad.mit.edu	37	4	189068417	189068417	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:189068417C>T	uc003izm.1	+	6	1413	c.1298C>T	c.(1297-1299)CCG>CTG	p.P433L	TRIML1_uc003izn.1_Missense_Mutation_p.P157L	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	433	B30.2/SPRY.				multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		TACAGCTTCCCGCAGGCTTCT	0.522	Melanoma(31;213 1036 16579 23968 32372)															0.262673	155.021256	166.048301	57	160	KEEP	---	---	---	---	30	36	88	96	-1	capture	Missense_Mutation	SNP	189068417	189068417	TRIML1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16433	257
EGFLAM	133584	broad.mit.edu	37	5	38438444	38438444	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:38438444C>T	uc003jlc.1	+	17	2675	c.2351C>T	c.(2350-2352)GCG>GTG	p.A784V	EGFLAM_uc003jlb.1_Missense_Mutation_p.A784V|EGFLAM_uc003jle.1_Missense_Mutation_p.A550V|EGFLAM_uc003jlf.1_Missense_Mutation_p.A150V	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	784	Laminin G-like 2.|EGF-like 3.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					GTGGAGAATGCGGCCCACCCC	0.547	Colon(62;485 1295 3347 17454)															0.065217	-2.611408	6.418312	3	43	KEEP	---	---	---	---	0	3	22	28	-1	capture	Missense_Mutation	SNP	38438444	38438444	EGFLAM	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4921	257
IL31RA	133396	broad.mit.edu	37	5	55210699	55210699	+	Silent	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:55210699C>T	uc003jql.2	+	14	1826	c.1761C>T	c.(1759-1761)CCC>CCT	p.P587P	IL31RA_uc003jqm.2_Silent_p.P555P|IL31RA_uc003jqn.2_Silent_p.P587P|IL31RA_uc003jqo.2_Silent_p.P445P	NM_139017	NP_620586	Q8NI17	IL31R_HUMAN	gp130-like monocyte receptor	555	Cytoplasmic (Potential).				anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity			ovary(1)	1		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				TGTGTTGGCCCACCGTTCCCA	0.423																0.026087	-21.980546	6.600412	3	112	KEEP	---	---	---	---	2	1	61	78	-1	capture	Silent	SNP	55210699	55210699	IL31RA	5	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	7614	257
MAST4	375449	broad.mit.edu	37	5	66462447	66462447	+	Silent	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:66462447C>T	uc003jut.1	+	28	6941	c.6873C>T	c.(6871-6873)AGC>AGT	p.S2291S	MAST4_uc003juw.2_Silent_p.S2219S|MAST4_uc003jux.2_Silent_p.S44S	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	2483						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CAGCCAGCAGCGACACCTCTT	0.652					805									OREG0016638	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.428571	7.822773	7.854082	3	4	KEEP	---	---	---	---	1	3	3	2	-1	capture	Silent	SNP	66462447	66462447	MAST4	5	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	9240	257
TTC37	9652	broad.mit.edu	37	5	94838702	94838702	+	Missense_Mutation	SNP	C	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:94838702C>G	uc003klb.2	-	32	3493	c.3223G>C	c.(3223-3225)GAG>CAG	p.E1075Q		NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	1075	TPR 18.						binding			ovary(3)|pancreas(1)	4						AAGGCTCTCTCATAGGCTGTT	0.368																0.033333	-7.905537	6.346397	2	58	KEEP	---	---	---	---	0	4	33	39	-1	capture	Missense_Mutation	SNP	94838702	94838702	TTC37	5	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	16587	257
FBN2	2201	broad.mit.edu	37	5	127611828	127611828	+	Missense_Mutation	SNP	G	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127611828G>T	uc003kuu.2	-	59	7935	c.7496C>A	c.(7495-7497)CCG>CAG	p.P2499Q		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	2499	EGF-like 42; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCATGGTTTCGGGGACTGGGA	0.433					1552											0.248588	118.414866	128.589441	44	133	KEEP	---	---	---	---	20	29	69	82	0.408163265306	capture	Missense_Mutation	SNP	127611828	127611828	FBN2	5	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	5649	257
ATP10B	23120	broad.mit.edu	37	5	160047790	160047790	+	Silent	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:160047790C>T	uc003lym.1	-	15	2827	c.1980G>A	c.(1978-1980)TCG>TCA	p.S660S	ATP10B_uc010jit.1_5'UTR|ATP10B_uc003lyn.2_Silent_p.S218S	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	660	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCTCTCATCCGAGTCTGTGG	0.572																0.028302	-18.672388	7.305363	3	103	KEEP	---	---	---	---	2	1	53	63	-1	capture	Silent	SNP	160047790	160047790	ATP10B	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	1108	257
NKAPL	222698	broad.mit.edu	37	6	28228340	28228340	+	Silent	SNP	A	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28228340A>G	uc003nkt.2	+	1	1243	c.1191A>G	c.(1189-1191)AAA>AAG	p.K397K	ZKSCAN4_uc011dlb.1_5'Flank	NM_001007531	NP_001007532	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	397										upper_aerodigestive_tract(1)|ovary(1)	2						AAAAGACAAAAGAGAAAGATG	0.368																0.042254	-7.238926	8.734891	3	68	KEEP	---	---	---	---	2	1	40	43	-1	capture	Silent	SNP	28228340	28228340	NKAPL	6	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	10347	257
ZKSCAN3	80317	broad.mit.edu	37	6	28333384	28333384	+	Silent	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28333384G>A	uc003nle.3	+	6	1155	c.939G>A	c.(937-939)CGG>CGA	p.R313R	ZKSCAN3_uc010jrc.2_Silent_p.R313R|ZKSCAN3_uc003nlf.3_Silent_p.R165R|uc010jrd.2_5'Flank	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	313					positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						GAGGGAGGCGGCACATCTGCC	0.493																0.046154	-7.222914	7.057555	3	62	KEEP	---	---	---	---	2	1	41	26	-1	capture	Silent	SNP	28333384	28333384	ZKSCAN3	6	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	17568	257
MDC1	9656	broad.mit.edu	37	6	30671653	30671653	+	Silent	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30671653G>A	uc003nrg.3	-	10	5747	c.5307C>T	c.(5305-5307)GCC>GCT	p.A1769A	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Silent_p.A1376A	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1769	Required for nuclear localization (NLS2).				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						GCTCAGGAATGGCTGTAAGGG	0.542											Other_conserved_DNA_damage_response_genes					0.038462	-11.644798	6.313082	3	75	KEEP	---	---	---	---	1	2	33	49	-1	capture	Silent	SNP	30671653	30671653	MDC1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	9316	257
AIF1	199	broad.mit.edu	37	6	31584614	31584614	+	Silent	SNP	A	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31584614A>G	uc003nuy.2	+	6	455	c.381A>G	c.(379-381)AAA>AAG	p.K127K	AIF1_uc010jsy.2_3'UTR|AIF1_uc003nva.2_Silent_p.K73K	NM_001623	NP_001614	P55008	AIF1_HUMAN	allograft inflammatory factor 1 isoform 3	127					actin filament bundle assembly|cell cycle arrest|inflammatory response|negative regulation of cell proliferation	nucleus|ruffle membrane	actin filament binding|calcium ion binding			ovary(1)	1						ATGAGGAAAAAGCGAGAGAAA	0.493	Ovarian(23;358 734 36938 38933 52312)															0.0625	-3.019985	6.584865	3	45	KEEP	---	---	---	---	0	3	27	27	-1	capture	Silent	SNP	31584614	31584614	AIF1	6	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	424	257
C6orf70	55780	broad.mit.edu	37	6	170156477	170156477	+	Missense_Mutation	SNP	C	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:170156477C>A	uc003qxg.1	+	4	392	c.359C>A	c.(358-360)CCT>CAT	p.P120H	C6orf70_uc011ehb.1_Translation_Start_Site|C6orf70_uc003qxh.1_Missense_Mutation_p.P120H|C6orf70_uc010kky.1_Translation_Start_Site	NM_018341	NP_060811	Q5T6L9	CF070_HUMAN	hypothetical protein LOC55780	120						integral to membrane				ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.2e-22)|BRCA - Breast invasive adenocarcinoma(81;1.49e-07)|GBM - Glioblastoma multiforme(31;0.00191)		CTACAATCTCCTGCTATTTCT	0.348																0.025424	-22.560882	6.866363	3	115	KEEP	---	---	---	---	2	1	53	87	0.333333333333	capture	Missense_Mutation	SNP	170156477	170156477	C6orf70	6	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	2347	257
IQCE	23288	broad.mit.edu	37	7	2613077	2613077	+	Nonsense_Mutation	SNP	C	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2613077C>A	uc003smo.3	+	6	604	c.420C>A	c.(418-420)TAC>TAA	p.Y140*	IQCE_uc010ksm.1_Nonsense_Mutation_p.Y140*|IQCE_uc003sml.1_Nonsense_Mutation_p.Y140*|IQCE_uc011jvy.1_Nonsense_Mutation_p.Y124*|IQCE_uc011jvz.1_Nonsense_Mutation_p.Y75*|IQCE_uc003smk.3_Nonsense_Mutation_p.Y124*|IQCE_uc003smn.3_Nonsense_Mutation_p.Y75*	NM_152558	NP_689771	Q6IPM2	IQCE_HUMAN	IQ motif containing E isoform 1	140											0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		CTCCTGTCTACAGAGAAAAAG	0.343																0.034483	-13.856764	6.666611	3	84	KEEP	---	---	---	---	2	2	47	52	0.5	capture	Nonsense_Mutation	SNP	2613077	2613077	IQCE	7	C	A	A	A	1	0	0	0	0	0	1	0	0	220	17	5	4	7729	257
MMD2	221938	broad.mit.edu	37	7	4947054	4947054	+	Missense_Mutation	SNP	G	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4947054G>T	uc003sno.3	-	7	982	c.786C>A	c.(784-786)AGC>AGA	p.S262R	MMD2_uc003snl.1_Intron|MMD2_uc003snn.3_Missense_Mutation_p.S238R|MMD2_uc010ksq.2_3'UTR	NM_001100600	NP_001094070	Q8IY49	PAQRA_HUMAN	monocyte to macrophage	262	Extracellular (Potential).					integral to membrane	receptor activity			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		TCTGCAGGGTGCTGGGCAGAT	0.542																0.068493	-6.978392	21.147354	10	136	KEEP	---	---	---	---	6	7	72	90	0.461538461538	capture	Missense_Mutation	SNP	4947054	4947054	MMD2	7	G	T	T	T	1	0	0	0	0	1	0	0	0	594	46	4	4	9556	257
MLL3	58508	broad.mit.edu	37	7	151945049	151945049	+	Missense_Mutation	SNP	C	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151945049C>G	uc003wla.2	-	14	2689	c.2470G>C	c.(2470-2472)GGC>CGC	p.G824R		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	824					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TTACCCATGCCAATTTTTGGA	0.408	Colon(68;14 1149 1884 27689 34759)				1780	N		medulloblastoma								0.08	2.099487	110.101589	48	552	KEEP	---	---	---	---	24	28	292	321	-1	capture	Missense_Mutation	SNP	151945049	151945049	MLL3	7	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	9534	257
ARHGEF10	9639	broad.mit.edu	37	8	1871746	1871746	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:1871746C>T	uc003wpr.2	+	20	2550	c.2372C>T	c.(2371-2373)CCC>CTC	p.P791L	ARHGEF10_uc003wpq.1_Missense_Mutation_p.P815L|ARHGEF10_uc003wps.2_Missense_Mutation_p.P753L|ARHGEF10_uc003wpv.2_Missense_Mutation_p.P524L|ARHGEF10_uc010lre.2_Missense_Mutation_p.P471L	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	816					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		TTACAGCTTCCCGGGAAGCAG	0.423					2844											0.185185	78.605144	96.173055	35	154	KEEP	---	---	---	---	19	22	82	95	-1	capture	Missense_Mutation	SNP	1871746	1871746	ARHGEF10	8	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	887	257
CSPP1	79848	broad.mit.edu	37	8	68024278	68024278	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:68024278G>A	uc003xxi.2	+	11	1328	c.1297G>A	c.(1297-1299)GAG>AAG	p.E433K	CSPP1_uc003xxg.1_Missense_Mutation_p.E425K|CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_Missense_Mutation_p.E398K|CSPP1_uc003xxk.2_Missense_Mutation_p.E104K	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1	433	Potential.					centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ACAAATGGCTGAGCAACAGAG	0.353					669											0.033333	-14.559359	6.822682	3	87	KEEP	---	---	---	---	1	2	50	54	-1	capture	Missense_Mutation	SNP	68024278	68024278	CSPP1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	3927	257
SULF1	23213	broad.mit.edu	37	8	70512942	70512942	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70512942G>A	uc010lza.1	+	9	1556	c.839G>A	c.(838-840)CGC>CAC	p.R280H	SULF1_uc003xyd.2_Missense_Mutation_p.R280H|SULF1_uc003xye.2_Missense_Mutation_p.R280H|SULF1_uc003xyf.2_Missense_Mutation_p.R280H|SULF1_uc003xyg.2_Missense_Mutation_p.R280H|SULF1_uc003xyh.1_RNA	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	280					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			ATTCTACAGCGCAAAAGGCTC	0.433					473											0.019011	-60.170383	8.24712	5	258	KEEP	---	---	---	---	0	5	155	157	-1	capture	Missense_Mutation	SNP	70512942	70512942	SULF1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15260	257
ZFHX4	79776	broad.mit.edu	37	8	77617628	77617628	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:77617628G>A	uc003yav.2	+	2	1692	c.1305G>A	c.(1303-1305)ATG>ATA	p.M435I	ZFHX4_uc003yat.1_Missense_Mutation_p.M435I|ZFHX4_uc003yau.1_Missense_Mutation_p.M435I|ZFHX4_uc003yaw.1_Missense_Mutation_p.M435I	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	435						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTAGCAAGATGTCAGAGAGCA	0.488													HNSCC(33;0.089)			0.162162	11.624603	15.641697	6	31	KEEP	---	---	---	---	2	5	16	20	-1	capture	Missense_Mutation	SNP	77617628	77617628	ZFHX4	8	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	17515	257
RGS22	26166	broad.mit.edu	37	8	101018320	101018320	+	Silent	SNP	T	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:101018320T>C	uc003yjb.1	-	16	2574	c.2379A>G	c.(2377-2379)GAA>GAG	p.E793E	RGS22_uc003yja.1_Silent_p.E612E|RGS22_uc003yjc.1_Silent_p.E781E|RGS22_uc011lgz.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	793					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ACTGTCGAGTTTCTTCCACCA	0.373					790											0.338235	77.302016	78.876559	23	45	KEEP	---	---	---	---	5	18	14	38	-1	capture	Silent	SNP	101018320	101018320	RGS22	8	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	13197	257
ANKS6	203286	broad.mit.edu	37	9	101530526	101530526	+	Missense_Mutation	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101530526C>T	uc004ayu.2	-	11	2000	c.1979G>A	c.(1978-1980)AGC>AAC	p.S660N	ANKS6_uc004ayt.2_Missense_Mutation_p.S359N|ANKS6_uc004ayv.1_Missense_Mutation_p.S122N|ANKS6_uc004ayw.1_Missense_Mutation_p.S242N|ANKS6_uc004ayx.1_RNA|ANKS6_uc004ayy.1_RNA	NM_173551	NP_775822	Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain	660	Ser-rich.									ovary(2)	2		Acute lymphoblastic leukemia(62;0.0527)				ATTGTCTATGCTGCCACCTGA	0.438																0.08	1.929018	6.427919	2	23	KEEP	---	---	---	---	0	2	8	20	-1	capture	Missense_Mutation	SNP	101530526	101530526	ANKS6	9	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	686	257
OR13C4	138804	broad.mit.edu	37	9	107288582	107288582	+	Silent	SNP	T	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107288582T>C	uc011lvn.1	-	1	909	c.909A>G	c.(907-909)GTA>GTG	p.V303V		NM_001001919	NP_001001919	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C,	303	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TAGCAGCTTTTACATCTTTAT	0.373																0.203704	66.099334	74.891126	22	86	KEEP	---	---	---	---	10	12	32	55	-1	capture	Silent	SNP	107288582	107288582	OR13C4	9	T	C	C	C	1	0	0	0	0	0	0	0	1	782	61	3	3	10840	257
SARDH	1757	broad.mit.edu	37	9	136594905	136594905	+	Missense_Mutation	SNP	C	G	G	rs141160856	byFrequency	TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136594905C>G	uc004cep.3	-	6	1031	c.897G>C	c.(895-897)GAG>GAC	p.E299D	SARDH_uc004ceo.2_Missense_Mutation_p.E299D|SARDH_uc011mdn.1_Missense_Mutation_p.E299D|SARDH_uc011mdo.1_Missense_Mutation_p.E131D	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	299					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CCTCGATGCGCTCGGTGACGA	0.488																0.037037	-11.850566	6.984948	3	78	KEEP	---	---	---	---	4	1	47	50	-1	capture	Missense_Mutation	SNP	136594905	136594905	SARDH	9	C	G	G	G	1	0	0	0	0	1	0	0	0	363	28	4	4	13733	257
APOO	79135	broad.mit.edu	37	X	23899048	23899048	+	Missense_Mutation	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:23899048G>A	uc004dax.2	-	2	262	c.31C>T	c.(31-33)CCA>TCA	p.P11S	APOO_uc004daw.2_RNA|APOO_uc004day.3_RNA	NM_024122	NP_077027	Q9BUR5	APOO_HUMAN	apolipoprotein O precursor	11					lipid transport	high-density lipoprotein particle|integral to membrane|low-density lipoprotein particle|very-low-density lipoprotein particle					0						AGGCTGGCTGGCCCCACGGAC	0.458																0.393617	105.985171	106.905862	37	57	KEEP	---	---	---	---	16	25	30	37	-1	capture	Missense_Mutation	SNP	23899048	23899048	APOO	23	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	806	257
MAGEB3	4114	broad.mit.edu	37	X	30254384	30254384	+	Missense_Mutation	SNP	A	G	G			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30254384A>G	uc004dca.1	+	5	1080	c.343A>G	c.(343-345)ACA>GCA	p.T115A		NM_002365	NP_002356	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	115	MAGE.										0						AATCATGAAGACAAATATGTT	0.403																0.05298	-11.125852	20.732898	8	143	KEEP	---	---	---	---	13	12	75	77	-1	capture	Missense_Mutation	SNP	30254384	30254384	MAGEB3	23	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	9091	257
CXorf65	158830	broad.mit.edu	37	X	70324148	70324148	+	Silent	SNP	C	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70324148C>T	uc011mpo.1	-	5	440	c.426G>A	c.(424-426)CCG>CCA	p.P142P	CXorf65_uc011mpp.1_Silent_p.P94P	NM_001025265	NP_001020436	A6NEN9	CX065_HUMAN	hypothetical protein LOC158830	142										central_nervous_system(1)	1						CAAGTCTTACCGGGACACTCG	0.517																0.280702	46.175477	48.639519	16	41	KEEP	---	---	---	---	9	9	25	21	-1	capture	Silent	SNP	70324148	70324148	CXorf65	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4077	257
STAG2	10735	broad.mit.edu	37	X	123182854	123182854	+	Splice_Site	SNP	G	T	T			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123182854G>T	uc004etz.3	+	9	1159	c.820_splice	c.e9-1	p.L274_splice	STAG2_uc004eua.2_Splice_Site_p.L274_splice|STAG2_uc004eub.2_Splice_Site_p.L274_splice|STAG2_uc004euc.2_Splice_Site_p.L274_splice|STAG2_uc004eud.2_Splice_Site_p.L274_splice|STAG2_uc004eue.2_Splice_Site_p.L274_splice	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						TTTTTTTACAGCTTCAGGAAA	0.308																0.275862	60.259934	64.196928	24	63	KEEP	---	---	---	---	8	16	31	36	0.333333333333	capture	Splice_Site	SNP	123182854	123182854	STAG2	23	G	T	T	T	1	0	0	0	0	0	0	1	0	442	34	5	4	15133	257
SPANXN4	441525	broad.mit.edu	37	X	142121936	142121936	+	Silent	SNP	G	A	A			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142121936G>A	uc004fbv.3	+	2	301	c.204G>A	c.(202-204)GAG>GAA	p.E68E		NM_001009613	NP_001009613	Q5MJ08	SPXN4_HUMAN	SPANX family, member N4	68										ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					ATCAACTGGAGAATAACCAGC	0.413																0.166667	5.942027	7.20623	2	10	KEEP	---	---	---	---	2	0	3	7	-1	capture	Silent	SNP	142121936	142121936	SPANXN4	23	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	14885	257
BRCC3	79184	broad.mit.edu	37	X	154344437	154344437	+	Missense_Mutation	SNP	G	C	C			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154344437G>C	uc004fna.2	+	9	822	c.729G>C	c.(727-729)GAG>GAC	p.E243D	BRCC3_uc004fnb.2_Missense_Mutation_p.E218D	NM_024332	NP_077308	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	243					double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|positive regulation of DNA repair|response to X-ray	BRCA1-A complex|BRISC complex|nuclear ubiquitin ligase complex	enzyme regulator activity|metal ion binding|metallopeptidase activity|polyubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(3)|ovary(1)|large_intestine(1)|breast(1)	6	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCCAGGAGGAGCAGGATGCGT	0.333					82											0.064516	0.222925	6.333885	2	29	KEEP	---	---	---	---	2	0	11	18	-1	capture	Missense_Mutation	SNP	154344437	154344437	BRCC3	23	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	1488	257
ANKRD17	26057	broad.mit.edu	37	4	73951059	73951059	+	Frame_Shift_Del	DEL	C	-	-			TCGA-41-4097-01	TCGA-41-4097-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:73951059delC	uc003hgp.2	-	30	7183	c.7066delG	c.(7066-7068)GCAfs	p.A2356fs	ANKRD17_uc003hgo.2_Frame_Shift_Del_p.A2243fs|ANKRD17_uc003hgq.2_Frame_Shift_Del_p.A2105fs|ANKRD17_uc003hgr.2_Frame_Shift_Del_p.A2355fs	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	2356					interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CCAAGGGGTGCCCCAGGTCCG	0.463																0.20			48	197		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	73951059	73951059	ANKRD17	4	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	643	257
