Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ABCA4	24	broad.mit.edu	37	1	94463458	94463458	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:94463458G>A	uc001dqh.2	-	48	6792	c.6688C>T	c.(6688-6690)CTC>TTC	p.L2230F		NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	2230	Cytoplasmic.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCCTCGATGAGCAGGCTGTCC	0.592																0.368421	66.359583	67.227316	21	36	KEEP	---	---	---	---	12	13	27	13	-1	capture	Missense_Mutation	SNP	94463458	94463458	ABCA4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	34	20
NBPF10	100132406	broad.mit.edu	37	1	145324371	145324371	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145324371T>C	uc001end.3	+	30	3826	c.3791T>C	c.(3790-3792)GTA>GCA	p.V1264A	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oym.1_Intron|NBPF10_uc010oyn.1_Intron|NBPF10_uc010oyo.1_Intron|NBPF10_uc010oyp.1_RNA	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	1189											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CTGCTGGAGGTAGTAGCGCCT	0.498																1	8.277108	8.053914	2	0	KEEP	---	---	---	---	0	2	6	2	-1	capture	Missense_Mutation	SNP	145324371	145324371	NBPF10	1	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	10100	20
OPTC	26254	broad.mit.edu	37	1	203472741	203472741	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:203472741C>T	uc001gzu.1	+	7	1008	c.892C>T	c.(892-894)CGC>TGC	p.R298C		NM_014359	NP_055174	Q9UBM4	OPT_HUMAN	opticin precursor	298						proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.109)			CAAACACACCCGCAGGCAGCT	0.587																0.254237	82.698501	89.16313	30	88	KEEP	---	---	---	---	16	17	60	39	-1	capture	Missense_Mutation	SNP	203472741	203472741	OPTC	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10792	20
PIGR	5284	broad.mit.edu	37	1	207109154	207109154	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207109154A>T	uc001hez.2	-	5	1239	c.1055T>A	c.(1054-1056)ATT>AAT	p.I352N	PIGR_uc009xbz.2_Missense_Mutation_p.I352N	NM_002644	NP_002635	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor precursor	352	Ig-like V-type 3.|Extracellular (Potential).					extracellular region|integral to plasma membrane	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3						GCTGCGGGGAATCGTGGACTC	0.602														OREG0014186	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.119048	5.44284	11.43439	5	37	KEEP	---	---	---	---	5	2	20	17	-1	capture	Missense_Mutation	SNP	207109154	207109154	PIGR	1	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	11800	20
SLC18A2	6571	broad.mit.edu	37	10	119003545	119003545	+	Missense_Mutation	SNP	C	T	T	rs140529367		TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:119003545C>T	uc001ldd.1	+	3	216	c.185C>T	c.(184-186)ACG>ATG	p.T62M	SLC18A2_uc009xyy.1_Translation_Start_Site	NM_003054	NP_003045	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine),	62	Lumenal, vesicle (Potential).				neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity				0		Colorectal(252;0.19)		all cancers(201;0.029)	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)	GAAATCCAGACGGCCAGGCCA	0.493																0.4	40.741767	41.048226	14	21	KEEP	---	---	---	---	7	7	10	13	-1	capture	Missense_Mutation	SNP	119003545	119003545	SLC18A2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14319	20
CLRN3	119467	broad.mit.edu	37	10	129682096	129682096	+	Silent	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:129682096C>T	uc001lka.1	-	2	436	c.273G>A	c.(271-273)TCG>TCA	p.S91S	CLRN3_uc001ljz.1_Silent_p.S23S	NM_152311	NP_689524	Q8NCR9	CLRN3_HUMAN	clarin 3	91						integral to membrane				skin(1)	1		all_epithelial(44;0.00168)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)|Colorectal(57;0.235)				GGATAGTCACCGAATGCAGAG	0.448																0.333333	84.002354	85.99283	27	54	KEEP	---	---	---	---	13	18	28	36	-1	capture	Silent	SNP	129682096	129682096	CLRN3	10	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3524	20
OR51G1	79324	broad.mit.edu	37	11	4945520	4945520	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4945520G>A	uc010qyr.1	-	1	50	c.50C>T	c.(49-51)ACG>ATG	p.T17M		NM_001005237	NP_001005237	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G,	17	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTGGAAGCCCGTCAGGAAGAA	0.458																0.310345	76.794114	79.580885	27	60	KEEP	---	---	---	---	10	18	34	30	-1	capture	Missense_Mutation	SNP	4945520	4945520	OR51G1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11002	20
OR51A2	401667	broad.mit.edu	37	11	4976936	4976936	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4976936A>G	uc010qyt.1	-	1	8	c.8T>C	c.(7-9)ATT>ACT	p.I3T		NM_001004748	NP_001004748	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A,	3	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGTGTTGATAATGGACATGAT	0.428																0.237624	73.249437	79.60123	24	77	KEEP	---	---	---	---	22	16	69	54	-1	capture	Missense_Mutation	SNP	4976936	4976936	OR51A2	11	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	10990	20
MS4A7	58475	broad.mit.edu	37	11	60161321	60161321	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60161321G>A	uc001npe.2	+	7	855	c.710G>A	c.(709-711)CGG>CAG	p.R237Q	MS4A7_uc001npf.2_Missense_Mutation_p.R237Q|MS4A7_uc001npg.2_Missense_Mutation_p.R192Q|MS4A7_uc001nph.2_Missense_Mutation_p.R192Q|MS4A14_uc001npi.2_Intron	NM_206939	NP_996822	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member	237	Cytoplasmic (Potential).					integral to membrane	receptor activity			ovary(1)|central_nervous_system(1)	2						AGTTCTTCACGGTCTTGGATA	0.373																0.248062	93.137526	100.585059	32	97	KEEP	---	---	---	---	19	17	58	56	-1	capture	Missense_Mutation	SNP	60161321	60161321	MS4A7	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9776	20
VWCE	220001	broad.mit.edu	37	11	61032003	61032003	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61032003G>A	uc001nra.2	-	19	2465	c.2186C>T	c.(2185-2187)GCC>GTC	p.A729V	VWCE_uc001nrb.2_RNA	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	729	VWFC 6.					extracellular region	calcium ion binding			ovary(1)	1						GGCAGGGTCGGCACAGGCCCG	0.592																0.096774	1.401821	6.454959	3	28	KEEP	---	---	---	---	3	0	17	14	-1	capture	Missense_Mutation	SNP	61032003	61032003	VWCE	11	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17127	20
HTR3A	3359	broad.mit.edu	37	11	113857684	113857684	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113857684G>A	uc010rxb.1	+	7	1401	c.1168G>A	c.(1168-1170)GCC>ACC	p.A390T	HTR3A_uc010rxa.1_Missense_Mutation_p.A358T|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Missense_Mutation_p.A337T	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	352	Cytoplasmic (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	GGAGAGAATCGCCTGGCTACT	0.587																0.287879	49.298284	51.961663	19	47	KEEP	---	---	---	---	12	7	27	23	-1	capture	Missense_Mutation	SNP	113857684	113857684	HTR3A	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7369	20
C12orf51	283450	broad.mit.edu	37	12	112721040	112721040	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112721040C>T	uc009zwc.2	-	2	238	c.220G>A	c.(220-222)GAA>AAA	p.E74K		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						TTGGCAGATTCGCCCTCTTTT	0.433																0.204082	23.322706	27.304605	10	39	KEEP	---	---	---	---	5	6	21	20	-1	capture	Missense_Mutation	SNP	112721040	112721040	C12orf51	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1682	20
RB1	5925	broad.mit.edu	37	13	48951144	48951144	+	Nonsense_Mutation	SNP	C	T	T	rs4151534		TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48951144C>T	uc001vcb.2	+	13	1472	c.1306C>T	c.(1306-1308)CAG>TAG	p.Q436*	RB1_uc010act.1_Nonsense_Mutation_p.Q137*	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	436	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AGCTGTGGGACAGGGTTGTGT	0.353			6	p.Q436*(COLO668-Tumor)	568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.434109	165.374118	165.863695	56	73	KEEP	---	---	---	---	27	32	38	43	-1	capture	Nonsense_Mutation	SNP	48951144	48951144	RB1	13	C	T	T	T	1	0	0	0	0	0	1	0	0	221	17	5	2	12993	20
C14orf115	55237	broad.mit.edu	37	14	74825422	74825422	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74825422A>G	uc001xpw.3	+	2	2127	c.1936A>G	c.(1936-1938)ATC>GTC	p.I646V		NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN	hypothetical protein LOC55237	646					transposition, DNA-mediated		DNA binding|transposase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00147)		GATGGACATGATCGCTACCAC	0.617																0.046154	-7.214792	7.057182	3	62	KEEP	---	---	---	---	2	1	31	34	-1	capture	Missense_Mutation	SNP	74825422	74825422	C14orf115	14	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	1726	20
ATP10A	57194	broad.mit.edu	37	15	25925003	25925003	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:25925003G>A	uc010ayu.2	-	21	4091	c.3985C>T	c.(3985-3987)CGC>TGC	p.R1329C		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1329	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TTCGGGAGGCGTCCCTGAGCA	0.607					877											0.206452	73.713839	86.094938	32	123	KEEP	---	---	---	---	17	16	80	48	-1	capture	Missense_Mutation	SNP	25925003	25925003	ATP10A	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1107	20
RASGRP1	10125	broad.mit.edu	37	15	38818585	38818585	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:38818585G>A	uc001zke.3	-	3	419	c.241C>T	c.(241-243)CGA>TGA	p.R81*	RASGRP1_uc001zkd.3_Nonsense_Mutation_p.R81*	NM_005739	NP_005730	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 isoform a	81	Ras exchanger motif region; required for transforming activity (By similarity).|N-terminal Ras-GEF.				cell differentiation|platelet activation|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|lipid binding|protein binding			large_intestine(1)|ovary(1)	2		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		TGGTTACTTCGACACAGGTTT	0.458																0.185714	27.832776	34.314567	13	57	KEEP	---	---	---	---	5	8	28	34	-1	capture	Nonsense_Mutation	SNP	38818585	38818585	RASGRP1	15	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	12969	20
FAM86A	196483	broad.mit.edu	37	16	5143514	5143514	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:5143514G>A	uc002cyo.2	-	3	260	c.211C>T	c.(211-213)CGG>TGG	p.R71W	FAM86A_uc002cyp.2_Missense_Mutation_p.R71W	NM_201400	NP_958802	Q96G04	FA86A_HUMAN	hypothetical protein LOC196483 isoform 1	71											0						AGAAAGCACCGGGCATATTTG	0.522																0.053571	-4.722253	7.052799	3	53	KEEP	---	---	---	---	0	4	37	28	-1	capture	Missense_Mutation	SNP	5143514	5143514	FAM86A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	5589	20
DNAH3	55567	broad.mit.edu	37	16	20976074	20976074	+	Silent	SNP	C	T	T	rs149630157	byFrequency	TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20976074C>T	uc010vbe.1	-	53	9132	c.9132G>A	c.(9130-9132)ACG>ACA	p.T3044T	DNAH3_uc010vbd.1_Silent_p.T479T	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3044					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		GATCCCCTAACGTGTGGCTGA	0.498																0.253012	50.433452	55.034855	21	62	KEEP	---	---	---	---	11	10	35	31	-1	capture	Silent	SNP	20976074	20976074	DNAH3	16	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	4560	20
KIFC3	3801	broad.mit.edu	37	16	57794781	57794781	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57794781T>C	uc002emp.2	-	16	2286	c.2089A>G	c.(2089-2091)ATC>GTC	p.I697V	KIFC3_uc010vhw.1_Missense_Mutation_p.I595V|KIFC3_uc002emn.2_RNA|KIFC3_uc002emm.2_Missense_Mutation_p.I558V|KIFC3_uc010vhx.1_Missense_Mutation_p.I555V|KIFC3_uc010cdf.2_Missense_Mutation_p.I558V|KIFC3_uc002emo.3_Missense_Mutation_p.I558V|KIFC3_uc010vhy.1_Missense_Mutation_p.I639V|KIFC3_uc002emq.2_Missense_Mutation_p.I697V|KIFC3_uc010vhz.1_Missense_Mutation_p.I719V	NM_005550	NP_005541	Q9BVG8	KIFC3_HUMAN	kinesin family member C3 isoform 1	697	Kinesin-motor.				epithelial cell-cell adhesion|microtubule-based movement|visual perception|zonula adherens maintenance	centrosome|cytoplasmic vesicle membrane|kinesin complex|microtubule|zonula adherens	ATP binding|microtubule motor activity			central_nervous_system(2)|ovary(1)	3		all_neural(199;0.224)				GACTTGTTGATGTGCTGCGCC	0.682																0.272727	30.180587	32.229258	12	32	KEEP	---	---	---	---	8	4	20	20	-1	capture	Missense_Mutation	SNP	57794781	57794781	KIFC3	16	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	8236	20
CHST6	4166	broad.mit.edu	37	16	75513386	75513386	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75513386C>T	uc002fef.2	-	3	521	c.341G>A	c.(340-342)CGC>CAC	p.R114H	CHST6_uc002feg.1_RNA|CHST6_uc002feh.1_Missense_Mutation_p.R114H	NM_021615	NP_067628	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	114	Lumenal (Potential).				keratan sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						CAGGTTGCGGCGCCAAGGCAG	0.672																0.337079	85.525101	87.613375	30	59	KEEP	---	---	---	---	13	21	31	30	-1	capture	Missense_Mutation	SNP	75513386	75513386	CHST6	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3373	20
ADAMTS18	170692	broad.mit.edu	37	16	77355016	77355016	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:77355016C>G	uc002ffc.3	-	15	2666	c.2247G>C	c.(2245-2247)AAG>AAC	p.K749N	ADAMTS18_uc010chc.1_Missense_Mutation_p.K337N|ADAMTS18_uc002ffe.1_Missense_Mutation_p.K445N	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	749	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						CTTTATAAAACTTGCAAGTTG	0.383					1451											0.230392	139.870853	153.424542	47	157	KEEP	---	---	---	---	24	25	75	100	-1	capture	Missense_Mutation	SNP	77355016	77355016	ADAMTS18	16	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	263	20
KRT16	3868	broad.mit.edu	37	17	39767345	39767345	+	Silent	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39767345G>A	uc002hxg.3	-	4	1048	c.909C>T	c.(907-909)GAC>GAT	p.D303D	JUP_uc010wfs.1_Intron	NM_005557	NP_005548	P08779	K1C16_HUMAN	keratin 16	303	Rod.|Coil 2.				cell proliferation|epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton			skin(1)	1		Breast(137;0.000307)				AGGTCTCAGCGTCTCTGCGGT	0.607																0.215768	119.695934	137.644573	52	189	KEEP	---	---	---	---	31	30	103	113	-1	capture	Silent	SNP	39767345	39767345	KRT16	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8373	20
CILP2	148113	broad.mit.edu	37	19	19656153	19656153	+	Silent	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19656153G>A	uc002nmv.3	+	8	2884	c.2799G>A	c.(2797-2799)CCG>CCA	p.P933P	CILP2_uc002nmw.3_Silent_p.P939P	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	933						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						GGCCCAACCCGCAGGAGTTCC	0.662																0.206897	12.857561	15.149476	6	23	KEEP	---	---	---	---	2	4	13	10	-1	capture	Silent	SNP	19656153	19656153	CILP2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3395	20
LMTK3	114783	broad.mit.edu	37	19	49013377	49013377	+	Silent	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49013377C>T	uc002pjk.2	-	4	351	c.351G>A	c.(349-351)GCG>GCA	p.A117A		NM_001080434	NP_001073903			lemur tyrosine kinase 3											lung(5)|central_nervous_system(1)	6		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		AGGTCTCCTCCGCAGGGGGAG	0.622					193											0.289474	32.310206	33.819256	11	27	KEEP	---	---	---	---	7	5	10	18	-1	capture	Silent	SNP	49013377	49013377	LMTK3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8780	20
ZNF71	58491	broad.mit.edu	37	19	57133286	57133286	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57133286G>A	uc002qnm.3	+	3	869	c.631G>A	c.(631-633)GAG>AAG	p.E211K		NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	211						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		GCACACGGGCGAGAAGCCGTA	0.657																0.196721	26.179001	31.395894	12	49	KEEP	---	---	---	---	7	7	29	28	-1	capture	Missense_Mutation	SNP	57133286	57133286	ZNF71	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17990	20
NBAS	51594	broad.mit.edu	37	2	15493765	15493765	+	Missense_Mutation	SNP	C	T	T	rs140188229		TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:15493765C>T	uc002rcc.1	-	34	4027	c.4001G>A	c.(4000-4002)CGT>CAT	p.R1334H	NBAS_uc010exl.1_Missense_Mutation_p.R406H|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	1334										ovary(2)|liver(1)|skin(1)	4						GAGCTCTTGACGAGTGGCCAA	0.453																0.253012	167.025482	180.803524	63	186	KEEP	---	---	---	---	36	34	93	103	-1	capture	Missense_Mutation	SNP	15493765	15493765	NBAS	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10093	20
CYP26B1	56603	broad.mit.edu	37	2	72360330	72360330	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:72360330C>T	uc002sih.1	-	5	968	c.968G>A	c.(967-969)CGG>CAG	p.R323Q	CYP26B1_uc010yra.1_Missense_Mutation_p.R306Q|CYP26B1_uc010yrb.1_Missense_Mutation_p.R248Q	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily b,	323					cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			skin(2)	2						CAGCTCATCCCGCAGCTTCTC	0.657																0.357143	15.772501	16.023557	5	9	KEEP	---	---	---	---	1	5	5	6	-1	capture	Missense_Mutation	SNP	72360330	72360330	CYP26B1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4116	20
ST6GAL2	84620	broad.mit.edu	37	2	107460088	107460088	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107460088C>T	uc002tdq.2	-	2	465	c.346G>A	c.(346-348)GTG>ATG	p.V116M	ST6GAL2_uc002tdr.2_Missense_Mutation_p.V116M|ST6GAL2_uc002tds.3_Missense_Mutation_p.V116M	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	116	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						TTTCTCCCCACCTGGGATGAA	0.547																0.178404	77.316203	98.059021	38	175	KEEP	---	---	---	---	27	14	89	100	-1	capture	Missense_Mutation	SNP	107460088	107460088	ST6GAL2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	15112	20
ACTR3	10096	broad.mit.edu	37	2	114691915	114691915	+	Silent	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:114691915C>T	uc002tkx.1	+	6	812	c.492C>T	c.(490-492)ACC>ACT	p.T164T	ACTR3_uc010yyc.1_Silent_p.T102T|ACTR3_uc010yyd.1_Silent_p.T113T	NM_005721	NP_005712	P61158	ARP3_HUMAN	ARP3 actin-related protein 3 homolog	164					cellular component movement|cilium morphogenesis	Arp2/3 protein complex	actin binding|ATP binding			skin(1)	1						GGACGTTGACCGGTACGGTAA	0.383																0.061905	-11.999552	30.038707	13	197	KEEP	---	---	---	---	9	6	137	97	-1	capture	Silent	SNP	114691915	114691915	ACTR3	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	212	20
PRPF40A	55660	broad.mit.edu	37	2	153515685	153515685	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:153515685C>T	uc002tyh.3	-	23	2450	c.2428G>A	c.(2428-2430)GAT>AAT	p.D810N	PRPF40A_uc002tyg.3_Missense_Mutation_p.D266N|PRPF40A_uc010zcd.1_Missense_Mutation_p.D761N	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3	837					mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						TGGCTATCATCATCATCTGAA	0.343																0.155172	15.633473	22.22531	9	49	KEEP	---	---	---	---	7	3	28	28	-1	capture	Missense_Mutation	SNP	153515685	153515685	PRPF40A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	12467	20
STK11IP	114790	broad.mit.edu	37	2	220476376	220476376	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220476376G>A	uc002vml.2	+	18	2231	c.2188G>A	c.(2188-2190)GCT>ACT	p.A730T		NM_052902	NP_443134	Q8N1F8	S11IP_HUMAN	LKB1 interacting protein	730					protein localization	cytoplasm	protein kinase binding			ovary(1)	1		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGTTCTCCTCGCTGTGTCTCG	0.627																0.032967	-31.994373	11.32236	6	176	KEEP	---	---	---	---	5	3	117	93	-1	capture	Missense_Mutation	SNP	220476376	220476376	STK11IP	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15178	20
SCG2	7857	broad.mit.edu	37	2	224462380	224462380	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:224462380C>T	uc002vnm.2	-	2	1754	c.1621G>A	c.(1621-1623)GAA>AAA	p.E541K		NM_003469	NP_003460	P13521	SCG2_HUMAN	secretogranin II precursor	541					angiogenesis|endothelial cell migration|eosinophil chemotaxis|induction of positive chemotaxis|inflammatory response|MAPKKK cascade|negative regulation of apoptosis|negative regulation of endothelial cell proliferation|positive regulation of endothelial cell proliferation|protein secretion	extracellular space|stored secretory granule	chemoattractant activity|cytokine activity			ovary(1)	1		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		TCAATTTGTTCCTCTTCCTGC	0.507																0.141667	27.215869	42.061444	17	103	KEEP	---	---	---	---	11	6	55	58	-1	capture	Missense_Mutation	SNP	224462380	224462380	SCG2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	13783	20
MLPH	79083	broad.mit.edu	37	2	238449110	238449110	+	Silent	SNP	C	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238449110C>A	uc002vwt.2	+	10	1451	c.1224C>A	c.(1222-1224)GCC>GCA	p.A408A	MLPH_uc002vws.2_Silent_p.A265A|MLPH_uc010fyt.1_Silent_p.A380A|MLPH_uc002vwu.2_Silent_p.A380A|MLPH_uc002vwv.2_Silent_p.A340A|MLPH_uc002vww.2_Silent_p.A356A|MLPH_uc002vwx.2_Silent_p.A264A|MLPH_uc010fyu.2_Silent_p.A160A	NM_024101	NP_077006	Q9BV36	MELPH_HUMAN	melanophilin isoform 1	408	Potential.						metal ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		AGGAGGAAGCCAAGGACGAAA	0.627																0.055556	-4.717432	6.502595	3	51	KEEP	---	---	---	---	3	0	30	22	-1	capture	Silent	SNP	238449110	238449110	MLPH	2	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	9545	20
PTPRT	11122	broad.mit.edu	37	20	41101086	41101086	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:41101086C>T	uc002xkg.2	-	8	1454	c.1270G>A	c.(1270-1272)GTG>ATG	p.V424M	PTPRT_uc010ggj.2_Missense_Mutation_p.V424M	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	424	Extracellular (Potential).|Fibronectin type-III 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGGTACTGCACGGTGAGGTTG	0.607					646											0.25974	50.585172	54.597547	20	57	KEEP	---	---	---	---	10	11	38	29	-1	capture	Missense_Mutation	SNP	41101086	41101086	PTPRT	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12707	20
ADM2	79924	broad.mit.edu	37	22	50921222	50921222	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50921222G>A	uc003blj.2	+	2	602	c.337G>A	c.(337-339)GGC>AGC	p.G113S	ADM2_uc011ary.1_Missense_Mutation_p.G113S	NM_024866	NP_079142	Q7Z4H4	ADM2_HUMAN	adrenomedullin 2 precursor	113					positive regulation of angiogenesis	extracellular region	hormone activity				0		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CTGTGTGCTGGGCACCTGCCA	0.701																0.333333	11.196386	11.4914	4	8	KEEP	---	---	---	---	1	3	7	2	-1	capture	Missense_Mutation	SNP	50921222	50921222	ADM2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	322	20
PLA1A	51365	broad.mit.edu	37	3	119316815	119316815	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:119316815C>G	uc003ecu.2	+	1	94	c.55C>G	c.(55-57)CTC>GTC	p.L19V	PLA1A_uc003ecv.2_Missense_Mutation_p.L19V|PLA1A_uc003ecw.2_RNA|PLA1A_uc011bjc.1_5'UTR	NM_015900	NP_056984	Q53H76	PLA1A_HUMAN	phospholipase A1 member A precursor	19					lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						CATTTTGTGGCTCAGCGTTGG	0.507																0.294118	16.068019	16.713004	5	12	KEEP	---	---	---	---	5	0	8	5	-1	capture	Missense_Mutation	SNP	119316815	119316815	PLA1A	3	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	11891	20
MRPL3	11222	broad.mit.edu	37	3	131190114	131190114	+	Silent	SNP	T	C	C			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:131190114T>C	uc003eoh.2	-	7	803	c.639A>G	c.(637-639)AAA>AAG	p.K213K	MRPL3_uc011blo.1_Silent_p.K108K|MRPL3_uc011blp.1_Silent_p.K240K	NM_007208	NP_009139	P09001	RM03_HUMAN	mitochondrial ribosomal protein L3	213					translation	mitochondrial large ribosomal subunit	RNA binding|structural constituent of ribosome				0						CTTGAAAACCTTTACCAATAC	0.408																0.289474	108.528983	113.057038	33	81	KEEP	---	---	---	---	16	19	45	40	-1	capture	Silent	SNP	131190114	131190114	MRPL3	3	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	9703	20
RASSF6	166824	broad.mit.edu	37	4	74442417	74442417	+	Silent	SNP	C	T	T	rs147932445	byFrequency	TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74442417C>T	uc003hhd.1	-	9	972	c.849G>A	c.(847-849)CCG>CCA	p.P283P	RASSF6_uc003hhc.1_Silent_p.P251P|RASSF6_uc010iik.1_Silent_p.P217P|RASSF6_uc010iil.1_Silent_p.P239P	NM_201431	NP_958834	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family 6	283	Ras-associating.				apoptosis|signal transduction		protein binding			pancreas(2)	2	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			TCTGCAGTAGCGGAATGTCTG	0.403																0.243626	220.67521	241.820659	86	267	KEEP	---	---	---	---	52	48	164	151	-1	capture	Silent	SNP	74442417	74442417	RASSF6	4	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	12985	20
DSPP	1834	broad.mit.edu	37	4	88534401	88534401	+	Missense_Mutation	SNP	G	A	A	rs61738515	by1000genomes	TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88534401G>A	uc003hqu.2	+	4	1183	c.1063G>A	c.(1063-1065)GTA>ATA	p.V355I		NM_014208	NP_055023	Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein preproprotein	355					biomineral tissue development|ossification|skeletal system development	proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent			central_nervous_system(1)	1		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		AAGCAAACGCGTAGAAAATAG	0.418																0.191176	28.540188	34.596874	13	55	KEEP	---	---	---	---	8	5	24	35	-1	capture	Missense_Mutation	SNP	88534401	88534401	DSPP	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4737	20
GYPE	2996	broad.mit.edu	37	4	144826671	144826671	+	Translation_Start_Site	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:144826671C>T	uc003ijj.2	-	1	46	c.-10G>A	c.(-12--8)TCGTG>TCATG		GYPE_uc010ion.2_RNA|GYPE_uc003ijk.3_Translation_Start_Site	NM_198682	NP_941391	P15421	GLPE_HUMAN	glycophorin E precursor							integral to plasma membrane					0	all_hematologic(180;0.158)					CCTGAGATCACGAGCTGGCTC	0.398																0.180556	28.931915	35.838409	13	59	KEEP	---	---	---	---	12	9	31	33	-1	capture	Translation_Start_Site	SNP	144826671	144826671	GYPE	4	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	6840	20
TRIM2	23321	broad.mit.edu	37	4	154215581	154215581	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:154215581G>A	uc003ing.2	+	5	850	c.649G>A	c.(649-651)GTG>ATG	p.V217M	TRIM2_uc003inh.2_Missense_Mutation_p.V244M	NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2	217						cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		GACTTTAAATGTGCGCAAGAG	0.418																0.176471	35.781944	45.848661	18	84	KEEP	---	---	---	---	8	11	39	53	-1	capture	Missense_Mutation	SNP	154215581	154215581	TRIM2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	16377	20
IL7R	3575	broad.mit.edu	37	5	35876389	35876389	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:35876389G>A	uc003jjs.2	+	8	1270	c.1181G>A	c.(1180-1182)GGC>GAC	p.G394D	IL7R_uc011cop.1_RNA	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor	394	Cytoplasmic (Potential).				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			AGGGAGAGTGGCAAGAATGGG	0.537																0.208955	32.116235	37.368122	14	53	KEEP	---	---	---	---	5	10	22	32	-1	capture	Missense_Mutation	SNP	35876389	35876389	IL7R	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7628	20
UTP15	84135	broad.mit.edu	37	5	72864347	72864347	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:72864347G>A	uc003kcw.1	+	4	509	c.286G>A	c.(286-288)GTG>ATG	p.V96M	UTP15_uc011cso.1_Missense_Mutation_p.V77M|UTP15_uc011csp.1_Translation_Start_Site|UTP15_uc010ize.1_Missense_Mutation_p.V96M|ANKRA2_uc003kcu.1_5'Flank|ANKRA2_uc003kcv.2_5'Flank	NM_032175	NP_115551	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein,	96	WD 2.				rRNA processing	cytoplasm|nucleolus					0		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		TAGATTGCTTGTGGCTGGCAG	0.428																0.244604	83.478736	91.740732	34	105	KEEP	---	---	---	---	23	14	51	67	-1	capture	Missense_Mutation	SNP	72864347	72864347	UTP15	5	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	16979	20
GRIA1	2890	broad.mit.edu	37	5	153190767	153190767	+	Silent	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:153190767G>A	uc003lva.3	+	16	3068	c.2703G>A	c.(2701-2703)TTG>TTA	p.L901L	GRIA1_uc003luy.3_Silent_p.L901L|GRIA1_uc003luz.3_Silent_p.L806L|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Silent_p.L821L|GRIA1_uc011dcx.1_Silent_p.L832L|GRIA1_uc011dcy.1_Silent_p.L911L|GRIA1_uc011dcz.1_Silent_p.L911L	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	901	Cytoplasmic (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GGATGCCCTTGGGAGCCACGG	0.592																0.314286	59.116735	61.269571	22	48	KEEP	---	---	---	---	11	13	22	30	-1	capture	Silent	SNP	153190767	153190767	GRIA1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	607	47	2	2	6700	20
IRF4	3662	broad.mit.edu	37	6	398928	398928	+	Silent	SNP	G	A	A	rs144395675		TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:398928G>A	uc003msz.3	+	6	851	c.738G>A	c.(736-738)GCG>GCA	p.A246A	IRF4_uc010jne.1_Silent_p.A246A|IRF4_uc003mta.3_RNA|IRF4_uc003mtb.3_Silent_p.A245A|IRF4_uc003mtc.1_Silent_p.A76A	NM_002460	NP_002451	Q15306	IRF4_HUMAN	interferon regulatory factor 4	246					interferon-gamma-mediated signaling pathway|positive regulation of interleukin-10 biosynthetic process|positive regulation of interleukin-13 biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of transcription, DNA-dependent|regulation of T-helper cell differentiation|T cell activation|type I interferon-mediated signaling pathway	cytoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(1)	1		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		AAGCCTTGGCGTTCTCAGGTG	0.592					223	T	IGH@	MM 								0.212121	15.910293	18.435893	7	26	KEEP	---	---	---	---	4	3	13	16	-1	capture	Silent	SNP	398928	398928	IRF4	6	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	7755	20
ECT2L	345930	broad.mit.edu	37	6	139208055	139208055	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:139208055G>A	uc003qif.1	+	17	2424	c.2321G>A	c.(2320-2322)TGC>TAC	p.C774Y	ECT2L_uc011edq.1_Missense_Mutation_p.C628Y	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2	774					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						ATCTGGGGATGCCCTGTATGT	0.373																0.3	32.182611	33.613162	12	28	KEEP	---	---	---	---	2	12	18	15	-1	capture	Missense_Mutation	SNP	139208055	139208055	ECT2L	6	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4857	20
MAD1L1	8379	broad.mit.edu	37	7	1855850	1855850	+	Silent	SNP	C	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:1855850C>T	uc003slh.1	-	19	2279	c.2013G>A	c.(2011-2013)TCG>TCA	p.S671S	MAD1L1_uc003sle.1_Silent_p.S400S|MAD1L1_uc003slf.1_Silent_p.S671S|MAD1L1_uc003slg.1_Silent_p.S671S|MAD1L1_uc010ksh.1_Silent_p.S671S|MAD1L1_uc003sli.1_Silent_p.S579S|MAD1L1_uc003sld.1_Silent_p.S127S	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	671					cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		TCTTGGAACCCGAGGGGCTGG	0.642																0.246269	83.185174	91.067578	33	101	KEEP	---	---	---	---	18	23	63	62	-1	capture	Silent	SNP	1855850	1855850	MAD1L1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9062	20
ELN	2006	broad.mit.edu	37	7	73457353	73457353	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73457353G>A	uc003tzw.2	+	7	456	c.365G>A	c.(364-366)GGA>GAA	p.G122E	RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_Intron|ELN_uc011kfe.1_Missense_Mutation_p.G91E|ELN_uc003tzn.2_Missense_Mutation_p.G122E|ELN_uc003tzz.2_Missense_Mutation_p.G110E|ELN_uc003tzo.2_Missense_Mutation_p.G122E|ELN_uc003tzp.2_Missense_Mutation_p.G112E|ELN_uc003tzq.2_Intron|ELN_uc003tzr.2_RNA|ELN_uc003tzs.2_Missense_Mutation_p.G122E|ELN_uc003tzt.2_Missense_Mutation_p.G122E|ELN_uc003tzu.2_Missense_Mutation_p.G122E|ELN_uc003tzv.2_Missense_Mutation_p.G112E|ELN_uc003tzx.2_Missense_Mutation_p.G112E|ELN_uc011kff.1_Missense_Mutation_p.G122E|ELN_uc003tzy.2_Missense_Mutation_p.G112E	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor	122					blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	GGTGGCTTAGGAGTGTCTGCA	0.627					434	T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						0.147059	31.681726	48.016314	20	116	KEEP	---	---	---	---	13	11	73	67	-1	capture	Missense_Mutation	SNP	73457353	73457353	ELN	7	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	5026	20
GTF2IRD1	9569	broad.mit.edu	37	7	73922465	73922465	+	Missense_Mutation	SNP	C	T	T	rs139144176		TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73922465C>T	uc003uaq.2	+	2	448	c.55C>T	c.(55-57)CGC>TGC	p.R19C	GTF2IRD1_uc010lbq.2_Missense_Mutation_p.R19C|GTF2IRD1_uc003uap.2_Missense_Mutation_p.R19C|GTF2IRD1_uc003uar.1_Missense_Mutation_p.R19C	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1	19						nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						CGGACCCGACCGCTGGAACTC	0.642																0.164706	29.898541	38.967179	14	71	KEEP	---	---	---	---	6	8	30	47	-1	capture	Missense_Mutation	SNP	73922465	73922465	GTF2IRD1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6797	20
NPTX2	4885	broad.mit.edu	37	7	98257925	98257925	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98257925G>A	uc003upl.2	+	5	1457	c.1280G>A	c.(1279-1281)CGT>CAT	p.R427H		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor	427	Pentaxin.			R -> A (in Ref. 1; AAA68980/AAA92296).	synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			TGTGAGGAGCGTCTCCTTGAC	0.582																0.285714	15.045229	15.908275	6	15	KEEP	---	---	---	---	2	4	7	8	-1	capture	Missense_Mutation	SNP	98257925	98257925	NPTX2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10510	20
REPIN1	29803	broad.mit.edu	37	7	150068350	150068350	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150068350G>A	uc010lpq.1	+	4	509	c.20G>A	c.(19-21)AGG>AAG	p.R7K	REPIN1_uc003whd.2_5'UTR|REPIN1_uc010lpr.1_Missense_Mutation_p.R64K|REPIN1_uc003whc.2_Missense_Mutation_p.R7K|REPIN1_uc003whe.2_Missense_Mutation_p.R7K	NM_013400	NP_037532	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 1	7					DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CGTCGTTGCAGGGGCCCCCTG	0.647																0.217391	12.261845	13.956445	5	18	KEEP	---	---	---	---	2	4	15	7	-1	capture	Missense_Mutation	SNP	150068350	150068350	REPIN1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	13122	20
C9orf96	169436	broad.mit.edu	37	9	136260823	136260823	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:136260823G>T	uc004cdk.2	+	9	860	c.799G>T	c.(799-801)GTG>TTG	p.V267L	C9orf96_uc004cdl.2_RNA	NM_153710	NP_714921	Q8NE28	SGK71_HUMAN	hypothetical protein LOC169436	267	Protein kinase.						ATP binding|protein kinase activity			stomach(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GATCCCGGATGTGGAAACCTT	0.552					527											0.321168	129.852431	133.743748	44	93	KEEP	---	---	---	---	25	20	50	48	0.555555555556	capture	Missense_Mutation	SNP	136260823	136260823	C9orf96	9	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	2484	20
AKAP4	8852	broad.mit.edu	37	X	49957245	49957245	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49957245G>A	uc004dow.1	-	5	2243	c.2119C>T	c.(2119-2121)CTC>TTC	p.L707F	AKAP4_uc004dov.1_Missense_Mutation_p.L324F|AKAP4_uc010njp.1_Missense_Mutation_p.L529F|AKAP4_uc004dou.1_Missense_Mutation_p.L698F	NM_003886	NP_003877	Q5JQC9	AKAP4_HUMAN	A-kinase anchor protein 4 isoform 1	707					cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding			kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8	Ovarian(276;0.236)					ATAAGGCAGAGCTTCATCACA	0.478					119											0.44	71.146044	71.302294	22	28	KEEP	---	---	---	---	10	14	17	14	-1	capture	Missense_Mutation	SNP	49957245	49957245	AKAP4	23	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	453	20
AZGP1	563	broad.mit.edu	37	7	99564820	99564820	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99564820delT	uc003ush.2	-	4	747	c.703delA	c.(703-705)ATTfs	p.I235fs		NM_001185	NP_001176	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc	235	Ig-like C1-type.				antigen processing and presentation|cell adhesion|immune response|lipid catabolic process|negative regulation of cell proliferation	extracellular region|MHC class I protein complex	fatty acid binding|protein transmembrane transporter activity|ribonuclease activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					TGCACATCAATTTTCCCTGGG	0.567																0.21			15	56		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	99564820	99564820	AZGP1	7	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	1229	20
BCOR	54880	broad.mit.edu	37	X	39932184	39932185	+	Frame_Shift_Ins	INS	-	CAGAC	CAGAC			TCGA-06-0140-01	TCGA-06-0140-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:39932184_39932185insCAGAC	uc004den.3	-	4	2706_2707	c.2414_2415insGTCTG	c.(2413-2415)TACfs	p.Y805fs	BCOR_uc004dep.3_Frame_Shift_Ins_p.Y805fs|BCOR_uc004deo.3_Frame_Shift_Ins_p.Y805fs|BCOR_uc004dem.3_Frame_Shift_Ins_p.Y805fs|BCOR_uc004deq.3_Frame_Shift_Ins_p.Y805fs	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	805					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						GAAGGTCTACGTAGACAAGCTT	0.515																0.29			36	88		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	39932184	39932185	BCOR	23	-	CAGAC	CAGAC	CAGAC	1	0	1	1	0	0	0	0	0	516	40	5	5	1375	20
