Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
EPHB2	2048	broad.mit.edu	37	1	23110979	23110979	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:23110979G>A	uc009vqj.1	+	3	366	c.221G>A	c.(220-222)CGG>CAG	p.R74Q	EPHB2_uc001bge.2_Missense_Mutation_p.R74Q|EPHB2_uc001bgf.2_Missense_Mutation_p.R74Q|EPHB2_uc010odu.1_Missense_Mutation_p.R74Q	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor	74	Extracellular (Potential).				axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		AACTGGCTACGGACCAAGTTT	0.587					437							Hereditary_Prostate_Cancer				0.424242	44.447102	44.611727	14	19	KEEP	---	---	---	---	10	9	9	13	-1	capture	Missense_Mutation	SNP	23110979	23110979	EPHB2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5130	7
FLG	2312	broad.mit.edu	37	1	152279764	152279764	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152279764C>T	uc001ezu.1	-	3	7634	c.7598G>A	c.(7597-7599)CGT>CAT	p.R2533H		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2533	Ser-rich.|Filaggrin 15.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCATGGTGACGCGACCCTGA	0.592												Ichthyosis				0.319088	578.451592	598.872698	224	478	KEEP	---	---	---	---	135	133	255	292	-1	capture	Missense_Mutation	SNP	152279764	152279764	FLG	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5867	7
NRP1	8829	broad.mit.edu	37	10	33545336	33545336	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:33545336C>T	uc001iwx.3	-	5	1245	c.722G>A	c.(721-723)GGC>GAC	p.G241D	NRP1_uc001iwv.3_Missense_Mutation_p.G241D|NRP1_uc009xlz.2_Missense_Mutation_p.G241D|NRP1_uc001iww.3_Missense_Mutation_p.G60D|NRP1_uc001iwy.3_Missense_Mutation_p.G241D|NRP1_uc001iwz.2_Missense_Mutation_p.G241D|NRP1_uc001ixa.2_Missense_Mutation_p.G241D|NRP1_uc001ixb.1_Missense_Mutation_p.G241D|NRP1_uc001ixc.1_Missense_Mutation_p.G241D	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	241	Extracellular (Potential).|CUB 2.				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	GGAGAGAATGCCCGATGAGGA	0.483	Melanoma(104;886 1489 44640 45944 51153)															0.044944	-13.069674	6.676446	4	85	KEEP	---	---	---	---	3	1	47	39	-1	capture	Missense_Mutation	SNP	33545336	33545336	NRP1	10	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10567	7
CYP2C8	1558	broad.mit.edu	37	10	96827051	96827051	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:96827051C>T	uc001kkb.2	-	3	490	c.395G>A	c.(394-396)CGG>CAG	p.R132Q	CYP2C8_uc001kkc.2_RNA|CYP2C8_uc010qoa.1_Missense_Mutation_p.R62Q|CYP2C8_uc010qob.1_Missense_Mutation_p.R46Q|CYP2C8_uc010qoc.1_Missense_Mutation_p.R30Q|CYP2C8_uc010qod.1_Missense_Mutation_p.R46Q	NM_000770	NP_000761	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C,	132					exogenous drug catabolic process|organic acid metabolic process|oxidative demethylation|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|electron carrier activity|heme binding|oxygen binding				0		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Aminophenazone(DB01424)|Amiodarone(DB01118)|Amodiaquine(DB00613)|Benzphetamine(DB00865)|Carbamazepine(DB00564)|Cerivastatin(DB00439)|Diclofenac(DB00586)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lovastatin(DB00227)|Midazolam(DB00683)|Montelukast(DB00471)|Nicardipine(DB00622)|Paclitaxel(DB01229)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rifampin(DB01045)|Rosiglitazone(DB00412)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Tolbutamide(DB01124)|Torasemide(DB00214)|Tretinoin(DB00755)|Trimethoprim(DB00440)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zopiclone(DB01198)	CCCAAAATTCCGCAAGGTTGT	0.483																0.818841	391.847254	405.028702	113	25	KEEP	---	---	---	---	48	74	16	10	-1	capture	Missense_Mutation	SNP	96827051	96827051	CYP2C8	10	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4127	7
NEURL	9148	broad.mit.edu	37	10	105331407	105331407	+	Missense_Mutation	SNP	G	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105331407G>T	uc001kxh.2	+	3	887	c.477G>T	c.(475-477)GAG>GAT	p.E159D		NM_004210	NP_004201	O76050	NEU1A_HUMAN	neuralized-like	159	NHR 1.				nervous system development	perinuclear region of cytoplasm	zinc ion binding				0				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CGCTGCCTGAGGAGTTTGCCA	0.612																0.421053	23.497654	23.600741	8	11	KEEP	---	---	---	---	2	6	7	4	0.25	capture	Missense_Mutation	SNP	105331407	105331407	NEURL	10	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	10252	7
MUC2	4583	broad.mit.edu	37	11	1080301	1080301	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1080301G>A	uc001lsx.1	+	8	1048	c.1021G>A	c.(1021-1023)GGG>AGG	p.G341R		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	341	TIL.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGACGACATCGGGGACAGTGG	0.642																0.363636	12.697555	12.877301	4	7	KEEP	---	---	---	---	2	4	9	7	-1	capture	Missense_Mutation	SNP	1080301	1080301	MUC2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9885	7
OR5M11	219487	broad.mit.edu	37	11	56310330	56310330	+	Missense_Mutation	SNP	G	C	C			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56310330G>C	uc010rjl.1	-	1	404	c.404C>G	c.(403-405)ACG>AGG	p.T135R		NM_001005245	NP_001005245	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M,	135	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCTCCTGGACGTTTTCACACT	0.498																0.434783	67.080799	67.253212	20	26	KEEP	---	---	---	---	11	11	10	18	-1	capture	Missense_Mutation	SNP	56310330	56310330	OR5M11	11	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	11078	7
UVRAG	7405	broad.mit.edu	37	11	75590966	75590966	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:75590966G>A	uc001oxc.2	+	4	555	c.314G>A	c.(313-315)CGT>CAT	p.R105H	UVRAG_uc010rrw.1_Missense_Mutation_p.R4H	NM_003369	NP_003360	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	105	C2.				DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6						ATGCCAGACCGTCTTGATACA	0.423																0.394366	585.219404	590.094649	196	301	KEEP	---	---	---	---	105	105	158	185	-1	capture	Missense_Mutation	SNP	75590966	75590966	UVRAG	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16990	7
NOP2	4839	broad.mit.edu	37	12	6675301	6675301	+	Missense_Mutation	SNP	T	G	G			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6675301T>G	uc001qpk.1	-	4	484	c.440A>C	c.(439-441)GAC>GCC	p.D147A	NOP2_uc009zeq.1_5'Flank|NOP2_uc001qph.1_Missense_Mutation_p.D143A|NOP2_uc001qpi.1_Missense_Mutation_p.D143A|NOP2_uc001qpj.1_Intron|NOP2_uc001qpl.1_Missense_Mutation_p.D147A|NOP2_uc001qpm.1_Missense_Mutation_p.D147A			P46087	NOP2_HUMAN	Homo sapiens cDNA FLJ31646 fis, clone NT2RI2003921, highly similar to PROLIFERATING-CELL NUCLEOLAR ANTIGEN P120.	147					positive regulation of cell proliferation|rRNA processing	nucleolus	protein binding|RNA binding|S-adenosylmethionine-dependent methyltransferase activity			ovary(2)	2						AGAGTTGGAGTCAGCTCCATA	0.488																0.484848	59.203397	59.209753	16	17	KEEP	---	---	---	---	9	9	7	11	-1	capture	Missense_Mutation	SNP	6675301	6675301	NOP2	12	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	10445	7
ATP8A2	51761	broad.mit.edu	37	13	26349058	26349058	+	Missense_Mutation	SNP	G	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:26349058G>T	uc001uqk.2	+	27	2782	c.2640G>T	c.(2638-2640)TTG>TTT	p.L880F	ATP8A2_uc010tdi.1_Missense_Mutation_p.L840F|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.L430F	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	840	Helical; (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		AGTGCATCTTGTACTGCTTCT	0.388																0.028249	-33.091791	10.306724	5	172	KEEP	---	---	---	---	2	4	94	107	0.333333333333	capture	Missense_Mutation	SNP	26349058	26349058	ATP8A2	13	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	1184	7
SIX4	51804	broad.mit.edu	37	14	61189964	61189964	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:61189964G>A	uc001xfc.2	-	1	829	c.829C>T	c.(829-831)CGC>TGC	p.R277C	SIX4_uc010app.1_Missense_Mutation_p.R269C	NM_017420	NP_059116	Q9UIU6	SIX4_HUMAN	sine oculis homeobox homolog 4	277	Homeobox.					nucleus				breast(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		TTCCTGTCGCGCTGCCGGCGG	0.502					127											0.083333	0.297591	6.649185	3	33	KEEP	---	---	---	---	0	3	27	35	-1	capture	Missense_Mutation	SNP	61189964	61189964	SIX4	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14242	7
ACOT1	641371	broad.mit.edu	37	14	74008216	74008216	+	Silent	SNP	C	G	G	rs142030871	by1000genomes	TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74008216C>G	uc001xol.1	+	2	675	c.477C>G	c.(475-477)GGC>GGG	p.G159G	HEATR4_uc010tua.1_Intron|ACOT1_uc010tuc.1_Silent_p.G159G	NM_001037161	NP_001032238	Q86TX2	ACOT1_HUMAN	acyl-CoA thioesterase 1	159					acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	cytosol	carboxylesterase activity|palmitoyl-CoA hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(108;1.37e-45)|BRCA - Breast invasive adenocarcinoma(234;0.0033)		CCTTTCCTGGCATTGTGGACA	0.363																0.022936	-43.414266	11.84588	5	213	KEEP	---	---	---	---	3	2	132	116	-1	capture	Silent	SNP	74008216	74008216	ACOT1	14	C	G	G	G	1	0	0	0	0	0	0	0	1	314	25	4	4	148	7
AGBL1	123624	broad.mit.edu	37	15	86838560	86838560	+	Silent	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:86838560G>A	uc002blz.1	+	16	2237	c.2157G>A	c.(2155-2157)ACG>ACA	p.T719T	AGBL1_uc002bma.1_Silent_p.T450T|AGBL1_uc002bmb.1_Silent_p.T413T	NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	719					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						TCTGCCAGACGCTGGGAGGGA	0.507																0.036036	-18.776992	7.141727	4	107	KEEP	---	---	---	---	3	1	55	58	-1	capture	Silent	SNP	86838560	86838560	AGBL1	15	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	375	7
ACSM2B	348158	broad.mit.edu	37	16	20548636	20548636	+	Nonsense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20548636G>A	uc002dhj.3	-	15	1888	c.1678C>T	c.(1678-1680)CGA>TGA	p.R560*	ACSM2B_uc002dhk.3_Nonsense_Mutation_p.R560*	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	560					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						AGTTTGGTTCGTTGAATTTTC	0.473																0.400458	524.985474	528.785961	175	262	KEEP	---	---	---	---	97	99	160	146	-1	capture	Nonsense_Mutation	SNP	20548636	20548636	ACSM2B	16	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	184	7
CACNG3	10368	broad.mit.edu	37	16	24366257	24366257	+	Silent	SNP	C	T	T	rs147734423		TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24366257C>T	uc002dmf.2	+	3	1599	c.399C>T	c.(397-399)AAC>AAT	p.N133N		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	133					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		GCAGACACAACGTCATTCTCA	0.587																0.481481	82.059746	82.074971	26	28	KEEP	---	---	---	---	18	20	14	26	-1	capture	Silent	SNP	24366257	24366257	CACNG3	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2534	7
ITGAM	3684	broad.mit.edu	37	16	31286996	31286996	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31286996C>T	uc002ebq.2	+	9	1083	c.985C>T	c.(985-987)CGG>TGG	p.R329W	ITGAM_uc002ebr.2_Missense_Mutation_p.R329W|ITGAM_uc010cam.1_5'UTR	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	329	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						GAACCAGCTTCGGGAGAAGAT	0.542																0.385542	96.482566	97.434892	32	51	KEEP	---	---	---	---	17	18	29	27	-1	capture	Missense_Mutation	SNP	31286996	31286996	ITGAM	16	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	7810	7
HYDIN	54768	broad.mit.edu	37	16	71004595	71004595	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:71004595C>T	uc002ezr.2	-	36	5572	c.5444G>A	c.(5443-5445)CGT>CAT	p.R1815H		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	1816										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				ACCTTGCCCACGTGCCAGGAG	0.507																0.386364	48.864176	49.362343	17	27	KEEP	---	---	---	---	15	21	28	42	-1	capture	Missense_Mutation	SNP	71004595	71004595	HYDIN	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7392	7
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	T	T	rs11540652		TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577538C>T	uc002gim.2	-	7	937	c.743G>A	c.(742-744)CGG>CAG	p.R248Q	TP53_uc002gig.1_Missense_Mutation_p.R248Q|TP53_uc002gih.2_Missense_Mutation_p.R248Q|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116Q|TP53_uc010cng.1_Missense_Mutation_p.R116Q|TP53_uc002gii.1_Missense_Mutation_p.R116Q|TP53_uc010cnh.1_Missense_Mutation_p.R248Q|TP53_uc010cni.1_Missense_Mutation_p.R248Q|TP53_uc002gij.2_Missense_Mutation_p.R248Q|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155Q|TP53_uc002gio.2_Missense_Mutation_p.R116Q	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(523)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.R155Q(4)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GATGGGCCTCCGGTTCATGCC	0.572	Pancreas(47;798 1329 9957 10801)	R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIN87_STOMACH)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NIHOVCAR3_OVARY)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(HCC70_BREAST)|R248Q(KYSE150_OESOPHAGUS)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PC14_LUNG)	111	p.R248L(NCIH211-Tumor)|p.R248L(NB4-Tumor)|p.R248L(PC14-Tumor)|p.R248L(KYO1-Tumor)|p.R248L(PCM6-Tumor)|p.R248L(NUDHL1-Tumor)|p.R248L(BL41-Tumor)|p.R248Q(FADU-Tumor)|p.R248L(CI1-Tumor)|p.R248L(SW1463-Tumor)|p.R248L(COLO699-Tumor)|p.R248L(HS683-Tumor)|p.R248*(DB-Tumor)|p.R248L(HCC1143-Tumor)|p.R248L(NCIN87-Tumor)|p.R248A(SF126-Tumor)|p.R248L(PANC02.03-Tumor)|p.R248L(HEC1B-Tumor)|p.R248L(PECAPJ15-Tumor)|p.R248L(LNCAPCLONEFGC-Tumor)|p.R248L(NIHOVCAR3-Tumor)|p.R248L(NUDUL1-Tumor)|p.R248L(ONCODG1-Tumor)|p.R248L(RT112-Tumor)|p.R248L(SF295-Tumor)|p.R248L(P12ICHIKAWA-Tumor)|p.R248L(DND41-Tumor)|p.R248Q(SBC5-Tumor)|p.R248L(KOPN8-Tumor)|p.R248L(KASUMI1-Tumor)|p.R248L(EM2-Tumor)|p.R248L(SKUT1-Tumor)|p.R248L(NCCSTCK140-Tumor)|p.R248L(TE6-Tumor)|p.R248L(MOLM6-Tumor)|p.R248L(SEM-Tumor)|p.R248L(NAMALWA-Tumor)|p.R248L(CA46-Tumor)|p.R248L(639V-Tumor)|p.R248L(SKM1-Tumor)|p.R248Q(NCIH1573-Tumor)|p.R248Q(NCIH1618-Tumor)|p.R248L(HCC70-Tumor)|p.R248L(WSUDLCL2-Tumor)|p.R248L(HEC1A-Tumor)|p.R248L(KYSE150-Tumor)|p.R248L(HSC4-Tumor)|p.R248L(CL40-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.338235	67.801262	69.376158	23	45	KEEP	---	---	---	---	12	14	26	24	-1	capture	Missense_Mutation	SNP	7577538	7577538	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16264	7
TP53	7157	broad.mit.edu	37	17	7578550	7578550	+	Missense_Mutation	SNP	G	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578550G>T	uc002gim.2	-	5	574	c.380C>A	c.(379-381)TCC>TAC	p.S127Y	TP53_uc002gig.1_Missense_Mutation_p.S127Y|TP53_uc002gih.2_Missense_Mutation_p.S127Y|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'UTR|TP53_uc010cng.1_5'UTR|TP53_uc002gii.1_5'UTR|TP53_uc010cnh.1_Missense_Mutation_p.S127Y|TP53_uc010cni.1_Missense_Mutation_p.S127Y|TP53_uc002gij.2_Missense_Mutation_p.S127Y|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.S34Y|TP53_uc002gio.2_5'UTR|TP53_uc010vug.1_Missense_Mutation_p.S88Y	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	127	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		S -> C (in a sporadic cancer; somatic mutation).|S -> F (in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).|S -> P (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.S127F(18)|p.S127Y(8)|p.0?(7)|p.Y126_K132delYSPALNK(6)|p.Y126_N131delYSPALN(3)|p.S127P(3)|p.S127T(2)|p.P128fs*42(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.P128fs*18(1)|p.Y126fs*11(1)|p.S127S(1)|p.S127C(1)|p.S127_Q136del10(1)|p.P13fs*18(1)|p.?(1)|p.S127fs*43(1)|p.S127fs*42(1)|p.Y126fs*18(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GAGGGCAGGGGAGTACTGTAG	0.552	Pancreas(47;798 1329 9957 10801)		111	(CORL279-Tumor)|p.S127F(SNU410-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.47619	58.2078	58.22748	20	22	KEEP	---	---	---	---	11	10	12	11	0.52380952381	capture	Missense_Mutation	SNP	7578550	7578550	TP53	17	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	16264	7
AMAC1	146861	broad.mit.edu	37	17	33520323	33520323	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33520323C>T	uc002hjd.2	-	1	1090	c.1004G>A	c.(1003-1005)AGG>AAG	p.R335K		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	335						integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		CTCCTCCACCCTCCCTGTCCT	0.557																0.030928	-16.735022	6.623653	3	94	KEEP	---	---	---	---	1	3	48	53	-1	capture	Missense_Mutation	SNP	33520323	33520323	AMAC1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	559	7
WNT3	7473	broad.mit.edu	37	17	44851175	44851175	+	Missense_Mutation	SNP	T	C	C			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:44851175T>C	uc002ikv.2	-	2	300	c.181A>G	c.(181-183)AAT>GAT	p.N61D		NM_030753	NP_110380	P56703	WNT3_HUMAN	wingless-type MMTV integration site family,	61					canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|cellular response to retinoic acid|dorsal/ventral axis specification|embryonic forelimb morphogenesis|embryonic hindlimb morphogenesis|embryonic pattern specification|head morphogenesis|hemopoietic stem cell proliferation|inner ear morphogenesis|limb bud formation|mammary gland epithelium development|mesoderm formation|midbrain-hindbrain boundary development|negative regulation of fat cell differentiation|positive regulation of cell proliferation|Spemann organizer formation at the anterior end of the primitive streak|Wnt receptor signaling pathway, calcium modulating pathway	early endosome|extracellular space|late endosome|membrane fraction|membrane raft|plasma membrane|proteinaceous extracellular matrix	frizzled binding|frizzled-2 binding|signal transducer activity			lung(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.0257)			TCGATGTAATTGCGGCAGAAG	0.657																0.433333	75.431347	75.665224	26	34	KEEP	---	---	---	---	10	16	14	22	-1	capture	Missense_Mutation	SNP	44851175	44851175	WNT3	17	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	17269	7
C17orf47	284083	broad.mit.edu	37	17	56621053	56621053	+	Missense_Mutation	SNP	C	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56621053C>A	uc002iwq.1	-	1	631	c.495G>T	c.(493-495)AAG>AAT	p.K165N	SEPT4_uc010wnx.1_5'Flank|SEPT4_uc010wny.1_5'Flank	NM_001038704	NP_001033793	Q8NEP4	CQ047_HUMAN	hypothetical protein LOC284083	165										breast(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GTAAGTTATTCTTCTGGTCTT	0.478																0.149306	71.42061	105.409811	43	245	KEEP	---	---	---	---	19	27	138	132	0.586956521739	capture	Missense_Mutation	SNP	56621053	56621053	C17orf47	17	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	1843	7
CD300A	11314	broad.mit.edu	37	17	72469900	72469900	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72469900C>T	uc002jkv.2	+	2	587	c.266C>T	c.(265-267)ACC>ATC	p.T89I	CD300A_uc002jkw.2_Intron|CD300A_uc010dfr.2_Intron|CD300A_uc010dfs.2_Intron	NM_007261	NP_009192	Q9UGN4	CLM8_HUMAN	leukocyte membrane antigen	89	Extracellular (Potential).|Ig-like V-type.				cell adhesion	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2						TTCACAGTGACCCTGGAGAAT	0.537																0.418182	136.247024	136.884288	46	64	KEEP	---	---	---	---	30	24	31	38	-1	capture	Missense_Mutation	SNP	72469900	72469900	CD300A	17	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	2967	7
THEG	51298	broad.mit.edu	37	19	375850	375850	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:375850G>A	uc002lol.2	-	1	160	c.121C>T	c.(121-123)CGG>TGG	p.R41W	THEG_uc002lom.2_Missense_Mutation_p.R41W	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	41					cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTGTGACCCGCCGGCTCTCG	0.672																0.4	151.787632	153.005389	56	84	KEEP	---	---	---	---	25	35	52	53	-1	capture	Missense_Mutation	SNP	375850	375850	THEG	19	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	15742	7
EEF2	1938	broad.mit.edu	37	19	3980665	3980665	+	Missense_Mutation	SNP	A	C	C			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3980665A>C	uc002lze.2	-	9	1276	c.1193T>G	c.(1192-1194)ATT>AGT	p.I398S		NM_001961	NP_001952	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	398						cytosol|ribonucleoprotein complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		CATTTTGGAAATATACATCAT	0.527	Colon(165;1804 1908 4071 6587 18799)															0.287879	123.38137	128.718991	38	94	KEEP	---	---	---	---	19	22	48	56	-1	capture	Missense_Mutation	SNP	3980665	3980665	EEF2	19	A	C	C	C	1	0	0	0	0	1	0	0	0	52	4	4	4	4884	7
MUC16	94025	broad.mit.edu	37	19	9046871	9046871	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9046871G>A	uc002mkp.2	-	5	34964	c.34760C>T	c.(34759-34761)ACG>ATG	p.T11587M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11589	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCCAGAAACCGTTGTGCTGGT	0.522																0.326389	130.775885	134.625885	47	97	KEEP	---	---	---	---	26	25	57	45	-1	capture	Missense_Mutation	SNP	9046871	9046871	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9883	7
OR7E24	26648	broad.mit.edu	37	19	9361873	9361873	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9361873A>G	uc002mlb.1	+	1	154	c.154A>G	c.(154-156)ATG>GTG	p.M52V		NM_001079935	NP_001073404	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E,	52	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GTTCCTGTCCATGTACCTGGT	0.577																0.425373	172.550894	173.202231	57	77	KEEP	---	---	---	---	35	27	44	53	-1	capture	Missense_Mutation	SNP	9361873	9361873	OR7E24	19	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	11125	7
ATP13A1	57130	broad.mit.edu	37	19	19756294	19756294	+	Silent	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19756294C>T	uc002nnh.3	-	26	3580	c.3552G>A	c.(3550-3552)GCG>GCA	p.A1184A	GMIP_uc002nnd.2_5'Flank|GMIP_uc010xrb.1_5'Flank|GMIP_uc010xrc.1_5'Flank|ATP13A1_uc002nne.2_Silent_p.A324A|ATP13A1_uc002nnf.3_Silent_p.A552A|ATP13A1_uc002nng.2_Silent_p.A1066A	NM_020410	NP_065143	Q9HD20	AT131_HUMAN	ATPase type 13A1	1184	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(3)|large_intestine(2)|central_nervous_system(1)	6						CGGCCAGGAGCGCCAGGCAGA	0.647	Esophageal Squamous(142;920 1789 9047 14684 24777)															0.238095	13.065452	14.38047	5	16	KEEP	---	---	---	---	7	0	7	12	-1	capture	Silent	SNP	19756294	19756294	ATP13A1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1114	7
ZNF681	148213	broad.mit.edu	37	19	23927494	23927494	+	Silent	SNP	T	C	C			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:23927494T>C	uc002nrk.3	-	4	1000	c.858A>G	c.(856-858)GAA>GAG	p.E286E	ZNF681_uc002nrl.3_Silent_p.E217E|ZNF681_uc002nrj.3_Silent_p.E217E	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	286	C2H2-type 5; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				CTTTGTCACATTCTTCACGTT	0.363																0.334711	267.005059	272.853508	81	161	KEEP	---	---	---	---	32	55	89	91	-1	capture	Silent	SNP	23927494	23927494	ZNF681	19	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	17966	7
EXOSC5	56915	broad.mit.edu	37	19	41903139	41903139	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41903139G>A	uc002oqo.2	-	1	118	c.95C>T	c.(94-96)GCC>GTC	p.A32V	CYP2F1_uc010xvw.1_Intron|BCKDHA_uc002oqm.3_Intron|BCKDHA_uc002oqp.1_5'Flank|BCKDHA_uc002oqq.2_5'Flank|BCKDHA_uc002oqr.2_5'Flank|BCKDHA_uc010xvz.1_5'Flank	NM_020158	NP_064543	Q9NQT4	EXOS5_HUMAN	exosome component Rrp46	32					DNA deamination|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5'-exoribonuclease activity|protein binding|RNA binding				0						CTGTTCGCAGGCAAAGTGCCG	0.582																0.020408	-65.372772	10.362014	6	288	KEEP	---	---	---	---	3	3	151	167	-1	capture	Missense_Mutation	SNP	41903139	41903139	EXOSC5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5273	7
IRGC	56269	broad.mit.edu	37	19	44222975	44222975	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44222975G>A	uc002oxh.2	+	2	412	c.265G>A	c.(265-267)GTC>ATC	p.V89I		NM_019612	NP_062558	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	89	GTP.					membrane	GTP binding|hydrolase activity, acting on acid anhydrides			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(69;0.0435)				TCTCACGGGCGTCATGGAGAC	0.701	Colon(189;350 2037 11447 13433 38914)															0.3	63.273807	66.130111	24	56	KEEP	---	---	---	---	15	11	31	30	-1	capture	Missense_Mutation	SNP	44222975	44222975	IRGC	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7761	7
EXOC3L2	90332	broad.mit.edu	37	19	45728158	45728158	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45728158G>A	uc002pay.1	-	6	459	c.418C>T	c.(418-420)CGC>TGC	p.R140C		NM_138568	NP_612635	Q2M3D2	EX3L2_HUMAN	exocyst complex component 3-like 2	140										ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)		CGGGCCAGGCGCTCGGCCAGA	0.637																0.181818	7.686981	9.779482	4	18	KEEP	---	---	---	---	5	1	12	10	-1	capture	Missense_Mutation	SNP	45728158	45728158	EXOC3L2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5260	7
LILRB2	10288	broad.mit.edu	37	19	54783691	54783691	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54783691C>T	uc002qfb.2	-	4	576	c.310G>A	c.(310-312)GCT>ACT	p.A104T	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Missense_Mutation_p.A104T|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Missense_Mutation_p.A104T|LILRB2_uc010yet.1_5'UTR|LILRB2_uc010yeu.1_RNA	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	104	Extracellular (Potential).|Ig-like C2-type 1.				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GACCACCGAGCGCGGCTGTAA	0.592																0.311688	187.263759	194.532036	72	159	KEEP	---	---	---	---	49	36	74	97	-1	capture	Missense_Mutation	SNP	54783691	54783691	LILRB2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8711	7
FNDC4	64838	broad.mit.edu	37	2	27716857	27716857	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27716857G>A	uc002rkx.2	-	4	800	c.394C>T	c.(394-396)CGG>TGG	p.R132W	GCKR_uc002rky.2_5'Flank|GCKR_uc010ezd.2_5'Flank|GCKR_uc010ylu.1_5'Flank	NM_022823	NP_073734	Q9H6D8	FNDC4_HUMAN	fibronectin type III domain containing 4	132	Extracellular (Potential).|Fibronectin type-III.					integral to membrane					0	Acute lymphoblastic leukemia(172;0.155)					AAGTGCACCCGGGGCCCTGGG	0.607																0.051095	-14.390798	14.846662	7	130	KEEP	---	---	---	---	5	2	62	87	-1	capture	Missense_Mutation	SNP	27716857	27716857	FNDC4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	5915	7
SCN3A	6328	broad.mit.edu	37	2	166019327	166019327	+	Missense_Mutation	SNP	T	C	C			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:166019327T>C	uc002ucx.2	-	8	1198	c.706A>G	c.(706-708)ATT>GTT	p.I236V	SCN3A_uc002ucy.2_Missense_Mutation_p.I236V|SCN3A_uc002ucz.2_Missense_Mutation_p.I236V|SCN3A_uc002uda.1_Missense_Mutation_p.I105V|SCN3A_uc002udb.1_Missense_Mutation_p.I105V	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	236						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	GCCCCCACAATGGTCTTTAAA	0.453																0.455556	262.833464	263.14264	82	98	KEEP	---	---	---	---	40	53	47	69	-1	capture	Missense_Mutation	SNP	166019327	166019327	SCN3A	2	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	13811	7
ZNF804A	91752	broad.mit.edu	37	2	185802513	185802513	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:185802513G>A	uc002uph.2	+	4	2984	c.2390G>A	c.(2389-2391)AGG>AAG	p.R797K		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	797						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						GAATTTTTGAGGCCACCAAGT	0.383																0.417476	139.51414	140.124216	43	60	KEEP	---	---	---	---	18	27	31	29	-1	capture	Missense_Mutation	SNP	185802513	185802513	ZNF804A	2	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	18046	7
ANKRD44	91526	broad.mit.edu	37	2	197863059	197863059	+	Splice_Site	SNP	A	G	G			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:197863059A>G	uc002uua.1	-	25	2750	c.2673_splice	c.e25+1	p.K891_splice	ANKRD44_uc002utz.3_Splice_Site_p.K623_splice	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TCATTTACATACTTTACTACA	0.333																0.026786	-21.367927	6.336315	3	109	KEEP	---	---	---	---	0	3	69	56	-1	capture	Splice_Site	SNP	197863059	197863059	ANKRD44	2	A	G	G	G	1	0	0	0	0	0	0	1	0	182	14	5	3	667	7
KIAA1486	57624	broad.mit.edu	37	2	226446958	226446958	+	Silent	SNP	C	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:226446958C>A	uc002voe.2	+	4	1000	c.825C>A	c.(823-825)ATC>ATA	p.I275I	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Silent_p.I45I	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	275										ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		AGTACCCTATCTTTGACGACT	0.542																0.446043	182.725472	183.079093	62	77	KEEP	---	---	---	---	29	38	33	47	0.567164179104	capture	Silent	SNP	226446958	226446958	KIAA1486	2	C	A	A	A	1	0	0	0	0	0	0	0	1	408	32	4	4	8159	7
KIAA1486	57624	broad.mit.edu	37	2	226446979	226446979	+	Silent	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:226446979C>T	uc002voe.2	+	4	1021	c.846C>T	c.(844-846)GAC>GAT	p.D282D	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Silent_p.D52D	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	282										ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		TGGGCCAAGACGCCAAATGTG	0.557																0.418182	139.532953	140.175117	46	64	KEEP	---	---	---	---	20	28	26	44	-1	capture	Silent	SNP	226446979	226446979	KIAA1486	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8159	7
COL6A3	1293	broad.mit.edu	37	2	238249201	238249201	+	Silent	SNP	G	A	A	rs113423040		TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238249201G>A	uc002vwl.2	-	38	8643	c.8358C>T	c.(8356-8358)TTC>TTT	p.F2786F	COL6A3_uc002vwo.2_Silent_p.F2580F|COL6A3_uc010znj.1_Silent_p.F2179F|COL6A3_uc002vwj.2_Silent_p.F167F	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2786	VWFA 12.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCTCACTGGCGAAGGTGTATA	0.547																0.452174	159.289459	159.517985	52	63	KEEP	---	---	---	---	25	30	37	29	-1	capture	Silent	SNP	238249201	238249201	COL6A3	2	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	3666	7
SLCO4A1	28231	broad.mit.edu	37	20	61299253	61299253	+	Silent	SNP	C	T	T	rs138089582	byFrequency	TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61299253C>T	uc002ydb.1	+	8	1834	c.1629C>T	c.(1627-1629)GAC>GAT	p.D543D	SLCO4A1_uc002ydc.1_RNA|LOC100127888_uc002ydd.2_5'Flank|SLCO4A1_uc002yde.1_Missense_Mutation_p.T3M	NM_016354	NP_057438	Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family	543	Extracellular (Potential).|Kazal-like.				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(1)	1	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)			CGAATGTGGACGGCCAGAAGG	0.647	Pancreas(168;741 2006 10379 40139 45334)				402											0.177419	20.98781	27.065173	11	51	KEEP	---	---	---	---	9	7	44	30	-1	capture	Silent	SNP	61299253	61299253	SLCO4A1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14621	7
KIAA1644	85352	broad.mit.edu	37	22	44692617	44692617	+	Silent	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:44692617G>A	uc003bet.2	-	3	349	c.216C>T	c.(214-216)AAC>AAT	p.N72N		NM_001099294	NP_001092764	Q3SXP7	K1644_HUMAN	hypothetical protein LOC85352 precursor	72	Extracellular (Potential).					integral to membrane				ovary(1)	1		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				ACTCCGTCTCGTTGCAGCAGT	0.582																0.465278	408.325942	408.626998	134	154	KEEP	---	---	---	---	87	66	89	82	-1	capture	Silent	SNP	44692617	44692617	KIAA1644	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8172	7
CNTN4	152330	broad.mit.edu	37	3	3076350	3076350	+	Silent	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:3076350C>T	uc003bpc.2	+	16	2039	c.1818C>T	c.(1816-1818)GAC>GAT	p.D606D	CNTN4_uc003bpb.1_Silent_p.D277D|CNTN4_uc003bpd.1_Silent_p.D606D|CNTN4_uc003bpe.2_Silent_p.D278D|CNTN4_uc003bpf.2_Silent_p.D277D	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	606	Fibronectin type-III 1.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		TGACAATAGACGAAATCACAG	0.537																0.4375	120.12895	120.456439	42	54	KEEP	---	---	---	---	20	26	29	30	-1	capture	Silent	SNP	3076350	3076350	CNTN4	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3608	7
COLQ	8292	broad.mit.edu	37	3	15512054	15512054	+	Nonsense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:15512054G>A	uc003bzx.2	-	11	832	c.706C>T	c.(706-708)CGA>TGA	p.R236*	COLQ_uc003bzv.2_Nonsense_Mutation_p.R226*|COLQ_uc003bzz.2_Nonsense_Mutation_p.R227*|COLQ_uc010heo.2_Nonsense_Mutation_p.R202*|COLQ_uc003cac.1_RNA|COLQ_uc003cae.1_Nonsense_Mutation_p.R95*|COLQ_uc003cad.1_RNA	NM_005677	NP_005668	Q9Y215	COLQ_HUMAN	acetylcholinesterase collagen-like tail subunit	236	Heparan sulfate proteoglycan binding (Potential).|Collagen-like 1.				acetylcholine catabolic process in synaptic cleft|asymmetric protein localization	basal lamina|cell junction|collagen|extracellular space|synaptic cleft					0						TGCTTGCCTCGTTTTCCTGGT	0.552																0.413333	182.52742	183.509344	62	88	KEEP	---	---	---	---	38	33	47	52	-1	capture	Nonsense_Mutation	SNP	15512054	15512054	COLQ	3	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	3678	7
PIK3CA	5290	broad.mit.edu	37	3	178916921	178916921	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916921A>G	uc003fjk.2	+	2	465	c.308A>G	c.(307-309)GAA>GGA	p.E103G		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	103	PI3K-ABD.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AAAGTAATTGAACCAGTAGGC	0.348	Colon(199;1504 1750 3362 26421 31210 32040)		57		621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.459854	230.723151	230.914103	63	74	KEEP	---	---	---	---	28	39	38	45	-1	capture	Missense_Mutation	SNP	178916921	178916921	PIK3CA	3	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	11816	7
HELT	391723	broad.mit.edu	37	4	185940979	185940979	+	Missense_Mutation	SNP	C	T	T	rs147187823	byFrequency	TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:185940979C>T	uc011ckq.1	+	3	466	c.466C>T	c.(466-468)CCC>TCC	p.P156S	HELT_uc011cko.1_Missense_Mutation_p.P71S|HELT_uc003ixa.3_Missense_Mutation_p.P71S|HELT_uc011ckp.1_Missense_Mutation_p.P15S	NM_001029887	NP_001025058	A6NFD8	HELT_HUMAN	HES/HEY-like transcription factor	156							DNA binding				0		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		CGCTGATTTTCCCCGGGGAAG	0.632																0.176471	6.11521	7.791707	3	14	KEEP	---	---	---	---	2	1	7	10	-1	capture	Missense_Mutation	SNP	185940979	185940979	HELT	4	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	6974	7
SLCO6A1	133482	broad.mit.edu	37	5	101735262	101735262	+	Missense_Mutation	SNP	G	A	A	rs139495343	by1000genomes	TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101735262G>A	uc003knn.2	-	10	1983	c.1811C>T	c.(1810-1812)ACG>ATG	p.T604M	SLCO6A1_uc003kno.2_Missense_Mutation_p.T351M|SLCO6A1_uc003knp.2_Missense_Mutation_p.T604M|SLCO6A1_uc003knq.2_Missense_Mutation_p.T542M	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	604	Helical; Name=10; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TACATACCGCGTCATGGCCAA	0.284																0.341463	40.437729	41.348271	14	27	KEEP	---	---	---	---	5	9	15	14	-1	capture	Missense_Mutation	SNP	101735262	101735262	SLCO6A1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14624	7
REEP2	51308	broad.mit.edu	37	5	137781275	137781275	+	Silent	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137781275G>A	uc003lcz.2	+	7	800	c.678G>A	c.(676-678)GCG>GCA	p.A226A	REEP2_uc003lda.2_Silent_p.A228A|REEP2_uc011cyt.1_Silent_p.A187A	NM_016606	NP_057690	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2	226						integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TCAAAAAAGCGCCCAAAGCTG	0.592																0.461538	86.05699	86.138497	30	35	KEEP	---	---	---	---	9	22	17	20	-1	capture	Silent	SNP	137781275	137781275	REEP2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13100	7
PCDHA12	56137	broad.mit.edu	37	5	140257259	140257259	+	Silent	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140257259G>A	uc003lic.2	+	1	2329	c.2202G>A	c.(2200-2202)CCG>CCA	p.P734P	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Silent_p.P734P	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	734	5 X 4 AA repeats of P-X-X-P.|Cytoplasmic (Potential).|PXXP 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGCGCGCCGGGCAAGCCCA	0.682	Pancreas(113;759 1672 13322 24104 50104)															0.258065	22.432977	24.046677	8	23	KEEP	---	---	---	---	5	5	15	18	-1	capture	Silent	SNP	140257259	140257259	PCDHA12	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11425	7
MAML1	9794	broad.mit.edu	37	5	179192466	179192466	+	Missense_Mutation	SNP	C	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179192466C>A	uc003mkm.2	+	2	718	c.455C>A	c.(454-456)TCC>TAC	p.S152Y	MAML1_uc003mkn.1_Missense_Mutation_p.S152Y	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1	152					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCATCTCTTCCAATGGACTG	0.602					189											0.456311	135.506498	135.678482	47	56	KEEP	---	---	---	---	29	24	34	30	0.452830188679	capture	Missense_Mutation	SNP	179192466	179192466	MAML1	5	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	9119	7
DSP	1832	broad.mit.edu	37	6	7583891	7583891	+	Silent	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7583891G>A	uc003mxp.1	+	24	6675	c.6396G>A	c.(6394-6396)GGG>GGA	p.G2132G	DSP_uc003mxq.1_Silent_p.G1533G	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	2132	Plectin 4.|Globular 2.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TTGCTTCAGGGGGTGTAGTAG	0.473																0.426901	235.846828	236.643856	73	98	KEEP	---	---	---	---	33	45	46	57	-1	capture	Silent	SNP	7583891	7583891	DSP	6	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	4736	7
JARID2	3720	broad.mit.edu	37	6	15520428	15520428	+	Silent	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:15520428C>T	uc003nbj.2	+	18	3931	c.3687C>T	c.(3685-3687)CCC>CCT	p.P1229P	JARID2_uc011div.1_Silent_p.P1057P	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein	1229					central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				TGGACGTGCCCCCCTCCCGTC	0.373					694											0.362832	116.66489	118.525891	41	72	KEEP	---	---	---	---	22	24	36	54	-1	capture	Silent	SNP	15520428	15520428	JARID2	6	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	7868	7
HIST1H2BF	8343	broad.mit.edu	37	6	26199947	26199947	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26199947G>A	uc003ngx.2	+	1	161	c.161G>A	c.(160-162)GGC>GAC	p.G54D	HIST1H3D_uc003ngv.2_5'Flank|HIST1H2AD_uc003ngw.2_5'Flank	NM_003522	NP_003513	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	54					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0		all_hematologic(11;0.196)				CCCGACACCGGCATCTCATCC	0.567																0.015424	-94.377834	9.235078	6	383	KEEP	---	---	---	---	1	6	194	237	-1	capture	Missense_Mutation	SNP	26199947	26199947	HIST1H2BF	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7070	7
LGSN	51557	broad.mit.edu	37	6	64004847	64004847	+	Missense_Mutation	SNP	A	C	C			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:64004847A>C	uc003peh.2	-	2	168	c.134T>G	c.(133-135)GTG>GGG	p.V45G	LGSN_uc003pei.2_Missense_Mutation_p.V45G|LGSN_uc003pej.1_Missense_Mutation_p.V45G	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	45					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	CGTTTCTCCCACTTCAGTTGA	0.393																0.173184	72.113268	90.183193	31	148	KEEP	---	---	---	---	16	18	78	81	-1	capture	Missense_Mutation	SNP	64004847	64004847	LGSN	6	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	8679	7
HECA	51696	broad.mit.edu	37	6	139487771	139487771	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:139487771G>A	uc003qin.2	+	2	907	c.622G>A	c.(622-624)GAG>AAG	p.E208K		NM_016217	NP_057301	Q9UBI9	HDC_HUMAN	headcase	208					respiratory tube development						0				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)		GTCTGGCTCCGAGAAGAACAC	0.592																0.453488	121.21539	121.377005	39	47	KEEP	---	---	---	---	22	19	22	28	-1	capture	Missense_Mutation	SNP	139487771	139487771	HECA	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6964	7
NOD1	10392	broad.mit.edu	37	7	30492358	30492358	+	Silent	SNP	G	A	A	rs150842987		TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30492358G>A	uc003tav.2	-	6	1198	c.675C>T	c.(673-675)GAC>GAT	p.D225D	NOD1_uc010kvs.2_Intron	NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain	225	NACHT.				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						TGACCCCTGCGTCTAGCCGGC	0.577																0.420168	141.439592	142.097376	50	69	KEEP	---	---	---	---	27	24	43	39	-1	capture	Silent	SNP	30492358	30492358	NOD1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10423	7
VPS41	27072	broad.mit.edu	37	7	38835094	38835094	+	Missense_Mutation	SNP	G	C	C			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:38835094G>C	uc003tgy.2	-	9	714	c.688C>G	c.(688-690)CTG>GTG	p.L230V	VPS41_uc003tgz.2_Missense_Mutation_p.L205V|VPS41_uc010kxn.2_Intron	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1	230					Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						CCAATAATCAGTGTCACATTG	0.468																0.190217	91.409036	107.923921	35	149	KEEP	---	---	---	---	25	21	94	97	-1	capture	Missense_Mutation	SNP	38835094	38835094	VPS41	7	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	17092	7
POM121L12	285877	broad.mit.edu	37	7	53103860	53103860	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53103860G>A	uc003tpz.2	+	1	512	c.496G>A	c.(496-498)GCC>ACC	p.A166T		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	166											0						ccgccccgccgcccAGGAGCT	0.587																0.810127	191.27368	198.382914	64	15	KEEP	---	---	---	---	34	43	10	13	-1	capture	Missense_Mutation	SNP	53103860	53103860	POM121L12	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12143	7
POM121L12	285877	broad.mit.edu	37	7	53104151	53104151	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53104151G>A	uc003tpz.2	+	1	803	c.787G>A	c.(787-789)GCC>ACC	p.A263T		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	263											0						CGCCCCATCCGCCATCTGGGA	0.662																0.125424	44.322614	84.719234	37	258	KEEP	---	---	---	---	24	23	152	187	-1	capture	Missense_Mutation	SNP	53104151	53104151	POM121L12	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12143	7
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	A	A	rs149840192		TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>A	uc003tqk.2	+	7	1112	c.866C>A	c.(865-867)GCC>GAC	p.A289D	EGFR_uc003tqh.2_Missense_Mutation_p.A289D|EGFR_uc003tqi.2_Missense_Mutation_p.A289D|EGFR_uc003tqj.2_Missense_Mutation_p.A289D|EGFR_uc010kzg.1_Missense_Mutation_p.A244D|EGFR_uc011kco.1_Missense_Mutation_p.A236D|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592			8	p.A289V(HEC6-Tumor)|p.A289D(HS683-Tumor)|p.A289V(RL952-Tumor)	608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.94572	3076.011858	3213.694562	906	52	KEEP	---	---	---	---	442	500	25	30	0.530785562633	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	4922	7
LRWD1	222229	broad.mit.edu	37	7	102106371	102106371	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:102106371C>T	uc003uzn.2	+	2	326	c.188C>T	c.(187-189)CCG>CTG	p.P63L	ALKBH4_uc003uzl.2_5'Flank|ALKBH4_uc003uzm.2_5'Flank|LRWD1_uc003uzo.2_5'UTR	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain	63	LRR 2.				chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GAGACGCTGCCGGACAACCTG	0.622																0.369231	65.537007	66.491761	24	41	KEEP	---	---	---	---	14	10	23	27	-1	capture	Missense_Mutation	SNP	102106371	102106371	LRWD1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8962	7
CHRM2	1129	broad.mit.edu	37	7	136700738	136700738	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:136700738A>G	uc003vtf.1	+	4	1749	c.1126A>G	c.(1126-1128)AAG>GAG	p.K376E	CHRM2_uc003vtg.1_Missense_Mutation_p.K376E|CHRM2_uc003vtj.1_Missense_Mutation_p.K376E|CHRM2_uc003vtk.1_Missense_Mutation_p.K376E|CHRM2_uc003vtl.1_Missense_Mutation_p.K376E|CHRM2_uc003vtm.1_Missense_Mutation_p.K376E|CHRM2_uc003vti.1_Missense_Mutation_p.K376E|CHRM2_uc003vto.1_Missense_Mutation_p.K376E|CHRM2_uc003vtn.1_Missense_Mutation_p.K376E|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	376	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	TGCAAAAAAGAAGCCTCCTCC	0.478																0.319797	204.470581	210.14687	63	134	KEEP	---	---	---	---	32	40	69	80	-1	capture	Missense_Mutation	SNP	136700738	136700738	CHRM2	7	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	3342	7
SFRP1	6422	broad.mit.edu	37	8	41166547	41166547	+	Silent	SNP	G	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:41166547G>T	uc003xnt.2	-	1	434	c.132C>A	c.(130-132)GGC>GGA	p.G44G		NM_003012	NP_003003	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1 precursor	44					brain development|canonical Wnt receptor signaling pathway|cellular response to BMP stimulus|cellular response to estradiol stimulus|cellular response to fibroblast growth factor stimulus|cellular response to heparin|cellular response to hypoxia|cellular response to interleukin-1|cellular response to prostaglandin E stimulus|cellular response to starvation|cellular response to transforming growth factor beta stimulus|cellular response to tumor necrosis factor|cellular response to vitamin D|DNA fragmentation involved in apoptotic nuclear change|dorsal/ventral axis specification|hemopoietic progenitor cell differentiation|hemopoietic stem cell differentiation|menstrual cycle phase|negative regulation of androgen receptor signaling pathway|negative regulation of B cell differentiation|negative regulation of bone remodeling|negative regulation of canonical Wnt receptor signaling pathway involved in controlling type B pancreatic cell proliferation|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cysteine-type endopeptidase activity|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast apoptosis|negative regulation of fibroblast proliferation|negative regulation of insulin secretion|negative regulation of ossification|negative regulation of osteoblast proliferation|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|osteoblast differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell growth|positive regulation of epithelial cell proliferation|positive regulation of fat cell differentiation|positive regulation of fibroblast apoptosis|positive regulation of focal adhesion assembly|positive regulation of non-canonical Wnt receptor signaling pathway|positive regulation of Rac GTPase activity|positive regulation of smoothened signaling pathway|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|regulation of angiogenesis|regulation of cell cycle process|response to drug|response to organic cyclic compound|vasculature development	cell surface|cytosol|extracellular space|plasma membrane|proteinaceous extracellular matrix	cysteine-type endopeptidase activity|drug binding|frizzled binding|heparin binding|identical protein binding|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			TCTGGTACGGGCCGATGTCCG	0.687																0.147059	2.290918	6.382739	5	29	KEEP	---	---	---	---	2	3	11	22	0.4	capture	Silent	SNP	41166547	41166547	SFRP1	8	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	14054	7
RP1	6101	broad.mit.edu	37	8	55541829	55541829	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:55541829C>T	uc003xsd.1	+	4	5535	c.5387C>T	c.(5386-5388)ACG>ATG	p.T1796M	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1796					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding	p.T1796T(1)		skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCAGGCCCAACGATGGATGAA	0.448	Colon(91;1014 1389 7634 14542 40420)															0.348485	67.307241	68.643434	23	43	KEEP	---	---	---	---	8	16	16	27	-1	capture	Missense_Mutation	SNP	55541829	55541829	RP1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13424	7
DOCK8	81704	broad.mit.edu	37	9	286571	286571	+	Silent	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:286571C>T	uc003zgf.2	+	3	379	c.267C>T	c.(265-267)GAC>GAT	p.D89D	DOCK8_uc011lls.1_Silent_p.D89D|DOCK8_uc010mgu.2_Translation_Start_Site|DOCK8_uc010mgv.2_Silent_p.D21D|DOCK8_uc010mgt.2_Silent_p.D21D|DOCK8_uc003zgg.2_Silent_p.D21D|DOCK8_uc003zgh.2_RNA	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	89					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TCACTGATGACGACTTGGACG	0.507																0.46729	153.94409	154.043332	50	57	KEEP	---	---	---	---	23	33	23	37	-1	capture	Silent	SNP	286571	286571	DOCK8	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4649	7
TMEM215	401498	broad.mit.edu	37	9	32784414	32784414	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32784414G>A	uc003zri.3	+	2	598	c.233G>A	c.(232-234)CGC>CAC	p.R78H		NM_212558	NP_997723	Q68D42	TM215_HUMAN	transmembrane protein 215	78						integral to membrane					0						CTGTGGGTCCGCAAATTGCCC	0.597																0.04386	-17.651205	7.782099	5	109	KEEP	---	---	---	---	2	3	64	58	-1	capture	Missense_Mutation	SNP	32784414	32784414	TMEM215	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16021	7
TDRD7	23424	broad.mit.edu	37	9	100227272	100227272	+	Silent	SNP	C	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100227272C>A	uc004axj.2	+	8	1816	c.1591C>A	c.(1591-1593)CGG>AGG	p.R531R	TDRD7_uc011lux.1_Silent_p.R457R	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	531	Tudor 1.				lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)				CGCCTGGTTACGGGCACAGGT	0.423																0.033708	-14.447315	6.636999	3	86	KEEP	---	---	---	---	2	1	39	52	0.333333333333	capture	Silent	SNP	100227272	100227272	TDRD7	9	C	A	A	A	1	0	0	0	0	0	0	0	1	243	19	4	4	15620	7
TGFBR1	7046	broad.mit.edu	37	9	101900167	101900167	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101900167A>G	uc004azc.2	+	4	677	c.601A>G	c.(601-603)ATT>GTT	p.I201V	TGFBR1_uc004azd.2_Missense_Mutation_p.I124V|TGFBR1_uc011lvc.1_Missense_Mutation_p.I132V	NM_004612	NP_004603	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor I	201	Cytoplasmic (Potential).|GS.				activation of MAPKK activity|anterior/posterior pattern formation|artery morphogenesis|collagen fibril organization|embryonic cranial skeleton morphogenesis|germ cell migration|heart development|kidney development|neuron fate commitment|palate development|parathyroid gland development|pathway-restricted SMAD protein phosphorylation|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|pharyngeal system development|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of cellular component movement|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of SMAD protein import into nucleus|positive regulation of survival gene product expression|positive regulation of transcription, DNA-dependent|response to cholesterol|thymus development|transforming growth factor beta receptor signaling pathway		ATP binding|I-SMAD binding|metal ion binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type I|type II transforming growth factor beta receptor binding			lung(2)|ovary(1)	3		Acute lymphoblastic leukemia(62;0.0559)				TCAGAGAACAATTGCGAGAAC	0.358					168											0.03	-17.762785	6.486058	3	97	KEEP	---	---	---	---	3	1	54	49	-1	capture	Missense_Mutation	SNP	101900167	101900167	TGFBR1	9	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	15706	7
PRPS2	5634	broad.mit.edu	37	X	12828240	12828240	+	Missense_Mutation	SNP	T	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12828240T>A	uc004cvb.2	+	4	629	c.505T>A	c.(505-507)TCA>ACA	p.S169T	PRPS2_uc004cva.2_Missense_Mutation_p.S172T|PRPS2_uc010nec.2_Missense_Mutation_p.S105T	NM_002765	NP_002756	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	169					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity				0						TATCATTGTTTCACCTGACGC	0.463																0.904255	263.865188	279.237977	85	9	KEEP	---	---	---	---	40	53	2	9	-1	capture	Missense_Mutation	SNP	12828240	12828240	PRPS2	23	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	12476	7
MSN	4478	broad.mit.edu	37	X	64949532	64949532	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:64949532A>G	uc004dwf.2	+	4	623	c.425A>G	c.(424-426)CAT>CGT	p.H142R		NM_002444	NP_002435	P26038	MOES_HUMAN	moesin	142	FERM.				leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking	apical plasma membrane|cytoskeleton|extrinsic to membrane|microvillus membrane|nucleolus	cell adhesion molecule binding|receptor binding|structural constituent of cytoskeleton		MSN/ALK(6)	haematopoietic_and_lymphoid_tissue(6)|ovary(3)|lung(1)	10						AAGGAAGTGCATAAGTCTGGC	0.562					172	T	ALK	ALCL								0.888889	114.224042	119.606725	32	4	KEEP	---	---	---	---	16	21	1	3	-1	capture	Missense_Mutation	SNP	64949532	64949532	MSN	23	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	9795	7
HEPH	9843	broad.mit.edu	37	X	65486458	65486458	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:65486458C>T	uc011moz.1	+	21	3490	c.3430C>T	c.(3430-3432)CGC>TGC	p.R1144C	HEPH_uc004dwn.2_Missense_Mutation_p.R1143C|HEPH_uc004dwo.2_Missense_Mutation_p.R874C|HEPH_uc010nkr.2_Missense_Mutation_p.R952C|HEPH_uc011mpa.1_Missense_Mutation_p.R1144C	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	1141	Cytoplasmic (Potential).				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						AAAGCTACGACGCAATAGGAG	0.498					386											0.169492	18.913221	25.013712	10	49	KEEP	---	---	---	---	5	5	28	29	-1	capture	Missense_Mutation	SNP	65486458	65486458	HEPH	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6980	7
DCAF12L2	340578	broad.mit.edu	37	X	125299891	125299891	+	Missense_Mutation	SNP	G	T	T			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125299891G>T	uc004euk.1	-	1	44	c.17C>A	c.(16-18)ACA>AAA	p.T6K		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	6										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						CCTGCTACCTGTTTGCTGCTG	0.512																0.642857	28.4637	28.711801	9	5	KEEP	---	---	---	---	7	6	5	3	0.538461538462	capture	Missense_Mutation	SNP	125299891	125299891	DCAF12L2	23	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	4224	7
WNT2B	7482	broad.mit.edu	37	1	113059824	113059825	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:113059824_113059825delCT	uc001ecb.2	+	4	1278_1279	c.763_764delCT	c.(763-765)CTCfs	p.L255fs	WNT2B_uc001eca.2_Frame_Shift_Del_p.L236fs|WNT2B_uc009wgg.2_Frame_Shift_Del_p.L163fs	NM_024494	NP_078613	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family,	255					chondrocyte differentiation|cornea development in camera-type eye|dorsal/ventral axis specification|forebrain regionalization|hemopoietic stem cell proliferation|iris morphogenesis|lens development in camera-type eye|lung induction|male gonad development|neuron differentiation|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding|signal transducer activity			ovary(2)|breast(2)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGGCGTGCACTCTCAGATTTC	0.624																0.45			51	62		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	113059824	113059825	WNT2B	1	CT	-	-	-	1	0	1	0	1	0	0	0	0	260	20	5	5	17268	7
BMS1	9790	broad.mit.edu	37	10	43312886	43312888	+	In_Frame_Del	DEL	GAA	-	-			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:43312886_43312888delGAA	uc001jaj.2	+	15	2882_2884	c.2524_2526delGAA	c.(2524-2526)GAAdel	p.E842del		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	842					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						AGAATATGATGAAGGAGAAAGCA	0.384																0.25			13	39		---	---	---	---						capture_indel	In_Frame_Del	DEL	43312886	43312888	BMS1	10	GAA	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	1460	7
GEFT	115557	broad.mit.edu	37	12	58010639	58010640	+	Frame_Shift_Ins	INS	-	A	A			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58010639_58010640insA	uc001spb.2	+	15	2165_2166	c.1705_1706insA	c.(1705-1707)CAAfs	p.Q569fs	GEFT_uc009zpy.2_Frame_Shift_Ins_p.Q608fs|GEFT_uc001spa.2_Frame_Shift_Ins_p.Q463fs|uc001spc.2_Intron|GEFT_uc001spd.2_Frame_Shift_Ins_p.Q274fs	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN	RhoA/RAC/CDC42 exchange factor isoform 1	569					regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity				0	Melanoma(17;0.122)					CCCTCCCTGCCAAGCCAGACTT	0.554																0.00			8	2180		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	58010639	58010640	GEFT	12	-	A	A	A	1	0	1	1	0	0	0	0	0	273	21	5	5	6268	7
KIAA1704	55425	broad.mit.edu	37	13	45580365	45580367	+	In_Frame_Del	DEL	GAT	-	-	rs138421508		TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:45580365_45580367delGAT	uc001uzq.2	+	3	353_355	c.250_252delGAT	c.(250-252)GATdel	p.D88del	KIAA1704_uc010tfo.1_RNA|KIAA1704_uc001uzr.1_In_Frame_Del_p.D88del|KIAA1704_uc001uzs.2_5'UTR|KIAA1704_uc001uzt.2_5'UTR	NM_018559	NP_061029	Q8IXQ4	K1704_HUMAN	hypothetical protein LOC55425	88	Poly-Asp.									pancreas(1)|skin(1)	2		Lung NSC(96;0.00143)|Prostate(109;0.0137)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000313)|BRCA - Breast invasive adenocarcinoma(63;0.126)		Ggatgatgacgatgatgatgatg	0.286																0.02			10	460		---	---	---	---						capture_indel	In_Frame_Del	DEL	45580365	45580367	KIAA1704	13	GAT	-	-	-	1	0	1	0	1	0	0	0	0	481	37	5	5	8174	7
ZNF571	51276	broad.mit.edu	37	19	38056190	38056193	+	Frame_Shift_Del	DEL	GTAA	-	-			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38056190_38056193delGTAA	uc002ogt.2	-	4	1238_1241	c.1137_1140delTTAC	c.(1135-1140)ACTTACfs	p.T379fs	uc002ogm.2_Intron|uc002ogn.2_Intron|ZNF540_uc002ogo.2_Intron|ZNF540_uc002ogp.2_Intron|ZNF540_uc002ogq.2_Intron|ZNF571_uc002ogr.1_Intron|uc002ogs.1_5'Flank|ZNF571_uc010efp.2_Frame_Shift_Del_p.T379fs	NM_016536	NP_057620	Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	379_380	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTCTCAGGTGGTAAGTAAGTTGTG	0.377																0.30			41	96		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	38056190	38056193	ZNF571	19	GTAA	-	-	-	1	0	1	0	1	0	0	0	0	568	44	5	5	17882	7
SIGLEC8	27181	broad.mit.edu	37	19	51961617	51961619	+	In_Frame_Del	DEL	GCA	-	-			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51961617_51961619delGCA	uc002pwt.2	-	1	90_92	c.23_25delTGC	c.(22-27)CTGCCC>CCC	p.L8del	SIGLEC8_uc010yda.1_In_Frame_Del_p.L8del|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_In_Frame_Del_p.L8del	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	8					cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CAGagcaggggcagcagcagcag	0.493																0.06			9	136		---	---	---	---						capture_indel	In_Frame_Del	DEL	51961617	51961619	SIGLEC8	19	GCA	-	-	-	1	0	1	0	1	0	0	0	0	546	42	5	5	14207	7
KIR2DL3	3804	broad.mit.edu	37	19	55255258	55255260	+	In_Frame_Del	DEL	CTT	-	-			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55255258_55255260delCTT	uc002qgv.2	+	4	404_406	c.386_388delCTT	c.(385-390)CCTTCT>CCT	p.S130del	KIR2DL3_uc002qgx.2_In_Frame_Del_p.S130del|KIR2DL3_uc002qgy.2_Intron|KIR2DL3_uc010erw.1_In_Frame_Del_p.S130del|KIR2DL1_uc002qgz.1_In_Frame_Del_p.S40del|KIR2DL3_uc002qha.1_Intron	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two	130	Extracellular (Potential).				immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		TATGAGAAACCTTCTCTCTCAGC	0.562																0.17			44	208		---	---	---	---						capture_indel	In_Frame_Del	DEL	55255258	55255260	KIR2DL3	19	CTT	-	-	-	1	0	1	0	1	0	0	0	0	312	24	5	5	8239	7
ROBO1	6091	broad.mit.edu	37	3	79639041	79639042	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-02-2485-01	TCGA-02-2485-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:79639041_79639042delAG	uc003dqe.2	-	2	228_229	c.20_21delCT	c.(19-21)CCTfs	p.P7fs		NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	7					activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGACCAAAAAAGGAACATGTTT	0.381					693											0.29			36	87		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	79639041	79639042	ROBO1	3	AG	-	-	-	1	0	1	0	1	0	0	0	0	28	3	5	5	13405	7
