Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CHD5	26038	broad.mit.edu	37	1	6184051	6184051	+	Silent	SNP	G	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6184051G>C	uc001amb.1	-	31	4756	c.4656C>G	c.(4654-4656)CCC>CCG	p.P1552P	CHD5_uc001alz.1_Silent_p.P409P|CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	1552					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CAGGGCTGGCGGGCACTGGTG	0.677					2304											0.230769	7.517881	8.38192	3	10	KEEP	---	---	---	---	1	4	8	7	-1	capture	Silent	SNP	6184051	6184051	CHD5	1	G	C	C	C	1	0	0	0	0	0	0	0	1	496	39	4	4	3294	268
PEX14	5195	broad.mit.edu	37	1	10555343	10555343	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:10555343C>G	uc001arn.2	+	2	70	c.49C>G	c.(49-51)CCA>GCA	p.P17A	PEX14_uc001arm.1_RNA|PEX14_uc009vmu.1_Missense_Mutation_p.P17A|PEX14_uc009vmv.2_5'UTR|PEX14_uc010oam.1_5'UTR|PEX14_uc010oan.1_Missense_Mutation_p.P17A|PEX14_uc001arl.2_RNA	NM_004565	NP_004556	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14	17					negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|protein homooligomerization|protein import into peroxisome matrix|transmembrane transport	integral to membrane|nucleus|peroxisomal membrane|protein complex	protein N-terminus binding|transcription corepressor activity			breast(1)	1	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		AAGCTCTACTCCAGGAAGTGA	0.428														OREG0013090	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.136986	19.797984	29.109113	10	63	KEEP	---	---	---	---	8	5	38	35	-1	capture	Missense_Mutation	SNP	10555343	10555343	PEX14	1	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	11645	268
UBR4	23352	broad.mit.edu	37	1	19412732	19412732	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19412732G>A	uc001bbi.2	-	101	14724	c.14720C>T	c.(14719-14721)GCC>GTC	p.A4907V	UBR4_uc010ocv.1_Missense_Mutation_p.A430V|UBR4_uc009vph.2_Missense_Mutation_p.A541V|UBR4_uc010ocw.1_Missense_Mutation_p.A571V|UBR4_uc001bbg.2_Missense_Mutation_p.A618V|UBR4_uc001bbh.2_Missense_Mutation_p.A616V	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	4907					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGCAGGGCGGCACTCTCCCA	0.607																0.072727	-3.942725	6.39926	4	51	KEEP	---	---	---	---	4	1	28	34	-1	capture	Missense_Mutation	SNP	19412732	19412732	UBR4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16786	268
FUCA1	2517	broad.mit.edu	37	1	24180899	24180899	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24180899C>T	uc001bie.2	-	5	965	c.920G>A	c.(919-921)CGT>CAT	p.R307H	FUCA1_uc009vqt.1_RNA	NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor	307					fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		CATGTCACGACGATAGCCCCA	0.378																0.211111	117.419813	138.270126	57	213	KEEP	---	---	---	---	34	31	124	134	-1	capture	Missense_Mutation	SNP	24180899	24180899	FUCA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6036	268
PTPRF	5792	broad.mit.edu	37	1	44084401	44084401	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44084401G>A	uc001cjr.2	+	26	4812	c.4472G>A	c.(4471-4473)CGC>CAC	p.R1491H	PTPRF_uc001cjs.2_Missense_Mutation_p.R1482H|PTPRF_uc001cju.2_Missense_Mutation_p.R880H|PTPRF_uc009vwt.2_Missense_Mutation_p.R1051H|PTPRF_uc001cjv.2_Missense_Mutation_p.R962H|PTPRF_uc001cjw.2_Missense_Mutation_p.R717H	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1491	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TACACTGTGCGCACCTTCGCA	0.572																0.211823	86.416585	102.006309	43	160	KEEP	---	---	---	---	21	31	91	92	-1	capture	Missense_Mutation	SNP	44084401	44084401	PTPRF	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12696	268
MUTYH	4595	broad.mit.edu	37	1	45797967	45797967	+	Silent	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:45797967C>T	uc001cnm.2	-	10	1011	c.795G>A	c.(793-795)CAG>CAA	p.Q265Q	MUTYH_uc009vxn.2_Silent_p.Q90Q|MUTYH_uc001cnf.2_Silent_p.Q240Q|MUTYH_uc009vxo.2_Silent_p.Q240Q|MUTYH_uc001cng.2_Silent_p.Q251Q|MUTYH_uc001cnj.2_Silent_p.Q148Q|MUTYH_uc001cni.2_Silent_p.Q240Q|MUTYH_uc001cnh.2_Silent_p.Q241Q|MUTYH_uc001cno.2_Silent_p.Q148Q|MUTYH_uc001cnk.2_Silent_p.Q125Q|MUTYH_uc010oll.1_Intron|MUTYH_uc001cnl.2_Silent_p.Q254Q|MUTYH_uc009vxp.2_Silent_p.Q268Q|MUTYH_uc001cnn.2_Silent_p.Q255Q	NM_012222	NP_036354	Q9UIF7	MUTYH_HUMAN	mutY homolog isoform 1	265					depurination|mismatch repair	nucleoplasm	4 iron, 4 sulfur cluster binding|DNA N-glycosylase activity|endonuclease activity|metal ion binding|MutSalpha complex binding				0	Acute lymphoblastic leukemia(166;0.155)					GGTCCACCAGCTGCTGGGCTA	0.597					162	Mis			colorectal		BER_DNA_glycosylases	MUTYH-associated_polyposis				0.109589	7.644245	18.665034	8	65	KEEP	---	---	---	---	7	2	30	40	-1	capture	Silent	SNP	45797967	45797967	MUTYH	1	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	9903	268
DENND2C	163259	broad.mit.edu	37	1	115167981	115167981	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115167981G>C	uc001efd.1	-	4	1327	c.625C>G	c.(625-627)CCT>GCT	p.P209A	DENND2C_uc001eez.2_RNA|DENND2C_uc001efc.1_Missense_Mutation_p.P209A	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	209										skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTGGCAAAGGATTTATGGAA	0.378																0.074349	7.27328	57.318296	20	249	KEEP	---	---	---	---	12	12	140	162	-1	capture	Missense_Mutation	SNP	115167981	115167981	DENND2C	1	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	4388	268
NBPF10	100132406	broad.mit.edu	37	1	145302676	145302676	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145302676G>T	uc001end.3	+	8	1149	c.1114G>T	c.(1114-1116)GCT>TCT	p.A372S	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_5'UTR|NBPF10_uc001emq.1_Missense_Mutation_p.A101S	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	372											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CCTGGTTCACGCTCAGGAACG	0.483																0.043011	-12.562072	8.249874	4	89	KEEP	---	---	---	---	3	3	91	77	0.5	capture	Missense_Mutation	SNP	145302676	145302676	NBPF10	1	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	10100	268
HIST2H3D	653604	broad.mit.edu	37	1	149785226	149785226	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:149785226G>C	uc010pbl.1	-	1	11	c.11C>G	c.(10-12)ACT>AGT	p.T4S	HIST2H2BF_uc010pbj.1_5'Flank|HIST2H2BF_uc010pbk.1_5'Flank|HIST2H2BF_uc001esr.2_5'Flank	NM_001123375	NP_001116847	Q71DI3	H32_HUMAN	histone cluster 2, H3d	4					blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding|protein binding				0						AGTCTGCTTAGTACGGGCCAT	0.567																0.189873	39.578218	46.682601	15	64	KEEP	---	---	---	---	7	11	50	46	-1	capture	Missense_Mutation	SNP	149785226	149785226	HIST2H3D	1	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	7106	268
FLG	2312	broad.mit.edu	37	1	152285914	152285914	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152285914C>A	uc001ezu.1	-	3	1484	c.1448G>T	c.(1447-1449)GGA>GTA	p.G483V	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	483	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCGGTCCGTCCATGGGCAGA	0.607												Ichthyosis				0.127473	57.808738	119.430486	58	397	KEEP	---	---	---	---	28	34	250	186	0.548387096774	capture	Missense_Mutation	SNP	152285914	152285914	FLG	1	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	5867	268
UBAP2L	9898	broad.mit.edu	37	1	154242707	154242707	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154242707C>T	uc001fep.3	+	27	3367	c.3200C>T	c.(3199-3201)TCC>TTC	p.S1067F	UBAP2L_uc010pel.1_Intron|UBAP2L_uc001feq.2_Intron|UBAP2L_uc001fer.2_Missense_Mutation_p.S280F|HAX1_uc001fet.2_5'Flank|HAX1_uc001fes.2_5'Flank|HAX1_uc010peo.1_5'Flank|HAX1_uc009wou.2_5'Flank|HAX1_uc009wov.2_5'Flank	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a	1067					binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CAGACCAGCTCCATCCCGCAG	0.562																0.071823	-7.874404	26.31507	13	168	KEEP	---	---	---	---	7	7	94	123	-1	capture	Missense_Mutation	SNP	154242707	154242707	UBAP2L	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	16720	268
SMG7	9887	broad.mit.edu	37	1	183486872	183486872	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183486872A>G	uc001gqg.2	+	4	351	c.229A>G	c.(229-231)AAG>GAG	p.K77E	SMG7_uc010pob.1_Missense_Mutation_p.K106E|SMG7_uc001gqf.2_Missense_Mutation_p.K77E|SMG7_uc001gqh.2_Missense_Mutation_p.K77E|SMG7_uc001gqi.2_Missense_Mutation_p.K35E|SMG7_uc010poc.1_Missense_Mutation_p.K35E	NM_173156	NP_775179	Q92540	SMG7_HUMAN	SMG-7 homolog isoform 1	77					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						AGGCCAGGCAAAGAATCGAGC	0.443																0.029851	-33.518173	15.249444	6	195	KEEP	---	---	---	---	5	2	95	118	-1	capture	Missense_Mutation	SNP	183486872	183486872	SMG7	1	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	14690	268
FAM196A	642938	broad.mit.edu	37	10	128974485	128974485	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:128974485G>A	uc001lju.1	-	1	216	c.175C>T	c.(175-177)CAG>TAG	p.Q59*	DOCK1_uc001ljt.2_Intron|DOCK1_uc010qun.1_Intron|FAM196A_uc010quo.1_Nonsense_Mutation_p.Q59*|FAM196A_uc001ljv.1_Nonsense_Mutation_p.Q59*|FAM196A_uc009yap.1_Nonsense_Mutation_p.Q59*	NM_001039762	NP_001034851	Q6ZSG2	F196A_HUMAN	hypothetical protein LOC642938	59										ovary(2)	2						GTGTCCCTCTGCTCATTCTGT	0.587																0.030172	-46.19205	10.041471	7	225	KEEP	---	---	---	---	3	6	118	131	-1	capture	Nonsense_Mutation	SNP	128974485	128974485	FAM196A	10	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	5480	268
LUZP2	338645	broad.mit.edu	37	11	25100153	25100153	+	Silent	SNP	A	G	G			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:25100153A>G	uc001mqs.2	+	12	1224	c.990A>G	c.(988-990)AAA>AAG	p.K330K	LUZP2_uc009yif.2_Silent_p.K244K|LUZP2_uc009yig.2_Silent_p.K288K	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor	330						extracellular region				ovary(1)|skin(1)	2						CCCCAGAAAAACCATTGACCA	0.348																0.113636	25.635448	45.063613	15	117	KEEP	---	---	---	---	9	9	71	68	-1	capture	Silent	SNP	25100153	25100153	LUZP2	11	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	9002	268
SPRYD5	84767	broad.mit.edu	37	11	55655555	55655555	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55655555G>T	uc010rip.1	+	4	647	c.555G>T	c.(553-555)AAG>AAT	p.K185N	SPRYD5_uc010riq.1_Missense_Mutation_p.K42N	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	185						intracellular	zinc ion binding				0		all_epithelial(135;0.226)				AATATCAGAAGATGCCTGCAT	0.398																0.141304	16.705008	28.135716	13	79	KEEP	---	---	---	---	9	8	59	61	0.529411764706	capture	Missense_Mutation	SNP	55655555	55655555	SPRYD5	11	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	15003	268
ARHGAP20	57569	broad.mit.edu	37	11	110495025	110495025	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:110495025T>C	uc001pkz.1	-	5	649	c.364A>G	c.(364-366)AAC>GAC	p.N122D	ARHGAP20_uc001pky.1_Missense_Mutation_p.N99D|ARHGAP20_uc009yyb.1_Missense_Mutation_p.N86D|ARHGAP20_uc001pla.1_Missense_Mutation_p.N86D	NM_020809	NP_065860	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	122	PH.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)|kidney(2)	5		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		atCTTAAAGTTATTGTTATAT	0.269																0.125	4.439883	6.636567	2	14	KEEP	---	---	---	---	0	2	5	9	-1	capture	Missense_Mutation	SNP	110495025	110495025	ARHGAP20	11	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	863	268
TMPRSS13	84000	broad.mit.edu	37	11	117789400	117789400	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:117789400C>T	uc001prs.1	-	2	268	c.175G>A	c.(175-177)GCA>ACA	p.A59T	TMPRSS13_uc009yzr.1_5'UTR|TMPRSS13_uc001prt.1_5'UTR|TMPRSS13_uc001pru.1_Missense_Mutation_p.A59T	NM_001077263	NP_001070731	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	59	4 X 5 AA repeats of T-P-P-G-R.|1-8.|12 X 5 AA repeats of A-S-P-A-[GLQR].|Cytoplasmic (Potential).|Ala-rich.				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			pancreas(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		GCTGGAGATGCCTGGGCTGGA	0.697																0.244444	48.084635	53.461766	22	68	KEEP	---	---	---	---	11	14	49	36	-1	capture	Missense_Mutation	SNP	117789400	117789400	TMPRSS13	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16128	268
TREH	11181	broad.mit.edu	37	11	118530175	118530175	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118530175T>C	uc001pty.1	-	12	1381	c.1336A>G	c.(1336-1338)ACT>GCT	p.T446A	TREH_uc009zaj.1_Missense_Mutation_p.T415A|TREH_uc001ptz.1_Missense_Mutation_p.T323A	NM_007180	NP_009111	O43280	TREA_HUMAN	trehalase precursor	446					polysaccharide digestion|trehalose catabolic process	anchored to plasma membrane	alpha,alpha-trehalase activity			pancreas(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.16e-05)		TACTGGTAAGTCAGGATCCGG	0.617														OREG0021385	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.222222	7.988209	9.269981	4	14	KEEP	---	---	---	---	3	2	7	9	-1	capture	Missense_Mutation	SNP	118530175	118530175	TREH	11	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	16352	268
CCND2	894	broad.mit.edu	37	12	4398029	4398029	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:4398029C>G	uc001qmo.2	+	4	898	c.593C>G	c.(592-594)CCA>CGA	p.P198R		NM_001759	NP_001750	P30279	CCND2_HUMAN	cyclin D2	198					cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding			haematopoietic_and_lymphoid_tissue(1)|breast(1)|kidney(1)	3			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			GCCATGTACCCACCGTCGATG	0.547					84	T	IGL@	NHL,CLL								0.113889	54.106281	107.040606	41	319	KEEP	---	---	---	---	18	31	179	208	-1	capture	Missense_Mutation	SNP	4398029	4398029	CCND2	12	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	2888	268
ACSM4	341392	broad.mit.edu	37	12	7470689	7470689	+	Missense_Mutation	SNP	G	A	A	rs79217312		TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7470689G>A	uc001qsx.1	+	5	832	c.832G>A	c.(832-834)GCC>ACC	p.A278T		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	278					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						GGTCAAGGCCGCCATTGGCAG	0.458																0.132075	15.37738	29.323225	14	92	KEEP	---	---	---	---	8	7	51	60	-1	capture	Missense_Mutation	SNP	7470689	7470689	ACSM4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	186	268
MRPS35	60488	broad.mit.edu	37	12	27908375	27908375	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:27908375G>A	uc001rih.2	+	8	1012	c.964G>A	c.(964-966)GTG>ATG	p.V322M	MRPS35_uc001rii.2_3'UTR	NM_021821	NP_068593	P82673	RT35_HUMAN	mitochondrial ribosomal protein S35 precursor	322					DNA damage response, detection of DNA damage	mitochondrial small ribosomal subunit					0	Lung SC(9;0.0873)					ACTATTAAATGTGACATGAAT	0.254																0.126866	39.042862	75.467822	34	234	KEEP	---	---	---	---	28	15	100	181	-1	capture	Missense_Mutation	SNP	27908375	27908375	MRPS35	12	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	9754	268
GLI1	2735	broad.mit.edu	37	12	57864118	57864118	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57864118G>A	uc001snx.2	+	12	1673	c.1595G>A	c.(1594-1596)CGC>CAC	p.R532H	GLI1_uc009zpq.2_Missense_Mutation_p.R404H	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	532					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			GTGTCCCGCCGCGTGGGCCCC	0.602	Pancreas(157;841 1936 10503 41495 50368)				277											0.208955	108.38216	129.394699	56	212	KEEP	---	---	---	---	30	34	120	141	-1	capture	Missense_Mutation	SNP	57864118	57864118	GLI1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6373	268
SLC6A15	55117	broad.mit.edu	37	12	85270346	85270346	+	Missense_Mutation	SNP	A	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85270346A>T	uc001szv.2	-	6	1290	c.797T>A	c.(796-798)ATT>AAT	p.I266N	SLC6A15_uc010sul.1_Missense_Mutation_p.I159N	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN	solute carrier family 6, member 15 isoform 1	266	Helical; Name=5; (Potential).				cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			pancreas(2)|ovary(1)	3						GAGGAAGCAAATAAGTACCAC	0.303																0.23913	87.508806	96.081257	33	105	KEEP	---	---	---	---	15	24	61	73	-1	capture	Missense_Mutation	SNP	85270346	85270346	SLC6A15	12	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	14570	268
KNTC1	9735	broad.mit.edu	37	12	123014673	123014673	+	Silent	SNP	T	G	G			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123014673T>G	uc001ucv.2	+	2	226	c.63T>G	c.(61-63)GGT>GGG	p.G21G	KNTC1_uc010taf.1_Silent_p.G21G	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	21					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TGAGTGTCGGTTCAAGAAAAG	0.403																0.147368	-3.65118	8.888526	14	81	KEEP	---	---	---	---	27	38	34	54	-1	capture	Silent	SNP	123014673	123014673	KNTC1	12	T	G	G	G	1	0	0	0	0	0	0	0	1	769	60	4	4	8348	268
ATP12A	479	broad.mit.edu	37	13	25263441	25263441	+	Silent	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25263441G>A	uc001upp.2	+	5	661	c.474G>A	c.(472-474)ACG>ACA	p.T158T	ATP12A_uc010aaa.2_Silent_p.T158T	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A	158	Helical; (Potential).				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	TCATTTTAACGGGGATCTTTG	0.537	Pancreas(156;1582 1935 18898 22665 26498)															0.125	27.517742	51.715778	22	154	KEEP	---	---	---	---	13	12	91	100	-1	capture	Silent	SNP	25263441	25263441	ATP12A	13	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	1113	268
TTC5	91875	broad.mit.edu	37	14	20767565	20767565	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20767565G>A	uc001vwt.2	-	4	496	c.439C>T	c.(439-441)CGT>TGT	p.R147C	TTC5_uc001vwu.2_Missense_Mutation_p.R4C	NM_138376	NP_612385	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	147					DNA repair	cytoplasm|nucleus	binding			ovary(1)	1	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		CGCAGCTGACGAAGCACCATT	0.493																0.178862	41.07073	53.014001	22	101	KEEP	---	---	---	---	13	12	51	58	-1	capture	Missense_Mutation	SNP	20767565	20767565	TTC5	14	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16593	268
ISM2	145501	broad.mit.edu	37	14	77948978	77948978	+	Silent	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:77948978G>A	uc001xtz.2	-	4	734	c.660C>T	c.(658-660)GCC>GCT	p.A220A	ISM2_uc001xua.2_Intron|ISM2_uc001xty.2_Silent_p.A132A|ISM2_uc010tvl.1_Silent_p.A139A	NM_199296	NP_954993	Q6H9L7	ISM2_HUMAN	isthmin 2 homolog isoform 1	220						extracellular region				skin(1)	1						TCGACACCTCGGCCTGGGGGT	0.622																0.104762	18.597331	51.220484	22	188	KEEP	---	---	---	---	15	11	122	104	-1	capture	Silent	SNP	77948978	77948978	ISM2	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7784	268
UNC13C	440279	broad.mit.edu	37	15	54542603	54542603	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:54542603G>A	uc002ack.2	+	6	3409	c.3409G>A	c.(3409-3411)GAA>AAA	p.E1137K		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1137	Phorbol-ester/DAG-type.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GAAATGCCACGAAAAGTGTCA	0.507					2691											0.096774	3.426884	18.564666	9	84	KEEP	---	---	---	---	4	6	47	46	-1	capture	Missense_Mutation	SNP	54542603	54542603	UNC13C	15	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16868	268
IGDCC3	9543	broad.mit.edu	37	15	65667680	65667680	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:65667680G>A	uc002aos.2	-	2	416	c.164C>T	c.(163-165)CCC>CTC	p.P55L		NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	55	Extracellular (Potential).|Ig-like C2-type 1.									ovary(3)	3						AGGCTGCCCGGGGACGGCAAC	0.582																0.078947	0.598233	7.475066	3	35	KEEP	---	---	---	---	1	2	11	34	-1	capture	Missense_Mutation	SNP	65667680	65667680	IGDCC3	15	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	7493	268
GRIN2A	2903	broad.mit.edu	37	16	9857171	9857171	+	Silent	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:9857171C>T	uc002czo.3	-	13	4778	c.4230G>A	c.(4228-4230)TCG>TCA	p.S1410S	GRIN2A_uc010uym.1_Silent_p.S1410S|GRIN2A_uc010uyn.1_3'UTR|GRIN2A_uc002czr.3_3'UTR	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1410	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TGGAACAGTACGATGCCGTTG	0.502					324											0.114943	7.38234	20.110945	10	77	KEEP	---	---	---	---	6	5	41	41	-1	capture	Silent	SNP	9857171	9857171	GRIN2A	16	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	6712	268
HYDIN	54768	broad.mit.edu	37	16	70917889	70917889	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:70917889C>T	uc002ezr.2	-	59	10038	c.9910G>A	c.(9910-9912)GGC>AGC	p.G3304S		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3305										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				GGGTCTCGGCCGGAGATATCG	0.532																0.253333	45.365157	49.458963	19	56	KEEP	---	---	---	---	12	11	32	38	-1	capture	Missense_Mutation	SNP	70917889	70917889	HYDIN	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7392	268
EIF4A1	1973	broad.mit.edu	37	17	7480924	7480924	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7480924C>A	uc002gho.1	+	16	2131	c.806C>A	c.(805-807)ACC>AAC	p.T269N	EIF4A1_uc002ghr.1_Missense_Mutation_p.T269N|EIF4A1_uc002ghq.1_Missense_Mutation_p.T269N|EIF4A1_uc002ghp.1_Missense_Mutation_p.T269N|SNORA67_uc010cml.1_5'Flank|CD68_uc002ghv.2_5'Flank|CD68_uc002ghu.2_5'Flank	NM_001416	NP_001407	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A	269	Helicase C-terminal.				nuclear-transcribed mRNA poly(A) tail shortening	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA cap binding|translation initiation factor activity			ovary(1)	1						TTGTATGAAACCCTGACCATC	0.537	Melanoma(120;278 1668 15796 27423 46368)				115											0.187166	73.674155	90.771059	35	152	KEEP	---	---	---	---	20	18	89	82	0.473684210526	capture	Missense_Mutation	SNP	7480924	7480924	EIF4A1	17	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	4979	268
PIK3R6	146850	broad.mit.edu	37	17	8741187	8741187	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8741187G>A	uc002glq.1	-	5	431	c.191C>T	c.(190-192)GCG>GTG	p.A64V	PIK3R6_uc002glr.1_RNA|PIK3R6_uc002gls.1_RNA	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	64					platelet activation	cytosol					0						CTGGCTTTCCGCCTGGAAAAC	0.587																0.108108	6.311284	23.242959	12	99	KEEP	---	---	---	---	1	11	55	61	-1	capture	Missense_Mutation	SNP	8741187	8741187	PIK3R6	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11826	268
MYH8	4626	broad.mit.edu	37	17	10316043	10316043	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10316043C>T	uc002gmm.2	-	13	1245	c.1150G>A	c.(1150-1152)GCT>ACT	p.A384T	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	384	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						GCCTTGTCAGCGACTGCAGAG	0.423												Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				0.233716	135.940554	152.881684	61	200	KEEP	---	---	---	---	34	34	120	113	-1	capture	Missense_Mutation	SNP	10316043	10316043	MYH8	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9951	268
ORMDL3	94103	broad.mit.edu	37	17	38080398	38080398	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38080398C>T	uc002htj.1	-	2	199	c.59G>A	c.(58-60)CGT>CAT	p.R20H	ORMDL3_uc002hti.1_RNA|ORMDL3_uc002htk.1_Missense_Mutation_p.R20H	NM_139280	NP_644809	Q8N138	ORML3_HUMAN	ORM1-like 3	20	Cytoplasmic (Potential).				ceramide metabolic process	integral to membrane|SPOTS complex	protein binding				0	Colorectal(19;0.000442)		Lung(15;0.0234)			CCAGATGCCACGGCTGTTCAT	0.602					24											0.235772	64.408532	72.264994	29	94	KEEP	---	---	---	---	19	13	54	57	-1	capture	Missense_Mutation	SNP	38080398	38080398	ORMDL3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11175	268
CNTNAP1	8506	broad.mit.edu	37	17	40837035	40837035	+	Silent	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40837035G>A	uc002iay.2	+	4	606	c.390G>A	c.(388-390)TCG>TCA	p.S130S	CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor	130	Extracellular (Potential).|F5/8 type C.				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		TGAACGAGTCGGCGGTGGTGC	0.478																0.222222	44.392559	50.753531	20	70	KEEP	---	---	---	---	13	12	44	45	-1	capture	Silent	SNP	40837035	40837035	CNTNAP1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3611	268
WIPI1	55062	broad.mit.edu	37	17	66449078	66449078	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:66449078C>T	uc010dey.2	-	2	227	c.136G>A	c.(136-138)GAG>AAG	p.E46K	WIPI1_uc002jhd.3_RNA|WIPI1_uc010wqo.1_Intron|WIPI1_uc002jhe.3_Intron	NM_017983	NP_060453	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting	46					macroautophagy|vesicle targeting, trans-Golgi to endosome	autophagic vacuole membrane|clathrin-coated vesicle|cytosol|endosome membrane|PAS complex|pre-autophagosomal structure membrane|trans-Golgi network	androgen receptor binding|estrogen receptor binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding				0						TCCAGCTGCTCCACAGAACTC	0.488																0.223684	39.23541	44.571206	17	59	KEEP	---	---	---	---	10	11	27	46	-1	capture	Missense_Mutation	SNP	66449078	66449078	WIPI1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	17251	268
GPR142	350383	broad.mit.edu	37	17	72368095	72368095	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72368095G>A	uc010wqy.1	+	4	745	c.745G>A	c.(745-747)GCC>ACC	p.A249T	GPR142_uc010wqx.1_Missense_Mutation_p.A161T	NM_181790	NP_861455	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	249	Helical; Name=3; (Potential).					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						AGTCTGGATCGCCATCCTGCT	0.692																0.24	26.180019	29.262469	12	38	KEEP	---	---	---	---	7	5	25	17	-1	capture	Missense_Mutation	SNP	72368095	72368095	GPR142	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6584	268
ST8SIA5	29906	broad.mit.edu	37	18	44260035	44260035	+	Silent	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:44260035G>A	uc002lcj.1	-	7	1669	c.1101C>T	c.(1099-1101)CGC>CGT	p.R367R	ST8SIA5_uc002lci.1_Silent_p.R214R|ST8SIA5_uc010xcy.1_Silent_p.R403R|ST8SIA5_uc010xcz.1_Silent_p.R336R	NM_013305	NP_037437	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide	367	Lumenal (Potential).				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						CCGTGTGCACGCGGAGGATGC	0.652																0.22449	23.199983	26.618268	11	38	KEEP	---	---	---	---	8	12	34	31	-1	capture	Silent	SNP	44260035	44260035	ST8SIA5	18	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	15125	268
CDH7	1005	broad.mit.edu	37	18	63430143	63430143	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:63430143C>T	uc002ljz.2	+	2	390	c.65C>T	c.(64-66)TCT>TTT	p.S22F	CDH7_uc002lka.2_Missense_Mutation_p.S22F|CDH7_uc002lkb.2_Missense_Mutation_p.S22F	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	22					adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				CTGTGTTTTTCTGGGATGAGT	0.433																0.103774	10.040515	26.610506	11	95	KEEP	---	---	---	---	6	5	57	53	-1	capture	Missense_Mutation	SNP	63430143	63430143	CDH7	18	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	3086	268
KLK15	55554	broad.mit.edu	37	19	51330305	51330305	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51330305G>A	uc002ptl.2	-	3	341	c.310C>T	c.(310-312)CGC>TGC	p.R104C	KLK15_uc002ptm.2_Missense_Mutation_p.R104C|KLK15_uc002ptn.2_Missense_Mutation_p.R104C|KLK15_uc002pto.2_Missense_Mutation_p.R103C|KLK15_uc010ych.1_RNA|KLK15_uc010yci.1_Missense_Mutation_p.R103C|KLK15_uc010eod.2_RNA	NM_017509	NP_059979	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15 isoform 4	104	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)|breast(1)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		ATGTCGTTGCGGTGGCTGCGC	0.697	Pancreas(140;10 2513 7143 9246)															0.270833	66.015949	70.558454	26	70	KEEP	---	---	---	---	17	28	56	77	-1	capture	Missense_Mutation	SNP	51330305	51330305	KLK15	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8323	268
NLRP5	126206	broad.mit.edu	37	19	56539657	56539657	+	Silent	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56539657C>T	uc002qmj.2	+	7	2058	c.2058C>T	c.(2056-2058)GAC>GAT	p.D686D	NLRP5_uc002qmi.2_Silent_p.D667D	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	686						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		ACACCCTGGACGCCTTCCACT	0.542																0.181452	78.763352	102.391446	45	203	KEEP	---	---	---	---	26	24	102	121	-1	capture	Silent	SNP	56539657	56539657	NLRP5	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10387	268
APOB	338	broad.mit.edu	37	2	21230333	21230333	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21230333C>T	uc002red.2	-	26	9535	c.9407G>A	c.(9406-9408)CGT>CAT	p.R3136H		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3136					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GTAAGGTAGACGCATTTCAGG	0.373																0.193548	90.034502	111.805266	48	200	KEEP	---	---	---	---	25	27	100	121	-1	capture	Missense_Mutation	SNP	21230333	21230333	APOB	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	778	268
NRXN1	9378	broad.mit.edu	37	2	50573861	50573861	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:50573861T>C	uc010fbp.2	-	1	1034	c.227A>G	c.(226-228)TAC>TGC	p.Y76C	NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	76	Extracellular (Potential).				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CGGTGACCTGTAGATTGCAAT	0.602																0.107438	16.294325	34.78509	13	108	KEEP	---	---	---	---	10	7	75	60	-1	capture	Missense_Mutation	SNP	50573861	50573861	NRXN1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	10572	268
SLC9A4	389015	broad.mit.edu	37	2	103141552	103141552	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103141552C>T	uc002tbz.3	+	10	2345	c.1888C>T	c.(1888-1890)CGC>TGC	p.R630C		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	630	Cytoplasmic (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						GATTCTGATCCGCCGCCAGAA	0.502																0.207547	164.178585	193.575382	77	294	KEEP	---	---	---	---	32	49	128	189	-1	capture	Missense_Mutation	SNP	103141552	103141552	SLC9A4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14608	268
LY75	4065	broad.mit.edu	37	2	160711043	160711043	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:160711043C>T	uc002ubc.3	-	18	2492	c.2423G>A	c.(2422-2424)CGT>CAT	p.R808H	LY75_uc002ubb.3_Missense_Mutation_p.R808H|LY75_uc010fos.2_Missense_Mutation_p.R808H	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	808	Extracellular (Potential).				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		AATTCCAGCACGGTCTAAAGA	0.363																0.109091	9.032956	25.674084	12	98	KEEP	---	---	---	---	6	7	52	53	-1	capture	Missense_Mutation	SNP	160711043	160711043	LY75	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9014	268
TGM3	7053	broad.mit.edu	37	20	2312692	2312692	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2312692C>T	uc002wfx.3	+	10	1475	c.1378C>T	c.(1378-1380)CTT>TTT	p.L460F		NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor	460					cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)	TTTGGGGAAACTTAAACCCAA	0.522																0.238636	107.754598	118.739974	42	134	KEEP	---	---	---	---	21	23	59	95	-1	capture	Missense_Mutation	SNP	2312692	2312692	TGM3	20	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	15716	268
RPRD1B	58490	broad.mit.edu	37	20	36687859	36687859	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36687859C>T	uc002xho.3	+	5	994	c.592C>T	c.(592-594)CGA>TGA	p.R198*		NM_021215	NP_067038	Q9NQG5	RPR1B_HUMAN	Regulation of nuclear pre-mRNA domain containing	198										pancreas(1)	1						TGCTACTGTCCGACAGAAAAT	0.433																0.095541	7.610269	33.379964	15	142	KEEP	---	---	---	---	6	10	65	90	-1	capture	Nonsense_Mutation	SNP	36687859	36687859	RPRD1B	20	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	13508	268
LBP	3929	broad.mit.edu	37	20	36995435	36995435	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36995435G>A	uc002xic.1	+	9	979	c.944G>A	c.(943-945)CGA>CAA	p.R315Q		NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor	315					acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				TCTAATATCCGACTGACCACC	0.537																0.196429	88.568961	107.810309	44	180	KEEP	---	---	---	---	28	28	108	124	-1	capture	Missense_Mutation	SNP	36995435	36995435	LBP	20	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8571	268
CHD6	84181	broad.mit.edu	37	20	40065924	40065924	+	Missense_Mutation	SNP	T	G	G			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:40065924T>G	uc002xka.1	-	27	4236	c.4058A>C	c.(4057-4059)CAG>CCG	p.Q1353P	CHD6_uc002xkb.1_Missense_Mutation_p.Q119P	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1353					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				CGTTTGTTTCTGGAGGCCATC	0.358																0.211982	113.035759	129.673999	46	171	KEEP	---	---	---	---	29	24	106	106	-1	capture	Missense_Mutation	SNP	40065924	40065924	CHD6	20	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	3295	268
KCNB1	3745	broad.mit.edu	37	20	48098620	48098620	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:48098620C>T	uc002xur.1	-	1	562	c.398G>A	c.(397-399)TGC>TAC	p.C133Y	KCNB1_uc002xus.1_Missense_Mutation_p.C133Y	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related	133	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GCGGGCCTGGCAGCAGGACTC	0.607																0.113636	11.232762	30.675634	15	117	KEEP	---	---	---	---	10	7	75	69	-1	capture	Missense_Mutation	SNP	48098620	48098620	KCNB1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	7934	268
KRTAP20-2	337976	broad.mit.edu	37	21	32007616	32007616	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:32007616C>T	uc011adg.1	+	1	34	c.34C>T	c.(34-36)CGT>TGT	p.R12C		NM_181616	NP_853647	Q3LI61	KR202_HUMAN	keratin associated protein 20-2	12						intermediate filament				central_nervous_system(1)	1						TGGTGGTCTGCGTTATGGCTA	0.517																0.134454	19.013904	34.442498	16	103	KEEP	---	---	---	---	14	8	69	82	-1	capture	Missense_Mutation	SNP	32007616	32007616	KRTAP20-2	21	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8457	268
POTEH	23784	broad.mit.edu	37	22	16279238	16279238	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:16279238T>C	uc010gqp.2	-	4	1037	c.985A>G	c.(985-987)ATC>GTC	p.I329V	POTEH_uc002zlg.1_RNA|POTEH_uc002zlh.1_Missense_Mutation_p.I48V|POTEH_uc002zlj.1_Missense_Mutation_p.I164V	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3	329	ANK 5.									skin(1)	1						TTTTTCTTGATTAAAAATTTC	0.338																0.04038	-107.767826	83.792003	34	808	KEEP	---	---	---	---	24	12	526	438	-1	capture	Missense_Mutation	SNP	16279238	16279238	POTEH	22	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	12168	268
PRODH	5625	broad.mit.edu	37	22	18912582	18912582	+	Missense_Mutation	SNP	G	A	A	rs147270439		TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:18912582G>A	uc010grl.2	-	4	663	c.649C>T	c.(649-651)CGC>TGC	p.R217C	PRODH_uc002zoj.3_Missense_Mutation_p.R107C|PRODH_uc002zol.3_Missense_Mutation_p.R107C|PRODH_uc002zok.3_Missense_Mutation_p.R217C	NM_016335	NP_057419	O43272	PROD_HUMAN	proline dehydrogenase 1	217					glutamate biosynthetic process|induction of apoptosis by oxidative stress|proline catabolic process	mitochondrial inner membrane|mitochondrial matrix	proline dehydrogenase activity			breast(1)	1					L-Proline(DB00172)	TCGATGCAGCGCAAGAATGTC	0.632																0.1875	17.152821	21.538328	9	39	KEEP	---	---	---	---	6	7	24	29	-1	capture	Missense_Mutation	SNP	18912582	18912582	PRODH	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12444	268
MAPK1	5594	broad.mit.edu	37	22	22142632	22142632	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22142632T>C	uc002zvn.2	-	6	1010	c.770A>G	c.(769-771)AAT>AGT	p.N257S	MAPK1_uc002zvo.2_Missense_Mutation_p.N257S|MAPK1_uc010gtk.1_Intron	NM_002745	NP_002736	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	257	Protein kinase.				activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)	AGCTTTTAAATTTATTATACA	0.353					164											0.271186	97.551283	103.120294	32	86	KEEP	---	---	---	---	19	13	43	47	-1	capture	Missense_Mutation	SNP	22142632	22142632	MAPK1	22	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	9184	268
TMPRSS6	164656	broad.mit.edu	37	22	37470715	37470715	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37470715C>T	uc003aqs.1	-	12	1517	c.1403G>A	c.(1402-1404)GGA>GAA	p.G468E	TMPRSS6_uc003aqt.1_Missense_Mutation_p.G459E	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	468	LDL-receptor class A 1.|Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						GACACAGAGTCCATTCACAGA	0.632																0.224138	30.358689	34.40565	13	45	KEEP	---	---	---	---	11	4	24	29	-1	capture	Missense_Mutation	SNP	37470715	37470715	TMPRSS6	22	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	16134	268
TRANK1	9881	broad.mit.edu	37	3	36898731	36898731	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:36898731C>T	uc003cgj.2	-	3	1002	c.700G>A	c.(700-702)GAC>AAC	p.D234N		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	784					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						TTATCGAAGTCCTGGAGGCAG	0.502																0.249077	323.534597	354.589696	135	407	KEEP	---	---	---	---	67	82	238	225	-1	capture	Missense_Mutation	SNP	36898731	36898731	TRANK1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	16337	268
CEP97	79598	broad.mit.edu	37	3	101451368	101451368	+	Missense_Mutation	SNP	T	G	G			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:101451368T>G	uc003dvk.1	+	6	625	c.598T>G	c.(598-600)TTG>GTG	p.L200V	CEP97_uc010hpm.1_Missense_Mutation_p.L166V|CEP97_uc011bhf.1_Missense_Mutation_p.L200V|CEP97_uc003dvl.1_5'UTR|CEP97_uc003dvm.1_Missense_Mutation_p.L38V	NM_024548	NP_078824	Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	200	LRR 8.					centrosome|nucleus	protein binding			ovary(2)	2						ATTGGAACAGTTGTCGATTAT	0.418																0.210937	78.960905	88.846401	27	101	KEEP	---	---	---	---	14	18	52	69	-1	capture	Missense_Mutation	SNP	101451368	101451368	CEP97	3	T	G	G	G	1	0	0	0	0	1	0	0	0	777	60	4	4	3231	268
TMPRSS7	344805	broad.mit.edu	37	3	111799811	111799811	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111799811G>T	uc010hqb.2	+	16	2204	c.2034G>T	c.(2032-2034)TGG>TGT	p.W678C	TMPRSS7_uc011bhr.1_Missense_Mutation_p.W533C	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	804	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2						ATGGAAAATGGATTTTGACTG	0.403																0.204225	112.369038	135.449555	58	226	KEEP	---	---	---	---	31	32	147	115	0.492063492063	capture	Missense_Mutation	SNP	111799811	111799811	TMPRSS7	3	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	16135	268
MECOM	2122	broad.mit.edu	37	3	168849257	168849257	+	Silent	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:168849257G>A	uc003ffi.3	-	3	278	c.9C>T	c.(7-9)AGC>AGT	p.S3S	MECOM_uc010hwk.1_Silent_p.S26S|MECOM_uc003ffj.3_Silent_p.S67S|MECOM_uc011bpi.1_Silent_p.S3S|MECOM_uc003ffn.3_Silent_p.S3S|MECOM_uc003ffk.2_Silent_p.S3S|MECOM_uc003ffl.2_Silent_p.S163S|MECOM_uc011bpj.1_Silent_p.S191S|MECOM_uc011bpk.1_5'UTR|MECOM_uc010hwn.2_Silent_p.S191S|MECOM_uc003ffm.1_Silent_p.S67S	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	3	Interaction with MAPK9, SMAD3 and probably SUV39H1.				apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						GATAGTCTTCGCTCTTCATGA	0.458					646											0.182796	27.264361	36.02277	17	76	KEEP	---	---	---	---	10	10	43	46	-1	capture	Silent	SNP	168849257	168849257	MECOM	3	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	9335	268
PIK3CA	5290	broad.mit.edu	37	3	178916854	178916854	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916854G>A	uc003fjk.2	+	2	398	c.241G>A	c.(241-243)GAA>AAA	p.E81K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	81	PI3K-ABD.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E81K(2)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AGAAAGGGAAGAATTTTTTGA	0.358	Colon(199;1504 1750 3362 26421 31210 32040)		57		621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.139785	41.318691	64.636118	26	160	KEEP	---	---	---	---	9	20	98	69	-1	capture	Missense_Mutation	SNP	178916854	178916854	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	11816	268
LAMP3	27074	broad.mit.edu	37	3	182870190	182870190	+	Silent	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:182870190G>A	uc003flh.3	-	3	1085	c.861C>T	c.(859-861)GGC>GGT	p.G287G		NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	287	Lumenal (Potential).				cell proliferation	integral to membrane|lysosomal membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			TCACAAATCCGCCCTGAAAAT	0.512																0.154882	69.279097	103.075985	46	251	KEEP	---	---	---	---	26	24	130	139	-1	capture	Silent	SNP	182870190	182870190	LAMP3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8539	268
LSG1	55341	broad.mit.edu	37	3	194373563	194373563	+	Silent	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:194373563C>T	uc003fui.2	-	8	1383	c.1068G>A	c.(1066-1068)CAG>CAA	p.Q356Q		NM_018385	NP_060855	Q9H089	LSG1_HUMAN	large subunit GTPase 1	356					nuclear export|protein transport	Cajal body|endoplasmic reticulum	GTP binding|hydrolase activity				0	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		AATTGTGTATCTGCCTCTTCT	0.507																0.131498	61.381593	104.559509	43	284	KEEP	---	---	---	---	24	23	157	148	-1	capture	Silent	SNP	194373563	194373563	LSG1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	8964	268
PCDH7	5099	broad.mit.edu	37	4	30725808	30725808	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:30725808T>C	uc003gsk.1	+	1	3772	c.2764T>C	c.(2764-2766)TTT>CTT	p.F922L	PCDH7_uc011bxw.1_Missense_Mutation_p.F875L|PCDH7_uc011bxx.1_Missense_Mutation_p.F922L	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	922	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						TCACGAAGACTTTTTTACACC	0.383																0.313725	107.468208	110.614915	32	70	KEEP	---	---	---	---	18	16	35	41	-1	capture	Missense_Mutation	SNP	30725808	30725808	PCDH7	4	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	11419	268
SMR3B	10879	broad.mit.edu	37	4	71255518	71255518	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71255518G>A	uc011cas.1	+	3	274	c.193G>A	c.(193-195)GCA>ACA	p.A65T	SMR3B_uc003hfh.2_Missense_Mutation_p.A65T	NM_006685	NP_006676	P02814	SMR3B_HUMAN	submaxillary gland androgen regulated protein 3	65	Poly-Pro.|Pro-rich.					extracellular space				skin(1)	1		all_hematologic(202;0.196)				TCCTCCTCCCGCACCCTATGG	0.602																0.27619	132.446497	141.927285	58	152	KEEP	---	---	---	---	36	34	93	81	-1	capture	Missense_Mutation	SNP	71255518	71255518	SMR3B	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14704	268
AFM	173	broad.mit.edu	37	4	74364954	74364954	+	Silent	SNP	T	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74364954T>A	uc003hhb.2	+	11	1444	c.1413T>A	c.(1411-1413)GTT>GTA	p.V471V		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	471	Albumin 3.				vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTGCCTGTGTTGATAATTTGG	0.383																0.278689	44.414546	47.130037	17	44	KEEP	---	---	---	---	5	14	30	16	-1	capture	Silent	SNP	74364954	74364954	AFM	4	T	A	A	A	1	0	0	0	0	0	0	0	1	808	63	4	4	361	268
KLHL8	57563	broad.mit.edu	37	4	88091238	88091238	+	Silent	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88091238G>A	uc011cdb.1	-	8	1915	c.1530C>T	c.(1528-1530)TAC>TAT	p.Y510Y	KLHL8_uc003hql.1_Silent_p.Y510Y|KLHL8_uc003hqm.1_Silent_p.Y434Y|KLHL8_uc003hqn.1_Silent_p.Y327Y|KLHL8_uc010ikj.1_Silent_p.Y159Y	NM_020803	NP_065854	Q9P2G9	KLHL8_HUMAN	kelch-like 8	510	Kelch 5.										0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CACCAACTACGTATAAGCAAC	0.358																0.125541	32.608096	64.252015	29	202	KEEP	---	---	---	---	22	14	106	121	-1	capture	Silent	SNP	88091238	88091238	KLHL8	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8315	268
ADH1A	124	broad.mit.edu	37	4	100208729	100208729	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:100208729G>A	uc003hur.1	-	2	183	c.112C>T	c.(112-114)CGT>TGT	p.R38C	uc003hum.1_Intron|ADH1A_uc011ceg.1_Missense_Mutation_p.R38C|ADH1A_uc010ilf.1_5'Flank|ADH1A_uc010ilg.1_Missense_Mutation_p.R38C	NM_000667	NP_000658	P07327	ADH1A_HUMAN	class I alcohol dehydrogenase, alpha subunit	38					ethanol oxidation|transcription, DNA-dependent|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|protein binding|zinc ion binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Fomepizole(DB01213)|NADH(DB00157)	ACCTTAATACGAACTTCATGG	0.348																0.203252	50.315611	60.367482	25	98	KEEP	---	---	---	---	15	12	67	40	-1	capture	Missense_Mutation	SNP	100208729	100208729	ADH1A	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	307	268
DCHS2	54798	broad.mit.edu	37	4	155241881	155241881	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155241881G>A	uc003inw.2	-	14	3305	c.3305C>T	c.(3304-3306)ACG>ATG	p.T1102M		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	1102	Cadherin 9.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AAATGGATTCGTGCCAGGGTT	0.453																0.081683	-4.546646	67.453413	33	371	KEEP	---	---	---	---	21	21	218	216	-1	capture	Missense_Mutation	SNP	155241881	155241881	DCHS2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4247	268
TLL1	7092	broad.mit.edu	37	4	166964454	166964454	+	Silent	SNP	T	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:166964454T>C	uc003irh.1	+	12	2054	c.1407T>C	c.(1405-1407)AAT>AAC	p.N469N	TLL1_uc011cjn.1_Silent_p.N469N|TLL1_uc011cjo.1_Silent_p.N293N	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	469	CUB 2.				cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TACGTAAAAATGAAGGACAGA	0.408																0.11041	44.605126	92.193637	35	282	KEEP	---	---	---	---	16	25	171	158	-1	capture	Silent	SNP	166964454	166964454	TLL1	4	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	15830	268
ANKRD55	79722	broad.mit.edu	37	5	55407551	55407551	+	Missense_Mutation	SNP	G	A	A	rs147414262	byFrequency	TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:55407551G>A	uc003jqu.2	-	10	1176	c.1024C>T	c.(1024-1026)CGG>TGG	p.R342W	ANKRD55_uc003jqt.2_Missense_Mutation_p.R54W	NM_024669	NP_078945	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55 isoform 1	341										skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				ACGTTGAACCGTCTCTCCTTC	0.512																0.093976	11.704728	80.480633	39	376	KEEP	---	---	---	---	14	27	216	216	-1	capture	Missense_Mutation	SNP	55407551	55407551	ANKRD55	5	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	676	268
FBN2	2201	broad.mit.edu	37	5	127729056	127729056	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127729056A>G	uc003kuu.2	-	10	1676	c.1237T>C	c.(1237-1239)TAT>CAT	p.Y413H	FBN2_uc003kuv.2_Missense_Mutation_p.Y380H	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	413	TB 2.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AGTCTGCGATATTCCTCTAGA	0.473					1552											0.164062	49.600385	63.311447	21	107	KEEP	---	---	---	---	10	12	48	66	-1	capture	Missense_Mutation	SNP	127729056	127729056	FBN2	5	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	5649	268
SPOCK1	6695	broad.mit.edu	37	5	136314406	136314406	+	Silent	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:136314406G>A	uc003lbo.2	-	10	1448	c.1257C>T	c.(1255-1257)GCC>GCT	p.A419A	SPOCK1_uc003lbp.2_Silent_p.A419A	NM_004598	NP_004589	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains	419					cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCTCTGTCACGGCTCGGGTGT	0.522																0.218069	171.372596	194.893304	70	251	KEEP	---	---	---	---	59	33	158	172	-1	capture	Silent	SNP	136314406	136314406	SPOCK1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	14971	268
PCDHA2	56146	broad.mit.edu	37	5	140174848	140174848	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140174848C>T	uc003lhd.2	+	1	405	c.299C>T	c.(298-300)GCG>GTG	p.A100V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.A100V|PCDHA2_uc011czy.1_Missense_Mutation_p.A100V	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	100	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCGGAGCGCGGAATGTAGC	0.542																0.111864	17.824842	61.754397	33	262	KEEP	---	---	---	---	22	19	156	144	-1	capture	Missense_Mutation	SNP	140174848	140174848	PCDHA2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11427	268
PCDHB6	56130	broad.mit.edu	37	5	140531524	140531524	+	Silent	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140531524G>A	uc003lir.2	+	1	1686	c.1686G>A	c.(1684-1686)CCG>CCA	p.P562P	PCDHB6_uc011dah.1_Silent_p.P426P	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	562	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTTGTACCCGCTGCAGAACG	0.726																0.21519	34.331746	40.249531	17	62	KEEP	---	---	---	---	12	16	65	53	-1	capture	Silent	SNP	140531524	140531524	PCDHB6	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11449	268
UNC5A	90249	broad.mit.edu	37	5	176301280	176301280	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176301280T>C	uc003mey.2	+	8	1283	c.1091T>C	c.(1090-1092)CTC>CCC	p.L364P	UNC5A_uc010jkg.1_Missense_Mutation_p.L324P	NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1 precursor	364	Cytoplasmic (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCCATCTGCTCACCATCCAG	0.642																0.031746	-20.490614	9.709273	4	122	KEEP	---	---	---	---	2	3	62	76	-1	capture	Missense_Mutation	SNP	176301280	176301280	UNC5A	5	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	16873	268
SKIV2L	6499	broad.mit.edu	37	6	31936254	31936254	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31936254G>A	uc003nyn.1	+	24	3397	c.3008G>A	c.(3007-3009)CGG>CAG	p.R1003Q	SKIV2L_uc011dou.1_Missense_Mutation_p.R845Q|SKIV2L_uc011dov.1_Missense_Mutation_p.R810Q|STK19_uc003nyt.2_5'Flank	NM_006929	NP_008860	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like homolog	1003						nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						CTCCGGGCCCGGAAGCTGGAG	0.632																0.234568	46.494754	51.708136	19	62	KEEP	---	---	---	---	13	10	27	46	-1	capture	Missense_Mutation	SNP	31936254	31936254	SKIV2L	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14252	268
DNAH8	1769	broad.mit.edu	37	6	38903432	38903432	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38903432A>G	uc003ooe.1	+	75	11471	c.10871A>G	c.(10870-10872)GAA>GGA	p.E3624G	DNAH8_uc003oog.1_Missense_Mutation_p.E73G|uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						AAGATGAAAGAACTTGAAGAT	0.308					2979											0.126005	85.973418	136.88552	47	326	KEEP	---	---	---	---	24	30	161	207	-1	capture	Missense_Mutation	SNP	38903432	38903432	DNAH8	6	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	4563	268
PKHD1	5314	broad.mit.edu	37	6	51497434	51497434	+	Missense_Mutation	SNP	A	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51497434A>T	uc003pah.1	-	65	11870	c.11594T>A	c.(11593-11595)CTG>CAG	p.L3865Q		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3865	Helical; (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CACAGAGGACAGGGAAGCAGC	0.478					1537											0.25	87.289869	95.013443	34	102	KEEP	---	---	---	---	29	19	65	72	-1	capture	Missense_Mutation	SNP	51497434	51497434	PKHD1	6	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	11874	268
ZNF679	168417	broad.mit.edu	37	7	63709526	63709526	+	Silent	SNP	C	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:63709526C>A	uc003tsx.2	+	2	300	c.31C>A	c.(31-33)CGA>AGA	p.R11R		NM_153363	NP_699194	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	11					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						CCCTGGAAGCCGAGAAATGGT	0.572																0.138889	21.870476	35.470293	15	93	KEEP	---	---	---	---	10	6	56	53	0.375	capture	Silent	SNP	63709526	63709526	ZNF679	7	C	A	A	A	1	0	0	0	0	0	0	0	1	295	23	4	4	17964	268
GATS	352954	broad.mit.edu	37	7	99821643	99821643	+	Silent	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99821643G>A	uc003uua.3	-	3	522	c.273C>T	c.(271-273)AAC>AAT	p.N91N	GATS_uc003uty.3_RNA|GATS_uc003utz.3_RNA|GATS_uc010lgt.2_RNA|GATS_uc011kjl.1_5'Flank|GATS_uc010lgu.2_RNA	NM_178831	NP_849153	Q8NAP1	GATS_HUMAN	GATS, stromal antigen 3 opposite strand	91											0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CGGACACCACGTTCAGGGCCA	0.622					9											0.14433	17.192071	29.01674	14	83	KEEP	---	---	---	---	12	7	56	67	-1	capture	Silent	SNP	99821643	99821643	GATS	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6204	268
C7orf53	286006	broad.mit.edu	37	7	112129963	112129963	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:112129963C>T	uc011kmq.1	+	4	490	c.355C>T	c.(355-357)CGA>TGA	p.R119*	C7orf53_uc003vgl.2_RNA|C7orf53_uc003vgm.2_Nonsense_Mutation_p.R119*	NM_001134468	NP_001127940	Q8N8F7	CG053_HUMAN	hypothetical protein LOC286006	119	Potential.					integral to membrane				ovary(1)	1						GATCGTAAAGCGACTCAACCA	0.388																0.172131	70.618651	95.396587	42	202	KEEP	---	---	---	---	28	20	100	125	-1	capture	Nonsense_Mutation	SNP	112129963	112129963	C7orf53	7	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	2379	268
PLXNA4	91584	broad.mit.edu	37	7	131817922	131817922	+	Silent	SNP	G	A	A	rs114567124	by1000genomes	TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131817922G>A	uc003vra.3	-	31	5704	c.5475C>T	c.(5473-5475)AGC>AGT	p.S1825S	PLXNA4_uc003vqz.3_Silent_p.S110S	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1825	Cytoplasmic (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						TGTCTTGGTCGCTGATGGCTG	0.507																0.2	88.274754	106.69399	44	176	KEEP	---	---	---	---	21	33	95	121	-1	capture	Silent	SNP	131817922	131817922	PLXNA4	7	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	12025	268
SVOPL	136306	broad.mit.edu	37	7	138305867	138305867	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138305867G>A	uc011kqh.1	-	13	1277	c.1277C>T	c.(1276-1278)ACG>ATG	p.T426M	SVOPL_uc003vue.2_Missense_Mutation_p.T274M	NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1	426						integral to membrane	transmembrane transporter activity				0						AGCGCGCATCGTGGTGGGGTA	0.597																0.055556	-9.385041	9.309686	5	85	KEEP	---	---	---	---	3	2	54	45	-1	capture	Missense_Mutation	SNP	138305867	138305867	SVOPL	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15312	268
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140453136A>T	uc003vwc.3	-	15	1860	c.1799T>A	c.(1798-1800)GTG>GAG	p.V600E		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	600	Protein kinase.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions).|V -> E (in sarcoma, colorectal adenocarcinoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis).		activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	p.V600E(16892)|p.V600?(325)|p.V600K(176)|p.V600R(36)|p.V600M(25)|p.V600A(23)|p.V600D(21)|p.V600G(11)|p.V600_K601>E(8)|p.T599_V600insTT(3)|p.T599_R603>I(2)|p.T599_V600>IAL(2)|p.V600L(2)|p.T599_V600insT(2)|p.V600_W604del(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insV(1)|p.T599_V600insDFGLAT(1)	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	TCGAGATTTCACTGTAGCTAG	0.368	Colon(40;35 892 2973 5743 27438)	V600E(UACC257_SKIN)|V600D(K029AX_SKIN)|V600E(HS695T_SKIN)|V600E(COLO679_SKIN)|V600E(BT474_BREAST)|V600E(IGR39_SKIN)|V600E(A101D_SKIN)|V600E(COLO783_SKIN)|V600E(IGR37_SKIN)|V600E(A375_SKIN)|V600E(WM793_SKIN)|V600E(COLO818_SKIN)|V600E(HS294T_SKIN)|V600E(SKMEL28_SKIN)|V600E(DU4475_BREAST)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(IGR1_SKIN)|V600E(SKHEP1_LIVER)|V600E(WM983B_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(RVH421_SKIN)|V600D(WM2664_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(SKMEL24_SKIN)|V600D(WM115_SKIN)|V600E(MALME3M_SKIN)|V600E(A673_BONE)|V600E(C32_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO800_SKIN)|V600E(COLO741_SKIN)|V600E(HS939T_SKIN)|V600E(COLO205_LARGE_INTESTINE)|V600E(K029AX_SKIN)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(SH4_SKIN)|V600E(WM88_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO849_SKIN)|V600E(MELHO_SKIN)|V600E(BHT101_THYROID)|V600E(G361_SKIN)|V600E(UACC62_SKIN)|V600E(BCPAP_THYROID)|V600E(8505C_THYROID)|V600E(SW1417_LARGE_INTESTINE)|V600E(COLO829_SKIN)|V600E(RKO_LARGE_INTESTINE)|V600E(A2058_SKIN)|V600E(RPMI7951_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(SKMEL5_SKIN)|V600E(ES2_OVARY)|V600E(LOXIMVI_SKIN)	61	p.V600E(G361-Tumor)|p.V600E(HT144-Tumor)|p.V600E(MDAMB361-Tumor)|p.V600E(COLO783-Tumor)|p.V600E(COLO201-Tumor)|p.V600E(8505C-Tumor)|p.V600E(COLO205-Tumor)|p.V600E(A673-Tumor)|p.V600E(WM88-Tumor)|p.V600E(LOXIMVI-Tumor)|p.V600D(WM2664-Tumor)|p.V600K(MDST8-Tumor)|p.V600E(HT29-Tumor)|p.V600E(CL34-Tumor)|p.V600E(COLO818-Tumor)|p.V600E(COLO741-Tumor)|p.V600E(LS411N-Tumor)|p.V600E(SKMEL28-Tumor)|p.V600E(NMCG1-Tumor)|p.V600E(MELHO-Tumor)|p.V600E(WM983B-Tumor)|p.V600E(OUMS23-Tumor)|p.V600E(NCIH854-Tumor)|p.V600E(IGR39-Tumor)|p.V600E(SKHEP1-Tumor)|p.V600E(COLO679-Tumor)|p.V600E(SKMEL5-Tumor)|p.V600E(UACC257-Tumor)|p.V600E(HS695T-Tumor)|p.V600E(A375-Tumor)|p.V600E(MALME3M-Tumor)|p.V600E(AM38-Tumor)|p.V600E(SIGM5-Tumor)|p.V600E(DBTRG05MG-Tumor)|p.V600E(8305C-Tumor)|p.V600E(SKMEL24-Tumor)|p.V600E(WM793-Tumor)|p.V600E(BCPAP-Tumor)|p.V600D(WM115-Tumor)|p.V600E(SNUC5-Tumor)|p.V600E(GCT-Tumor)|p.V600E(ES2-Tumor)|p.V600E(SW1417-Tumor)|p.V600E(MDAMB435S-Tumor)|p.V600E(HS294T-Tumor)|p.V600E(DU4475-Tumor)|p.V600E(C32-Tumor)|p.V600E(A101D-Tumor)|p.V600E(COLO829-Tumor)|p.V600E(SKMEL3-Tumor)|p.V600E(SKMEL1-Tumor)|p.V600E(WM1799-Tumor)|p.V600E(RKO-Tumor)|p.V600E(IGR37-Tumor)|p.V600E(K029AX-Tumor)|p.V600E(JHOM2B-Tumor)|p.V600E(SH4-Tumor)	451	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				0.101124	17.024451	45.275767	18	160	KEEP	---	---	---	---	12	8	95	87	-1	capture	Missense_Mutation	SNP	140453136	140453136	BRAF	7	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	1484	268
C7orf33	202865	broad.mit.edu	37	7	148288176	148288176	+	Silent	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148288176C>T	uc003wew.2	+	1	520	c.159C>T	c.(157-159)GGC>GGT	p.G53G		NM_145304	NP_660347	Q8WU49	CG033_HUMAN	hypothetical protein LOC202865	53										central_nervous_system(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			ACGTTAGGGGCGGTCCAGGTC	0.512																0.071429	-14.911438	27.661858	16	208	KEEP	---	---	---	---	8	9	103	157	-1	capture	Silent	SNP	148288176	148288176	C7orf33	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	2365	268
NPBWR1	2831	broad.mit.edu	37	8	53853296	53853296	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:53853296A>G	uc011ldu.1	+	1	829	c.829A>G	c.(829-831)ACC>GCC	p.T277A		NM_005285	NP_005276	P48145	NPBW1_HUMAN	G protein-coupled receptor 7	277	Extracellular (Potential).				synaptic transmission	plasma membrane	opioid receptor activity|protein binding			ovary(2)|breast(1)	3		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				GGCGCTCACCACCGACCTCCC	0.642																0.184615	24.474943	30.529852	12	53	KEEP	---	---	---	---	4	10	29	34	-1	capture	Missense_Mutation	SNP	53853296	53853296	NPBWR1	8	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	10475	268
KCNS2	3788	broad.mit.edu	37	8	99441064	99441064	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:99441064C>A	uc003yin.2	+	2	1207	c.857C>A	c.(856-858)ACT>AAT	p.T286N		NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	286	Extracellular (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			AGCACACCTACTTTAGCCAAC	0.557	Pancreas(138;844 2489 9202 24627)															0.25	131.508893	144.017033	55	165	KEEP	---	---	---	---	28	33	95	91	0.540983606557	capture	Missense_Mutation	SNP	99441064	99441064	KCNS2	8	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	8011	268
JAK2	3717	broad.mit.edu	37	9	5073770	5073770	+	Missense_Mutation	SNP	G	T	T	rs77375493		TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:5073770G>T	uc010mhm.2	+	13	1962	c.1849G>T	c.(1849-1851)GTC>TTC	p.V617F	JAK2_uc003ziw.2_Missense_Mutation_p.V617F	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2	617	Protein kinase 1.		V -> F (in PV and AML; associated with susceptibility to Budd-Chiari syndrome; somatic mutation in a high percentage of patients with essential thrombocythemia or myelofibrosis; leads to constitutive tyrosine phosphorylation activity that promotes cytokine hypersensitivity).		actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding	p.V617F(28228)|p.V617_C618>FR(2)|p.V617I(1)|p.V617V(1)	PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		TGGAGTATGTGTCTGTGGAGA	0.343		V617F(HEL9217_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	1	p.V617F(HEL-Tumor)|p.V617F(SET2-Tumor)|p.V617F(HEL92.1.7-Tumor)	432	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				0.041667	-22.126552	15.808403	7	161	KEEP	---	---	---	---	2	5	95	89	0.285714285714	capture	Missense_Mutation	SNP	5073770	5073770	JAK2	9	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	7861	268
FBP1	2203	broad.mit.edu	37	9	97367792	97367792	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:97367792C>A	uc004auw.3	-	6	1103	c.772G>T	c.(772-774)GTC>TTC	p.V258F	FBP1_uc010mrl.2_Missense_Mutation_p.V258F	NM_000507	NP_000498	P09467	F16P1_HUMAN	fructose-1,6-bisphosphatase 1	258					gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)			Adenosine monophosphate(DB00131)	CCTCCGTAGACCAGAGTGCGA	0.408	Ovarian(142;590 2466 25593 44496)															0.213483	42.072974	48.826151	19	70	KEEP	---	---	---	---	10	10	41	38	0.5	capture	Missense_Mutation	SNP	97367792	97367792	FBP1	9	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	5651	268
LHX2	9355	broad.mit.edu	37	9	126794913	126794913	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:126794913C>T	uc004boe.1	+	5	1887	c.1148C>T	c.(1147-1149)ACT>ATT	p.T383I	LHX2_uc010mwi.1_Missense_Mutation_p.T391I	NM_004789	NP_004780	P50458	LHX2_HUMAN	LIM homeobox protein 2	383						nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0						TCCGTCTTAACTTCTGTGCCT	0.592																0.138211	22.785266	38.361683	17	106	KEEP	---	---	---	---	10	7	57	56	-1	capture	Missense_Mutation	SNP	126794913	126794913	LHX2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	8691	268
PNPLA7	375775	broad.mit.edu	37	9	140374853	140374853	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140374853T>C	uc004cnf.2	-	22	2753	c.2416A>G	c.(2416-2418)ACG>GCG	p.T806A	C9orf167_uc011mew.1_Intron|PNPLA7_uc004cnd.1_Missense_Mutation_p.T72A|PNPLA7_uc004cne.1_Missense_Mutation_p.T72A|PNPLA7_uc011mfa.1_Missense_Mutation_p.T214A|PNPLA7_uc010ncj.1_Missense_Mutation_p.T831A	NM_152286	NP_689499	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	806					lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity			skin(1)	1	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		GGTGTGAGCGTGCCATCTACC	0.662																0.070175	-1.335952	9.521994	4	53	KEEP	---	---	---	---	2	2	31	27	-1	capture	Missense_Mutation	SNP	140374853	140374853	PNPLA7	9	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	12073	268
ARSF	416	broad.mit.edu	37	X	3021841	3021841	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3021841G>A	uc004cre.1	+	9	1362	c.1141G>A	c.(1141-1143)GTC>ATC	p.V381I	ARSF_uc004crf.1_Missense_Mutation_p.V381I	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	381						extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGGAATCCGCGTCCCAGGAAT	0.438																0.155779	47.990653	70.519681	31	168	KEEP	---	---	---	---	31	13	86	103	-1	capture	Missense_Mutation	SNP	3021841	3021841	ARSF	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	984	268
BRWD3	254065	broad.mit.edu	37	X	79999713	79999713	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:79999713C>T	uc004edt.2	-	8	894	c.631G>A	c.(631-633)GAT>AAT	p.D211N	BRWD3_uc004edo.2_5'UTR|BRWD3_uc004edp.2_Missense_Mutation_p.D40N|BRWD3_uc004edq.2_5'UTR|BRWD3_uc010nmj.1_5'UTR|BRWD3_uc004edr.2_5'UTR|BRWD3_uc004eds.2_5'UTR|BRWD3_uc004edu.2_5'UTR|BRWD3_uc004edv.2_5'UTR|BRWD3_uc004edw.2_5'UTR|BRWD3_uc004edx.2_5'UTR|BRWD3_uc004edy.2_5'UTR|BRWD3_uc004edz.2_5'UTR|BRWD3_uc004eea.2_5'UTR|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	211	WD 2.									ovary(4)	4						AGGCGTCCATCATCTGTAGCC	0.403																0.240909	119.458062	132.940804	53	167	KEEP	---	---	---	---	31	36	86	109	-1	capture	Missense_Mutation	SNP	79999713	79999713	BRWD3	23	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	1514	268
FATE1	89885	broad.mit.edu	37	X	150885868	150885868	+	Missense_Mutation	SNP	A	T	T			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:150885868A>T	uc004fex.2	+	2	315	c.231A>T	c.(229-231)AAA>AAT	p.K77N		NM_033085	NP_149076	Q969F0	FATE1_HUMAN	fetal and adult testis expressed transcript	77						endoplasmic reticulum|integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GACCCAAGAAAATGGTACTGT	0.562																0.228	118.939272	135.918754	57	193	KEEP	---	---	---	---	27	34	111	107	-1	capture	Missense_Mutation	SNP	150885868	150885868	FATE1	23	A	T	T	T	1	0	0	0	0	1	0	0	0	11	1	4	4	5639	268
KIAA1704	55425	broad.mit.edu	37	13	45580365	45580367	+	In_Frame_Del	DEL	GAT	-	-	rs138421508		TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:45580365_45580367delGAT	uc001uzq.2	+	3	353_355	c.250_252delGAT	c.(250-252)GATdel	p.D88del	KIAA1704_uc010tfo.1_RNA|KIAA1704_uc001uzr.1_In_Frame_Del_p.D88del|KIAA1704_uc001uzs.2_5'UTR|KIAA1704_uc001uzt.2_5'UTR	NM_018559	NP_061029	Q8IXQ4	K1704_HUMAN	hypothetical protein LOC55425	88	Poly-Asp.									pancreas(1)|skin(1)	2		Lung NSC(96;0.00143)|Prostate(109;0.0137)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000313)|BRCA - Breast invasive adenocarcinoma(63;0.126)		Ggatgatgacgatgatgatgatg	0.286																0.02			8	525		---	---	---	---						capture_indel	In_Frame_Del	DEL	45580365	45580367	KIAA1704	13	GAT	-	-	-	1	0	1	0	1	0	0	0	0	481	37	5	5	8174	268
CPD	1362	broad.mit.edu	37	17	28772878	28772881	+	Frame_Shift_Del	DEL	TTAA	-	-			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:28772878_28772881delTTAA	uc002hfb.1	+	12	2728_2731	c.2713_2716delTTAA	c.(2713-2718)TTAATTfs	p.L905fs	CPD_uc010wbo.1_Frame_Shift_Del_p.L658fs|CPD_uc010wbp.1_RNA	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor	905_906	Extracellular (Potential).|Carboxypeptidase-like 3.				proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						GTTTGAAACTTTAATTAAAGACCT	0.417																0.22			34	120		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	28772878	28772881	CPD	17	TTAA	-	-	-	1	0	1	0	1	0	0	0	0	829	64	5	5	3763	268
CD3EAP	10849	broad.mit.edu	37	19	45911859	45911861	+	In_Frame_Del	DEL	GAA	-	-			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45911859_45911861delGAA	uc002pbq.1	+	3	1121_1123	c.633_635delGAA	c.(631-636)CGGAAG>CGG	p.K217del	PPP1R13L_uc002pbo.2_5'Flank|PPP1R13L_uc002pbp.2_5'Flank|CD3EAP_uc002pbr.1_In_Frame_Del_p.K219del	NM_012099	NP_036231	O15446	RPA34_HUMAN	CD3E antigen, epsilon polypeptide associated	217	Poly-Lys.				rRNA transcription|transmembrane receptor protein tyrosine kinase signaling pathway	chromosome|RNA polymerase I transcription factor complex	DNA-directed RNA polymerase activity			large_intestine(2)|ovary(2)	4		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		TGGATGTGCGGAAGAAGAAGAAG	0.581																0.04			8	213		---	---	---	---						capture_indel	In_Frame_Del	DEL	45911859	45911861	CD3EAP	19	GAA	-	-	-	1	0	1	0	1	0	0	0	0	522	41	5	5	2983	268
ETAA1	54465	broad.mit.edu	37	2	67631223	67631226	+	Frame_Shift_Del	DEL	CAAA	-	-			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:67631223_67631226delCAAA	uc002sdz.1	+	5	1548_1551	c.1409_1412delCAAA	c.(1408-1413)TCAAACfs	p.S470fs		NM_019002	NP_061875	Q9NY74	ETAA1_HUMAN	ETAA16 protein	470_471						cytoplasm|nucleus				ovary(3)|large_intestine(1)	4						TCAAATAAATCAAACAAATTATCC	0.265																0.21			14	52		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	67631223	67631226	ETAA1	2	CAAA	-	-	-	1	0	1	0	1	0	0	0	0	377	29	5	5	5222	268
GALNT7	51809	broad.mit.edu	37	4	174235303	174235303	+	Frame_Shift_Del	DEL	A	-	-			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:174235303delA	uc003isz.3	+	9	1667	c.1584delA	c.(1582-1584)CCAfs	p.P528fs	GALNT7_uc011ckb.1_Frame_Shift_Del_p.P305fs	NM_017423	NP_059119	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	528	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(1)	1		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		ACCCTTTGCCACCCAAAAATG	0.393																0.14			25	150		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	174235303	174235303	GALNT7	4	A	-	-	-	1	0	1	0	1	0	0	0	0	67	6	5	5	6158	268
DLL1	28514	broad.mit.edu	37	6	170592139	170592140	+	Frame_Shift_Ins	INS	-	TC	TC			TCGA-76-4928-01	TCGA-76-4928-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:170592139_170592140insTC	uc003qxm.2	-	10	2572_2573	c.2102_2103insGA	c.(2101-2103)GACfs	p.D701fs		NM_005618	NP_005609	O00548	DLL1_HUMAN	delta-like 1 precursor	701	Cytoplasmic (Potential).				cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding			lung(4)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		GGTACTTGGTGTCTTTTGAAGT	0.485					187											0.11			35	287		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	170592139	170592140	DLL1	6	-	TC	TC	TC	1	0	1	1	0	0	0	0	0	620	48	5	5	4524	268
